 |
Previous Article | Next Article 
Volume 16, Number 14,
Issue of July 15, 1996
pp. 4360-4369
Copyright ©1996 Society for Neuroscience
Structure and Evolution of Neurexophilin
Alexander G. Petrenko1, 2,
Beate Ullrich1,
Markus Missler1,
Valery Krasnoperov2,
Thomas W. Rosahl1, and
Thomas C. Südhof1
1 Howard Hughes Medical Institute and Department of
Molecular Genetics, The University of Texas Southwestern Medical
School, Dallas, Texas 75235, and 2 Department of
Environmental Medicine, New York University Medical Center, New York,
New York 10016
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Using affinity chromatography on immobilized -latrotoxin, we
have purified a novel 29 kDa protein, neurexophilin, in a complex with
neurexin I . Cloning revealed that rat and bovine neurexophilins are
composed of N-terminal signal peptides, nonconserved N-terminal domains
(20% identity over 80 residues), and highly homologous C-terminal
sequences (85% identity over 169 residues). Analysis of genomic clones
from mice identified two distinct neurexophilin genes, one of which is
more homologous to rat neurexophilin and the other to bovine
neurexophilin. The first neurexophilin gene is expressed abundantly in
adult rat and mouse brain, whereas no mRNA corresponding to the second
gene was detected in rodents despite its abundant expression in bovine
brain, suggesting that rodents and cattle primarily express distinct
neurexophilin genes. RNA blots and in situ hybridizations
revealed that neurexophilin is expressed in adult rat brain at high
levels only in a scattered subpopulation of neurons that probably
represent inhibitory interneurons; by contrast, neurexins are expressed
in all neurons. Neurexophilin contains a signal sequence and is
N-glycosylated at multiple sites, suggesting that it is secreted and
binds to the extracellular domain of neurexin I . This hypothesis was
confirmed by binding recombinant neurexophilin to the extracellular
domains of neurexin I . Together our data suggest that neurexophilin
constitutes a secreted glycoprotein that is synthesized in a subclass
of neurons and may be a ligand for neurexins.
Key words:
neurexins;
-latrotoxin;
synapse;
gene duplication;
neuron-specific receptor;
inhibitory interneurons
INTRODUCTION
-Latrotoxin, a component of black widow spider
venom, is a potent presynaptic neurotoxin (Frontali et al., 1976 ;
Rosenthal and Meldolesi, 1989 ). Acute administration of -latrotoxin
causes massive neurotransmitter release; chronic exposure results in
cell membrane damage and synaptic degeneration. An understanding of the
molecular mechanisms of -latrotoxin toxicity is beginning to emerge.
The toxin binds to high-affinity receptors that are localized in the
presynaptic plasma membrane of the nerve terminal (Tzeng and Siekevitz,
1979 ; Valtorta et al., 1984 ). Binding of toxin results in
Ca2+ influx into nerve terminals, activation of
synaptic vesicle exocytosis, and ATP depletion (Grasso et al., 1980 ;
McMahon et al., 1990 ). Interestingly, -latrotoxin triggers synaptic
vesicle exocytosis even in the absence of extracellular
Ca2+, suggesting that the toxin stimulates
Ca2+-independent vesicle exocytosis (Misler and
Hurlbut, 1979 ).
A protein complex that binds -latrotoxin with high affinity was
purified from bovine and rat brain and shown to consist of a set of
high molecular weight proteins of 160-220 kDa and a low molecular
weight protein of 29 kDa (Petrenko et al., 1990 , 1993 ). The high
molecular weight proteins represent splice variants of neurexin I
(Ushkaryov et al., 1992 ), and recombinant neurexin I binds
-latrotoxin with high affinity (Davletov et al., 1995 ). The identity
and characteristics of the low molecular weight protein, however,
remain unknown.
Neurexins are membrane proteins with the characteristics of
cell-surface receptors. They are encoded by at least three genes, each
of which has two independent promoters directing transcription of
longer -neurexins and shorter -neurexins. The neurexin
transcripts are subject to extensive alternative splicing (Geppert et
al., 1992 ; Ushkaryov et al., 1992 , 1994 ; Ushkaryov and Südhof,
1993 ). This probably results in the synthesis of >1000 neurexin
isoforms that are expressed differentially in subpopulations of neurons
in the brain (Ullrich et al., 1995 ). The domain structure of the
neurexins suggests a receptor function, possibly in cell adhesion. In
support of this hypothesis, a family of neuronal cell surface proteins
named neuroligins, which bind to -neurexins in a splice
variant-specific manner, was described recently (Ich- tchenko et
al., 1995, 1996). It seems likely that additional ligands for neurexins
that may also be splice-site specific will be discovered. On the
intracellular side, neurexins contain a short cytoplasmic tail that
interacts with the synaptic vesicle protein synaptotagmin (Petrenko et
al., 1991 ; Hata et al., 1993 ) and with a novel protein called CASK that
contains CaM kinase- and dlg-like sequences (Hata et al., 1996 ).
We have now studied the structure, properties, and expression of the
low molecular weight protein that is purified on immobilized
-latrotoxin. We propose to name this protein neurexophilin because
of its strong binding to neurexin I . Our data reveal that
neurexophilin is a secreted cysteine-rich glycoprotein. Neurexophilin
is expressed in a brain-specific manner in a subset of neurons that are
scattered throughout the nervous system. Together our data raise the
possibility that neurexophilin represents a novel ligand for
-neurexins.
MATERIALS AND METHODS
Cloning and sequencing of cDNAs and genomic clones
encoding neurexophilins. A PCR-based cDNA cloning strategy was
used to take advantage of the single short peptide sequence (sequence:
VVEFEVSPQSTLETK) obtained previously from purified neurexophilin
(Petrenko et al., 1993 ). PCRs using primers A and B or C (sequences:
A = GGCTGCAGTNGTNGA[G,A]TT[C,T] GA; B = GGTCTAGAA[A,G,T]CA[G,A]AGNT CNCA; and C = GGTCTAGAANCA[A,G]AG[A,G]TTNCA; n = all nucleotides;
other redundant nucleotide combinations are shown in brackets) were
performed on single-stranded bovine brain cDNA as template, as
described by Ushkaryov and Südhof (1993) . PCR products of
approximately the right size were subcloned in M13 vectors and analyzed
by sequencing. One M13 clone with the correct sequence was identified
and used to screen cDNA libraries (Sambrook et al., 1989 ; Südhof,
1990 ). Mouse genomic clones were isolated from different libraries
using the rat cDNA as a probe and mapped and sequenced, essentially as
described (Südhof, 1990 ). All DNA sequencing was performed on M13
subclones using the dideoxy nucleotide-chain termination method (Sanger
et al., 1977 ) with fluorescently labeled primers, Taq DNA
polymerase, and an ABI373A DNA sequencer for analysis. Sequences were
analyzed on a PC using Intelligenetics software and submitted to
Genbank (accession numbers L27867[GenBank], L29868[GenBank], U56650[GenBank], and U56651[GenBank]).
