 |
Previous Article | Next Article 
Volume 16, Number 12,
Issue of June 15, 1996
pp. 3925-3933
Copyright ©1996 Society for Neuroscience
Cloning and Functional Characterization of a Novel Dopamine
Receptor from Drosophila melanogaster
Guoping Feng1,
Frances Hannan1, 2,
Vincenzina Reale2,
Yuen
Yi Hon1,
Christopher T. Kousky1,
Peter D. Evans2, and
Linda M. Hall1
1 Department of Biochemical Pharmacology, State
University of New York at Buffalo, Buffalo, New York 14260-1200, and
2 The Babraham Institute Laboratory of Molecular
Signalling, Department of Zoology, University of Cambridge, Cambridge
CB2 3EJ, United Kingdom
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
A cDNA clone is described that encodes a novel G-protein-coupled
dopamine receptor (DopR99B) expressed in Drosophila heads.
The DopR99B receptor maps to 99B3-5, close to the position of the
octopamine/tyramine receptor gene at 99A10-B1, suggesting that the two
may be related through a gene duplication. Agonist stimulation of
DopR99B receptors expressed in Xenopus oocytes increased
intracellular Ca2+ levels monitored as changes in
an endogenous inward Ca2+-dependent chloride
current. In addition to initiating this intracellular
Ca2+ signal, stimulation of DopR99B increased
cAMP levels. The rank order of potency of agonists in stimulating the
chloride current is: dopamine > norepinephrine > epinephrine > tyramine. Octopamine and 5-hydroxytryptamine are not active (<100
µM). This pharmacological profile plus the
second-messenger coupling pattern suggest that the DopR99B receptor is
a D1-like dopamine receptor. However, the hydrophobic core region of
the DopR99B receptor shows almost equal amino acid sequence identity
(40-48%) with vertebrate serotonergic, 1- and -adrenergic, and
D1-like and D2-like dopaminergic receptors. Thus, this
Drosophila receptor defines a novel structural class of
dopamine receptors. Because DopR99B is the second dopamine receptor
cloned from Drosophila, this work establishes dopamine
receptor diversity in a system amenable to genetic dissection.
Key words:
cloned dopamine receptor;
Drosophila
melanogaster;
Xenopus oocyte expression;
adenylyl cyclase;
calcium;
gene mapping
INTRODUCTION
Dopamine is a neurotransmitter in both the central
and the peripheral nervous systems and is involved in a variety of
important physiological and behavioral processes, such as
neuroendocrine function, emotion, and motor control (Civelli et al.,
1993 ). Moreover, dopaminergic systems have been implicated in several
neurological disorders, including Parkinson's disease and
schizophrenia (Seeman et al., 1984 ; Goldstein and Deutch, 1992 ;
Wichmann and DeLong, 1993 ). Dopamine exerts its effects by interacting
with G-protein-coupled, heptahelical membrane receptors on the cell
surface (Jackson and Westlind-Danielsson, 1994 ).
Numerous agonists and antagonists of dopamine receptors have been
discovered in the search for new drugs to battle neurological
disorders. Using these drugs, dopamine receptors were originally
classified into D1 and D2 subtypes based on their pharmacological
specificity with neuroleptics (Kebabian and Calne, 1979 ), a class of
dopamine antagonists used to alleviate the main symptoms of
schizophrenia (Levinson, 1991 ). Molecular cloning of dopamine receptors
has revealed at least five distinct subtypes (D1-D5) that can be
divided into two classes, the D1-like (D1 and D5) and D2-like (D2, D3,
and D4) receptors based on their sequence similarity and
pharmacological profile (Gingrich and Caron, 1993 ). These two classes
of dopamine receptors are linked to distinct cascades for signal
transduction. Activation of D1-like receptors stimulates adenylyl
cyclase and phosphatidylinositol-4,5-bisphosphate (PI) metabolism,
whereas D2-like receptor activation inhibits adenylyl cyclase and
activates potassium channels (Gingrich and Caron, 1993 ; Jackson and
Westlind-Danielsson, 1994 ).
Dopamine and dopamine receptors have long been thought to play an
important role in the invertebrate nervous system (Weiss and Drummond,
1981 ; Sonetti et al., 1987 ; Walker and Holden-Dye, 1989 ; Ali and
Orchard, 1994 ; Hall, 1994 ). We report here the molecular cloning and
functional characterization of a novel Drosophila dopamine
receptor that shows a pharmacology and second-messenger coupling
pattern similar to D1-like receptors. However, this
Drosophila receptor differs structurally from the D1-like
group of dopamine receptors that includes mammalian D1 and D5 subtypes,
and it also differs from a previously reported D1-like receptor from
Drosophila (Gotzes et al., 1994 ; Sugamori et al., 1995 ).
Northern blot analysis suggests that this novel Drosophila
receptor is expressed in both central and peripheral nervous systems.
Stimulation of these receptors, expressed in Xenopus
oocytes, generates a calcium signal and increases cAMP levels. Gene
mapping provides a first step toward future studies aimed at mutant
dissection of the physiological roles of dopamine receptor subtypes in
the intact organism, including their possible involvement in memory and
learning.
MATERIALS AND METHODS
PCR amplification for initial isolation of new receptor
genomic DNA. The forward primer (OPS3: CATAGCCCTCGACCGGTACT)
encodes the cytoplasmic end of the third transmembrane domain of the
Drosophila octopamine/tyramine receptor (OctyR99AB) (Arakawa
et al., 1990 ). The reverse primer (OPS4: GGCAGCCAGCAGATGACGAA) encodes
the middle region of transmembrane domain VI from this receptor. The
PCR template was 300 ng of Drosophila genomic DNA prepared
from wild-type Canton-S adult flies (Jowett, 1986 ). The 100 µl PCR
mixture contained 0.2 mM each of
deoxyribonucleotide triphosphate, 10 mM Tris-HCl
buffer, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin,
0.1 µM of each primer, and 2.5 units of
AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT). PCR was
performed under reduced stringency annealing conditions: 94°C for 2 min, 33°C for 2 min, 72°C for 2 min for 6 cycles followed by an
additional 31 cycles with an annealing temperature of 42°C instead of
33°C. Final extension was 10 min at 72°C. PCR products were
analyzed by electrophoresis of 10 µl of reaction mixture on a 1%
agarose gel.
DNA sequencing. Direct sequencing of the PCR product was
performed as described previously (Feng et al., 1995 ; Zheng et al.,
1995 ) using a Taq Dye Primer Cycle Sequencing kit (Applied
Biosystems, Foster City, CA). To facilitate the sequencing of the cDNA
clone, nested deletions were used (Henikoff, 1987 ). Each segment of DNA
was sequenced at least twice in both directions. The contig was
assembled using Geneworks software (Intelligenetics, Mountain View,
CA).
Screening for cDNA clones. The 0.68 kb fragment from the
initial PCR amplification experiment was labeled with
[ -32P]dCTP (~110 TBq/mmol) using the
Multiprime DNA labeling system (Amersham, Arlington Heights, IL) and
was used to screen a Drosophila head cDNA library (Itoh et
al., 1985 ) in gt11, generously provided by Dr. Paul Salvaterra
(Beckman Research Institute, Duarte, CA). Four positive clones were
identified by high-stringency (Sambrook et al., 1989 ) screening of 4 × 105 plaque-forming units (pfu). The longest
insert (4 kb) was cut out with EcoRI and subcloned into
pBluescript II SK( ) for further analysis. This insert and the gene
that encodes it are referred to as DopR99B throughout this paper.
