 |
Previous Article | Next Article 
Volume 16, Number 10,
Issue of May 15, 1996
pp. 3265-3273
Copyright ©1996 Society for Neuroscience
Transgenic Expression of Embryonic MAP2 in Adult Mouse Brain:
Implications for Neuronal Polarization
Kathryn M. Marsden,
Thierry Doll,
Jacqueline Ferralli,
Florence Botteri, and
Andrew Matus
Friedrich Miescher Institute, Basel, 4002 Switzerland
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
The major neuronal microtubule-associated protein MAP2 is
selectively localized in dendrites, where its expression is under
strong developmental regulation. To learn more about its potential
effects on neuronal morphogenesis and its sorting within the neuronal
cytoplasm, we have raised transgenic mice that express high levels of
the embryonic form, MAP2c, in the adult brain. One transgenic line
expressed higher levels of MAP2c than endogenous adult MAP2. This had
no detectable effect on either the arrangement or morphology of
neurons, suggesting that although MAP2c is necessary for neuronal
morphogenesis it is not involved in its regulation. Like endogenous
adult MAP2, transgenic MAP2c was present in dendrites but not axons,
indicating that the signal responsible for its cytoplasmic sorting is
contained within the 1.5 kb of its coding sequence. In situ
hybridization with specific probes showed that transgenic MAP2c mRNA
was limited to cell bodies. Thus, the dendritic localization of MAP2c
protein cannot be the result of previous transport of its mRNA but must
depend on a signal associated with the protein itself. Furthermore,
because the amino acid sequence of MAP2c is present in all forms of
MAP2, this signal is also contained within adult
high-Mr MAP2 protein. This raises the
possibility that, rather than the conventional scheme of mRNA sorting
preceding protein localization, the transport of adult MAP2 mRNA into
dendrites could depend on it being part of a translation complex in
which the targeting signal is on the nascent protein.
Key words:
neuronal differentiation;
dendrites;
cytoskeleton;
polarization;
transgenic;
microtubules;
morphogenesis;
development;
brain;
nervous system;
mouse
INTRODUCTION
The polarized form of neurons depends on the
targeting of appropriate structural molecules into either axons or
dendrites (Craig and Banker, 1994 ). Among these the neuronal
microtubule-associated protein MAP2 provides a striking example, being
present in dendrites but not axons (Matus et al., 1981 ; Bernhardt and
Matus, 1984 ; Caceres et al., 1984 ; De Camilli et al., 1984 ; Matus et
al., 1986 ). Because MAP2 has a profound influence on the organization
of cellular microtubules (Lewis et al., 1989 ; Weisshaar et al., 1992 )
and their ability to support process outgrowth (Chen et al., 1992 ;
Edson et al., 1993 ), this dendritic localization has correspondingly
important implications for neuronal morphogenesis. The molecular
mechanism responsible for sorting MAP2 within the neuronal cytoplasm is
unknown. However, in situ hybridization studies have shown
that MAP2 mRNA is also present in dendrites (Garner et al., 1988 ;
Tucker et al., 1989 ; Bruckenstein et al., 1990 ; Kleiman et al., 1990 )
so that its localization there could depend in principle on previous
targeting of the mRNA, from which the protein is then synthesized
locally. The existence of mRNA-based sorting in a variety of systems,
including Drosophila embryos (Berleth et al., 1988 ),
Xenopus oocytes (Melton, 1987 ; Yisraeli and Melton, 1988 ),
and -actin in myocytes and fibroblasts (Sundell and Singer, 1990 ;
Hill and Gunning, 1993 ), provides precedents for such a mechanism.
In addition to the adult high-Mr forms,
MAP2a and MAP2b, MAP2 also occurs as a smaller embryonic form, MAP2c,
which is normally expressed only during development (Riederer and
Matus, 1985 ; Garner and Matus, 1988 ). Immunohistochemical studies
have shown that in most areas of the developing brain all forms of
MAP2, including MAP2c, appear to be limited to dendrites (Greenough et
al., 1978 ; Bernhardt and Matus, 1984 ; Burgoyne and Cumming, 1984 ).
However, unlike the high-Mr forms, which
are always dendritic, MAP2c occurs in the axons of developing motor
neurons (Tucker et al., 1988 ; Albala et al., 1995 ) and retinal ganglion
cells (Tucker and Matus, 1988 ). In two previous transfection studies,
MAP2c was also found to enter axons. Meichsner et al. (1993) found that
epitope-tagged MAP2c entered all processes of hippocampal neurons
transfected in culture, and Kanai and Hirokawa (1995) reported similar
findings for cultured motor neurons. To investigate the underlying
sorting mechanism further, we have now raised transgenic mice that
express epitope-labeled MAP2c in the adult brain. These animals allow
the cytoplasmic distribution of MAP2c to be studied in both brain
sections and primary cell cultures. The results show that, like the
larger adult MAP2, MAP2c protein is restricted to dendrites in adult
neurons. However, unlike the adult forms, the MAP2c mRNA does not enter
dendrites but remains in cell bodies. These observations suggest the
existence of a protein-based mechanism capable of sorting MAP2 protein
isoforms and their respective mRNAs within the neuronal cytoplasm.
In addition to targeting, we raised these MAP2c-transgenic mice to
determine the consequences of prolonging the expression of this
embryonic cytoskeletal protein beyond the time when it normally
disappears from developing neurons. Rather, to our surprise, the
expression of MAP2c in the adult brain at levels greater than
endogenous adult MAP2 had no detectable effect on neuronal
morphology.