RNA preparation and blotting. Total RNA isolated from
different rat and bovine tissues by guanidinium isothiocyanate
extraction was analyzed by blotting, using uniformly
32P-labeled probes as described (Ushkaryov et
al., 1992 ). To control for RNA loads, blots were rehybridized with a
cyclophilin probe.
In situ hybridizations were performed on rat brain sections
using 35S-labeled oligonucleotides corresponding
to rat and bovine neurexophilins, essentially as described (Gerfen et
al., 1992 ; Ullrich et al., 1995 ). Two controls were performed to verify
specificity of labeling. First, hybridizations were performed in a 50- and 100-fold excess of unlabeled oligonucleotide to determine which
signal could be competed away and was therefore specific. Second, two
antisense oligonucleotides from different regions of the mRNAs were
used for the experiments to ensure that the signal that was observed
corresponded to the mRNA being studied. Neurexophilin 1 oligonucleotides used for in situ hybridizations were T964
and T1065 [sequences (redundant positions shown in brackets):
CCAGGACAC[A,G]TGACT[C,T]TG[A,G]GTCTGCTCCT GGTA[G,A]CAG and
AATCTGTGCCATTTTCTTTACCACGGAAAGTCTGTGAGAGGA] and T1066 (CTGGAGA
CTGTTTAACAAACAGGCGCAGAGGGTTGATGATCC) for neurexophilin 2.
Antibodies. The antibodies used for the current study were
raised against the following synthetic peptides coupled to keyhole
limpet hemocyanin (Johnston et al., 1989 ; Petrenko et al., 1993 ): (1) a
synthetic peptide containing residues 261-271 of rat neurexophilin
(the C terminus), which in bovine neurexophilin exhibits three amino
acid substitutions (F508); (2) a peptide containing residues 167-179
of bovine neurexophilin of which only five residues are conserved in
rat neurexophilin (A550); (3) a peptide from the C terminus of neurexin
II that reacts with all neurexins (A473) (Ushkaryov et al., 1992 ).
Specificities of the antibodies were assessed by competition studies,
with the respective synthetic peptides used for immunizations.
Expression of neurexophilins and IgG-fusion proteins by
transfection in COS cells. Expression vectors encoding full-length
bovine and rat neurexophilins (pCMV 1 and pCMV 2, respectively)
were constructed by subcloning the cDNA clones into the appropriate
pCMV vectors. The expression construct encoding the N-terminal
truncated rat neurexophilin preceded by the signal sequence (pCMV 3)
was obtained by deleting the coding sequence for the cleaved
pro-peptide portion by PCR-based site-directed mutagenesis.
IgG-neurexin I and IgG-control proteins were produced in COS cells
by transfection of previously described constructs (Ichtchenko et al.,
1995 ). DNA transfections into COS cells were performed as described
(Gorman, 1985 ), using DEAE-dextran.
-Latrotoxin affinity chromatography was performed using homogenates
from frozen bovine and rat brains, as described (Petrenko et al.,
1993 ). The protein components of the preparations were characterized by
SDS-PAGE followed by Coomassie blue staining or by immunoblotting with
antibodies to neurexins and neurexophilin.
Sucrose gradient and gel filtration experiments. The nature
of the binding of neurexophilin to neurexins purified on immobilized
-latrotoxin was studied by sucrose gradient centrifugations in the
presence of different concentrations of NaCl and different detergents
and by gel filtration on a Sephacryl S-300 column (7 × 137 mm)
equilibrated with either 6 M urea, 75 mM Tris-HCl, pH 7.4, or with 7 M guanidinium-HCl, pH 1.7. The
neurexin/neurexophilin samples were applied to and eluted from the
column with the respective buffers at a flow rate of 7.5 ml/hr.
Fractions (0.1 ml) were analyzed by electrophoresis and immunoblotting
with anti-neurexophilin and anti-neurexin antibodies.
Binding of recombinant neurexin I to neurexophilin.
Recombinant neurexin I -IgG and control IgG-fusion proteins were
immobilized on protein A-agarose (20 µl/1 ml culture medium) from the
medium of transfected COS cells after the addition of 40 mM Tris-HCl, pH 8.0. The portion of the rat
neurexophilin cDNA encoding residues 111-271 was subcloned into the
XbaI site of pGEX-KG using PCR. Recombinant GST-fusion
proteins were expressed and purified as described on
glutathione-agarose (Smith and Johnson, 1988 ). Protein eluted from the
glutathione agarose column was purified additionally by DEAE-Sepharose
for some experiments. The protein A-agarose beads containing
recombinant IgG-fusion proteins were washed twice with incubation
buffer (40 mM Tris-HCl, pH 8.0, 0.3 M NaCl, 1% Triton X-100, 1% bovine serum
albumin), preincubated in 80 µl of this buffer for 2 hr, and then
incubated 30 min after the addition of ~1 µg GST-neurexophilin
added in 20 µl of the same buffer containing 5 mM glutathione but lacking bovine serum albumin.
After incubation, samples were centrifuged, and the beads were washed
twice with 40 mM Tris-HCl, pH 8.0, 0.15 M NaCl. Beads were resuspended in 40 µl
SDS-PAGE sample buffer, and 10 µl of the bead fraction and the
supernatants from the incubations were analyzed by SDS-PAGE and
immunoblotting.
Deglycosylation of native and recombinant neurexophilin.
Proteins purified by affinity chromatography on -latrotoxin (30 µg/ml protein) were dialyzed against 50 mM
Na2HPO4, pH 7.4, 0.1%
Triton X-100, to remove KCl, denatured with SDS/ -mercaptoethanol,
and treated with recombinant PNGase F (New England Biolabs, Beverly,
MA) with control incubations in the absence of the enzyme. Transfected
COS cells and their culture media were digested with PNGase F in the
same manner. Samples were analyzed by SDS-PAGE and immunoblotting using
anti-neurexophilin antibodies.
RESULTS
Molecular cloning of rat and bovine neurexophilins
Only a single short peptide sequence from bovine neurexophilin was
obtained in previous studies (sequence: VVEFEVSPQSTLETK; Petrenko et
al., 1993 ). This sequence contains two serine residues, making direct
screening of cDNA libraries with redundant oligonucleotides difficult.
