WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (32)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petrenko, A. G.
Right arrow Articles by Südhof, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petrenko, A. G.
Right arrow Articles by Südhof, T. C.

 Previous Article  |  Next Article 

Volume 16, Number 14, Issue of July 15, 1996 pp. 4360-4369
Copyright ©1996 Society for Neuroscience

Structure and Evolution of Neurexophilin

Alexander G. Petrenko1, 2, Beate Ullrich1, Markus Missler1, Valery Krasnoperov2, Thomas W. Rosahl1, and Thomas C. Südhof1

1 Howard Hughes Medical Institute and Department of Molecular Genetics, The University of Texas Southwestern Medical School, Dallas, Texas 75235, and 2 Department of Environmental Medicine, New York University Medical Center, New York, New York 10016

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Using affinity chromatography on immobilized alpha -latrotoxin, we have purified a novel 29 kDa protein, neurexophilin, in a complex with neurexin Ialpha . Cloning revealed that rat and bovine neurexophilins are composed of N-terminal signal peptides, nonconserved N-terminal domains (20% identity over 80 residues), and highly homologous C-terminal sequences (85% identity over 169 residues). Analysis of genomic clones from mice identified two distinct neurexophilin genes, one of which is more homologous to rat neurexophilin and the other to bovine neurexophilin. The first neurexophilin gene is expressed abundantly in adult rat and mouse brain, whereas no mRNA corresponding to the second gene was detected in rodents despite its abundant expression in bovine brain, suggesting that rodents and cattle primarily express distinct neurexophilin genes. RNA blots and in situ hybridizations revealed that neurexophilin is expressed in adult rat brain at high levels only in a scattered subpopulation of neurons that probably represent inhibitory interneurons; by contrast, neurexins are expressed in all neurons. Neurexophilin contains a signal sequence and is N-glycosylated at multiple sites, suggesting that it is secreted and binds to the extracellular domain of neurexin Ialpha . This hypothesis was confirmed by binding recombinant neurexophilin to the extracellular domains of neurexin Ialpha . Together our data suggest that neurexophilin constitutes a secreted glycoprotein that is synthesized in a subclass of neurons and may be a ligand for neurexins.

Key words: neurexins; alpha -latrotoxin; synapse; gene duplication; neuron-specific receptor; inhibitory interneurons


INTRODUCTION

alpha -Latrotoxin, a component of black widow spider venom, is a potent presynaptic neurotoxin (Frontali et al., 1976; Rosenthal and Meldolesi, 1989). Acute administration of alpha -latrotoxin causes massive neurotransmitter release; chronic exposure results in cell membrane damage and synaptic degeneration. An understanding of the molecular mechanisms of alpha -latrotoxin toxicity is beginning to emerge. The toxin binds to high-affinity receptors that are localized in the presynaptic plasma membrane of the nerve terminal (Tzeng and Siekevitz, 1979; Valtorta et al., 1984). Binding of toxin results in Ca2+ influx into nerve terminals, activation of synaptic vesicle exocytosis, and ATP depletion (Grasso et al., 1980; McMahon et al., 1990). Interestingly, alpha -latrotoxin triggers synaptic vesicle exocytosis even in the absence of extracellular Ca2+, suggesting that the toxin stimulates Ca2+-independent vesicle exocytosis (Misler and Hurlbut, 1979).

A protein complex that binds alpha -latrotoxin with high affinity was purified from bovine and rat brain and shown to consist of a set of high molecular weight proteins of 160-220 kDa and a low molecular weight protein of 29 kDa (Petrenko et al., 1990, 1993). The high molecular weight proteins represent splice variants of neurexin Ialpha (Ushkaryov et al., 1992), and recombinant neurexin Ialpha binds alpha -latrotoxin with high affinity (Davletov et al., 1995). The identity and characteristics of the low molecular weight protein, however, remain unknown.

Neurexins are membrane proteins with the characteristics of cell-surface receptors. They are encoded by at least three genes, each of which has two independent promoters directing transcription of longer alpha -neurexins and shorter beta -neurexins. The neurexin transcripts are subject to extensive alternative splicing (Geppert et al., 1992; Ushkaryov et al., 1992, 1994; Ushkaryov and Südhof, 1993). This probably results in the synthesis of >1000 neurexin isoforms that are expressed differentially in subpopulations of neurons in the brain (Ullrich et al., 1995). The domain structure of the neurexins suggests a receptor function, possibly in cell adhesion. In support of this hypothesis, a family of neuronal cell surface proteins named neuroligins, which bind to beta -neurexins in a splice variant-specific manner, was described recently (Ich- tchenko et al., 1995, 1996). It seems likely that additional ligands for neurexins that may also be splice-site specific will be discovered. On the intracellular side, neurexins contain a short cytoplasmic tail that interacts with the synaptic vesicle protein synaptotagmin (Petrenko et al., 1991; Hata et al., 1993) and with a novel protein called CASK that contains CaM kinase- and dlg-like sequences (Hata et al., 1996).

We have now studied the structure, properties, and expression of the low molecular weight protein that is purified on immobilized alpha -latrotoxin. We propose to name this protein neurexophilin because of its strong binding to neurexin Ialpha . Our data reveal that neurexophilin is a secreted cysteine-rich glycoprotein. Neurexophilin is expressed in a brain-specific manner in a subset of neurons that are scattered throughout the nervous system. Together our data raise the possibility that neurexophilin represents a novel ligand for alpha -neurexins.


MATERIALS AND METHODS

Cloning and sequencing of cDNAs and genomic clones encoding neurexophilins. A PCR-based cDNA cloning strategy was used to take advantage of the single short peptide sequence (sequence: VVEFEVSPQSTLETK) obtained previously from purified neurexophilin (Petrenko et al., 1993). PCRs using primers A and B or C (sequences: A = GGCTGCAGTNGTNGA[G,A]TT[C,T] GA; B = GGTCTAGAA[A,G,T]CA[G,A]AGNT CNCA; and C = GGTCTAGAANCA[A,G]AG[A,G]TTNCA; n = all nucleotides; other redundant nucleotide combinations are shown in brackets) were performed on single-stranded bovine brain cDNA as template, as described by Ushkaryov and Südhof (1993). PCR products of approximately the right size were subcloned in M13 vectors and analyzed by sequencing. One M13 clone with the correct sequence was identified and used to screen cDNA libraries (Sambrook et al., 1989; Südhof, 1990). Mouse genomic clones were isolated from different lambda  libraries using the rat cDNA as a probe and mapped and sequenced, essentially as described (Südhof, 1990). All DNA sequencing was performed on M13 subclones using the dideoxy nucleotide-chain termination method (Sanger et al., 1977) with fluorescently labeled primers, Taq DNA polymerase, and an ABI373A DNA sequencer for analysis. Sequences were analyzed on a PC using Intelligenetics software and submitted to Genbank (accession numbers L27867[GenBank], L29868[GenBank], U56650[GenBank], and U56651[GenBank]).