Northern blots. Heads, bodies, and appendages (legs and
antennae) were isolated from frozen adult flies (Schmidt-Nielsen et
al., 1977 ). Poly(A)+ RNA and blots were prepared
as described previously (Feng et al., 1995 ; Zheng et al., 1995 ).
Poly(A)+ RNA (10 µg/lane) was run on a
denaturing, formaldehyde agarose (0.8%) gel. Blots were probed with
the 32P-labeled 0.68 kb PCR fragment added to a
final concentration of 106 cpm/ml. After
high-stringency washing (Feng et al., 1995 ; Zheng et al., 1995 ), blots
were exposed to x-ray film for 24 hr at 70°C.
In situ hybridization to salivary gland chromosome squashes.
The 0.68 kb PCR fragment was biotinylated, hybridized to larval
salivary gland polytene chromosome squashes, and localized using the
Gibco (Gaithersburg, MD) Bluegene detection kit as described by Engels
et al. (1985) with minor modifications (Feng et al., 1995 ; Zheng et
al., 1995 ).
Expression in Xenopus oocytes. Sense cRNA was
prepared in vitro from the DopR99B clone in the pBluescript
II SK( ) vector using T7 RNA polymerase (Stratagene, La Jolla, CA)
after linearizing the plasmid with NotI (Promega, Madison,
WI). Transcripts were capped by adding 0.75 units of
m7G(5 )ppp(5 )G (Boehringer Mannheim,
Indianapolis, IN) to a standard 150 µl transcription reaction
(Stratagene kit).
Stage V and VI oocytes from virgin female adult Xenopus
laevis were manually separated and placed in sterile ND96 medium
[in mM: NaCl 96, KCl 2, CaCl2 1.8, MgCl2 1, HEPES
buffer (pH 7.6) 5, containing 2.4 mM sodium
pyruvate, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 0.2 mg/ml
gentamycin]. The oocytes were defolliculated enzymatically by
incubation in ND96 containing collagenase (2 mg/ml) for 30 min. Oocytes
were then injected with 50 ng of Drosophila DopR99B receptor
sense cRNA and incubated at 19°C for 2-5 d. Uninjected oocytes were
used as controls.
Electrophysiological recordings were made from oocytes using a
two-microelectrode voltage-clamp technique, at a 60 mV holding
potential, to measure oocyte currents (Van Renterghem et al., 1987 ).
Oocytes were continuously superfused with ND96 during the experiments
at room temperature, and drugs were added to the superfusate.
cAMP assays. To monitor cAMP levels, individual oocytes were
preincubated for 30 min in ND96 plus 100 µM
isobutylmethylxanthine (IBMX). Experimental oocytes were incubated for
a further 30 min with the desired concentration of agonist in the same
medium while control oocytes (to measure basal cAMP levels) were
incubated in parallel in the same medium without agonist. After the
incubations, each oocyte was homogenized in 500 µl of acidified
ethanol, centrifuged to remove particulate matter, and the supernatant
was evaporated to dryness in a vacuum centrifuge (Savant, Farmingdale,
NY). Each sample was taken up in 60 µl of assay buffer and assayed
for cAMP using a commercial assay kit (Amersham).
Drugs. The drugs used in the classification of the
expressed receptor were obtained from the following sources:
dopamine hydrochloride, ( )-norepinephrine hydrochloride,
( )-epinephrine, tyramine hydrochloride,
DL-octopamine hydrochloride, 5-hydroxytryptamine
hydrochloride, (±)-isoproterenol hydrochloride, phentolamine
hydrochloride, and DL-propranolol were from
Sigma (Poole, Dorset, UK); R(+)-SKF-38393
[R(+)-1-phenyl-2,3,4,5-tetrahydro-(1H)-3-benzazepine-7,8-diol],
quineloranedihydrochloride, ( )-quinpirole hydrochloride,
PD-128,907
[(+)-(4aR,10bR)-3,4,4a,10b-tetrahydro4-propyl-2H,5H-(1)benzopyrano-(4,3-b)-1,4-oxazin-9-ol-hydrochloride],
cis-(Z)-flupenthixol dihydrochloride,
R(+)SCH-23390
[R(+)-7chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzepine
hydrochloride], S( )-sulpiride, spiperone hydrochloride,
(+)-butaclamol hydrochloride, S( )-eticlopride hydrochloride,
domperidone, (+)-bromocriptine methanesulfonate, (±)-6-chloro-APB
[(±)-6-chloro-7,8-dihydroxy-3-allyl-1-phenyl-2,3,4,5-tetrahydro-1H-3benzazepine
hydrobromide], R(+)-6-bromo-APB
(R(+)-6-bromo7,
8-dihydroxy-3-allyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine
hydro-bromide), (±)-6-chloro-PB
[(±)-6-chloro-7,8-dihydroxy-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine
hydrobromide], and (±)-PPHT
[(±)-2-(N-phenylethyl-N-propyl)amino-5-hydroxytetralin
hydrochloride] were from Research Biochemicals (Natick, MA).
RESULTS
Cloning of a novel Drosophila dopamine receptor
When we began these studies, cDNAs encoding several
G-protein-coupled receptors had been cloned from Drosophila,
including a muscarinic acetylcholine receptor (Onai et al., 1989 ),
several serotonergic receptors (Witz et al., 1990 ; Saudou et al.,
1992 ), and an adrenergic receptor homolog (OctyR99AB) (Arakawa et al.,
1990 ). However, there were no representatives of the dopaminergic
receptor family cloned from invertebrates even though the role of
dopamine was well established in the invertebrate nervous system.
To expand the group of cloned G-protein-coupled receptors from
Drosophila, we used reduced stringency PCR with primers from
regions conserved in all biogenic amine receptors. To facilitate the
identification of those PCR products that were likely to encode new
receptors, we amplified across a region including cytoplasmic loop 3 (between transmembrane domains V and VI). This nonconserved loop varies
greatly in length among different G-protein-coupled receptors (Probst
et al., 1992 ), so different size amplification products are expected
and would serve to distinguish fragments encoding new receptors from
those encoding previously cloned ones. In addition, the amplified
region also includes the conserved transmembrane domains IV, V, and
part of VI. Because these domains are easily recognized, this allows
rapid identification of these amplified fragments encoding
G-protein-coupled receptors.
PCR primers were chosen by aligning the amino acid sequence of the
Drosophila octopamine/tyramine receptor (OctyR99AB) (Arakawa
et al., 1990 ) with sequences of a subset of previously cloned
vertebrate biogenic amine receptors. A forward primer sequence (OPS3)
was selected from the region of the Drosophila
octopamine/tyramine receptor cDNA that encodes the cytoplasmic end of
the third transmembrane domain (amino acids IALDRYW). This included the
DRY sequence that is found in almost all cloned G-protein-coupled
receptors. A reverse primer sequence (OPS4) was from the conserved
middle region of transmembrane domain VI of OctyR99AB cDNA
(encoding amino acids FVICWLP). Genomic DNA was used as the template to
avoid assumptions concerning the time- and tissue-specific expression
of receptors.