Therefore we performed PCRs on single-stranded bovine brain cDNA
templates using highly degenerate oligonucleotides encoding the N- and
C-terminal five amino acids of this peptide (see Materials and
Methods). PCR products of the expected size (58 bp) were cloned into
M13 vectors and sequenced. One M13 clone had the correct sequence and
was used as a probe for cDNA screening, resulting in the identification
of partial bovine neurexophilin cDNA clones. These were then used as
probes to isolate rat and bovine cDNA clones for neurexophilin that
were full-length with respect to the coding region (p 7 and
p 14).
The cDNA sequences were used to determine the amino acid
sequences of rat and bovine neurexophilins (shown aligned with each
other in Fig. 1A). Databank searches revealed
no significant similarity to current entries, suggesting that the
neurexophilins are novel proteins. Analyses of the rat and bovine
sequences suggested that the primary translation product of
neurexophilin has a multidomain structure (Fig. 1B). At the
N terminus, rat and bovine neurexophilins contain a single hydrophobic
sequence that has the characteristics of a signal peptide with putative
cleavage sites after residues 21 (rat) or alternatively 20 or 22 (bovine) (von Heijne, 1987 ). After the putative signal sequence, an
80-residue sequence is observed in neurexophilins that exhibits little
similarity between the rat and bovine sequences (20% identity) but
ends in a conserved polybasic sequence
(double-underlined in Fig. 1A). After this
nonconserved region, rat and bovine neurexophilin contain a 169-residue
sequence that is well conserved (85% identity). This sequence can be
subdivided into an N-terminal half that exhibits only a single amino
acid substitution between rat and bovine neurexophilin and contains
three N-glycosylation sites, and a C-terminal half that is
characterized by six conserved cysteine residues (shaded in
Fig. 1A). The two conserved C-terminal domains are separated
from each other by a short stretch of a nonconserved sequence (residues
171-188 in rat neurexophilin). Thus the domain model of neurexophilins
suggests that they are composed of an N-terminal signal peptide, an
N-terminal variable domain, and two C-terminal conserved domains (Fig.
1B).
Fig. 1.
Structure of rat and bovine neurexophilins.
A, Amino acid sequences of rat and bovine neurexophilins.
Protein sequences were deduced from the cDNA nucleotide sequences
(Genbank accession numbers L27867[GenBank] and L29868[GenBank]). Sequences are identified
on the left (R, rat; B, bovine
neurexophilin) and numbered on the right. Residues that are
different between the rat and bovine sequences are marked by
asterisks. The putative N-terminal signal sequence is shown
in bold typeface, and its predicted cleavage site is marked
by an arrow. The basic tetrapeptide sequence (RTKR) at the
boundary between variable and conserved domains is
double-underlined and shown in bold typeface.
Conserved cysteine residues are shaded, and the four
N-linked glycosylation consensus sequences are underlined.
B, Domain structure of neurexophilin. Four domains are
proposed: (1) a signal peptide at the N terminus; (2) a nonhomologous
N-terminal region that may constitute a propeptide; (3) a highly
conserved middle segment that contains three N-glycosylation consensus
sequences (branched lines); and (4) a conserved C-terminal
sequence characterized by six conserved cysteine residues (indicated by
C).
[View Larger Version of this Image (54K GIF file)]
Characterization of murine neurexophilin genes
Rat and bovine neurexophilin exhibit no significant sequence
homology with each other in their signal sequences and the following
N-terminal 87 residues and are only 85% identical over their
C-terminal regions. This is an unusually low degree of similarity for
the same proteins from different mammals, suggesting the possibility
that the proteins we cloned may be isoforms instead of homologs. To
investigate this possibility, we screened a murine genomic library by
low-stringency hybridization with coding region probes from
neurexophilins. Two classes of clones were isolated that correspond to
two different neurexophilin genes (Fig. 2). In both
classes of genomic clones, a single large exon encoding neurexophilin
was identified that initiates at the end of the signal sequence and
contains all of the remaining coding sequence (Fig.
3A,B). The exon is preceded by a typical
intron acceptor site (underlined in Fig. 3A,B) and as far as
sequenced also contains the complete 3 untranslated region of the
neurexophilin mRNA. Only the first 18 and 17 amino acids encoded by the
rat and bovine cDNAs are missing in the exon, suggesting that the
complete coding sequence for neurexophilin is contained in two exons,
one encoding the signal peptide and the second encoding the remaining
parts of the protein. The first exon was not identified in the genomic
clones isolated, indicating that the intron in the gene is rather
large.
Fig. 2.
Partial structure of murine neurexophilin genes.
The diagram depicts restriction maps of the murine neurexophilin 1 (Nxph-1) and neurexophilin 2 (Nxph-2) genes as
deduced from the genomic clones identified below the maps. Restriction
enzyme cleavage sites are indicated by letters (B,
BstBI; C, ClaI; E,
EcoRV; H, HindIII; K,
KpnI; S, SpeI). The locations of exons
are marked by boxes; closed boxes indicate coding
and open boxes indicate 3 untranslated regions. The scale
of the drawing is given in the lower right corner.
[View Larger Version of this Image (15K GIF file)]
Fig. 3.
Sequences of neurexophilin genes: implications for
evolution. The nucleotide sequences of the 3 ends of the intron and
the large exon of the murine neurexophilin 1 and neurexophilin 2 genes
are shown in A and B, together with the
translated amino acid sequences. Underlined sequences
correspond to the intron acceptor site. In C, the amino acid
sequences of the murine neurexophilin 1 and 2 genes (labeled M1 and M2
on the left) are aligned with the corresponding sequences
from rat and bovine neurexophilin (identified as R and
B on the left). Residues that are identical in
all four sequences are shown in bold typeface. Positions at
which the murine neurexophilin 1 gene sequence is identical with the
rat neurexophilin sequence and the murine neurexophilin 2 sequence is
identical with the bovine neurexophilin sequence, but at which these
two groups differ from each other, are marked by an asterisk
above the corresponding residue to highlight the close relation of the
neurexophilin 1 gene with rat neurexophilin and of the neurexophilin 2 gene with bovine neurexophilin. Overall, the mouse neurexophilin 1 sequence is 61% identical with the mouse neurexophilin 2 sequence,
99% identical with the rat neurexophilin sequence, and 63% identical
with the bovine neurexophilin sequence. Conversely, the mouse
neurexophilin 2 sequence is 60% identical with the rat neurexophilin
sequence but 88% identical with the bovine neurexophilin sequence,
whereas the bovine and rat neurexophilin sequences are 60% identical
in the region shown. All sequences are numbered on the
right.