MATERIALS AND METHODS
Vector construction and raising of transgenic
animals. cDNA encoding rat MAP2c (Doll et al., 1990 ), together
with 33 bp encoding an N-terminal epitope tag from human c-myc (Munro
and Pelham, 1987 ; Burgin et al., 1994 ), was subcloned into vector
act-16, which contains chicken -actin promoter sequences (Fregien
and Davidson, 1986 ; Meichsner et al., 1993 ). A fragment containing
promoter, coding, and required 3 -untranslated vector sequence was
excised from the vector by digestion with restriction enzymes and
purified by agarose gel electrophoresis before microinjection into
oocytes as described previously (Botteri et al., 1987 ). Founder animals
and progeny carrying the transgene were identified by Southern blot
analysis of genomic DNA from tail clippings. Microtubules were isolated
from brain homogenates by taxol precipitation (Vallee, 1982 ), and
transgenic and endogenous forms of MAP2 were identified by Western blot
analysis as described previously (Towbin et al., 1979 ).
Immunohistochemistry. Mice were deeply anesthetized with a
mixture of 80 mg of ketamine (Ketasol, Grueub) and 24 mg of xylazin
(Rompun, Bayer) per kg of body weight and fixed by transcardiac
perfusion with 4% paraformaldehyde in 100 mM
phosphate buffer, pH 7.4. After dissection, brains were immersed
overnight in the same fixative and 40 µm sections were cut on a
Vibratome (Oxford Instruments). Immunoperoxidase staining was performed
as described previously (Bernhardt and Matus, 1984 ).
Cell culture and transfection.
Hippocampal neuronal cell cultures from both transgenic and wild
type mice were established at embryonic day 16 (E16) and grown over a
glial feeder layer (Goslin and Banker, 1991 ). Transfection with
act-16 containing the coding sequences of either myc-MAP2c or
bacterial chloramphenicol acetyl transferase (CAT) (Meichsner et al.,
1993 ) was performed at the time of plating of the cells using a
modified liposome-mediated (DOTAP; Boehringer Mannheim, Indianapolis,
IN) procedure (Kaech et al., in press). Briefly, cells from E16
hippocampus were trypsinized, resuspended in HBSS at 4 × 106 cells/ml, and treated with DOTAP (20 µl/ml). After 15 min at 37°C, they were resuspended with the
appropriate DNA at the required concentration (0.5-2.0 µg/ml) and
incubated in suspension for another 40 min before plating for 6 hr at
37°C. Coverslips with the transfected cells were then inverted over a
glial feeder layer as described previously (Goslin and Banker, 1991 )
and maintained for up to 15 d before fixation and staining. In each
experiment, cells were fixed at three or more time points, on days 6, 9, 11, or 15 after transfection, and assessed by immunostaining. Cells
were fixed for 10 min with 1% glutaraldehyde in PHEM buffer (60 mM PIPES, 25 mM HEPES, 10 mM EGTA, and 2 mM
MgCl2), pH 6.9, and immunofluorescence double
labeling was performed as described previously (Matus et al.,
1986 ).
In situ hybridization. Fresh brain tissue was rapidly frozen
in isopentane cooled in dry ice, sectioned at 12 µm on a cryostat,
and mounted on SuperFrost/Plus slides (Menzel-Glaser). Sections were
fixed for 40 min at room temperature with 4% formaldehyde in 50 mM phosphate buffer, pH 7.4, and 150 mM NaCl (PBS). After washing three times for 5 min with PBS, they were hybridized overnight at 43°C with antisense
oligonucleotides that had been end-labeled with
[35S]dATP for 5 min at 37°C using the
terminal transferase procedure. The sections were washed as follows:
twice with 1× SSC plus 10 mM dithiothreitol
(DTT) at 55°C, twice with 0.5× SSC plus 10 mM DTT at 55°C and, finally, once at room
temperature with 0.5× SSC plus 10 mM DTT. After
being dipped in distilled water, they were dehydrated in a graded
series of alcohols, air-dried, and exposed to -max film (Amersham,
Arlington Heights, IL) for 6 weeks. The antisense
oligodeoxynucleotides used were: high-Mr
MAP2, TACTGCCTCTGGCTCAGATGTAACTTTTCCCAAGGT; -tubulin,
TGCTTGCCAGCTCCTGTCTCACTGAAGAAG; and MAP2c junction,
ACCACTTGTTGCTTCTTCCAGTGCAGCTGT.
RESULTS
To distinguish transgenic MAP2c from endogenous adult MAP2, the
transgene construct used in this study was tagged with a 10-amino-acid
epitope from the human c-myc gene. From 5 founder mice (F0) containing
transgene DNA inserted into the genome, two stable lines were
established (Fig. 1A,B),
one of which expresses transgenic myc-MAP2c at levels higher than
endogenous adult high-Mr MAP2 (Fig.
1A, lane 3). Western blot analysis
of various tissues including skeletal muscle, heart, kidney, liver,
lung, and testes failed to detect myc-MAP2c expression anywhere other
than brain (data not shown). This presumably reflects the selective
activity of the chick -actin promoter sequence used to express the
protein. Neuron-specific expression from -actin promoters has also
been reported in previous transfection studies of hippocampal cell
cultures (Meichsner et al., 1993 ) and motor neurons (Kanai and
Hirokawa, 1995 ).
Fig. 1.