Using the OPS3 and OPS4 PCR primers, five fragments (1.7, 1.0, 0.68, 0.60, and 0.46 kb) were amplified from Drosophila genomic
DNA. Direct sequencing of the PCR products revealed that the 1.7 kb
fragment is the genomic equivalent of OctyR99AB with a 0.7 kb intron in the region encoding cytoplasmic loop 3. The 0.68 kb
fragment had high sequence similarity to OctyR99AB and other
G-protein-coupled receptors in the transmembrane domains, but was
different in cytoplasmic loop 3. These data suggested that this 0.68 kb
fragment encodes part of a novel G-protein-coupled receptor gene in
Drosophila. Using this 0.68 kb PCR fragment as a probe, four
overlapping cDNA clones were isolated from an adult head cDNA library.
The clone with the longest insert (4 kb) was completely sequenced and
has been designated DopR99B.
Structural features of the DopR99B cDNA sequence
The 4 kb cDNA insert contains an open reading frame encoding 538 amino acids with a predicted molecular mass of 59.5 kDa (Fig.
1A). The open reading frame is defined by the
first in-frame ATG that is preceded by an in-frame stop codon. Although
the flanking sequence preceding this ATG ( 4 to 1, TGCA) does not
match well with the Drosophila consensus sequence for a
translation start site [C/A A A A/C (Cavener, 1987 )], a potential
ribosome-binding site around this ATG was identified (Fig.
1A). A comparison of the cDNA sequence in the regions used
for the original PCR primers shows that in the forward primer region
there are 4 base mismatches concentrated in the first 7 nucleotides
from the 5 end. The reverse primer had only 1 base mismatch in the
fourth base position from the 3 end. The robust amplification of the
0.68 kb product indicates that these mismatches were all tolerated at
the initial annealing temperature of 33°C.
Fig. 1.
The DopR99B sequence. A,
Nucleotide sequence and deduced amino acid sequence of the
Drosophila dopamine receptor DopR99B. In-frame stop codons
are indicated by asterisks. The sequence of a potential
ribosome binding site is boxed. The seven transmembrane
domains are underlined and numbered. Potential
PKC phosphorylation sites are indicated by . Potential
N-glycosylation sites are marked by . B, Hydrophobicity
plot of the deduced DopR99B amino acid sequence. Regions
above the line are hydrophobic. Transmembrane domains are
numbered. The hydropathy plot was done using the method of
Kyte and Doolittle (1982) and the Geneworks software (Intelligenetics).
The Genbank accession number for DopR99B is U34383[GenBank].
[View Larger Version of this Image (75K GIF file)]
Sequence comparison with other G-protein-coupled receptors
The deduced amino acid sequence for DopR99B shows many standard
characteristics of the G-protein-coupled receptor gene family. The
hydropathy plot (Fig. 1B) reveals the 7 transmembrane
domains diagnostic of all members of this group of receptors (Probst et
al., 1992 ). At the cytoplasmic end of transmembrane domain III is the
highly conserved DRY sequence. This amino acid triplet is thought to be
important in G-protein coupling (Dixon et al., 1987 ; Fraser et al.,
1988 ). Single cysteine residues (at 182 and 261) in extracellular loops
1 and 2, respectively, are also conserved. These residues form a
disulfide bond that stabilizes the functional receptor structure (Dixon
et al., 1987 ; Karnik et al., 1988 ; Fraser, 1989 ). Two aspartate
residues in TM II and TM III that are conserved in all catecholamine
receptors are also conserved in DopR99B (D154 and D189). These two
aspartates are thought to play a direct role in binding the amine
groups on catecholamines (Strader et al., 1988 ). The three serine
residues in TM V that are postulated to interact with the catecholamine
ring hydroxyl groups (Strader et al., 1989 ; Pollock et al., 1992 ) are
also conserved in DopR99B (S273, S274, S277). Thus, this new receptor
has appropriately placed amino acid side chains for binding
catecholamines.
There are other, more general structural motifs that are found in this
Drosophila receptor as well as in other G-protein-coupled
receptors. For example, mammalian dopamine receptors typically have one
to four N-linked glycosylation sites in their extracellular domains
(Jackson and Westlind-Danielsson, 1994 ). This Drosophila
receptor has four potential N-linked glycosylation sites in the amino
terminus (positions 5, 31, 47, and 68). This region is likely to be an
extracellular domain. All G-protein-coupled receptors have protein
kinase C sites in cytoplasmic loop 3 (between TM V and VI) and in the
C-terminal tail, but the exact positions of these sites are not
strictly conserved. This newly cloned Drosophila receptor
has eight potential protein kinase C phosphorylation sites in
cytoplasmic loop 2 (position 222), cytoplasmic loop 3 (positions 302, 320, 328, and 405), and in the C terminus (positions 504, 509, and
514). Finally, many G-protein-coupled receptors undergo a
post-translational palmitoylation at a conserved cysteine residue in
the C-terminal tail (Gingrich and Caron, 1993 ). This modification
serves to anchor the tail to the internal face of the plasma membrane,
creating a fourth cytoplasmic loop. The Drosophila receptor
has several cysteines that could serve this function (at 490, 492, 493, 517, 521, and 534). The conserved structural motifs, along with the
fact that this gene product has, overall, a high sequence similarity
with other G-protein-coupled receptors, suggest that it encodes a novel
G-protein-coupled receptor in Drosophila.
Comparison of the predicted hydrophobic core region of the DopR99B
deduced amino acid sequence revealed significant sequence similarity
with vertebrate and invertebrate dopamine receptors (41-47%
identity), serotonin receptors (40-47% identity), 1- and
-adrenergic receptors (46-48% identity), as well as the
Drosophila octopamine/tyramine receptor from which the
primers were derived (47% identity). Detailed sequence comparison of
either the hydrophobic core region or the full-length deduced amino
acid sequence showed that the DopR99B receptor clearly belonged to the
biogenic amine class of receptors, but it was not possible to predict
its receptor type based on sequence comparisons alone. The dendrogram
in Figure 2 shows that DopR99B did not fall clearly
within one of the biogenic amine receptor groups, although a previously
described (Gotzes et al., 1994 ; Sugamori et al., 1995 )
Drosophila dopamine receptor (DopR35EF) consistently grouped
with the vertebrate D1-like dopamine receptors. To define the DopR99B
receptor-type pharmacologically, we expressed it in Xenopus
oocytes.
Fig. 2.
Structural relationship of DopR99B with other
G-protein-coupled receptors. Sequence alignment was done with the
PILEUP program of the Wisconsin Genetic Computer Group (GCG) software
(Devereux et al., 1984 ) using the hydrophobic cores of each receptor
listed. The hydrophobic core was defined as the region between and
including transmembrane domains I and V plus the region between and
including transmembrane domains VI and VII. The lengths of the
horizontal lines are inversely proportional to the percentages of
sequence similarity between receptors or groups of receptors. In the
receptor names listed, the first three to four letters refer to the
general receptor type: Adr, adrenergic; Dop,
dopamine; 5ht, serotonin; Octy,
octopamine/tyramine. The next letters in the name refer to the species:
dro, Drosophila; hum, human;
rat, rat; xen, Xenopus. The
exceptions to this nomenclature are three Drosophila
receptors (DopR35EF, DopR99B,
OctyR99AB). For these, the type name is followed by
R (receptor) and then the salivary gland chromosome map
position. Pathway refers to the second-messenger coupling reported in
the literature for each receptor: PLC, phospholipase C;
AC, adenylyl cyclase. An upward arrow
indicates stimulation of the indicated second-messenger system, and a
downward arrow indicates inhibition.