[View Larger Version of this Image (54K GIF file)]
Comparison of the protein sequences predicted from the genomic clones
with those of rat and bovine neurexophilins revealed that one of the
genes is more similar to rat neurexophilin and is referred to as the
neurexophilin 1 gene. By contrast, the second gene, referred to as the
neurexophilin 2 gene, is more similar to bovine neurexophilin (Fig.
3C). In the N-terminal nonconserved domain, murine
neurexophilin 1 is almost identical with the rat sequence (1 mismatch
over 80 residues) but exhibits little similarity to bovine or mouse
neurexophilin 2 (60 mismatches over 80 residues). Conversely, the
N-terminal domain of mouse neurexophilin 2 is 70% identical with that
of bovine neurexophilin but exhibits only 25% identity with rat or
mouse neurexophilin 1 (Fig. 3C). Thus, the murine genome
contains at least two neurexophilin genes, one of which corresponds to
neurexophilin cDNAs isolated from rat brain and the other corresponds
to cDNAs from bovine brain.
Only the neurexophilin 1 gene generates a detectable mRNA
in mice
The genomic cloning results raised two alternative
hypotheses: (1) two neurexophilin isoforms are expressed in mice and
other mammals from two distinct genes; and (2) mammals primarily
express only one neurexophilin isoform, although two genes are present,
but different mammals (i.e., rodents vs cattle) may express different
isoforms. To differentiate between these two hypotheses, we used RNA
blots and in situ hybridization experiments and investigated
the expression of neurexophilins in adult mice, rats, and cattle. Of
all tissues tested, hybridizing neurexophilin mRNAs were observed only
in brain (see below and data not shown). Blots of adult brain RNAs with
probes from the two types of neurexophilin surprisingly revealed that
in mouse and rat brain, only mRNAs corresponding to the neurexophilin 1 gene (i.e., rat neurexophilin) were detectable (Fig. 4
and data not shown). Conversely, in bovine brain only the bovine form
of neurexophilin corresponding to mouse neurexophilin 2 was found (data
not shown). Using redundant oligonucleotides hybridizing to conserved
sequences in both neurexophilins, polymerase chain reactions were
performed with total cDNA from adult mouse brains. Only a single band
was amplified that on sequencing was found to contain only
neurexophilin 1 (data not shown). Together these data indicate that
only transcripts corresponding to neurexophilin 1 are present at
measurable levels in adult rat and mouse brain, whereas bovine brain
primarily expresses transcripts corresponding to neurexophilin 2. Although we cloned both genes only from mice and not from rats and
cows, it seems likely that both genes are also present in these
organisms. The presence of distinct neurexophilin genes and their
expression pattern in mice, rats, and cattle suggest that neurexophilin
genes duplicated in evolution before the divergence of rodents and
cattle, and that after the divergence, high expression of one gene was
maintained in rodents and of the other gene in cattle.
Fig. 4.
RNA blot analysis of the expression of the
two murine neurexophilin genes in mouse brain. Blots containing
electrophoretic separated mouse brain RNA were hybridized consecutively
with probes from the coding regions of the murine neurexophilin 1 and 2 genes (lanes 1 and 2) and with a GAPDH probe at a
positive control (lanes 3 and 4). Numbers on the
left indicate positions of molecular weight markers in
kilobases (kb).
[View Larger Version of this Image (35K GIF file)]
Pattern of neurexophilin 1 expression in rat brain
RNA blots indicated that neurexophilin mRNA was detectable
only in nervous tissues (data not shown). To examine which cells in
brain express neurexophilin, in situ hybridizations were
performed with 35S-labeled oligonucleotides from
two different regions of the cDNA. All hybridizations were performed in
the presence and absence of a 100-fold excess of unlabeled
oligonucleotide to control for nonspecific labeling. Hybridization of
horizontal rat brain sections revealed expression of rat neurexophilin
in neurons in most brain structures in a nonuniform, granular pattern
(Fig. 5). Particularly high expression was observed in
selected thalamic nuclei (arrowheads) and in the glomerular
layer of the olfactory bulb (arrows). The nonuniform
labeling pattern was especially evident in the cerebral cortex, which
has a peppered appearance (open arrows). Parallel
experiments with an oligonucleotide corresponding to neurexophilin 2 gave no specific hybridization signals in rat brain (data not
shown).
Fig. 5.
Expression of neurexophilin in rat brain
visualized by in situ hybridization. Horizontal sections at
two different levels were hybridized with a
35S-labeled oligonucleotide specific for
neurexophilin and exposed to film without screen. Note the granular
hybridization pattern in most brain regions, particularly in the
cerebral cortex (open arrows in A and
B). A strong uniform signal is observed only in the
periglomerular zone of the olfactory bulb (arrows in
B) and in some of the thalamic nuclei (arrowheads
in A and B), especially the anteroventricular,
medial habenular, paraventricular, subgeniculate, reuniens, and
reticular thalamic nuclei.
[View Larger Version of this Image (126K GIF file)]
The granular pattern of the hybridization signal suggests that only
subpopulations of neurons express neurexophilin. To test this
hypothesis, expression was examined at the cellular level. A comparison
of the expression of synaptotagmin I (Fig.
6A), neurexophilin (B), and
neurexins (C; the oligonucleotide that was used hybridizes
with all neurexin mRNAs) in the hippocampus showed that only a small
subpopulation of neurons express high levels of neurexophilin mRNA.
Although synaptotagmin I and neurexins are expressed in all
identifiable neurons, neurexophilin was not detected in the most
abundant classes of neurons in the hippocampal formation, such as the
pyramidal cells of the CA1-CA4 regions and the granule cells of the
dentate gyrus. Only interspersed cells likely to be inhibitory
interneurons contained high levels of neurexophilin mRNA. Similar
results were obtained with the cerebellum where again the majority of
the mRNA was localized to basket and Golgi cells and not to the
predominant granule cells (data not shown). Finally, investigation of
the olfactory bulb revealed strong staining of periglomerular neurons
(Fig. 7) that probably accounts for the strong signal
seen in the olfactory bulb in the overview (Fig. 5). In addition,
scattered cells that may correspond to tufted cells in the external
plexiform layer were also labeled. In contrast, the mitral cells and
granule cells, the major cell types in the olfactory bulb, did not
express neurexophilin. Together these data suggest that neurexophilin
is expressed selectively in subpopulations of neurons, probably
primarily inhibitory interneurons.
Fig. 6.
Distribution of neurexophilin mRNA in hippocampus.
Rat hippocampal sections were hybridized with
35S-labeled oligonucleotides corresponding to
synaptotagmin I (A) or neurexophilin (B) or to a
consensus sequence present in all neurexins (C). Note the
presence of neurexins and synaptotagmin I in apparently all neurons in
the hippocampus, whereas neurexophilin is absent from most hippocampal
neurons, including pyramidal cells of the hippocampus proper and
granule cells of the dentate gyrus (DG); however,
neurexophilin is present at high levels in scattered neurons of the
hippocampus (straight arrows) and dentate gyrus
(curved arrows) that seem to be primarily inhibitory
interneurons.