RNA preparation and blotting. Total RNA isolated from different rat and bovine tissues by guanidinium isothiocyanate extraction was analyzed by blotting, using uniformly 32P-labeled probes as described (Ushkaryov et al., 1992). To control for RNA loads, blots were rehybridized with a cyclophilin probe.

In situ hybridizations were performed on rat brain sections using 35S-labeled oligonucleotides corresponding to rat and bovine neurexophilins, essentially as described (Gerfen et al., 1992; Ullrich et al., 1995). Two controls were performed to verify specificity of labeling. First, hybridizations were performed in a 50- and 100-fold excess of unlabeled oligonucleotide to determine which signal could be competed away and was therefore specific. Second, two antisense oligonucleotides from different regions of the mRNAs were used for the experiments to ensure that the signal that was observed corresponded to the mRNA being studied. Neurexophilin 1 oligonucleotides used for in situ hybridizations were T964 and T1065 [sequences (redundant positions shown in brackets): CCAGGACAC[A,G]TGACT[C,T]TG[A,G]GTCTGCTCCT GGTA[G,A]CAG and AATCTGTGCCATTTTCTTTACCACGGAAAGTCTGTGAGAGGA] and T1066 (CTGGAGA CTGTTTAACAAACAGGCGCAGAGGGTTGATGATCC) for neurexophilin 2.

Antibodies. The antibodies used for the current study were raised against the following synthetic peptides coupled to keyhole limpet hemocyanin (Johnston et al., 1989; Petrenko et al., 1993): (1) a synthetic peptide containing residues 261-271 of rat neurexophilin (the C terminus), which in bovine neurexophilin exhibits three amino acid substitutions (F508); (2) a peptide containing residues 167-179 of bovine neurexophilin of which only five residues are conserved in rat neurexophilin (A550); (3) a peptide from the C terminus of neurexin II that reacts with all neurexins (A473) (Ushkaryov et al., 1992). Specificities of the antibodies were assessed by competition studies, with the respective synthetic peptides used for immunizations.

Expression of neurexophilins and IgG-fusion proteins by transfection in COS cells. Expression vectors encoding full-length bovine and rat neurexophilins (pCMVDelta 1 and pCMVDelta 2, respectively) were constructed by subcloning the cDNA clones into the appropriate pCMV vectors. The expression construct encoding the N-terminal truncated rat neurexophilin preceded by the signal sequence (pCMVDelta 3) was obtained by deleting the coding sequence for the cleaved pro-peptide portion by PCR-based site-directed mutagenesis. IgG-neurexin Ialpha and IgG-control proteins were produced in COS cells by transfection of previously described constructs (Ichtchenko et al., 1995). DNA transfections into COS cells were performed as described (Gorman, 1985), using DEAE-dextran.

alpha -Latrotoxin affinity chromatography was performed using homogenates from frozen bovine and rat brains, as described (Petrenko et al., 1993). The protein components of the preparations were characterized by SDS-PAGE followed by Coomassie blue staining or by immunoblotting with antibodies to neurexins and neurexophilin.

Sucrose gradient and gel filtration experiments. The nature of the binding of neurexophilin to neurexins purified on immobilized alpha -latrotoxin was studied by sucrose gradient centrifugations in the presence of different concentrations of NaCl and different detergents and by gel filtration on a Sephacryl S-300 column (7 × 137 mm) equilibrated with either 6 M urea, 75 mM Tris-HCl, pH 7.4, or with 7 M guanidinium-HCl, pH 1.7. The neurexin/neurexophilin samples were applied to and eluted from the column with the respective buffers at a flow rate of 7.5 ml/hr. Fractions (0.1 ml) were analyzed by electrophoresis and immunoblotting with anti-neurexophilin and anti-neurexin antibodies.

Binding of recombinant neurexin Ialpha to neurexophilin. Recombinant neurexin Ialpha -IgG and control IgG-fusion proteins were immobilized on protein A-agarose (20 µl/1 ml culture medium) from the medium of transfected COS cells after the addition of 40 mM Tris-HCl, pH 8.0. The portion of the rat neurexophilin cDNA encoding residues 111-271 was subcloned into the XbaI site of pGEX-KG using PCR. Recombinant GST-fusion proteins were expressed and purified as described on glutathione-agarose (Smith and Johnson, 1988). Protein eluted from the glutathione agarose column was purified additionally by DEAE-Sepharose for some experiments. The protein A-agarose beads containing recombinant IgG-fusion proteins were washed twice with incubation buffer (40 mM Tris-HCl, pH 8.0, 0.3 M NaCl, 1% Triton X-100, 1% bovine serum albumin), preincubated in 80 µl of this buffer for 2 hr, and then incubated 30 min after the addition of ~1 µg GST-neurexophilin added in 20 µl of the same buffer containing 5 mM glutathione but lacking bovine serum albumin. After incubation, samples were centrifuged, and the beads were washed twice with 40 mM Tris-HCl, pH 8.0, 0.15 M NaCl. Beads were resuspended in 40 µl SDS-PAGE sample buffer, and 10 µl of the bead fraction and the supernatants from the incubations were analyzed by SDS-PAGE and immunoblotting.

Deglycosylation of native and recombinant neurexophilin. Proteins purified by affinity chromatography on alpha -latrotoxin (30 µg/ml protein) were dialyzed against 50 mM Na2HPO4, pH 7.4, 0.1% Triton X-100, to remove KCl, denatured with SDS/beta -mercaptoethanol, and treated with recombinant PNGase F (New England Biolabs, Beverly, MA) with control incubations in the absence of the enzyme. Transfected COS cells and their culture media were digested with PNGase F in the same manner. Samples were analyzed by SDS-PAGE and immunoblotting using anti-neurexophilin antibodies.