Accession # refers to the Genbank database locator
number.
[View Larger Version of this Image (48K GIF file)]
Expression studies in Xenopus oocytes
Xenopus oocytes translate exogenous mRNAs encoding
neurotransmitter receptors and incorporate the receptor proteins into
their cell membranes (Sumikawa et al., 1981 ; Barnard et al., 1982 ). To
define which ligands activate the DopR99B receptor, we expressed its
cRNA in Xenopus oocytes and tested the ability of a range of
biogenic amines to initiate responses. The application of dopamine
initiated transient inward current responses in injected oocytes (Fig.
3A). Uninjected, control oocytes showed no
responses (data not shown). The responses have a reversal potential of
21.7 ± 2.9 mV (n = 3) estimated from current-voltage
(I-V) plots, consistent with their
mediation via the activation of the endogenous, inward
calcium-dependent chloride current of the oocyte. This inward current
is presumably generated by the same mechanism originally reported by
Masu et al. (1987) after stimulation of another G-protein-coupled
receptor (the bovine substance-K receptor) expressed in oocytes; i.e.,
receptor-mediated activation of phospholipase C increases PI hydrolysis
and stimulates release of intracellular calcium which, in turn,
activates the endogenous calcium-dependent chloride current of the
oocyte.
Fig. 3.
Inward current response after agonist stimulation
mediated by the DopR99B receptor expressed in Xenopus
oocytes. Two minute pulses of agonists were given to Xenopus
oocytes 3 d after the injection of DopR99B cRNA. A, Typical
responses of a single oocyte to various concentrations of dopamine.
B, Dose-response curves for dopamine, ( )-norepinephrine,
( )-epinephrine, and tyramine. The results (from at least 6 oocytes)
are expressed as the mean peak inward current ± SE initiated by each
amine.
[View Larger Version of this Image (16K GIF file)]
Dose-response curves (Fig. 3B) indicate that the threshold
response to dopamine occurred in the region of 1 nM, whereas the maximal response occurred at 1 µM. Exposure of injected oocytes to
concentrations of dopamine >1 µM consistently
produced smaller responses (Fig. 3A,B). Figure
3B also shows that the catecholamines norepinephrine and
epinephrine induce inward currents in injected oocytes. However, these
catecholamines are less effective than dopamine. The injected oocytes
also showed inward currents when exposed to tyramine (Fig.
3B), but much higher concentrations were required and the
average current response was smaller at the maximum concentration
tested (100 µM) than for the other amines.
Oocytes showed no response to either
DL-octopamine or 5-hydroxytryptamine at
concentrations up to 100 µM. Taken together,
these results suggest that the DopR99B cDNA clone encodes a
Drosophila dopamine receptor.
To determine whether this Drosophila dopamine receptor falls
into the D1-like or D2-like pharmacological category, the ability of
antagonists (10 µM) to block the responses to 1 µM dopamine in oocytes expressing the DopR99B
receptor was determined (Table 1A). The
rank order potency of the dopaminergic antagonists tested was:
flupenthixol > R(+)-SCH-23390 > S( )-sulpiride > spiperone > (+)butaclamol > S( )eticlopride = domperidone. The D1-like receptor blockers were, in general, more
effective than those with D2-like receptor specificity. The
-adrenergic blocker phentolamine and the -adrenergic blocker
DL-propranolol were poor blockers, falling within
the same range as the weaker D2-like receptor blockers. Thus, in terms
of antagonist responses, the DopR99B receptor would be classed with the
D1-like dopamine receptor group.
When a range of synthetic dopamine agonists specific for various
vertebrate receptor subtypes was tested (Table 1B), both D1-like and
D2-like agonists mimicked the dopamine responses in oocytes expressing
the DopR99B receptor. However, with the exception of the relatively
ineffective D1-like agonist SKF-38393, the D1-like agonists were more
effective than the D2-like agonists. Thus, these pharmacological
studies of the inward currents generated by dopamine application
indicate that the receptor encoded by the DopR99B cDNA, again, has a
pharmacological profile closer to D1-like dopamine receptors.
Another way to categorize receptors is in terms of the
second-messenger systems to which they couple. Therefore, we have also
investigated second-messenger coupling for the Drosophila
DopR99B receptor. This receptor, when expressed in Xenopus
oocytes, appears to couple to multiple second-messenger systems. As
described above, receptor activation initiates a calcium response. In
addition, dopamine activation of the DopR99B receptor also increases
cAMP levels in oocytes (Fig. 4). This response is
mimicked by the application of epinephrine and norepinephrine to
expressing oocytes, but not by phenylethylamine, 5-hydroxytryptamine,
DL-octopamine, phenylethanolamine, or tyramine
when these agonists were tested at a concentration of 10 µM (Table 2).
Stimulation of cAMP levels is characteristic of second-messenger
coupling by D1-like receptors, whereas inhibition of cAMP synthesis is
characteristic of D2-like receptors (see Fig. 2). Therefore, in this
respect, DopR99B also resembles D1-like receptors. We have named this
receptor DopR99B (for amine eceptor from
Drosophila mapping to to distinguish it from
another Drosophila D1-like dopamine receptor (which we
designate as DopR35EF) described previously (Gotzes et al., 1994 ;
Sugamori et al., 1995 ).
Fig. 4.
Dose-response curves for increase in cAMP levels
in oocytes expressing DopR99B. Five days after injection with
Drosophila DopR99B receptor cRNA, injected and uninjected
(control) oocytes were treated with the indicated dopamine
concentrations for 30 min in the presence of 100 µM IBMX after preincubation for 30 min in 100 µM IBMX. The results are expressed as the mean
oocyte cAMP level (pmol/oocyte) ± SE (n = 5 oocytes).
B, Basal levels.
[View Larger Version of this Image (21K GIF file)]
Table 2.
Effects of biogenic amines on cAMP levels in
Xenopus oocytes expressing the Drosophila
DopR99B
receptor
| Agonist |
DopR99B
cRNA-injected |
Uninjected |
|
| Basal |
0.82
± 0.05 |
(n
= 9) |
0.87 ± 0.08 |
(n
= 10) |
| Dopamine |
1.46 ± 0.10 |
(n
= 10) |
0.77 ± 0.09 |
(n
= 10) |
( )-Epinephrine |
1.28 ± 0.15 |
(n
= 8) |
0.76 ± 0.08 |
(n
= 10) |
( )-Norepinephrine |
1.15 ± 0.06 |
(n
= 8) |
0.71 ± 0.07 |
(n
= 9) |
| Phenylethylamine |
0.86 ± 0.09 |
(n
= 10) |
0.69 ± 0.10 |
(n
= 10) |
| 5-Hydroxytryptamine |
0.83 ± 0.09 |
(n
= 5) |
0.96 ± 0.05 |
(n
= 5) |
| DL-Octopamine |
0.78
± 0.07 |
(n = 10) |
0.69
± 0.08 |
(n = 10) |
| Phenylethanolamine |
0.76
± 0.06 |
(n = 10) |
0.89
± 0.06 |
(n = 10) |
| Tyramine |
0.71
± 0.08 |
(n = 10) |
0.71
± 0.09 |
(n = 9) |
|
|
cAMP levels were measured 5 d after cRNA injection. Before
measurement, oocytes were preincubated for 30 min in 100 µM IBMX and then exposed to 10 µM biogenic
amine for 30 min in the presence of 100 µM IBMX. The
results are expressed as the mean oocyte cAMP level (pmol/oocyte) ± SE.
|
|
mRNA distribution and chromosomal localization of DopR99B
To determine the distribution of the DopR99B transcript in
different body parts, we did Northern blot analysis with
poly(A)+ RNA isolated from heads, bodies, and
appendages (mostly legs and antennae). The blot was probed with the
original 0.68 kb PCR fragment that contains the nonconserved
cytoplasmic loop 3. As shown in Figure 5, a single band
of 5.5 kb mRNA was detected predominantly in heads with a lighter
signal in appendages. No expression was detected in bodies. This
distribution is consistent with a role for these dopamine receptors in
the central and peripheral nervous systems. The absence of major
expression in bodies suggests that this receptor is not highly
expressed in flight muscle.