Expression of embryonic MAP2c in the brains
of adult transgenic mice. A, B, Western blot
analysis of MAP2 expression in transgenic and nontransgenic mice. Each
lane contains 40 µg of microtubule protein stained with monoclonal
antibodies against MAP2 (A) or the myc epitope
(B). Lane 1, Control nontransgenic mouse;
lane 2, a nontransgenic littermate to transgenic mice;
lanes 3, 4, two independent transgenic
mouse lines. Positions are indicated for endogenous adult high
Mr MAP2 (2b), embryonic MAP2
(2c), and tubulin (T).
[View Larger Version of this Image (62K GIF file)]
Immunohistochemical staining of brain sections from transgenic animals
showed expression of myc-MAP2c in most brain regions, including the
cerebral cortex, hippocampus, striatum, and cerebellum, but despite the
high levels of expression there was no detectable disturbance of tissue
structure or cell morphology. Cresyl violet-stained sections showed
apparently normal arrangements of cell bodies in all brain areas (Fig.
2). Cell morphologies, as revealed by staining with
various antibodies against cytoskeletal proteins (Fig.
3), were indistinguishable from those of nontransgenic
control mice (data not shown). Despite the high level of expression,
transgenic MAP2c was limited to cell bodies and dendrites within the
cytoplasm of adult neurons (Fig. 3A). Its distribution was
thus identical to that of adult high-Mr
MAP2 (Fig. 3B) and readily distinguished from the axonal
pattern of microtubule-associated protein tau (Fig. 3C). A
comparable pattern of distribution was also evident in neuron-enriched
cell cultures established from the hippocampi of transgenic animals
that were stained simultaneously with antibodies against the myc
epitope of transgenic MAP2c and with antibodies against tau (Fig.
4). The transgenic MAP2c was only present in cell bodies
and dendrites (Fig. 4A), which were readily
distinguishable from tau-labeled axons (Fig. 4B). The
presence of tau immunostaining along dendrites is caused by axons that
run along the surface of dendritic processes in dispersed hippocampal
neuron cultures (Goslin and Banker, 1991 ).
Fig. 2.
Cresyl violet-stained sections from the brain of a
transgenic mouse expressing high levels of myc MAP2c. No abnormalities
in either cell number or arrangement were detectable in either cerebral
cortex (A, B) or hippocampus (C).
Positions are indicated for endogenous adult high
Mr MAP2 (2b), embryonic MAP2
(2c), and tubulin (T). Scale bars, 50 µm.
[View Larger Version of this Image (159K GIF file)]
Fig. 3.
Immunohistochemical staining of sections from the
CA1 region of the hippocampus from the brain of a transgenic mouse
expressing high levels of MAP2c. A, Stained with monoclonal
antibodies against the myc epitope to visualize transgenically
expressed MAP2c. B, Neighboring section stained with
monoclonal antibody AP14 that selectively labels the adult high
Mr forms of MAP2. C, Neighboring
section stained with rabbit polyclonal antiserum against
microtubule-associated protein tau (Goedert et al., 1989 ) that
selectively labels tau in axons. The layer of pyramidal neuron cell
bodies is labeled py, and the overlying white matter axon
tracts (alveus and corpus callosum) wm. Scale bar, 100 µm.
[View Larger Version of this Image (121K GIF file)]
Fig. 4.
Dendritic localization of MAP2c in cultured
hippocampal neurons from transgenic mice. Cultures established at
embryonic day 16 and grown for 15 d were fixed and
double-immunofluorescence-stained with anti-c-myc antibody for
transgenic MAP2c (rhodamine; A) and rabbit antibody against
tau (fluorescein; B). In A some dendrites are
identified by arrowheads. Preparations were also made using
fluorescein to label anti-c-myc and rhodamine to label tau with
identical results. Scale bar, 50 µm.
[View Larger Version of this Image (77K GIF file)]
In a previous study, we observed that myc-MAP2c expressed in calcium
phosphate-transfected primary hippocampal cultures entered all neuronal
processes (Meichsner et al., 1993 ). This result obviously conflicts
with the exclusively dendritic localization that we observed in both
tissue sections and cultured neurons in the present study. To resolve
this inconsistency, we repeated the transfection experiments with a new
procedure that uses liposome-mediated transfection (Kaech et al., in
press). Using this technique, we found that MAP2c was limited to the
cell bodies and dendrites of transfected hippocampal neurons. This is
shown by the identical immunohistochemical staining patterns for the
myc epitope of transgenic MAP2c and endogenous adult MAP2 in Figure 5,
A and B. The specificity of this
distribution pattern was shown by expressing the similarly sized
bacterial protein CAT from the same vector. In this case, the expressed
protein appeared throughout the entire length of both dendrites and
axons (Fig. 5C). These results indicate that there is no
barrier to the entry of transgenically expressed foreign proteins into
axons, and that the restriction of transgenic MAP2c to dendrites
reflects the operation of a saturable endogenous sorting mechanism.
Fig. 5.
Location of myc-MAP2c in primary hippocampal
neurons transfected in vitro. Cultures established at
embryonic day 16 grown for 11 d were fixed and
double-immunofluorescence-stained for the myc epitope of MAP2c
(rhodamine; A) and for MAP2 (fluorescein; B). In
the strongly expressing cell in A, transfected MAP2c shows
the same dendritic localization as the endogenous adult MAP2 shown in
B. A soluble test protein (CAT) expressed using the same
promoter and transfection procedure is distributed throughout dendrites
and axons (C). Scale bar, 50 µm.
