 |
Previous Article | Next Article 
Volume 16, Number 15,
Issue of August 1, 1996
pp. 4638-4650
Copyright ©1996 Society for Neuroscience
APPL, the Drosophila Member of the APP-Family,
Exhibits Differential Trafficking and Processing in CNS Neurons
Laura Torroja,
Liqun Luo, and
Kalpana White
Department of Biology and Volen National Center for Complex
Systems, Brandeis University, Waltham, Massachusetts 02254
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
The Drosophila Appl gene encodes a transmembrane protein
that is expressed exclusively in neurons. Amino acid comparisons show
that APPL protein is a member of the amyloid precursor protein
(APP)-like family of proteins. Similar to mammalian APP-family
proteins, APPL is synthesized as a transmembrane holoprotein and
cleaved to release a large secreted amino-terminal domain. Using
immunocytochemical methods, we have analyzed the distribution of APPL
in the Drosophila CNS. Surprisingly, although APPL is
present in all neuronal cell bodies, the neuropil shows stereotypic
differential distribution. Double-labeling experiments with different
neuronal markers were used to distinguish between APPL associated with
neuronal processes or extracellular matrix. The distribution of APPL
protein produced from transgenes encoding wild-type (APPL),
secretion-defective (APPLsd), and constitutively
secreted (APPLs) forms was analyzed in
an Appl-deficient background to determine which APPL form is
associated with different neuropil regions. We found that
APPLsd protein is enriched where APPL
immunoreactivity coincides with neuronal processes. In contrast,
APPLs preferentially localizes to those parts of
the neuropil that show a diffuse APPL signal that rarely colocalizes
with processes, and thus seems to be a component of the extracellular
matrix. These data indicate that proteolytic cleavage and trafficking
of APPL is differentially regulated in different neuronal populations.
Through metamorphosis, APPL is especially abundant in growing axons and
in areas where synapses are forming. Interestingly, in adult brains,
APPL protein is enriched in the mushroom bodies and to a lesser extent
in the central complex, structures involved in learning and memory.
Key words:
amyloid precursor protein family;
neuropil distribution;
mushroom bodies;
protein sorting and processing;
mutant transgenes;
Alzheimer's disease
INTRODUCTION
The Drosophila APPL protein shares
sequence and structural homology with the members of the amyloid
precursor protein (APP) family (Rosen et al., 1989 ). The single mature
Appl transcript is expressed exclusively in the nervous
system in most, and likely all, developing and mature neurons (Luo et
al., 1990 ; Martin-Morris and White, 1990 ). Mutational analysis
indicates that Appl is not a vital gene (Luo et al., 1992 );
however, the behavioral deficits exhibited by mutant flies lacking
Appl gene (Appld) imply that
APPL protein is necessary for the proper function of the nervous
system. Transgenes encoding Drosophila APPL protein and a
human neural APP isoform are able to provide similar rescue of the
behavioral defects displayed by Appld
flies. Similarly, mice with impaired APP function are viable, yet they
display functional deficits in behavioral assays (Müller et al.,
1994 ; Zheng et al., 1995 ). Together with the sequence homology, these
data indicate that APPL is a member of a family that is
evolutionary-conserved in domain structure and function; however, the
cellular processes in which these proteins engage in the nervous system
remain poorly understood.
Along with APP and APPL, the APP-family of proteins now includes two
closely related genes in mammals, APLP1 and APLP2 (Wasco et al., 1992 ,
1993 ), one gene in nematodes (Daigle and Li, 1993 ), and one gene in
Xenopus (Okado and Okamoto, 1992 ). APP, APLP1, APLP2, and
APPL are all synthesized as membrane-spanning glycoproteins (Kang et
al., 1987 ; Luo et al., 1990 ; Wasco et al., 1992 , 1993 ), suggesting that
they might serve as surface receptors. The finding that APP can
associate and activate a G0 protein through its
cytoplasmic domain supports this hypothesis (Nishimoto et al., 1993 ;
Okamoto et al., 1995 ). These proteins, however, undergo proteolytic
cleavage that releases the large soluble ectodomain (Weidemann et al.,
1989 ; Luo et al., 1990 ; Sisodia et al., 1994 ; Slunt et al., 1994 ).
In vitro experiments have shown that secreted APP displays
several trophic activities (Milward et al., 1992 ; Jin et al., 1994 ) and
can regulate neuronal activity (Barger et al., 1995 ; Furukawa et al.,
1996 ), supporting the physiological importance of the proteolytic
processing.