RESULTS

Molecular cloning of rat and bovine neurexophilins

Only a single short peptide sequence from bovine neurexophilin was obtained in previous studies (sequence: VVEFEVSPQSTLETK; Petrenko et al., 1993). This sequence contains two serine residues, making direct screening of cDNA libraries with redundant oligonucleotides difficult. Therefore we performed PCRs on single-stranded bovine brain cDNA templates using highly degenerate oligonucleotides encoding the N- and C-terminal five amino acids of this peptide (see Materials and Methods). PCR products of the expected size (58 bp) were cloned into M13 vectors and sequenced. One M13 clone had the correct sequence and was used as a probe for cDNA screening, resulting in the identification of partial bovine neurexophilin cDNA clones. These were then used as probes to isolate rat and bovine cDNA clones for neurexophilin that were full-length with respect to the coding region (pDelta 7 and pDelta 14).

The cDNA sequences were used to determine the amino acid sequences of rat and bovine neurexophilins (shown aligned with each other in Fig. 1A). Databank searches revealed no significant similarity to current entries, suggesting that the neurexophilins are novel proteins. Analyses of the rat and bovine sequences suggested that the primary translation product of neurexophilin has a multidomain structure (Fig. 1B). At the N terminus, rat and bovine neurexophilins contain a single hydrophobic sequence that has the characteristics of a signal peptide with putative cleavage sites after residues 21 (rat) or alternatively 20 or 22 (bovine) (von Heijne, 1987). After the putative signal sequence, an 80-residue sequence is observed in neurexophilins that exhibits little similarity between the rat and bovine sequences (20% identity) but ends in a conserved polybasic sequence (double-underlined in Fig. 1A). After this nonconserved region, rat and bovine neurexophilin contain a 169-residue sequence that is well conserved (85% identity). This sequence can be subdivided into an N-terminal half that exhibits only a single amino acid substitution between rat and bovine neurexophilin and contains three N-glycosylation sites, and a C-terminal half that is characterized by six conserved cysteine residues (shaded in Fig. 1A). The two conserved C-terminal domains are separated from each other by a short stretch of a nonconserved sequence (residues 171-188 in rat neurexophilin). Thus the domain model of neurexophilins suggests that they are composed of an N-terminal signal peptide, an N-terminal variable domain, and two C-terminal conserved domains (Fig. 1B).


Fig. 1. Structure of rat and bovine neurexophilins. A, Amino acid sequences of rat and bovine neurexophilins. Protein sequences were deduced from the cDNA nucleotide sequences (Genbank accession numbers L27867[GenBank] and L29868[GenBank]). Sequences are identified on the left (R, rat; B, bovine neurexophilin) and numbered on the right. Residues that are different between the rat and bovine sequences are marked by asterisks. The putative N-terminal signal sequence is shown in bold typeface, and its predicted cleavage site is marked by an arrow. The basic tetrapeptide sequence (RTKR) at the boundary between variable and conserved domains is double-underlined and shown in bold typeface. Conserved cysteine residues are shaded, and the four N-linked glycosylation consensus sequences are underlined. B, Domain structure of neurexophilin. Four domains are proposed: (1) a signal peptide at the N terminus; (2) a nonhomologous N-terminal region that may constitute a propeptide; (3) a highly conserved middle segment that contains three N-glycosylation consensus sequences (branched lines); and (4) a conserved C-terminal sequence characterized by six conserved cysteine residues (indicated by C).
[View Larger Version of this Image (54K GIF file)]

Characterization of murine neurexophilin genes

Rat and bovine neurexophilin exhibit no significant sequence homology with each other in their signal sequences and the following N-terminal 87 residues and are only 85% identical over their C-terminal regions. This is an unusually low degree of similarity for the same proteins from different mammals, suggesting the possibility that the proteins we cloned may be isoforms instead of homologs. To investigate this possibility, we screened a murine genomic library by low-stringency hybridization with coding region probes from neurexophilins. Two classes of clones were isolated that correspond to two different neurexophilin genes (Fig. 2). In both classes of genomic clones, a single large exon encoding neurexophilin was identified that initiates at the end of the signal sequence and contains all of the remaining coding sequence (Fig. 3A,B). The exon is preceded by a typical intron acceptor site (underlined in Fig. 3A,B) and as far as sequenced also contains the complete 3' untranslated region of the neurexophilin mRNA. Only the first 18 and 17 amino acids encoded by the rat and bovine cDNAs are missing in the exon, suggesting that the complete coding sequence for neurexophilin is contained in two exons, one encoding the signal peptide and the second encoding the remaining parts of the protein. The first exon was not identified in the genomic clones isolated, indicating that the intron in the gene is rather large.
Fig. 2. Partial structure of murine neurexophilin genes. The diagram depicts restriction maps of the murine neurexophilin 1 (Nxph-1) and neurexophilin 2 (Nxph-2) genes as deduced from the genomic clones identified below the maps. Restriction enzyme cleavage sites are indicated by letters (B, BstBI; C, ClaI; E, EcoRV; H, HindIII; K, KpnI; S, SpeI). The locations of exons are marked by boxes; closed boxes indicate coding and open boxes indicate 3' untranslated regions. The scale of the drawing is given in the lower right corner.
[View Larger Version of this Image (15K GIF file)]


Fig. 3. Sequences of neurexophilin genes: implications for evolution. The nucleotide sequences of the 3' ends of the intron and the large exon of the murine neurexophilin 1 and neurexophilin 2 genes are shown in A and B, together with the translated amino acid sequences. Underlined sequences correspond to the intron acceptor site. In C, the amino acid sequences of the murine neurexophilin 1 and 2 genes (labeled M1 and M2 on the left) are aligned with the corresponding sequences from rat and bovine neurexophilin (identified as R and B on the left). Residues that are identical in all four sequences are shown in bold typeface. Positions at which the murine neurexophilin 1 gene sequence is identical with the rat neurexophilin sequence and the murine neurexophilin 2 sequence is identical with the bovine neurexophilin sequence, but at which these two groups differ from each other, are marked by an asterisk above the corresponding residue to highlight the close relation of the neurexophilin 1 gene with rat neurexophilin and of the neurexophilin 2 gene with bovine neurexophilin. Overall, the mouse neurexophilin 1 sequence is 61% identical with the mouse neurexophilin 2 sequence, 99% identical with the rat neurexophilin sequence, and 63% identical with the bovine neurexophilin sequence. Conversely, the mouse neurexophilin 2 sequence is 60% identical with the rat neurexophilin sequence but 88% identical with the bovine neurexophilin sequence, whereas the bovine and rat neurexophilin sequences are 60% identical in the region shown. All sequences are numbered on the right.
[View Larger Version of this Image (54K GIF file)]

Comparison of the protein sequences predicted from the genomic clones with those of rat and bovine neurexophilins revealed that one of the genes is more similar to rat neurexophilin and is referred to as the neurexophilin 1 gene. By contrast, the second gene, referred to as the neurexophilin 2 gene, is more similar to bovine neurexophilin (Fig. 3C). In the N-terminal nonconserved domain, murine neurexophilin 1 is almost identical with the rat sequence (1 mismatch over 80 residues) but exhibits little similarity to bovine or mouse neurexophilin 2 (60 mismatches over 80 residues). Conversely, the N-terminal domain of mouse neurexophilin 2 is 70% identical with that of bovine neurexophilin but exhibits only 25% identity with rat or mouse neurexophilin 1 (Fig. 3C). Thus, the murine genome contains at least two neurexophilin genes, one of which corresponds to neurexophilin cDNAs isolated from rat brain and the other corresponds to cDNAs from bovine brain.