[View Larger Version of this Image (33K GIF file)]
Currently known examples of cytoplasmic sorting of mRNAs
depend on signals situated in their 3 -untranslated sequences
(Kislauskis and Singer, 1992 ; Wilhelm and Vale, 1993 ). However, the
myc-MAP2c construct used to produce our transgenic mice does not
contain any untranslated sequence from the MAP2 mRNA, indicating that
the mechanism responsible for its dendritic restriction depends on a
signal situated within the coding sequence. This signal could reside in
principle either in the protein sequence or in the nucleotide sequence
of the mRNA. To distinguish between these alternatives, we determined
the cellular location of endogenous adult MAP2 mRNA and the transgenic
MAP2c mRNA in sections of mouse brain using specific oligonucleotide
probes (Fig. 6). The transgenic MAP2c was located using
a probe directed against the unique MAP2c sequence across the splice
junction (Papandrikopoulou et al., 1989 ; Doll et al., 1990 ; Kindler et
al., 1991 ). This probe gave clear labeling on sections of transgenic
brain (Fig. 6A) and, as expected, there was no
signal on brain sections from control nontransgenic animals (Fig.
6B). In both the CA region and dentate gyrus (dg)
region of the hippocampus, the MAP2c mRNA signal was restricted to the
cell body layer (Fig. 6A). By contrast, a probe
specific for endogenous adult high-Mr MAP2
mRNA confirmed its previously described dendritic location (Garner et
al., 1988 ; Tucker et al., 1989 ) in both transgenic and control brain
sections (Fig. 6C,D). For comparison,
Figure 6, E and F, shows the contrasting cell
body localization of tubulin mRNA.
Fig. 6.
Localization of MAP2 and tubulin mRNAs in
transgenic mouse hippocampus by in situ hybridization.
Sections from brains of either transgenic (left) or control
(right) mice were incubated with specific
35S-labeled oligonucleotide probes, and the
distribution of their target mRNAs was determined by autoradiography.
Probes specific for the MAP2c-specific splice junction (A,
B) gave specific labeling only in transgenic brain sections,
and this labeling was limited to cell body layer in both the CA region
(labeled CA1) and dentate gyrus (dg). By
contrast, probes specific for endogenous high
Mr MAP2 mRNA labeled both cell bodies and
the adjacent dendrite-rich neuropil in both transgenic (C)
and control (D) brains. A tubulin control probe labeled only
cell body layers of CA1 and dentate gyrus neurons (E,
F). Scale bar, 0.5 mm.
[View Larger Version of this Image (214K GIF file)]
DISCUSSION
By expressing embryonic MAP2c in the adult brain, this study
provides new insights into the mechanisms that determine the targeting
of structural proteins within the neuronal cytoplasm. Another objective
of these experiments was to investigate the consequences of expressing
embryonic MAP2c beyond the time when it normally disappears from the
developing brain. Because at the end of the neonatal period MAP2c
disappears from most brain regions and because inhibition of MAP2
expression during neuronal differentiation suppresses dendrite growth
(Dinsmore and Solomon, 1991 ; Caceres et al., 1992 ; Sharma et al.,
1994 ), it might have been expected that its prolonged expression would
have a detectable and possibly informative effect on neuronal
morphogenesis. However, even though one of our transgenic lines
expressed MAP2c in the adult brain at levels exceeding those of
endogenous high-Mr MAP2, there was no
detectable difference in neuronal morphology between these and control
animals. In addition to the light microscopic and immunohistochemical
data shown, we also analyzed tissue by Golgi staining and electron
microscopy, neither of which revealed any detectable difference between
MAP2c-transgenic and control animals. Although this result at first
seemed surprising, the situation may perhaps be compared to that of the
olfactory system where, as an exception to the rest of the brain,
neurons continue to express MAP2c during adulthood (Viereck et al.,
1989 ; Viereck and Matus, 1990 ). Despite this, these cells are not
morphologically ``abnormal'' compared to other neuronal types in the
adult brain (Viereck et al., 1989 ; Viereck and Matus, 1990 ). MAP2c is
also expressed in photosensitive cells of the adult retina (Tucker and
Matus, 1988 ) that undergo a daily cycle of shedding and regenerating
their outer segment disks, which are functionally equivalent to
dendrites (Young, 1967 ). The distribution and intensity of anti-MAP2
staining in these photoreceptor cells does not vary during the
light/dark cycle (Tucker and Matus, 1988 ), suggesting that MAP2c is not
directly involved in regulating outer disk regeneration but that it is
part of the machinery required for this to occur. Taken together with
our present findings, these earlier results suggest that MAP2c provides
a morphogenic potential that is only realized in tissues in which
neuronal circuitry is being formed. Our transgenic mice may provide a
model for evaluating the potential contribution of MAP2c to
readjustments of circuitry after lesions to brain areas in which it is
normally absent in the adult.
Cytoplasmic distribution of transgenically expressed MAP2c
Despite its high level of expression, transgenic MAP2c was
restricted to dendrites in both tissue sections and cell cultures. This
distribution mirrored that of endogenous adult MAP2 and contrasted
strikingly with the axonal distribution of tau. It agrees with the
dendritic localization of MAP2 found in most areas of both the adult
and the developing nervous systems (Bernhardt and Matus, 1982 ;
Bernhardt and Matus, 1984 ; Burgoyne and Cumming, 1984 ; De Camilli et
al., 1984 ; Bernhardt et al., 1985 ). However, MAP2c-selective
immunohistochemical staining is detectable in the axons of embryonic
retinal ganglion cells (Tucker and Matus, 1988 ) and embryonic motor
neurons (Tucker et al., 1988 ; Albala et al., 1995 ). It has also been
reported that not only MAP2c but also
high-Mr MAP2 is present in motor neuron
axons (Papasozomenos et al., 1985 ). A possible reason for this is the
exceptional length and diameter of the axons of these cell types, which
may require MAP2 to lend additional stiffness to their microtubules
(Matus, 1994 ). The exceptional nature of these cases is shown by the
absence of MAP2c from axons of the rat olfactory tract, which contain
high levels of another embryonic microtubule protein, MAP5 (MAP1B)
(Viereck et al., 1989 ). Also in the olfactory bulb, where both MAP2c
and high-Mr MAP2 are expressed,
immunohistochemical staining patterns for the two forms are
indistinguishable and limited to dendrites (Viereck et al., 1989 ).