[View Larger Version of this Image (49K GIF file)]
Fig. 7.
Distribution of neurexophilin mRNA in the
olfactory bulb. Panels show sections of rat olfactory bulb hybridized
with 35S-labeled oligonucleotides specific for
neurexophilin (A) or for neurexin I (B).
Neurexophilin mRNA is present at high levels in two cell types:
periglomerular neurons in the glomerular layer (GL) that are
uniformly positive for neurexophilin mRNA (open arrowheads)
and scattered neurons of the external plexiform layer that may
correspond to tufted cells (full arrows). Note the absence
of neurexophilin mRNA from the mitral cell layer (MCL) and
the granule cell layer (GCL), which are strongly positive
for neurexin I .
[View Larger Version of this Image (70K GIF file)]
Neurexophilin co-purifies with bovine and rat neurexin I on
immobilized -latrotoxin
To test whether the neurexophilins we cloned correspond to the 29 kDa protein that co-purifies with neurexin I on immobilized
-latrotoxin, we raised antibodies against peptides containing
residues 167-179 of bovine neurexophilin and residues 261-271 of rat
neurexophilin. Testing of these antibodies with rat and bovine
neurexophilin expressed in COS cells confirmed that each reacted
specifically with the corresponding protein (data not shown). As
expected from the limited sequence similarity between rat neurexophilin
1 and bovine neurexophilin 2 in the peptides used for immunizations,
the bovine neurexophilin antibody did not react with rat neurexophilin,
and the rat neurexophilin antibody recognized bovine neurexophilins
only weakly.
We then isolated rat and bovine neurexin I and associated 29 kDa
proteins by affinity chromatography on immobilized -latrotoxin and
analyzed them by immunoblotting for the presence of neurexophilins. The
29 kDa proteins from both species reacted strongly with the
neurexophilin antibodies (Fig. 8). This result confirms
that the proteins we cloned are identical with the 29 kDa proteins that
co-purify with neurexin I on immobilized -latrotoxin. Rat
neurexophilin isolated on immobilized -latrotoxin reacted only with
the anti-rat neurexophilin 1 antibody, and bovine neurexophilin reacted
strongly with the bovine neurexophilin 2 antibody and only weakly with
the rat neurexophilin 1 antibody. The lack of immunoreactivity of
antibodies to bovine neurexophilin 2 with the -latrotoxin affinity
eluate from rat brain despite its strong reactivity with the eluate
from bovine brain provides further support for the conclusion that
neurexophilin 2 is not expressed in rodent brain.
Fig. 8.
Neurexophilins are co-purified with neurexin I
by affinity chromatography on immobilized -latrotoxin from rat and
bovine brain. Rat and bovine -latrotoxin binding proteins were
purified from brain homogenates by affinity chromatography on
immobilized -latrotoxin and analyzed by SDS-PAGE in the presence or
absence of -mercaptoethanol ( -ME). Gels were
immunoblotted with antibodies against synthetic peptides corresponding
to residues 167-179 of bovine neurexophilin (left) or to
residues 261-271 of rat neurexophilin (right). Numbers on
the left indicate positions of molecular weight
markers.
[View Larger Version of this Image (36K GIF file)]
Association of neurexophilins with neurexin I
Previous studies demonstrated that after purification on
immobilized -latrotoxin, the 29 kDa protein corresponding to
neurexophilin co-purified with neurexin I during additional sucrose
gradient centrifugation and anion exchange chromatography procedures,
suggesting that they are complexed to each other (Petrenko et al.,
1993 ). Because neurexophilin migrates as a monomer on SDS-PAGE in the
absence or presence of reducing agents (Fig. 8), neurexin I and
neurexophilin are not linked to each other by disulfide bonds. To
characterize their association better, we probed for conditions under
which neurexin I and neurexophilin dissociate by performing sucrose
gradient centrifugation and gel filtration experiments under denaturing
conditions.
Dissociation could not be obtained in 2 M NaCl on
sucrose gradients or in 6 M urea on gel
filtration columns (Fig. 9 and data not shown).
Neurexophilin was dissociated only from neurexin I in 7 M guanidinium-HCl at pH 1.7 (Fig. 9). These
results suggest that the neurexophilin-neurexin I complex, although
noncovalent, requires complete denaturation for dissociation.
Fig. 9.
Tight binding of neurexophilin to neurexins. The
stability of the neurexin-neurexophilin complex purified on
immobilized -latrotoxin was analyzed by gel filtration on a
Sephacryl S-300 column in 6 M urea, 75 mM Tris-HCl, pH 7.4 (top), or in 7 M guanidinium-HCl, pH 1.7 (bottom).
The first 1.8 ml of column eluate was discarded, and 0.1 ml fractions
were subjected to immunoblotting using antibodies against the C
terminus of neurexins or bovine neurexophilin, as indicated.
Immunoreactive bands were visualized by ECL. Note that neurexophilin
comigrates with neurexin I at high molecular weights in 6 M urea but dissociates from neurexin I in 7 M guanidinium-HCl. In the samples containing
urea, protein migration in the gel is slightly distorted.
[View Larger Version of this Image (34K GIF file)]
Post-translational processing of neurexophilins
Neurexophilins co-purified with neurexin I on immobilized
-latrotoxin migrate as 29 kDa proteins on SDS-PAGE (Fig. 8).
Digestion with PNGase F (which cleaves N-linked sugars) shifts the
apparent size of neurexophilin to 19 kDa (Fig. 10).
This result demonstrates that neurexophilins are highly N-glycosylated,
a hypothesis that was confirmed with transfected COS cells in which at
least three N-glycosylated intermediates of neurexophilin could be
distinguished (data not shown).
Fig. 10.
N-glycosylation of neurexophilin.
Neurexophilin complexed to neurexin I was purified by affinity
chromatography on immobilized -latrotoxin and incubated with or
without PNGase F. Samples (0.5 µg protein) were analyzed by
immunoblotting with antibodies to neurexophilin. Numbers on
the right indicate positions of molecular weight
markers.