Only the neurexophilin 1 gene generates a detectable mRNA in mice

The genomic cloning results raised two alternative hypotheses: (1) two neurexophilin isoforms are expressed in mice and other mammals from two distinct genes; and (2) mammals primarily express only one neurexophilin isoform, although two genes are present, but different mammals (i.e., rodents vs cattle) may express different isoforms. To differentiate between these two hypotheses, we used RNA blots and in situ hybridization experiments and investigated the expression of neurexophilins in adult mice, rats, and cattle. Of all tissues tested, hybridizing neurexophilin mRNAs were observed only in brain (see below and data not shown). Blots of adult brain RNAs with probes from the two types of neurexophilin surprisingly revealed that in mouse and rat brain, only mRNAs corresponding to the neurexophilin 1 gene (i.e., rat neurexophilin) were detectable (Fig. 4 and data not shown). Conversely, in bovine brain only the bovine form of neurexophilin corresponding to mouse neurexophilin 2 was found (data not shown). Using redundant oligonucleotides hybridizing to conserved sequences in both neurexophilins, polymerase chain reactions were performed with total cDNA from adult mouse brains. Only a single band was amplified that on sequencing was found to contain only neurexophilin 1 (data not shown). Together these data indicate that only transcripts corresponding to neurexophilin 1 are present at measurable levels in adult rat and mouse brain, whereas bovine brain primarily expresses transcripts corresponding to neurexophilin 2. Although we cloned both genes only from mice and not from rats and cows, it seems likely that both genes are also present in these organisms. The presence of distinct neurexophilin genes and their expression pattern in mice, rats, and cattle suggest that neurexophilin genes duplicated in evolution before the divergence of rodents and cattle, and that after the divergence, high expression of one gene was maintained in rodents and of the other gene in cattle.
Fig. 4. RNA blot analysis of the expression of the two murine neurexophilin genes in mouse brain. Blots containing electrophoretic separated mouse brain RNA were hybridized consecutively with probes from the coding regions of the murine neurexophilin 1 and 2 genes (lanes 1 and 2) and with a GAPDH probe at a positive control (lanes 3 and 4). Numbers on the left indicate positions of molecular weight markers in kilobases (kb).
[View Larger Version of this Image (35K GIF file)]

Pattern of neurexophilin 1 expression in rat brain

RNA blots indicated that neurexophilin mRNA was detectable only in nervous tissues (data not shown). To examine which cells in brain express neurexophilin, in situ hybridizations were performed with 35S-labeled oligonucleotides from two different regions of the cDNA. All hybridizations were performed in the presence and absence of a 100-fold excess of unlabeled oligonucleotide to control for nonspecific labeling. Hybridization of horizontal rat brain sections revealed expression of rat neurexophilin in neurons in most brain structures in a nonuniform, granular pattern (Fig. 5). Particularly high expression was observed in selected thalamic nuclei (arrowheads) and in the glomerular layer of the olfactory bulb (arrows). The nonuniform labeling pattern was especially evident in the cerebral cortex, which has a peppered appearance (open arrows). Parallel experiments with an oligonucleotide corresponding to neurexophilin 2 gave no specific hybridization signals in rat brain (data not shown).
Fig. 5. Expression of neurexophilin in rat brain visualized by in situ hybridization. Horizontal sections at two different levels were hybridized with a 35S-labeled oligonucleotide specific for neurexophilin and exposed to film without screen. Note the granular hybridization pattern in most brain regions, particularly in the cerebral cortex (open arrows in A and B). A strong uniform signal is observed only in the periglomerular zone of the olfactory bulb (arrows in B) and in some of the thalamic nuclei (arrowheads in A and B), especially the anteroventricular, medial habenular, paraventricular, subgeniculate, reuniens, and reticular thalamic nuclei.
[View Larger Version of this Image (126K GIF file)]

The granular pattern of the hybridization signal suggests that only subpopulations of neurons express neurexophilin. To test this hypothesis, expression was examined at the cellular level. A comparison of the expression of synaptotagmin I (Fig. 6A), neurexophilin (B), and neurexins (C; the oligonucleotide that was used hybridizes with all neurexin mRNAs) in the hippocampus showed that only a small subpopulation of neurons express high levels of neurexophilin mRNA. Although synaptotagmin I and neurexins are expressed in all identifiable neurons, neurexophilin was not detected in the most abundant classes of neurons in the hippocampal formation, such as the pyramidal cells of the CA1-CA4 regions and the granule cells of the dentate gyrus. Only interspersed cells likely to be inhibitory interneurons contained high levels of neurexophilin mRNA. Similar results were obtained with the cerebellum where again the majority of the mRNA was localized to basket and Golgi cells and not to the predominant granule cells (data not shown). Finally, investigation of the olfactory bulb revealed strong staining of periglomerular neurons (Fig. 7) that probably accounts for the strong signal seen in the olfactory bulb in the overview (Fig. 5). In addition, scattered cells that may correspond to tufted cells in the external plexiform layer were also labeled. In contrast, the mitral cells and granule cells, the major cell types in the olfactory bulb, did not express neurexophilin. Together these data suggest that neurexophilin is expressed selectively in subpopulations of neurons, probably primarily inhibitory interneurons.