Although there are some exceptions, the available data suggest that in
most neurons a mechanism exists, both during development and in
adulthood, that sorts all forms of MAP2 to dendrites.
MAP2 sorting has also been investigated by transfecting primary neurons
in cell culture. We initially reported that in rat hippocampal cells
transfected in vitro epitope-labeled MAP2c entered both
axons and dendrites (Meichsner et al., 1993 ). However, in the present
study, despite high expression levels, MAP2c did not enter axons in
cultured hippocampal neurons whether they were taken from transgenic
animals or transfected in vitro using a liposome-mediated
procedure (Kaech et al., in press). This suggests that the calcium
phosphate transfection procedure used in our previous study may
interfere with the normal sorting. Recently, it was reported that
transfected MAP2c enters axons in cultured motor neurons (Kanai and
Hirokawa, 1995 ). However, motor neurons belong to a relatively small
group of neurons that contain immunoreactive MAP2 in their axons during
normal development (Tucker et al., 1988 ; Albala et al., 1995 ).
Furthermore Kanai and Hirokawa (1995) reported that MAP2c was not
detectable in the axons of cultured embryonic motor neurons that had
not been transfected, suggesting that in these cells, too, there is a
preferential association of all MAP2 isoforms with the dendritic
compartment under normal circumstances (Albala et al., 1995 ). On
balance, the available data suggest that in most neurons both
high-Mr MAP2 and MAP2c are sorted to
dendrites.
In situ hybridization studies have shown that not only MAP2
protein but also its mRNA are present in neuronal dendrites
(Bruckenstein et al., 1990 ; Kleiman et al., 1990 ). This raises the
possibility that the dendritic localization of MAP2 might result from
the previous sorting of the mRNA followed by local synthesis of the
protein. However, in our transgenic mice, although MAP2c protein was
localized in dendrites, its mRNA was present only in cell bodies. This
indicates that the dendritic location of MAP2c protein depends on a
signal situated on the protein itself. This signal must operate in such
a way that for high-Mr MAP2 both the
protein and mRNA are localized in the dendrite, whereas for MAP2c the
protein enters the dendrite but the mRNA remains in the cell body.
Figure 7 indicates a mechanism by which this could be
achieved. In this scheme, a signal situated near the N terminus of the
MAP2 protein, in a region common to both
high-Mr MAP2 (MAP2b) and MAP2c, determines
their transport into dendrites. For MAP2b this occurs during
translation (Fig. 7, top), the period necessary for
transport of the mRNA being provided by the length of time required to
translate the ~6 kb of the MAP2b coding sequence, with the possible
additional involvement of a pause signal within the nucleotide sequence
(indicated as a loop in Fig. 7, top). For the
much shorter coding sequence of MAP2c (~1.5 kb), translation would be
completed in the cell body, releasing the mRNA before transport of the
protein into the dendrite (Fig. 7, bottom). In addition to
the differential distribution of the two mRNAs, this mechanism can also
account for the presence of ribosomes (Steward and Falk, 1991 ) and the
active transport of ribosomal RNA into dendrites (Davis et al., 1987 )
as part of a MAP2 translation complex.
Fig. 7.
Diagrammatic representation of possible mechanisms
for MAP2 transport signals. The large gray arrow
represents the putative dendrite-directed transport mechanism.
1, A transport signal (green box) near the
N terminus of the protein emerges during translation so that the
translation complex, including the adult
high-Mr protein (2b
protein) and mRNA (Adult mRNA) and
ribosomes (rb) are cotransported. A pause signal unique to
the high-Mr mRNA (shown as a
loop) may act as an additional feature mediating mRNA
transport. 2, MAP2c mRNA (Embryonic mRNA),
either because it is shorter or because it lacks a pause signal,
completes its translation in the cell body so that only the protein is
carried into the dendrite.
[View Larger Version of this Image (32K GIF file)]
It is also possible that there are two independent mechanisms, one that
sorts the MAP2 proteins to dendrites and another that operates
selectively on the 9 kb mRNA of the high-Mr
MAP2. It has been shown previously that inhibition of protein synthesis
alters the distribution of mRNA in neurons so that mRNAs that are
normally restricted to the cell body appear in the dendrites (Kleiman
et al., 1993 ). One explanation for this finding is that mRNAs are
retained in the cell body by a translation-dependent mechanism so that
all mRNAs that are not translated are transported. Such a mechanism
might operate selectively on high-Mr MAP2
under normal circumstances if its mRNA contained a conditional
translation pause mechanism, such as that indicated in the hypothetical
scheme of Figure 7. Such a mechanism would not operate on MAP2c, which
lacks the central domain of MAP2 containing the putative pause signal
(Papandrikopoulou et al., 1989 ; Kindler et al., 1991 ). Its 6 kb mRNA
consequently would remain in the cell body, where translation would
occur followed by transport of the MAP2c protein into the
dendrites.