[View Larger Version of this Image (29K GIF file)]
Although neurexophilin purified on immobilized -latrotoxin migrates
at ~19 kDa after deglycosylation, its predicted size after signal
sequence cleavage amounts to ~28 kDa, suggesting that neurexophilin
may be proteolytically processed after synthesis. This raises two
possibilities: (1) neurexophilin is a preproprotein that is
proteolytically processed in the secretory pathway; and (2) nonspecific
proteolysis during purification leads to partial degradation. The
simplest method of distinguishing between these hypotheses would be to
determine the size of neurexophilin in fresh total brain homogenates
before any nonspecific proteolysis can occur; however, we were unable
to detect neurexophilin in total brain homogenates, possibly because of
the relatively low affinity of our neurexophilin antibodies or of the
low abundance of the protein, making it currently impossible to
differentiate between these alternatives.
Binding of recombinant neurexophilin to the extracellular domain of
neurexin I
The fact that neurexophilins are N-glycosylated, contain a signal
peptide, and lack a transmembrane region suggests that they are
secreted and presumably bind to the extracellular part of neurexin
I . To test this directly, the extracellular domains of neurexin I
were produced as a recombinant fusion protein with the Fc portion of
human IgG. The neurexin-IgG fusion protein as well as a control IgG Fc
domain were immobilized on protein A-agarose and mixed with
neurexophilin produced as a recombinant GST-fusion protein in bacteria.
Quantitative binding of neurexophilin was observed only to neurexin
I but not to the control (Fig. 11), suggesting that
neurexophilin binds to the extracellular domains of neurexin I .
Fig. 11.
Binding of recombinant neurexophilin to neurexin
I -IgG fusion protein and to IgG control protein. Purified
GST-neurexophilin fusion protein (0.1 µg, lane 1) was
mixed with immobilized control IgG fusion protein (lanes 2 and 4) or with neurexin I -IgG fusion protein
(lanes 3 and 5), incubated, and centrifuged.
Pellets and supernatants were analyzed by immunoblotting for
neurexophilin, demonstrating retention of neurexophilin with the
control IgG matrix but pelleting with the neurexin I -IgG
matrix.
[View Larger Version of this Image (42K GIF file)]
DISCUSSION
Neurexins constitute a polymorphic family of neuronal cell surface
proteins (Ushkaryov et al., 1992 , 1994 ; Ullrich et al., 1995 ). Neurexin
I , the founding member of the family, was discovered in studies on
the mechanism of action of -latrotoxin, a potent excitatory
neurotoxin. Affinity chromatography of rat and bovine brain proteins on
immobilized -latrotoxin revealed that two proteins were purified
specifically in a Ca2+-dependent manner (Petrenko
et al., 1993 ): a set of high molecular weight proteins that represent
splice variants of neurexin I , and a low molecular weight protein
that we have now named neurexophilin. The two proteins co-purify with
each other in several separation procedures, suggesting that they are
present in a complex; however, recombinant neurexin I binds
-latrotoxin with high affinity and does not need to be complexed to
neurexophilin for binding (Davletov et al., 1995 ), indicating that
neurexophilin is purified on immobilized -latrotoxin piggy-back in a
complex with neurexin I . We have now studied the molecular nature of
neurexophilin and of its association with neurexin I .
We have cloned cDNAs encoding neurexophilins from rat and bovine brain,
isolated genomic clones encoding most of the coding regions for two
neurexophilins from mice, investigated their pattern of expression, and
studied the biochemical properties of neurexophilin and its binding to
neurexin I . The structures of rat and bovine neurexophilins revealed
that they are novel proteins without significant similarity to current
databank entries. Sequence analyses suggested a four-domain structure
for neurexophilins: (1) an N-terminal signal peptide; (2) an N-terminal
nonconserved sequence; (3) a conserved region containing no cysteine
residues but three potential N-glycosylation sites; and (4) a
C-terminal domain characterized by six conserved cysteine residues
(Fig. 1). No hydrophobic region except for the putative signal peptide
was observed. The presence of a signal sequence in neurexophilin and
the absence of hydrophobic transmembrane regions suggest that
neurexophilin is a secreted protein. This hypothesis was supported by
the demonstration that neurexophilin is highly N-glycosylated and has
to transverse the secretory pathway.
Neurexophilin was purified first in a complex with neurexin I
(Petrenko et al., 1993 ). Studies on the nature of this complex revealed
an unexpectedly tight association (Fig. 9). Only strong denaturants
(SDS, guanidinium hydrochloride) could dissociate them from each other.
Comparison of the size of the deglycosylated peptide backbone of
purified neurexophilin complexed to neurexin I with the calculated
size of the protein after signal sequence cleavage revealed that the
purified protein is smaller than expected. It is unclear at present
whether this size discrepancy is attributable to proteolytic processing
of neurexophilin during biosynthesis or whether the protein is
partially degraded during purification by nonspecific proteases. The
low affinity of our antibodies and the low abundance of neurexophilin
did not allow us to address this question directly. Antibodies against
the C terminus of neurexophilin, however, react with the purified
protein complexed to neurexin I , suggesting that it contains the C
terminus and lacks the nonconserved N terminus. Because in many
secreted proteins that are processed from precursor proteins (such as
NGF) the removed propeptide often is not evolutionarily conserved, this
observation supports the notion that neurexophilin is synthesized as a
prepropeptide and proteolytically processed in the secretory pathway.
Future experiments will have to address this question.
In situ hybridizations demonstrated that neurexophilin is
expressed in a restricted pattern strikingly different from that of
neurexins. Neurexins are present in all identifiable neurons, with
distinct heterogeneous expression patterns for different subtypes
(Ullrich et al., 1995 ). By contrast, no neurexophilin mRNA was detected
in the majority of neurons. Only a relatively small subclass of neurons
that corresponded primarily to inhibitory interneurons contained
abundant levels of neurexophilin mRNA. These data suggest that
neurexophilin, unlike neurexins, is not expressed universally in
neurons.
The overall sequence homology between bovine and rat neurexophilin is
surprisingly low. There is little similarity between the bovine and rat
proteins in the putative signal sequence and the N-terminal 80 residues
that follow the signal peptide. Even in the conserved C-terminal
domains, the sequence conservation is much lower than that observed in
comparisons between rat and bovine neurexins (>95% identity as
opposed to 85% identity in neurexophilins; Ullrich et al., 1995 ). This
observation prompted us to investigate the possibility that the rat and
bovine cDNAs we cloned are not exact homologs but are isoforms.