Fig. 6. Distribution of neurexophilin mRNA in hippocampus. Rat hippocampal sections were hybridized with 35S-labeled oligonucleotides corresponding to synaptotagmin I (A) or neurexophilin (B) or to a consensus sequence present in all neurexins (C). Note the presence of neurexins and synaptotagmin I in apparently all neurons in the hippocampus, whereas neurexophilin is absent from most hippocampal neurons, including pyramidal cells of the hippocampus proper and granule cells of the dentate gyrus (DG); however, neurexophilin is present at high levels in scattered neurons of the hippocampus (straight arrows) and dentate gyrus (curved arrows) that seem to be primarily inhibitory interneurons.
[View Larger Version of this Image (49K GIF file)]


Fig. 7. Distribution of neurexophilin mRNA in the olfactory bulb. Panels show sections of rat olfactory bulb hybridized with 35S-labeled oligonucleotides specific for neurexophilin (A) or for neurexin Ialpha (B). Neurexophilin mRNA is present at high levels in two cell types: periglomerular neurons in the glomerular layer (GL) that are uniformly positive for neurexophilin mRNA (open arrowheads) and scattered neurons of the external plexiform layer that may correspond to tufted cells (full arrows). Note the absence of neurexophilin mRNA from the mitral cell layer (MCL) and the granule cell layer (GCL), which are strongly positive for neurexin Ialpha .
[View Larger Version of this Image (70K GIF file)]

Neurexophilin co-purifies with bovine and rat neurexin Ialpha on immobilized alpha -latrotoxin

To test whether the neurexophilins we cloned correspond to the 29 kDa protein that co-purifies with neurexin Ialpha on immobilized alpha -latrotoxin, we raised antibodies against peptides containing residues 167-179 of bovine neurexophilin and residues 261-271 of rat neurexophilin. Testing of these antibodies with rat and bovine neurexophilin expressed in COS cells confirmed that each reacted specifically with the corresponding protein (data not shown). As expected from the limited sequence similarity between rat neurexophilin 1 and bovine neurexophilin 2 in the peptides used for immunizations, the bovine neurexophilin antibody did not react with rat neurexophilin, and the rat neurexophilin antibody recognized bovine neurexophilins only weakly.

We then isolated rat and bovine neurexin Ialpha and associated 29 kDa proteins by affinity chromatography on immobilized alpha -latrotoxin and analyzed them by immunoblotting for the presence of neurexophilins. The 29 kDa proteins from both species reacted strongly with the neurexophilin antibodies (Fig. 8). This result confirms that the proteins we cloned are identical with the 29 kDa proteins that co-purify with neurexin Ialpha on immobilized alpha -latrotoxin. Rat neurexophilin isolated on immobilized alpha -latrotoxin reacted only with the anti-rat neurexophilin 1 antibody, and bovine neurexophilin reacted strongly with the bovine neurexophilin 2 antibody and only weakly with the rat neurexophilin 1 antibody. The lack of immunoreactivity of antibodies to bovine neurexophilin 2 with the alpha -latrotoxin affinity eluate from rat brain despite its strong reactivity with the eluate from bovine brain provides further support for the conclusion that neurexophilin 2 is not expressed in rodent brain.


Fig. 8. Neurexophilins are co-purified with neurexin Ialpha by affinity chromatography on immobilized alpha -latrotoxin from rat and bovine brain. Rat and bovine alpha -latrotoxin binding proteins were purified from brain homogenates by affinity chromatography on immobilized alpha -latrotoxin and analyzed by SDS-PAGE in the presence or absence of beta -mercaptoethanol (beta -ME). Gels were immunoblotted with antibodies against synthetic peptides corresponding to residues 167-179 of bovine neurexophilin (left) or to residues 261-271 of rat neurexophilin (right). Numbers on the left indicate positions of molecular weight markers.
[View Larger Version of this Image (36K GIF file)]

Association of neurexophilins with neurexin Ialpha

Previous studies demonstrated that after purification on immobilized alpha -latrotoxin, the 29 kDa protein corresponding to neurexophilin co-purified with neurexin Ialpha during additional sucrose gradient centrifugation and anion exchange chromatography procedures, suggesting that they are complexed to each other (Petrenko et al., 1993). Because neurexophilin migrates as a monomer on SDS-PAGE in the absence or presence of reducing agents (Fig. 8), neurexin Ialpha and neurexophilin are not linked to each other by disulfide bonds. To characterize their association better, we probed for conditions under which neurexin Ialpha and neurexophilin dissociate by performing sucrose gradient centrifugation and gel filtration experiments under denaturing conditions.

Dissociation could not be obtained in 2 M NaCl on sucrose gradients or in 6 M urea on gel filtration columns (Fig. 9 and data not shown). Neurexophilin was dissociated only from neurexin Ialpha in 7 M guanidinium-HCl at pH 1.7 (Fig. 9). These results suggest that the neurexophilin-neurexin Ialpha complex, although noncovalent, requires complete denaturation for dissociation.


Fig. 9. Tight binding of neurexophilin to neurexins. The stability of the neurexin-neurexophilin complex purified on immobilized alpha -latrotoxin was analyzed by gel filtration on a Sephacryl S-300 column in 6 M urea, 75 mM Tris-HCl, pH 7.4 (top), or in 7 M guanidinium-HCl, pH 1.7 (bottom). The first 1.8 ml of column eluate was discarded, and 0.1 ml fractions were subjected to immunoblotting using antibodies against the C terminus of neurexins or bovine neurexophilin, as indicated. Immunoreactive bands were visualized by ECL. Note that neurexophilin comigrates with neurexin Ialpha at high molecular weights in 6 M urea but dissociates from neurexin Ialpha in 7 M guanidinium-HCl. In the samples containing urea, protein migration in the gel is slightly distorted.
[View Larger Version of this Image (34K GIF file)]

Post-translational processing of neurexophilins

Neurexophilins co-purified with neurexin Ialpha on immobilized alpha -latrotoxin migrate as 29 kDa proteins on SDS-PAGE (Fig. 8). Digestion with PNGase F (which cleaves N-linked sugars) shifts the apparent size of neurexophilin to 19 kDa (Fig. 10). This result demonstrates that neurexophilins are highly N-glycosylated, a hypothesis that was confirmed with transfected COS cells in which at least three N-glycosylated intermediates of neurexophilin could be distinguished (data not shown).
Fig. 10. N-glycosylation of neurexophilin. Neurexophilin complexed to neurexin Ialpha was purified by affinity chromatography on immobilized alpha -latrotoxin and incubated with or without PNGase F. Samples (0.5 µg protein) were analyzed by immunoblotting with antibodies to neurexophilin. Numbers on the right indicate positions of molecular weight markers.
[View Larger Version of this Image (29K GIF file)]

Although neurexophilin purified on immobilized alpha -latrotoxin migrates at ~19 kDa after deglycosylation, its predicted size after signal sequence cleavage amounts to ~28 kDa, suggesting that neurexophilin may be proteolytically processed after synthesis. This raises two possibilities: (1) neurexophilin is a preproprotein that is proteolytically processed in the secretory pathway; and (2) nonspecific proteolysis during purification leads to partial degradation. The simplest method of distinguishing between these hypotheses would be to determine the size of neurexophilin in fresh total brain homogenates before any nonspecific proteolysis can occur; however, we were unable to detect neurexophilin in total brain homogenates, possibly because of the relatively low affinity of our neurexophilin antibodies or of the low abundance of the protein, making it currently impossible to differentiate between these alternatives.