Another factor relevant to the interpretation of our data is that
approximately half the microtubules in dendrites have their ``minus''
ends oriented distally (Baas et al., 1988 ; Burton, 1988 ). Recent
evidence indicates that this nonuniform polarity is established by the
transport of assembled microtubules into dendrites with this
orientation (Sharp et al., 1995 ). Because the appearance of
``minus-end-out'' microtubules is temporally correlated with the
restriction of MAP2 to dendrites, it is possible that MAP2 might be
transported into dendrites attached to this class of microtubules.
Whatever the scheme involved, the dendritic localization of both high-
and low-Mr MAP2 protein would require a
signal common to the protein sequence of all forms. The fact that this
signal involved is present in the 467 amino acids of MAP2c rather than
the 1830 amino acids of the adult forms (Doll et al., 1990 ; Kindler et
al., 1991 ) should greatly simplify the task of characterizing both the
signal and the mechanism that operates on it.
FOOTNOTES
Received Aug. 7, 1995; revised Feb. 26, 1996; accepted Feb. 28, 1996.
K.M. was supported by a fellowship from the Wellcome Trust. We thank
Dr. Nevis Fregien for supplying the chicken -actin promoter, Drs. M. Goedert and S. Halpain for providing rabbit antibodies against tau and
MAP2, respectively, Dr. Herman van der Putten for assistance with
transgenic mouse techniques, and Dr. Grayson Richards for assistance
with the in situ hybridization technique.
Correspondence should be addressed to Dr. Kathryn Marsden, Friedrich
Miescher Institute, P.0. Box 2543, 4002 Basel,
Switzerland.
REFERENCES
-
Albala JS,
Kress Y,
Liu W-K,
Weidenheim K,
Yen S-HC,
Shafit Zagardo B
(1995)
Human microtubule-associated protein-2c localizes to
dendrites and axons in fetal spinal motor neurons.
J Neurochem
95:2480-2490.
-
Baas PW,
Deitch JS,
Black MM,
Banker GA
(1988)
Polarity
orientation of microtubules in hippocampal neurons: uniformity in the
axon and nonuniformity in the dendrite.
Proc Natl Acad Sci USA
85:8335-8339 .
[Abstract/Free Full Text]
-
Berleth T,
Burri M,
Thoma G,
Bopp D,
Richstein S,
Frigerio G,
Noll M,
Nüsslein-Vollhard C
(1988)
The role and localization
ofbicoid RNA in organizing the anterior pattern of the
Drosophila embryo.
EMBO J
7:1749-1756 .
[Web of Science][Medline]
-
Bernhardt R,
Matus A
(1982)
Initial phase of dendrite growth:
evidence for the involvement of high molecular weight
microtubule-associated proteins (HMWP) before the appearance of
tubulin.
J Cell Biol
92:589-593 .
[Abstract/Free Full Text]
-
Bernhardt R,
Matus A
(1984)
Light and electron microscopic
studies of the distribution of microtubule-associated protein 2 in rat
brain: a difference between dendritic and axonal cytoskeletons.
J Comp Neurol
226:203-221 .
[Web of Science][Medline]
-
Bernhardt R,
Huber G,
Matus A
(1985)
Differences in the
developmental patterns of three microtubule-associated proteins in the
rat cerebellum.
J Neurosci
5:977-991 .
[Abstract]
-
Botteri FM, van der Putten H, Wong DF, Sauvage CA, Evans
RM (1987) Mol Cell Biol 7:3178-3184.
-
Bruckenstein DA,
Lein PJ,
Higgins D,
Fremeau R Jr
(1990)
Distinct spatial localizations of mRNA in cultured
sympathetic neurons.
Neuron
5:809-819 .
[Web of Science][Medline]
-
Burgin KE,
Ludin B,
Ferralli J,
Matus A
(1994)
Bundling of
microtubules in transfected cells does not involve an autonomous
dimerization site on the MAP2 molecule.
Mol Biol Cell
5:511-517 .
[Abstract]
-
Burgoyne RD,
Cumming R
(1984)
Ontogeny of
microtubule-associated protein 2 in rat cerebellum: differential
expression of the doublet polypeptides.
Neuroscience
11:156-167 .
[Medline]
-
Burton PR
(1988)
Dendrites of mitral cell neurons contain
microtubules of opposite polarity.
Brain Res
473:107-115 .
[Web of Science][Medline]
-
Caceres A,
Banker G,
Steward O,
Binder L,
Payne M
(1984)
MAP2
is localized to the dendrites of hippocampal neurons which develop in
culture.
Dev Brain Res
13:314-318.
-
Caceres A,
Mautino J,
Kosik KS
(1992)
Suppression of MAP2 in
cultured cerebellar macroneurons inhibits minor neurite formation.
Neuron
9:607-618 .
[Web of Science][Medline]
-
Chen J,
Kanai Y,
Cowan NJ,
Hirokawa N
(1992)
Projection
domains of MAP2 and tau determine spacings of microtubules in dendrites
and axons.
Nature
360:674-677 .
[Medline]
-
Craig AM,
Banker G
(1994)
Neuronal polarity.
Annu Rev Neurosci
17:267-310 .
[Web of Science][Medline]
-
Davis L,
Banker GA,
Steward O
(1987)
Selective dendritic
transport of RNA in hippocampal neurons in culture.
Nature
330:477-479 .