Fig. 5.
Northern blot analysis of DopR99B. A Northern blot
of poly(A)+ RNA isolated from heads
(H), bodies (B), and legs/antennae
(L/A) was probed with the
32P-labeled 0.68 kb PCR fragment. To control for
mRNA recovery, the blot was reprobed with ribosomal protein cDNA
(rp49), which is expressed throughout the organism
(O'Connell and Robash, 1984).
[View Larger Version of this Image (55K GIF file)]
To determine where DopR99B maps in the Drosophila genome,
the 0.68 kb PCR fragment was biotinylated and hybridized to
Drosophila salivary gland polytene chromosomes (Fig.
6). The probe hybridized to a single location on the
right arm of chromosome 3 at 99B3-5. This location is close to, but
distinct from, the Drosophila octopamine/tyramine receptor
gene that maps to 99A10-B1 (Arakawa et al., 1990 ). The structural
relationship between DopR99B and this Drosophila
octopamine/tyramine receptor (OctyR99AB, Fig. 2) suggests that these
receptors may be related by a local gene duplication followed by
independent evolution.
Fig. 6.
Chromosome localization of DopR99B. In
situ hybridization to Drosophila salivary gland
polytene chromosomes using the biotinylated 0.68 kb PCR fragment. The
arrow indicates the site of hybridization at 99B3-5 on the
right arm of chromosome 3.
[View Larger Version of this Image (155K GIF file)]
DISCUSSION
The present study establishes, for the first time, the presence of
multiple dopamine receptor types in insects. These receptors, which we
have designated as DopR35EF [cloned in previous studies (Gotzes et
al., 1994 ; Sugamori et al., 1995 )] and DopR99B (present study), are
similar in that both stimulate adenylyl cyclase when activated.
Although both resemble the vertebrate D1-like dopamine receptor class,
there are differences. For example, vertebrate D1-like receptors
generally have long C-terminal tails ranging from 113 to 117 amino
acids in length, whereas D2-like receptors have short tails in the
range of 16-18 amino acids (Jackson and Westlind-Danielsson, 1994 ).
The two Drosophila dopamine receptors have C-terminal tails
that are intermediate in length (62 amino acids for DopR35EF and 64 for
DopR99B).
Although the two Drosophila receptors resemble each other
with respect to C-terminal tail length, in overall sequence similarity
DopR35EF is less similar to DopR99B (43% sequence identity in the
hydrophobic core region) than it is to the vertebrate D1-like class of
dopamine receptors (46-48% identity). When dendrograms are
constructed based on structural relatedness (e.g., Fig. 2), DopR35EF
consistently falls into a group with vertebrate D1-like dopamine
receptors regardless of whether the entire sequence or only the
hydrophobic core is used for comparison. DopR99B does not group with
the D1-like receptors, but instead shows almost equal sequence identity
to a number of different biogenic amine receptor groups. This suggests
that the dopamine receptor subtypes in Drosophila did not
arise from each other but, rather, may represent convergent evolution
from different precursors.
Although the Drosophila DopR99B receptor does not fall into
the D1-like structural group, it does show pharmacological properties
similar to D1-like receptors (Jackson and Westlind-Danielsson, 1994 ;
Seeman and VanTol, 1994 ) when expressed in Xenopus oocytes.
Agonists and antagonists with D1-like selectivity are, in general, more
effective than those with D2-like receptor selectivity. A comparison of
our pharmacological data with the limited information on DopR35EF
(Gotzes et al., 1994 ; Sugamori et al., 1995 ) suggests that these two
Drosophila dopamine receptors differ in their
pharmacological specificity. For example, the dopamine receptor agonist
SKF-38393 is 30% as effective as dopamine on DopR35EF (Gotzes et al.,
1994 ), but is almost inactive on DopR99B. With respect to antagonists,
SCH-23390 is less effective than flupenthixol and butaclamol on
DopR35EF, but is intermediate between flupenthixol and butaclamol on
DopR99B.
Agonist stimulation of DopR99B activates adenylyl cyclase to increase
cAMP levels and also generates a calcium signal presumably through
stimulation of phospholipase C. Both of these responses have been
reported for vertebrate D1-like receptors (Figure 2) (Mahan et al.,
1990 ). In contrast, vertebrate D2-like receptors usually show opposite
effects on these second-messenger systems because they inhibit cAMP
synthesis (Jackson and Westlind-Danielsson, 1994 ) and are associated
with a decline in intracellular Ca2+ levels.
Structural features, presumably in the second and third intracellular
loops and in the C terminus, must underlie the ability of this
Drosophila dopamine receptor to couple to two different
second-messenger systems. Because the DopR99B receptor is structurally
distinct from classical vertebrate dopamine receptors, the use of
chimeras and the application of in vitro mutagenesis may
produce novel insights into how dopamine interacts with this receptor
and how this interaction results in the stimulation of different
systems.
Our results leave unanswered the question of whether
Drosophila has a D2-like dopamine receptor homolog. Dopamine
and the enzymes involved in its synthesis are widely distributed in the
insect nervous system (Klemm, 1976 ; Evans, 1980 ; Livingstone and
Tempel, 1983 ; Brown and Nestler, 1985 ; Budnik and White, 1987 ).
Previous studies demonstrating the presence of dopamine-sensitive
adenylyl cyclases in insect nervous tissue (Nathanson and Greengard,
1973 ; Bodnaryk, 1979 ; Uzzan and Dudai, 1982 ; Orr et al., 1987 ) and
salivary glands (House and Ginsborg, 1979 ; Lafon-Cazal and Bockaert,
1984 ; Evans and Green, 1990a ,b; Ali and Orchard, 1994 ), together with
radioligand binding studies on cockroach brains (Notman and Downer,
1987 ), suggested the presence of D1-like dopamine receptors in insects.
These D1-like receptor responses could correspond to either the DopR99B
receptor described in this report or the DopR35EF receptor (Gotzes et
al., 1994 ; Sugamori et al., 1995 ) or both. There are no reports yet of
D2-like dopamine receptor activity in insects, but this is not a well
studied area. None of the other PCR amplification products found in our
search for new receptor types in Drosophila encode
additional dopamine receptors, although at least one product (the 0.60 kb fragment) represents another G-protein-coupled receptor (G. Feng, R. Venard, and L. M. Hall, unpublished results). Thus, a modification of
our cloning strategy will be necessary to search for additional
dopamine receptor cDNAs in Drosophila.