Binding of recombinant neurexophilin to the extracellular domain of neurexin Ialpha

The fact that neurexophilins are N-glycosylated, contain a signal peptide, and lack a transmembrane region suggests that they are secreted and presumably bind to the extracellular part of neurexin Ialpha . To test this directly, the extracellular domains of neurexin Ialpha were produced as a recombinant fusion protein with the Fc portion of human IgG. The neurexin-IgG fusion protein as well as a control IgG Fc domain were immobilized on protein A-agarose and mixed with neurexophilin produced as a recombinant GST-fusion protein in bacteria. Quantitative binding of neurexophilin was observed only to neurexin Ialpha but not to the control (Fig. 11), suggesting that neurexophilin binds to the extracellular domains of neurexin Ialpha .
Fig. 11. Binding of recombinant neurexophilin to neurexin Ialpha -IgG fusion protein and to IgG control protein. Purified GST-neurexophilin fusion protein (0.1 µg, lane 1) was mixed with immobilized control IgG fusion protein (lanes 2 and 4) or with neurexin Ialpha -IgG fusion protein (lanes 3 and 5), incubated, and centrifuged. Pellets and supernatants were analyzed by immunoblotting for neurexophilin, demonstrating retention of neurexophilin with the control IgG matrix but pelleting with the neurexin Ialpha -IgG matrix.
[View Larger Version of this Image (42K GIF file)]


DISCUSSION

Neurexins constitute a polymorphic family of neuronal cell surface proteins (Ushkaryov et al., 1992, 1994; Ullrich et al., 1995). Neurexin Ialpha , the founding member of the family, was discovered in studies on the mechanism of action of alpha -latrotoxin, a potent excitatory neurotoxin. Affinity chromatography of rat and bovine brain proteins on immobilized alpha -latrotoxin revealed that two proteins were purified specifically in a Ca2+-dependent manner (Petrenko et al., 1993): a set of high molecular weight proteins that represent splice variants of neurexin Ialpha , and a low molecular weight protein that we have now named neurexophilin. The two proteins co-purify with each other in several separation procedures, suggesting that they are present in a complex; however, recombinant neurexin Ialpha binds alpha -latrotoxin with high affinity and does not need to be complexed to neurexophilin for binding (Davletov et al., 1995), indicating that neurexophilin is purified on immobilized alpha -latrotoxin piggy-back in a complex with neurexin Ialpha . We have now studied the molecular nature of neurexophilin and of its association with neurexin Ialpha .

We have cloned cDNAs encoding neurexophilins from rat and bovine brain, isolated genomic clones encoding most of the coding regions for two neurexophilins from mice, investigated their pattern of expression, and studied the biochemical properties of neurexophilin and its binding to neurexin Ialpha . The structures of rat and bovine neurexophilins revealed that they are novel proteins without significant similarity to current databank entries. Sequence analyses suggested a four-domain structure for neurexophilins: (1) an N-terminal signal peptide; (2) an N-terminal nonconserved sequence; (3) a conserved region containing no cysteine residues but three potential N-glycosylation sites; and (4) a C-terminal domain characterized by six conserved cysteine residues (Fig. 1). No hydrophobic region except for the putative signal peptide was observed. The presence of a signal sequence in neurexophilin and the absence of hydrophobic transmembrane regions suggest that neurexophilin is a secreted protein. This hypothesis was supported by the demonstration that neurexophilin is highly N-glycosylated and has to transverse the secretory pathway.

Neurexophilin was purified first in a complex with neurexin Ialpha (Petrenko et al., 1993). Studies on the nature of this complex revealed an unexpectedly tight association (Fig. 9). Only strong denaturants (SDS, guanidinium hydrochloride) could dissociate them from each other. Comparison of the size of the deglycosylated peptide backbone of purified neurexophilin complexed to neurexin Ialpha with the calculated size of the protein after signal sequence cleavage revealed that the purified protein is smaller than expected. It is unclear at present whether this size discrepancy is attributable to proteolytic processing of neurexophilin during biosynthesis or whether the protein is partially degraded during purification by nonspecific proteases. The low affinity of our antibodies and the low abundance of neurexophilin did not allow us to address this question directly. Antibodies against the C terminus of neurexophilin, however, react with the purified protein complexed to neurexin Ialpha , suggesting that it contains the C terminus and lacks the nonconserved N terminus. Because in many secreted proteins that are processed from precursor proteins (such as NGF) the removed propeptide often is not evolutionarily conserved, this observation supports the notion that neurexophilin is synthesized as a prepropeptide and proteolytically processed in the secretory pathway. Future experiments will have to address this question.

In situ hybridizations demonstrated that neurexophilin is expressed in a restricted pattern strikingly different from that of neurexins. Neurexins are present in all identifiable neurons, with distinct heterogeneous expression patterns for different subtypes (Ullrich et al., 1995). By contrast, no neurexophilin mRNA was detected in the majority of neurons. Only a relatively small subclass of neurons that corresponded primarily to inhibitory interneurons contained abundant levels of neurexophilin mRNA. These data suggest that neurexophilin, unlike neurexins, is not expressed universally in neurons.

The overall sequence homology between bovine and rat neurexophilin is surprisingly low. There is little similarity between the bovine and rat proteins in the putative signal sequence and the N-terminal 80 residues that follow the signal peptide. Even in the conserved C-terminal domains, the sequence conservation is much lower than that observed in comparisons between rat and bovine neurexins (>95% identity as opposed to 85% identity in neurexophilins; Ullrich et al., 1995). This observation prompted us to investigate the possibility that the rat and bovine cDNAs we cloned are not exact homologs but are isoforms.