Isolation of genomic clones encoding neurexophilins from mice revealed
the presence of two murine neurexophilin genes, referred to as the
neurexophilin 1 and 2 genes. The similarity between the structures and
sequences of the two murine neurexophilin genes suggests that they
resulted from an evolutionary gene duplication event that was followed
by sequence divergence with selective conservation of the C-terminal
sequences of neurexophilins. The following evidence supports the
hypothesis that the two neurexophilin genes do not encode two isoforms
co-expressed in the same organism, but rather one or the other
neurexophilin gene is expressed selectively at high levels in different
species. (1) Multiple cDNAs isolated from rat and bovine brain
libraries under low stringency conditions exclusively encoded only one
type of neurexophilin that corresponded to either neurexophilin 1 (rat)
or neurexophilin 2 (bovine). (2) No neurexophilin 2 mRNA could be
detected in RNA blots in rat and murine brain RNA but was expressed
abundantly in bovine brain RNA, whereas neurexophilin 1 mRNA was
abundant in rat and mouse RNA. (3) No neurexophilin 2 sequence could be
amplified from mouse cDNA by the polymerase chain reaction. (4)
In situ hybridizations failed to detect cells expressing
neurexophilin 2 in adult rat brain. (5) Antibodies to neurexophilins 1 and 2 failed to detect neurexophilin 2 in rat -latrotoxin affinity
eluate. Although these data do not completely rule out expression of
neurexophilin 2 in rodents or of neurexophilin 1 in cattle, especially
in tissues and at developmental time points distinct from those studied
here, they are compatible with the hypothesis that at some time in
evolution, after the neurexophilin genes had duplicated and diverged,
expression of the neurexophilin 2 gene was depressed in rodents, and
expression of the neurexophilin 1 gene was depressed in cattle. This
resulted in the expression of distinct types of genes in rodents and
cattle.
Together our findings characterize a novel neuronal glycoprotein
that has an unusual evolutionary history, is expressed in a small
subset of neurons, and binds to neurexin I and potentially other
neurexins. Future studies will have to determine whether neurexophilin
serves as a ligand for neurexins and what the determinants and
functional implications of this interaction are, especially in view of
their unusual relative distributions in brain.
FOOTNOTES
Received Feb. 22, 1996; revised April 19, 1996; accepted April 24, 1996.
This research was supported by National Institutes of Health Grants
MH52804 (T.C.S.) and NS34937 (A.G.P.), and by fellowship grants from
the Deutsche Forschungsgemeinschaft to B.U., M.M., and T.W.R. We thank
I. Leznicki, A. Roth, H. Tripoli, and E. Borowicz for excellent
technical assistance; Drs. M. S. Brown and J. L. Goldstein for critical
advice; and Drs. J. Dixon and D. W. Russell for the gift of expression
vectors and cDNA libraries.
Correspondence should be addressed to Thomas C. Südhof, Howard
Hughes Medical Institute, Room Y5.322, 5323 Harry Hines Boulevard,
Dallas TX 75235.
REFERENCES
-
Davletov B,
Krasnoperov V,
Hata Y,
Petrenko AG,
Südhof TC
(1995)
High affinity binding of
-latrotoxin to
recombinant neurexin I .
J Biol Chem
270:23903-23905.
[Abstract/Free Full Text]
-
Frontali N,
Ceccarelli B,
Gorio A,
Mauro A,
Siekevitz P,
Tzeng MC,
Hurlbut WP
(1976)
Purification from black widow spider venom
of a protein factor causing the depletion of synaptic vesicles at
neuromuscular junctions.
J Cell Biol
68:462-479.
[Abstract/Free Full Text]
-
Geppert M, Ushkaryov YA, Hata Y, Davletov B, Petrenko AG,
Südhof TC (1992) Neurexins. Cold Spring Harbor Symp
Quant Biol LVII: 483-490.
-
Gerfen CR,
Young WS,
Emson P
(1992)
In situ hybridization
histochemistry with oligonucleotides for localization of messenger RNA
in neurones.
In: Experimental neuroanatomy: a practical approach
(Bolam, JP,
eds)
, p. 173. Oxford: IRL.
-
Gorman C
(1985)
High efficiency gene transfer into mammalian
cells.
In: DNA cloning,
(Glover, DM,
eds)
, Vol II, p. 143. Oxford: IRL.
-
Grasso A,
Alema S,
Rufini S,
Senni MI
(1980)
Black widow
spider toxin-induced calcium fluxes and transmitter release in a
neurosecretory cell line.
Nature
283:774-776.
[Medline]
-
Hata Y,
Butz S,
Südhof TC
(1996)
CASK: a novel
dlg/PSD95 homolog with an N-terminal calmodulin-dependent
protein kinase domain identified by interaction with neurexins.
J Neurosci
16:2488-2494.
[Abstract/Free Full Text]
-
Hata Y,
Davletov B,
Petrenko R,
Jahn R,
Südhof TC
(1993)
Interaction of synaptotagmin with the cytoplasmic
domains of neurexins.
Neuron
10:307-315.
[Web of Science][Medline]
-
Ichtchenko K,
Hata Y,
Nguyen T,
Ullrich B,
Missler M,
Moomaw C,
Südhof TC
(1995)
Neuroligin 1: a splice-site specific
ligand for
-neurexins.
Cell
81:435-443.
[Web of Science][Medline]
-
Ichtchenko K,
Nguyen T,
Südhof TC
(1996)
Structure,
alternative splicing, and neurexin binding of multiple neuroligins.
J Biol Chem
271:2676-2682.
[Abstract/Free Full Text]
-
Johnston PA,
Jahn R,
Südhof TC
(1989)
Transmembrane
topography and evolutionary conservation of synaptophysin.
J Biol Chem
264:1268-1273.
[Abstract/Free Full Text]
-
McMahon HT, Rosenthal L, Meldolesi J, Nichols DG (1990)
-Latrotoxin
releases both vesicular and cytoplasmic glutamate from isolated nerve
terminals. J Neurochem 55:2039-2047. -
Misler S,
Hurlbut WP
(1979)
Action of black widow
spider venom on quantized release of acetylcholine at the frog
neuromuscular junction: dependence upon external Mg2+.
Proc Natl Acad Sci USA
76:991-995.
[Abstract/Free Full Text]
-
Petrenko AG,
Kovalenko VA,
Shamotienko OG,
Surkova IN,
Tarasyuk TA,
Ushkaryov YA,
Grishin EV
(1990)
Isolation and properties of
the alpha-latrotoxin receptor.
EMBO J
9:2023-2027.
[Web of Science][Medline]
-
Petrenko AG,
Lazaryeva VD,
Geppert M,
Tarasyuk TA,
Moomaw C,
Khokhlatchev AV,
Ushkaryov YA,
Slaughter C,
Nasimov IV,
Südhof TC
(1993)
Polypeptide composition of the
-latrotoxin
receptor.
J Biol Chem
268:1860-1867.
[Abstract/Free Full Text]
-
Petrenko AG,
Perin MS,
Davletov BA,
Ushkaryov YA,
Geppert M,
Südhof TC
(1991)
Binding of synaptotagmin to the
-latrotoxin receptor implicates both in synaptic vesicle exocytosis.