In insects, the dense innervation of the mushroom bodies by
dopamine-immunoreactive neurons (Budnik and White, 1988 ; Schafer and
Rehder, 1989 : Nassel and Elkes, 1992 ), together with studies on
behavioral mutants of Drosophila (Tempel et al., 1984 ;
Buchner, 1991 ), has suggested roles for dopamine in both memory and
learning, and in neuronal development. Analysis of the
Drosophila mutant Ddc, which is deficient in dopa
decarboxylase (therefore lacking dopamine and serotonin), reveals
learning deficits (Tempel et al., 1984 ) and an abnormal pattern of
neuronal arborization (Budnik et al., 1989 ) that can be partially
rescued by feeding flies dopamine, but not serotonin. These studies
suggest possible roles for cloned dopamine receptors from
Drosophila.
Our work, in conjunction with that of others (Gotzes et al., 1994 ;
Sugamori et al., 1995 ), establishes that there are at least two
genetically distinct dopamine receptors in Drosophila that
both stimulate adenylyl cyclase when activated. The DopR99B receptor is
also capable of generating a calcium signal. Are either of these
receptors involved in the signal transduction role that dopamine plays
in learning and memory? Because the DopR35EF receptors are
preferentially expressed in the optic lobes (Gotzes et al., 1994 ), they
are unlikely to play a role in learning and memory that involves
mushroom body-mediated functions. In contrast, DopR99B is good
candidate for dopaminergic modulation of learning and memory because
this receptor is expressed preferentially in mushroom bodies (K. Han
and R. Davis, personal communication). Genetic studies aimed at
identifying dopamine receptor mutations in Drosophila will
be useful in defining their physiological and behavioral roles.
FOOTNOTES
Received Nov. 30, 1995; revised March 26, 1996; accepted April 2, 1996.
This work was supported by National Institutes of Health Jacob Javits
Neuroscience Investigator Award NS16204 to L.M.H. and NATO
Collaborative Research Grant 900709 to P.D.E. and L.M.H. G.F. was
supported, in part, by a predoctoral fellowship from the Pharmaceutical
Manufacturers Association Foundation. V.R. was supported, in part, by a
grant from the Isaac Newton Trust. C.T.K. was supported by National
Institutes of Health training Grant GM07145 and by a Howard Hughes
Predoctoral Fellowship. We thank Jane Pursey-Lee for outstanding
technical assistance in the initial stages of cloning and sequencing
the 0.68 PCR fragment, and Dr. Todd R. Jackman for helpful
comments.
Correspondence should be addressed to Linda M. Hall, Department of
Biochemical Pharmacology, State University of New York at Buffalo, 329 Hochstetter Hall, North Campus, Buffalo, NY 14260-1200 (please note
that Dr. Hall is on sabbatical until 9/30/96. Her sabbatical address
should be used for correspondence concerning this manuscript during
that time).
Dr. Hall's sabbatical address (9/95 to 9/30/96): Department of
Microbiology and Molecular Genetics, Medical Sciences I Bldg C, Room
266, University of California-Irvine, Irvine, CA 92717-4025.
Dr. Feng's current address: Department of Anatomy and Neurobiology,
Washington University School of Medicine, 660 South Euclid Avenue, St.
Louis, MO 63110.
REFERENCES
-
Ali DW,
Orchard I
(1994)
Characterization of dopamine and
serotonin receptors on the salivary glands of the locust, Locusta
migratoria.
Biog Amines
10:195-212.
-
Arakawa S,
Gocayne JD,
McCombie WR,
Urquhart DA,
Hall LM,
Fraser CM,
Venter JC
(1990)
Cloning, localization, and permanent
expression of a Drosophila octopamine receptor.
Neuron
4:343-354.
[Web of Science][Medline]
-
Barnard EA,
Miledi R,
Sumikawa K
(1982)
Translation of
exogenous messenger RNA coding for nicotinic acetylcholine receptors
produces functional receptors in Xenopus oocytes.
Proc R Soc Lond [Biol]
215:241-246.
[Medline]
-
Bodnaryk RP
(1979)
Identification of specific dopamine- and
octopamine-sensitive adenylate cyclases in the brain of Mamestra
configurata Wlk.
Insect Biochem
9:155-162.
-
Brown CS,
Nestler C
(1985)
Catecholamines and
indolalkylamines.
In: Comprehensive insect physiology, biochemistry and pharmacology,
(Kerkut, GA,
Gilbert, LI,
eds)
, Vol 11, p. 436. Oxford: Pergamon.
-
Budnik V,
White K
(1987)
Genetic dissection of dopamine and
serotonin synthesis in the nervous system of Drosophila
melanogaster.
J Neurogenet
4:309-314.
[Web of Science][Medline]
-
Budnik V,
White K
(1988)
Catecholamine-containing neurons in
Drosophila melanogaster distribution and development.
J Comp Neurol
268:400-413.
[Web of Science][Medline]
-
Budnik V,
Wu C-F,
White K
(1989)
Altered branching of
serotonin-containing neurons in Drosophila mutants unable to
synthesize serotonin and dopamine.
J Neurosci
9:2866-2877.
[Abstract]
-
Buchner E
(1991)
Genes expressed in the adult brain of
Drosophila and effects of their mutations on behavior: a
survey of transmitter- and second messenger-related genes.
J Neurogenet
7:153-192.
[Web of Science][Medline]
-
Cavener DR
(1987)
Comparison of the consensus sequence
flanking translational start sites in Drosophila and
vertebrates.
Nucleic Acids Res
15:1353-1361.
[Abstract/Free Full Text]
-
Civelli O,
Bunzow JR,
Grandy DK
(1993)
Molecular diversity of
the dopamine receptors.
Annu Rev Pharmacol Toxicol
33:281-307.
[Web of Science][Medline]
-
Devereux J,
Haeberli P,
Smithies O
(1984)
A comprehensive set
of sequence analysis programs for the VAX.
Nucleic Acids Res
12:387-395.
-
Dixon RAF,
Sigal IS,
Candelore MR,
Register RB,
Scattergood W,
Rands E,
Strader CD
(1987)
Structural features required for ligand
binding to the
-adrenergic receptor.
EMBO J
6:3269-3275.
[Web of Science][Medline]
-
Engels WR,
Preston CR,
Thompson P,
Eggleston WB
(1985)
In
situ hybridization to Drosophila salivary chromosomes with
biotinylated DNA probes and alkaline phosphatase.
Focus
8:6-8.
-
Evans PD
(1980)
Biogenic amines in the insect nervous system.
Adv Insect Physiol
15:317-473.
-
Evans AM,
Green KL
(1990a)
The action of dopamine receptor
antagonists on the secretory response of the cockroach salivary gland
in vitro.
Comp Biochem Physiol
97C:283-286.
-
Evans AM,
Green KL
(1990b)
Characterization of the dopamine
receptor mediating the hyperpolarization of cockroach salivary gland
acinar cells in vitro.
Br J Pharmacol
101:103-108.
[Web of Science][Medline]
-
Feng G,
Deák P,
Kasbekar DP,
Gil DW,
Hall LM
(1995)
Cytogenetic and molecular localization of tipE: a
gene affecting sodium channels in Drosophila melanogaster.