Isolation of genomic clones encoding neurexophilins from mice revealed the presence of two murine neurexophilin genes, referred to as the neurexophilin 1 and 2 genes. The similarity between the structures and sequences of the two murine neurexophilin genes suggests that they resulted from an evolutionary gene duplication event that was followed by sequence divergence with selective conservation of the C-terminal sequences of neurexophilins. The following evidence supports the hypothesis that the two neurexophilin genes do not encode two isoforms co-expressed in the same organism, but rather one or the other neurexophilin gene is expressed selectively at high levels in different species. (1) Multiple cDNAs isolated from rat and bovine brain libraries under low stringency conditions exclusively encoded only one type of neurexophilin that corresponded to either neurexophilin 1 (rat) or neurexophilin 2 (bovine). (2) No neurexophilin 2 mRNA could be detected in RNA blots in rat and murine brain RNA but was expressed abundantly in bovine brain RNA, whereas neurexophilin 1 mRNA was abundant in rat and mouse RNA. (3) No neurexophilin 2 sequence could be amplified from mouse cDNA by the polymerase chain reaction. (4) In situ hybridizations failed to detect cells expressing neurexophilin 2 in adult rat brain. (5) Antibodies to neurexophilins 1 and 2 failed to detect neurexophilin 2 in rat alpha -latrotoxin affinity eluate. Although these data do not completely rule out expression of neurexophilin 2 in rodents or of neurexophilin 1 in cattle, especially in tissues and at developmental time points distinct from those studied here, they are compatible with the hypothesis that at some time in evolution, after the neurexophilin genes had duplicated and diverged, expression of the neurexophilin 2 gene was depressed in rodents, and expression of the neurexophilin 1 gene was depressed in cattle. This resulted in the expression of distinct types of genes in rodents and cattle.

Together our findings characterize a novel neuronal glycoprotein that has an unusual evolutionary history, is expressed in a small subset of neurons, and binds to neurexin Ialpha and potentially other neurexins. Future studies will have to determine whether neurexophilin serves as a ligand for neurexins and what the determinants and functional implications of this interaction are, especially in view of their unusual relative distributions in brain.


FOOTNOTES

Received Feb. 22, 1996; revised April 19, 1996; accepted April 24, 1996.

  

This research was supported by National Institutes of Health Grants MH52804 (T.C.S.) and NS34937 (A.G.P.), and by fellowship grants from the Deutsche Forschungsgemeinschaft to B.U., M.M., and T.W.R. We thank I. Leznicki, A. Roth, H. Tripoli, and E. Borowicz for excellent technical assistance; Drs. M. S. Brown and J. L. Goldstein for critical advice; and Drs. J. Dixon and D. W. Russell for the gift of expression vectors and cDNA libraries.

Correspondence should be addressed to Thomas C. Südhof, Howard Hughes Medical Institute, Room Y5.322, 5323 Harry Hines Boulevard, Dallas TX 75235.



REFERENCES

  • Davletov B, Krasnoperov V, Hata Y, Petrenko AG, Südhof TC (1995) High affinity binding of alpha -latrotoxin to recombinant neurexin Ialpha . J Biol Chem 270:23903-23905. [Abstract/Free Full Text]
  • Frontali N, Ceccarelli B, Gorio A, Mauro A, Siekevitz P, Tzeng MC, Hurlbut WP (1976) Purification from black widow spider venom of a protein factor causing the depletion of synaptic vesicles at neuromuscular junctions. J Cell Biol 68:462-479. [Abstract/Free Full Text]
  • Geppert M, Ushkaryov YA, Hata Y, Davletov B, Petrenko AG, Südhof TC (1992) Neurexins. Cold Spring Harbor Symp Quant Biol LVII: 483-490.
  • Gerfen CR, Young WS, Emson P (1992) In situ hybridization histochemistry with oligonucleotides for localization of messenger RNA in neurones. In: Experimental neuroanatomy: a practical approach (Bolam, JP, eds) , p. 173. Oxford: IRL.
  • Gorman C (1985) High efficiency gene transfer into mammalian cells. In: DNA cloning, (Glover, DM, eds) , Vol II, p. 143. Oxford: IRL.
  • Grasso A, Alema S, Rufini S, Senni MI (1980) Black widow spider toxin-induced calcium fluxes and transmitter release in a neurosecretory cell line. Nature 283:774-776. [Medline]
  • Hata Y, Butz S, Südhof TC (1996) CASK: a novel dlg/PSD95 homolog with an N-terminal calmodulin-dependent protein kinase domain identified by interaction with neurexins. J Neurosci 16:2488-2494. [Abstract/Free Full Text]
  • Hata Y, Davletov B, Petrenko R, Jahn R, Südhof TC (1993) Interaction of synaptotagmin with the cytoplasmic domains of neurexins. Neuron 10:307-315. [Web of Science][Medline]
  • Ichtchenko K, Hata Y, Nguyen T, Ullrich B, Missler M, Moomaw C, Südhof TC (1995) Neuroligin 1: a splice-site specific ligand for beta -neurexins. Cell 81:435-443. [Web of Science][Medline]
  • Ichtchenko K, Nguyen T, Südhof TC (1996) Structure, alternative splicing, and neurexin binding of multiple neuroligins. J Biol Chem 271:2676-2682. [Abstract/Free Full Text]
  • Johnston PA, Jahn R, Südhof TC (1989) Transmembrane topography and evolutionary conservation of synaptophysin. J Biol Chem 264:1268-1273. [Abstract/Free Full Text]
  • McMahon HT, Rosenthal L, Meldolesi J, Nichols DG (1990) alpha -Latrotoxin releases both vesicular and cytoplasmic glutamate from isolated nerve terminals. J Neurochem 55:2039-2047.
  • Misler S, Hurlbut WP (1979) Action of black widow spider venom on quantized release of acetylcholine at the frog neuromuscular junction: dependence upon external Mg2+. Proc Natl Acad Sci USA 76:991-995. [Abstract/Free Full Text]
  • Petrenko AG, Kovalenko VA, Shamotienko OG, Surkova IN, Tarasyuk TA, Ushkaryov YA, Grishin EV (1990) Isolation and properties of the alpha-latrotoxin receptor. EMBO J 9:2023-2027. [Web of Science][Medline]
  • Petrenko AG, Lazaryeva VD, Geppert M, Tarasyuk TA, Moomaw C, Khokhlatchev AV, Ushkaryov YA, Slaughter C, Nasimov IV, Südhof TC (1993) Polypeptide composition of the alpha -latrotoxin receptor. J Biol Chem 268:1860-1867. [Abstract/Free Full Text]
  • Petrenko AG, Perin MS, Davletov BA, Ushkaryov YA, Geppert M, Südhof TC (1991) Binding of synaptotagmin to the alpha -latrotoxin receptor implicates both in synaptic vesicle exocytosis. Nature 353:65-68. [Medline]
  • Rosenthal L, Meldolesi J (1989) Alpha-latrotoxin and related toxins. Pharmacol Ther 42:115-134. [Web of Science][Medline]
  • Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd ed. .
  • Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467. [Abstract/Free Full Text]
  • Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31-40. [Web of Science][Medline]
  • Südhof TC (1990) The structure of the human synapsin I gene and protein. J Biol Chem 265:7849-7852. [Abstract/Free Full Text]
  • Tzeng MC, Siekevitz P (1979) The binding interaction between alpha- latrotoxin from black widow spider venom and a dog cerebral cortex synaptosomal membrane preparation. J Neurochem 33:263-274. [Web of Science][Medline]
  • Ullrich B, Ushkaryov YA, Südhof TC (1995) Cartography of neurexins: more than 1000 isoforms generated by alternative splicing and expressed in distinct subsets of neurons. Neuron 14:497-507. [Web of Science][Medline]
  • Ushkaryov YA, Südhof TC (1993) Neurexin IIIalpha : extensive alternative splicing generates membrane-bound and soluble forms in a novel neurexin. Proc Natl Acad Sci USA 90:6410-6414. [Abstract/Free Full Text]
  • Ushkaryov YA, Hata Y, Ichtchenko K, Moomaw C, Afendis S, Slaughter CA, Südhof TC (1994) Conserved domain structure of beta -neurexins. J Biol Chem 269:11987-11992. [Abstract/Free Full Text]
  • Ushkaryov YA, Petrenko AG, Geppert M, Südhof TC (1992) Neurexins: synaptic cell surface proteins related to the alpha -latrotoxin receptor and laminin. Science 257:50-56. [Abstract/Free Full Text]
  • Valtorta F, Maddedu L, Meldolesi J, Ceccarelli B (1984) Specific localization of the alpha-latrotoxin receptor in the nerve terminal plasma membrane. J Cell Biol 99:124-132. [Abstract/Free Full Text]
  • von Heijne G (1987) Sequence analysis in molecular biology: treasure trove or trivial pursuit. .