Nature
353:65-68.
[Medline]
-
Rosenthal L,
Meldolesi J
(1989)
Alpha-latrotoxin and related
toxins.
Pharmacol Ther
42:115-134.
[Web of Science][Medline]
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular cloning:
a laboratory manual, 2nd ed.
.
-
Sanger F,
Nicklen S,
Coulson AR
(1977)
DNA sequencing with
chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463-5467.
[Abstract/Free Full Text]
-
Smith DB,
Johnson KS
(1988)
Single-step purification of polypeptides
expressed in Escherichia coli as fusions with glutathione
S-transferase.
Gene
67:31-40.
[Web of Science][Medline]
-
Südhof TC
(1990)
The structure of the human synapsin I
gene and protein.
J Biol Chem
265:7849-7852.
[Abstract/Free Full Text]
-
Tzeng MC,
Siekevitz P
(1979)
The binding interaction between
alpha- latrotoxin from black widow spider venom and a dog
cerebral cortex synaptosomal membrane preparation.
J Neurochem
33:263-274.
[Web of Science][Medline]
-
Ullrich B,
Ushkaryov YA,
Südhof TC
(1995)
Cartography
of neurexins: more than 1000 isoforms generated by alternative splicing
and expressed in distinct subsets of neurons.
Neuron
14:497-507.
[Web of Science][Medline]
-
Ushkaryov YA,
Südhof TC
(1993)
Neurexin III
:
extensive alternative splicing generates membrane-bound and soluble
forms in a novel neurexin.
Proc Natl Acad Sci USA
90:6410-6414.
[Abstract/Free Full Text]
-
Ushkaryov YA,
Hata Y,
Ichtchenko K,
Moomaw C,
Afendis S,
Slaughter CA,
Südhof TC
(1994)
Conserved domain structure of
-neurexins.
J Biol Chem
269:11987-11992.
[Abstract/Free Full Text]
-
Ushkaryov YA,
Petrenko AG,
Geppert M,
Südhof TC
(1992)
Neurexins: synaptic cell surface proteins related
to the
-latrotoxin receptor and laminin.
Science
257:50-56.
[Abstract/Free Full Text]
-
Valtorta F,
Maddedu L,
Meldolesi J,
Ceccarelli B
(1984)
Specific localization of the alpha-latrotoxin
receptor in the nerve terminal plasma membrane.
J Cell Biol
99:124-132.
[Abstract/Free Full Text]
-
von Heijne G
(1987)
Sequence analysis in molecular biology:
treasure trove or trivial pursuit.
.
This article has been cited by other articles:

|
 |

|
 |
 
R. Batista-Brito, R. Machold, C. Klein, and G. Fishell
Gene Expression in Cortical Interneuron Precursors is Prescient of their Mature Function
Cereb Cortex,
October 1, 2008;
18(10):
2306 - 2317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hishimoto, Q.-R. Liu, T. Drgon, O. Pletnikova, D. Walther, X.-G. Zhu, J. C. Troncoso, and G. R. Uhl
Neurexin 3 polymorphisms are associated with alcohol dependence and altered expression of specific isoforms
Hum. Mol. Genet.,
December 1, 2007;
16(23):
2880 - 2891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rissone, M. Monopoli, M. Beltrame, F. Bussolino, F. Cotelli, and M. Arese
Comparative Genome Analysis of the Neurexin Gene Family in Danio rerio: Insights into Their Functions and Evolution
Mol. Biol. Evol.,
January 1, 2007;
24(1):
236 - 252.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. R. Sheckler, L. Henry, S. Sugita, T. C. Sudhof, and G. Rudenko
Crystal Structure of the Second LNS/LG Domain from Neurexin 1{alpha}: Ca2+ BINDING AND THE EFFECTS OF ALTERNATIVE SPLICING
J. Biol. Chem.,
August 11, 2006;
281(32):
22896 - 22905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Beglopoulos, M. Montag-Sallaz, A. Rohlmann, K. Piechotta, M. Ahmad, D. Montag, and M. Missler
Neurexophilin 3 Is Highly Localized in Cortical and Cerebellar Regions and Is Functionally Important for Sensorimotor Gating and Motor Coordination
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7278 - 7288.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-Y. Liu and G. A. Brent
Thyroid Hormone-Dependent Gene Expression in Differentiated Embryonic Stem Cells and Embryonal Carcinoma Cells: Identification of Novel Thyroid Hormone Target Genes by Deoxyribonucleic Acid Microarray Analysis
Endocrinology,
February 1, 2005;
146(2):
776 - 783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Meunier, C Mattei, P Chameau, G Lawrence, C Colasante, A. Kreger, J. Dolly, and J Molgo
Trachynilysin mediates SNARE-dependent release of catecholamines from chromaffin cells via external and stored Ca2+
J. Cell Sci.,
January 4, 2000;
113(7):
1119 - 1125.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ichtchenko, M. A. Bittner, V. Krasnoperov, A. R. Little, O. Chepurny, R. W. Holz, and A. G. Petrenko
A Novel Ubiquitously Expressed alpha -Latrotoxin Receptor Is a Member of the CIRL Family of G-protein-coupled Receptors
J. Biol. Chem.,
February 26, 1999;
274(9):
5491 - 5498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Missler, R. E. Hammer, and T. C. Sudhof
Neurexophilin Binding to alpha -Neurexins. A SINGLE LNS DOMAIN FUNCTIONS AS AN INDEPENDENTLY FOLDING LIGAND-BINDING UNIT
J. Biol. Chem.,
December 25, 1998;
273(52):
34716 - 34723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Missler and T. C. Sudhof
Neurexophilins Form a Conserved Family of Neuropeptide-Like Glycoproteins
J. Neurosci.,
May 15, 1998;
18(10):
3630 - 3638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Geppert, M. Khvotchev, V. Krasnoperov, Y. Goda, M. Missler, R. E. Hammer, K. Ichtchenko, A. G. Petrenko, and T. C. Sudhof
Neurexin Ialpha Is a Major alpha -Latrotoxin Receptor That Cooperates in alpha -Latrotoxin Action
J. Biol. Chem.,
January 16, 1998;
273(3):
1705 - 1710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nguyen and T. C. Sudhof
Binding Properties of Neuroligin 1 and Neurexin 1beta Reveal Function as Heterophilic Cell Adhesion Molecules
J. Biol. Chem.,
October 10, 1997;
272(41):
26032 - 26039.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sugita, F. Saito, J. Tang, J. Satz, K. Campbell, and T. C. Sudhof
A stoichiometric complex of neurexins and dystroglycan in brain
J. Cell Biol.,
July 23, 2001;
154(2):
435 - 446.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|