Genetics
139:1679-1688.
[Abstract]
-
Fraser CM
(1989)
Site-directed mutagenesis of
-adrenergic
receptors: identification of conserved cysteine residues that
independently affect ligand binding and receptor activation.
J Biol Chem
264:9266-9270.
[Abstract/Free Full Text]
-
Fraser CM,
Chung FZ,
Wang CD,
Venter JC
(1988)
Site-directed
mutagenesis of human
-adrenergic receptors: substitution of aspartic
acid-130 by asparagine produces a receptor with high-affinity agonist
binding that is uncoupled from adenylate cyclase.
Proc Natl Acad Sci USA
85:5478-5482.
[Abstract/Free Full Text]
-
Gingrich JA,
Caron MG
(1993)
Recent advances in the molecular
biology of dopamine receptors.
Annu Rev Neurosci
16:299-321.
[Web of Science][Medline]
-
Goldstein M,
Deutch AY
(1992)
Dopaminergic mechanisms in the
pathogenesis of schizophrenia.
FASEB J
6:2413-2421.
[Abstract]
-
Gotzes F,
Balfanz S,
Baumann A
(1994)
Primary structure and
functional characterization of a Drosophila dopamine
receptor with high homology to human D1/5
receptors.
Receptors Channels
2:131-141.
[Web of Science][Medline]
-
Hall H
(1994)
Dopamine receptors: radioligands for
pharmacological and biochemical characterization.
In: Dopamine receptors and transporters
(Niznik, HB,
eds)
, p. 3. New York: Marcel
Dekker.
-
Henikoff S
(1987)
Unidirectional digestion with exonuclease
III in DNA sequence analysis.
Methods Enzymol
155:156-165.
[Web of Science][Medline]
-
House CR,
Ginsborg BL
(1979)
Pharmacology of cockroach
salivary secretion.
Comp Biochem Physiol
63C:1-6.
-
Itoh N,
Salvaterra P,
Itakura K
(1985)
Construction of an
adult Drosophila head cDNA expression library with lambda
gt11.
Dros Inform Serv
61:89.
-
Jackson DM,
Westlind-Danielsson A
(1994)
Dopamine receptors:
molecular biology, biochemistry and behavioural aspects.
J Pharmacol Exp Ther
64:291-369.
-
Jowett T
(1986)
Preparation of nucleic acids.
In: Drosophila: a practical approach
(Roberts, DB,
eds)
. Washington, DC: IRL.
-
Karnik SS,
Sakmar TP,
Chen HB,
Khorana HG
(1988)
Cysteine
residues 110 and 187 are essential for the formation of the correct
structure in bovine rhodopsin.
Proc Natl Acad Sci USA
85:8459-8463.
[Abstract/Free Full Text]
-
Kebabian JW,
Calne DB
(1979)
Multiple receptors for dopamine.
Nature
277:93-96.
[Medline]
-
Klemm N
(1976)
Histochemistry of putative transmitter
substances in the insect brain.
Prog Neurobiol
7:99-169.
[Medline]
-
Kyte J,
Doolittle RF
(1982)
A simple method for displaying
the hydropathic character of a protein.
J Mol Biol
157:105-132.
[Web of Science][Medline]
-
Lafon-Cazal M,
Bockaert J
(1984)
Pharmacological
characterization of dopamine-sensitive adenylate cyclase in the
salivary glands of Locusta migratoria L.
Insect Biochem
14:541-545.
-
Levinson DF
(1991)
Pharmacological treatment of
schizophrenia.
Clin Ther
13:326-352.
[Web of Science][Medline]
-
Livingstone MS,
Tempel BL
(1983)
Genetic dissection of
monoamine neurotransmitter synthesis in Drosophila.
Nature
303:67-70.
[Medline]
-
Mahan LC,
Burch RM,
Monsma FJ Jr,
Sibley DR
(1990)
Expression
of striatal D1 dopamine receptors coupled to
inositol phosphate production and Ca2+
mobilization in Xenopus oocytes.
Proc Natl Acad Sci USA
87:2196-2200.
[Abstract/Free Full Text]
-
Masu Y,
Nakayama K,
Tamaki H,
Harada Y,
Kuno M,
Nakanishi S
(1987)
cDNA cloning of bovine substance-K receptor through
oocyte expression system.
Nature
329:836-838.
[Medline]
-
Nassel DR,
Elkes K
(1992)
Aminergic neurons in the brain of
blowflies and Drosophila: dopamine- and tyrosine
hydroxylase-immunoreactive neurons and their relationship with putative
histaminergic neurons.
Cell Tissue Res
267:147-167.
[Web of Science][Medline]
-
Nathanson JA,
Greengard P
(1973)
Octopamine-sensitive
adenylate cyclase: evidence for a biological role of octopamine in
nervous tissue.
Science
180:308-310.
[Abstract/Free Full Text]
-
Notman HJ,
Downer RGH
(1987)
Binding of
[3H]pifluthixol, a dopamine antagonist, in the
brain of the American cockroach, Periplaneta americana.
Insect Biochem
17:587-590.
-
O'Connell P,
Rosbash M
(1984)
Sequence, structure, and codon
preference of the Drosophila ribosomal protein 49 gene.
Nucleic Acids Res
12:5495-5513.
[Abstract/Free Full Text]
-
Onai T,
FitzGerald MG,
Arakawa S,
Gocayne JD,
Urquhart DA,
Hall LM,
Fraser CM,
McCombie WR,
Venter JC
(1989)
Cloning, sequence
analysis and chromosome localization of a Drosophila
muscarinic acetylcholine receptor.
FEBS Lett
255:219-225.
[Web of Science][Medline]
-
Orr GL,
Gole JWD,
Notman HJ,
Downer RGH
(1987)
Pharmacological characterization of the
dopamine-sensitive adenylate cyclase in cockroach brain: evidence for a
distinct dopamine receptor.
Life Sci
41:2705-2715.
[Web of Science][Medline]
-
Pollock NJ,
Manelli AM,
Hutchins CW,
Steffey ME,
MacKenzie RG,
Frail DE
(1992)
Serine mutations in transmembrane-V of the dopamine
D1-receptor affect ligand interactions and receptor activation.
J Biol Chem
267:17780-17786.
[Abstract/Free Full Text]
-
Probst WC,
Snyder LA,
Schuster DI,
Brosius J,
Sealfon SC
(1992)
Sequence alignment of the G-protein coupled
receptor superfamily.
DNA Cell Biol
11:1-20.
[Web of Science][Medline]
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular cloning:
a laboratory manual, 2nd ed.
.
-
Saudou F,
Boschert U,
Amlaiky N,
Plassat J-L,
Hen R
(1992)
A
family of Drosophila serotonin receptors with distinct
intracellular signalling properties and expression patterns.
EMBO J
11:7-17.
[Web of Science][Medline]
-
Schafer S,
Rehder V
(1989)
Dopamine-like immunoreactivity in
the brain and suboesophageal ganglion of the honey bee.
J Comp Neurol
280:43-58.
[Web of Science][Medline]
-
Schmidt-Nielsen BK,
Gepner JI,
Teng NNH,
Hall LM
(1977)
Characterization of an
-bungarotoxin binding
component from Drosophila melanogaster.
J Neurochem
29:1013-1029.