Copyright ©1996 Society for Neuroscience   0270-6474/1996/164360-10$05.00/0



This article has been cited by other articles:


Home page
Cereb CortexHome page
R. Batista-Brito, R. Machold, C. Klein, and G. Fishell
Gene Expression in Cortical Interneuron Precursors is Prescient of their Mature Function
Cereb Cortex, October 1, 2008; 18(10): 2306 - 2317.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Hishimoto, Q.-R. Liu, T. Drgon, O. Pletnikova, D. Walther, X.-G. Zhu, J. C. Troncoso, and G. R. Uhl
Neurexin 3 polymorphisms are associated with alcohol dependence and altered expression of specific isoforms
Hum. Mol. Genet., December 1, 2007; 16(23): 2880 - 2891.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. Rissone, M. Monopoli, M. Beltrame, F. Bussolino, F. Cotelli, and M. Arese
Comparative Genome Analysis of the Neurexin Gene Family in Danio rerio: Insights into Their Functions and Evolution
Mol. Biol. Evol., January 1, 2007; 24(1): 236 - 252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. R. Sheckler, L. Henry, S. Sugita, T. C. Sudhof, and G. Rudenko
Crystal Structure of the Second LNS/LG Domain from Neurexin 1{alpha}: Ca2+ BINDING AND THE EFFECTS OF ALTERNATIVE SPLICING
J. Biol. Chem., August 11, 2006; 281(32): 22896 - 22905.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. Beglopoulos, M. Montag-Sallaz, A. Rohlmann, K. Piechotta, M. Ahmad, D. Montag, and M. Missler
Neurexophilin 3 Is Highly Localized in Cortical and Cerebellar Regions and Is Functionally Important for Sensorimotor Gating and Motor Coordination
Mol. Cell. Biol., August 15, 2005; 25(16): 7278 - 7288.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y.-Y. Liu and G. A. Brent
Thyroid Hormone-Dependent Gene Expression in Differentiated Embryonic Stem Cells and Embryonal Carcinoma Cells: Identification of Novel Thyroid Hormone Target Genes by Deoxyribonucleic Acid Microarray Analysis
Endocrinology, February 1, 2005; 146(2): 776 - 783.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
F. Meunier, C Mattei, P Chameau, G Lawrence, C Colasante, A. Kreger, J. Dolly, and J Molgo
Trachynilysin mediates SNARE-dependent release of catecholamines from chromaffin cells via external and stored Ca2+
J. Cell Sci., January 4, 2000; 113(7): 1119 - 1125.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
K. Ichtchenko, M. A. Bittner, V. Krasnoperov, A. R. Little, O. Chepurny, R. W. Holz, and A. G. Petrenko
A Novel Ubiquitously Expressed alpha -Latrotoxin Receptor Is a Member of the CIRL Family of G-protein-coupled Receptors
J. Biol. Chem., February 26, 1999; 274(9): 5491 - 5498.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Missler, R. E. Hammer, and T. C. Sudhof
Neurexophilin Binding to alpha -Neurexins. A SINGLE LNS DOMAIN FUNCTIONS AS AN INDEPENDENTLY FOLDING LIGAND-BINDING UNIT
J. Biol. Chem., December 25, 1998; 273(52): 34716 - 34723.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Missler and T. C. Sudhof
Neurexophilins Form a Conserved Family of Neuropeptide-Like Glycoproteins
J. Neurosci., May 15, 1998; 18(10): 3630 - 3638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Geppert, M. Khvotchev, V. Krasnoperov, Y. Goda, M. Missler, R. E. Hammer, K. Ichtchenko, A. G. Petrenko, and T. C. Sudhof
Neurexin Ialpha Is a Major alpha -Latrotoxin Receptor That Cooperates in alpha -Latrotoxin Action
J. Biol. Chem., January 16, 1998; 273(3): 1705 - 1710.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nguyen and T. C. Sudhof
Binding Properties of Neuroligin 1 and Neurexin 1beta Reveal Function as Heterophilic Cell Adhesion Molecules
J. Biol. Chem., October 10, 1997; 272(41): 26032 - 26039.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Sugita, F. Saito, J. Tang, J. Satz, K. Campbell, and T. C. Sudhof
A stoichiometric complex of neurexins and dystroglycan in brain
J. Cell Biol., July 23, 2001; 154(2): 435 - 446.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (32)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petrenko, A. G.
Right arrow Articles by Südhof, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petrenko, A. G.
Right arrow Articles by Südhof, T. C.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-