[Medline]
-
De Camilli P,
Miller PE,
Navone F,
Theurkauf WE,
Vallee RB
(1984)
Distribution of microtubule-associated protein 2 in
the nervous system of the rat studied by immunofluorescence.
Neuroscience
11:817-846 .
[Medline]
-
Dinsmore JH,
Solomon F
(1991)
Inhibition of MAP2 expression
affects both morphological and cell division phenotypes of neuronal
differentiation.
Cell
64:817-826 .
[Web of Science][Medline]
-
Doll T,
Papandrikopoulou A,
Matus A
(1990)
Nucleotide and
amino acid sequences of embryonic rat MAP2c.
Nucleic Acids Res
18:361 .
[Free Full Text]
-
Edson K,
Weisshaar B,
Matus A
(1993)
Actin depolymerisation
induces process formation in MAP2-transfected non-neuronal cells.
Development
117:689-700 .
[Abstract]
-
Fregien N,
Davidson N
(1986)
Activating elements in the
promoter region of the chicken beta-actin gene.
Gene
48:1-11 .
[Web of Science][Medline]
-
Garner CC,
Matus A
(1988)
Different forms of
microtubule-associated protein 2 are encoded by separate mRNA
transcripts.
J Cell Biol
106:779-783 .
[Abstract/Free Full Text]
-
Garner CC,
Tucker RP,
Matus A
(1988)
Selective localization
of messenger RNA for cytoskeletal protein MAP2 in dendrites.
Nature
336:674-677 .
[Medline]
-
Goedert M,
Spillantini M,
G,
Jakes R,
Rutherford D,
Crowther R,
A
(1989)
Multiple isoforms of human microtubule-associated
protein tau: sequences and localization in neurofibrillary tangles of
Alzheimer's disease.
Neuron
3:519-526 .
[Web of Science][Medline]
-
Goslin K,
Banker G
(1991)
Rat hippocampal neurons in
low-density culture.
In: Culturing nerve cells
(Goslin, K,
Banker, G,
eds)
, p. 252. Cambridge: MIT.
-
Greenough WT,
West RW,
DeVoogd TJ
(1978)
Subsynaptic plate
perforations: changes with age and experience.
Science
202:1096-1098 .
[Abstract/Free Full Text]
-
Hill MA,
Gunning P
(1993)
Beta and gamma actin mRNAs are
differentially located within myoblasts.
J Cell Biol
122:825-832 .
[Abstract/Free Full Text]
-
Kaech S, Kim JB, Cariola M, Ralston E (1996) Improved
lipid-mediated gene transfer into primary cultures of hippocampal
neurons. Mol Brain Res, in press.
-
Kanai Y,
Hirokawa N
(1995)
Sorting mechanisms of tau and MAP2
in neurons: suppressed axonal transport of MAP2 and locally regulated
microtubule binding.
Neuron
14:421-432 .
[Web of Science][Medline]
-
Kindler S,
Schulz B,
Goedert M,
Garner CC
(1991)
Molecular
structure of microtubule-associated protein 2b and 2c from rat brain.
J Biol Chem
265:19679-19684 .
[Abstract/Free Full Text]
-
Kislauskis EH,
Singer RH
(1992)
Determinants of mRNA
localization.
Curr Opin Cell Biol
4:975-978 .
[Medline]
-
Kleiman R,
Banker G,
Steward O
(1990)
Differential
subcellular localization of particular mRNAs in hippocampal neurons in
culture.
Neuron
5:821-830 .
[Web of Science][Medline]
-
Kleiman R,
Banker G,
Steward O
(1993)
Inhibition of protein
synthesis alters the subcellular distribution of mRNA in neurons but
does not prevent dendritic transport of RNA.
Proc Natl Acad Sci USA
90:11192-11196 .
[Abstract/Free Full Text]
-
Lewis SA,
Ivanov IE,
Lee GH,
Cowan NJ
(1989)
Organization of
microtubules in dendrites and axons is determined by a short
hydrophobic zipper in microtubule-associated and tau.
Nature
342:498-505 .
[Medline]
-
Matus A
(1994)
Stiff microtubules and neuronal morphology.
Trends Neurosci
17:19-22 .
[Web of Science][Medline]
-
Matus A,
Bernhardt R,
Hugh Jones T
(1981)
High molecular
weight microtubule-associated proteins are preferentially associated
with dendritic microtubules in brain.
Proc Natl Acad Sci USA
78:3010-3014 .
[Abstract/Free Full Text]
-
Matus A,
Bernhardt R,
Bodmer R,
Alaimo D
(1986)
Microtubule-associated protein 2 and tubulin are
differently distributed in the dendrites of developing neurons.
Neuroscience
17:371-389 .
[Web of Science][Medline]
-
Meichsner M,
Doll T,
Reddy D,
Weisshaar B,
Matus A
(1993)
The
low molecular weight form of microtubule-associated protein 2 is
transported into both axons and dendrites.
Neuroscience
54:873-880 .
[Web of Science][Medline]
-
Melton DA
(1987)
Translocation of a localized maternal mRNA
to the vegetal pole of Xenopus oocytes.
Nature
328:80-82 .
[Medline]
-
Munro S,
Pelham HRB
(1987)
A C-terminal signal prevents
secretion of luminal ER proteins.
Cell
48:899-907 .
[Web of Science][Medline]
-
Papandrikopoulou A,
Doll T,
Tucker RP,
Garner CC,
Matus A
(1989)
Embryonic MAP2 lacks the cross-linking sidearm
sequences and dendritic targeting signal of adult MAP2.