[Web of Science][Medline]
-
Seeman P,
VanTol HHM
(1994)
Dopamine receptor pharmacology.
Trends Pharmacol Sci
15:264-270.
[Medline]
-
Seeman P,
Ulpian C,
Bergeron C,
Riederer P,
Jellinger K,
Gabriel E,
Reynolds GP,
Tourtellotte WW
(1984)
Bimodal distribution of
dopamine receptor densities in brains of schizophrenics.
Science
225:728-730.
[Abstract/Free Full Text]
-
Sonetti D,
Biondi C,
Ferretti ME,
Portolan A,
Brunelli M
(1987)
Effects of serotonin, dopamine and prostaglandin-E2
on adenylate-cyclase activity and cyclic AMP levels in different
ganglia of the fresh water snail Planorbis corneus L.
Neurochem Int
11:119-126.
-
Strader CD,
Sigal IS,
Candelore MR,
Rands E,
Hill WS,
Dixon RAF
(1988)
Conserved aspartic acid residue-79 and residue-113
of the
-adrenergic receptor have different roles in receptor
function.
J Biol Chem
263:10267-10271.
[Abstract/Free Full Text]
-
Strader CD,
Candelore MR,
Hill WS,
Sigal IS,
Dixon RAF
(1989)
Identification of two serine residues involved in
agonist activation of the
-adrenergic receptor.
J Biol Chem
264:13572-13578.
[Abstract/Free Full Text]
-
Sugamori KS,
Demchyshyn LL,
McConkey F,
Forte MA,
Niznik HB
(1995)
A primordial dopamine D1-like adenylate
cyclase-linked receptor from Drosophila melanogaster
displaying poor affinity for benzazepines.
FEBS Lett
362:131-138.
[Web of Science][Medline]
-
Sumikawa K,
Houghton M,
Emtage JS,
Richards BM,
Barnard EA
(1981)
Active multi-subunit ACh receptor assembled by
translation of heterologous mRNA in Xenopus oocytes.
Nature
292:862-864.
[Medline]
-
Tempel BL,
Livingstone MS,
Quinn WG
(1984)
Mutations in the
dopa decarboxylase gene affect learning in Drosophila.
Proc Natl Acad Sci USA
81:3577-3581.
[Abstract/Free Full Text]
-
Uzzan A,
Dudai Y
(1982)
Aminergic receptors in
Drosophila melanogaster: responsiveness of adenylate cyclase
to putative neurotransmitters.
J Neurochem
38:1542-1550.
[Web of Science][Medline]
-
Van Renterghem C,
Bilbe G,
Moss S,
Smart TG,
Constanti A,
Brown DA,
Barnard EA
(1987)
GABA receptors induced in
Xenopus oocytes by chick brain messenger RNA: evaluation of
TBPS as a use dependent channel blocker.
Mol Brain Res
2:21-31.
-
Walker RJ,
Holden-Dye L
(1989)
Commentary on the evolution of
transmitters, receptors and ion channels in invertebrates.
Comp Biochem Physiol
93A:25-39.
-
Weiss S,
Drummond GI
(1981)
Dopamine-sensitive and
serotonin-sensitive adenylate-cyclase in the gill of Aplysia
californica.
Mol Pharmacol
20:592-597.
[Abstract/Free Full Text]
-
Wichmann T,
DeLong MR
(1993)
Pathophysiology of parkinsonian
motor abnormalities.
Adv Neurol
60:53-61.
[Medline]
-
Witz P,
Amlaiky N,
Plassat J-L,
Maroteaux L,
Borrelli E,
Hen R
(1990)
Cloning and characterization of a
Drosophila serotonin receptor that activates adenylate
cyclase.
Proc Natl Acad Sci USA
87:8940-8944.
[Abstract/Free Full Text]
-
Zheng W,
Feng G,
Ren D,
Eberl DF,
Hannan F,
Dubald M,
Hall LM
(1995)
Cloning and characterization of a calcium channel
1 subunit from Drosophila
melanogaster with similarity to the rat brain type D isoform.
J Neurosci
15:1132-1143.
[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
M. C. Clark, T. E. Dever, J. J. Dever, P. Xu, V. Rehder, M. A. Sosa, and D. J. Baro
Arthropod 5-HT2 Receptors: A Neurohormonal Receptor in Decapod Crustaceans That Displays Agonist Independent Activity Resulting from an Evolutionary Alteration to the DRY Motif
J. Neurosci.,
March 31, 2004;
24(13):
3421 - 3435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Farooqui, K. Robinson, H. Vaessin, and B. H. Smith
Modulation of Early Olfactory Processing by an Octopaminergic Reinforcement Pathway in the Honeybee
J. Neurosci.,
June 15, 2003;
23(12):
5370 - 5380.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Hearn, Y. Ren, E. W. McBride, I. Reveillaud, M. Beinborn, and A. S. Kopin
A Drosophila dopamine 2-like receptor: Molecular characterization and identification of multiple alternatively spliced variants
PNAS,
October 29, 2002;
99(22):
14554 - 14559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Brody and A. Cravchik
Drosophila melanogaster G Protein-coupled Receptors
J. Cell Biol.,
July 24, 2000;
150(2):
F83 - F88.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Andretic and J. Hirsh
Circadian modulation of dopamine receptor responsiveness in Drosophila melanogaster
PNAS,
February 15, 2000;
97(4):
1873 - 1878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chyb, W. Hevers, M. Forte, W. J. Wolfgang, Z. Selinger, and R. C. Hardie
Modulation of the Light Response by cAMP in Drosophila Photoreceptors
J. Neurosci.,
October 15, 1999;
19(20):
8799 - 8807.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. G. Hammerland, J. E. Garrett, B. C. P. Hung, C. Levinthal, and E. F. Nemeth
Allosteric Activation of the Ca2+ Receptor Expressed in Xenopus laevis Oocytes by NPS 467 or NPS 568
Mol. Pharmacol.,
June 1, 1998;
53(6):
1083 - 1088.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. S. Neckameyer
Dopamine and Mushroom Bodies in Drosophila: Experience-Dependent and -Independent Aspects of Sexual Behavior
Learn. Mem.,
May 1, 1998;
5(1):
157 - 165.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Reale, F. Hannan, L. M. Hall, and P. D. Evans
Agonist-Specific Coupling of a Cloned Drosophila melanogaster D1-Like Dopamine Receptor to Multiple Second Messenger Pathways by Synthetic Agonists
J. Neurosci.,
September 1, 1997;
17(17):
6545 - 6553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Nicola and R. C. Malenka
Dopamine Depresses Excitatory and Inhibitory Synaptic Transmission by Distinct Mechanisms in the Nucleus Accumbens
J. Neurosci.,
August 1, 1997;
17(15):
5697 - 5710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yellman, H. Tao, B. He, and J. Hirsh
Conserved and sexually dimorphic behavioral responses to biogenic amines in decapitated Drosophila
PNAS,
April 15, 1997;
94(8):
4131 - 4136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tully, G. Bolwig, J. Christensen, J. Connolly, M. DelVecchio, J. DeZazzo, J. Dubnau, C. Jones, S. Pinto, M. Regulski, et al.
A Return to Genetic Dissection of Memory in Drosophila
Cold Spring Harb Symp Quant Biol,
January 1, 1996;
61(0):
207 - 218.
[Abstract]
[PDF]
|
 |
|
|