Nature
340:650-652 .
[Medline]
-
Papasozomenos SC,
Binder LI,
Bender PK,
Payne MR
(1985)
Microtubule-associated protein 2 within axons of
spinal motor neurons: associations with microtubules and neurofilaments
in normal and beta, beta
-iminodipropionitrile-treated axons.
J Cell Biol
100:74-85 .
[Abstract/Free Full Text]
-
Riederer B,
Matus A
(1985)
Differential expression of
distinct microtubule-associated proteins during brain development.
Proc Natl Acad Sci USA
82:6006-6009 .
[Abstract/Free Full Text]
-
Sharma N,
Kress Y,
Shafit Zagardo B
(1994)
Antisense MAP-2
oligonucleotides induce changes in microtubule assembly and neuritic
elongation in pre-existing neurites of rat cortical neurons.
Cell Motil Cytoskeleton
27:234-247 .
[Web of Science][Medline]
-
Sharp DJ,
Yu W,
Baas PW
(1995)
Transport of dendritic
microtubules establishes their nonuniform polarity orientation.
J Cell Biol
130:93-104 .
[Abstract/Free Full Text]
-
Steward O,
Falk PM
(1991)
Selective localization of
polyribosomes beneath developing synapses: a quantitative analysis of
the relationships between polyribosomes and developing synapses in the
hippocampus and dentate gyrus.
J Comp Neurol
314:545-557 .
[Web of Science][Medline]
-
Sundell CL,
Singer RH
(1990)
Actin mRNA localizes in the
absence of protein synthesis.
J Cell Biol
111:2397-2403 .
[Abstract/Free Full Text]
-
Towbin H,
Staehelin T,
Gordon J
(1979)
Electrophoretic
transfer of protein from polyacrylamide gels to nitrocellulose sheets:
procedure and some applications.
Proc Natl Acad Sci USA
76:4350-4354 .
[Abstract/Free Full Text]
-
Tucker RP,
Matus AI
(1988)
Microtubule-associated proteins
characteristic of embryonic brain are found in the adult mammalian
retina.
Dev Biol
130:423-434 .
[Web of Science][Medline]
-
Tucker RP,
Binder LI,
Matus AI
(1988)
Neuronal
microtubule-associated proteins in the embryonic avian spinal cord.
J Comp Neurol
271:44-55 .
[Web of Science][Medline]
-
Tucker RP,
Garner CC,
Matus A
(1989)
In situ localization of
microtubule-associated protein mRNA in the developing and adult rat
brain.
Neuron
2:1245-1256 .
[Web of Science][Medline]
-
Vallee RB
(1982)
A taxol dependent procedure for the
isolation of microtubules and microtubule-associated proteins.
J Cell Biol
92:435-442 .
[Abstract/Free Full Text]
-
Viereck C,
Matus A
(1990)
The expression of phosphorylated
and non-phosphorylated forms of MAP5 in the amphibian CNS.
Brain Res
508:257-264 .
[Web of Science][Medline]
-
Viereck C,
Tucker RP,
Matus A
(1989)
The adult rat olfactory
system expresses microtubule-associated proteins found in the
developing brain.
J Neurosci
9:3547-3557 .
[Abstract]
-
Weisshaar B,
Doll T,
Matus A
(1992)
Reorganisation of the
microtubular cytoskeleton by embryonic microtubule-associated protein 2 (MAP2c).
Development
116:1151-1161 .
[Abstract]
-
Wilhelm JE,
Vale RD
(1993)
RNA on the move: the mRNA
localization pathway.
J Cell Biol
123:269-274 .
[Free Full Text]
-
Yisraeli JK,
Melton DA
(1988)
The maternal mRNA Vg1 is
correctly localized following injection into Xenopus
oocytes.
Nature
336:592-595 .
[Medline]
-
Young RW
(1967)
The renewal of photoreceptor outer segments.
J Cell Biol
33:61-72 .
[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
L. Dehmelt, F. M. Smart, R. S. Ozer, and S. Halpain
The Role of Microtubule-Associated Protein 2c in the Reorganization of Microtubules and Lamellipodia during Neurite Initiation
J. Neurosci.,
October 22, 2003;
23(29):
9479 - 9490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kaech, H. Parmar, M. Roelandse, C. Bornmann, and A. Matus
Cytoskeletal microdifferentiation: A mechanism for organizing morphological plasticity in dendrites
PNAS,
June 19, 2001;
98(13):
7086 - 7092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Blichenberg, B. Schwanke, M. Rehbein, C. C. Garner, D. Richter, and S. Kindler
Identification of a cis-Acting Dendritic Targeting Element in MAP2 mRNAs
J. Neurosci.,
October 15, 1999;
19(20):
8818 - 8829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Severt, T. Biber, X Wu, N. Hecht, R. DeLorenzo, and E. Jakoi
The suppression of testis-brain RNA binding protein and kinesin heavy chain disrupts mRNA sorting in dendrites
J. Cell Sci.,
January 11, 1999;
112(21):
3691 - 3702.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Wallace, G. L. Lyford, P. F. Worley, and O. Steward
Differential Intracellular Sorting of Immediate Early Gene mRNAs Depends on Signals in the mRNA Sequence
J. Neurosci.,
January 1, 1998;
18(1):
26 - 35.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kaech, M. Fischer, T. Doll, and A. Matus
Isoform Specificity in the Relationship of Actin to Dendritic Spines
J. Neurosci.,
December 15, 1997;
17(24):
9565 - 9572.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|