In this study, we took an immunocytochemical approach to analyze the
in vivo regulation of APPL processing and trafficking in
neurons and to gain insights into the biological significance of APPL
holoprotein and secreted forms. A detailed analysis of APPL
distribution in the CNS in different developmental stages was
performed. In addition, using transgenes encoding mutant APPL proteins
that mimic the secreted form as well as the membrane-spanning form, the
in vivo distribution of the transmembrane and soluble forms
was examined. Specifically, we demonstrate that although synthesized in
all neurons, neuronal processes and the extracellular neuropil show
stereotypic differential distribution of the two APPL forms and that
this distribution is dynamic during development. Furthermore, in the
adult brain, APPL is concentrated in the mushroom bodies and to a
lesser extent in the central complex, centers involved in associative
learning and memory in insects. These findings suggest that
transmembrane and secreted APPL forms have their respective roles and
reinforce our previous finding that Appl is essential for
optimal nervous system function (Luo et al., 1992 ).
MATERIALS AND METHODS
Fly strains. Generation of
Appld mutant has been described previously
(Luo et al., 1992 ). In summary, a synthetic interstitial deletion of
the central region of Appl gene was created by translocating
a duplication containing all of the genes distal to Appl
(y+m64) to the right
arm of the X-chromosome that carried a terminal deletion that extended
through Appl locus (Df(1)RT518).
All autosomal transgenes were kept in Df(1)w background.
Affinity purification of antibodies against APPL. Antiserum
from rabbit 952, which was immunized with the secreted form of APPL
generated in the baculovirus cells, was used for affinity purification
of anti-APPL antibodies. Monospecific antibodies for APPL (Ab952M) were
affinity-purified against the baculovirus-secreted APPL protein
immobilized on a nitrocellulose filter, following the protocol
described in Sambrook et al. (1989) . The specificity of the
affinity-purified anti-APPL antibody was tested by comparing
Canton S and Appld samples in
both immunoblots and immunocytochemistry.
DNA constructs for germline transformation. Caspar vector
(Pirrotta, 1988 ) was used as the germline transformation vector. The
three constructs used in this study
(hsp:Appl+,
hsp:Applsd, and
hsp:Appls) were made using hsp70 promoter.
The construction of hsp:Appl+ and
hsp:Applsd has been described (Luo et al.,
1990 , 1992 ). To generate hsp:Appls,
oligo-directed mutagenesis [with oligo ggccaccgctaatcgagctt
using an oligonucleotide-directed in vitro mutagenesis
system (Amersham, Arlington Heights, IL) according to the
manufacturer's specification] was performed with cDNA s1 of
Appl (Rosen et al., 1989 ) in Bluescript
SK+ as the template. The mutated EcoRI
fragment of s1 (Appls) was then inserted
into hsp:Appl+ cDNA (Luo et al., 1990 ),
replacing the wild-type counterpart. The hsp:Appls
XbaI fragment was cloned into Caspar, which had been
digested with XbaI.
P-element-mediated germline transformation was performed according to
described methods (Spradling and Rubin, 1982 ). Df(1)w flies
were the parental strain for all germline transformations. Flies
bearing autosomal homozygous transgenes were used for
immunocytochemical analysis. Two independent insertions of each
transgene were used in all of the experiments.
Heat-shock experiments. Male third-instar larvae were
collected from the progeny of the cross
Appld/Appld × Df(1)w;
hsp:Appl*/hsp:Appl*. After
a 1 hr heat shock at 37°C, larvae were allowed to rest at room
temperature (RT) for 2 or 4 hr, and brains were dissected and
immunoprocessed for confocal microscopy.
Adult males of genotype Appld;
hsp:Appl*/+ were heat-shocked at 37°C for
30 min, allowed to rest for different times, and frozen on dry ice. For
each sample, the same number of frozen heads was collected into
Eppendorf tubes and homogenized for immunoblotting experiments. For
adult immunohistochemistry, after a resting period of 2-4 hr, heads
were cut off and immediately processed for paraffin sectioning.
Protein extraction, electrophoresis, and immunoblot. Frozen
heads were extracted directly in 2× SDS buffer. The sample was boiled
for 3 min and spun in the microcentrifuge for 5 min before
electrophoretic analysis. All protein gels were 7.5% SDS-PAGE gels
with 3% stacking gels, according to standard protocols (Harlow and
Lane, 1988 ). Bio-Rad (Richmond, CA) mini-gel (200 V, 45 min) was
used.
For immunoblotting, gels were electrotransferred onto nitrocellulose
with standard procedures (Harlow and Lane, 1988 ) for 1 hr at 100 V on
ice. Immunoreaction with Ab952M (dilution 1:100) was visualized using
an ECL Western blot detection system (Amersham) according to the
manufacturer's specifications.
Confocal microscopy. CNSs were dissected in ice-cold PBS,
fixed in 4% paraformaldehyde for 1 hr at RT, washed six times in PBT
(0.3% Triton X-100, 0.1% BSA, in PBS) for 15 min each, and incubated
for 1 hr in PBT with 5% normal goat serum (NGS). After primary
antibody incubation at 4°C overnight (rabbit anti-APPL antibody
Ab952M; dilution 1:5), samples were washed in PBT 6 × 15 min and
blocked with 5% NGS. A 1:100 dilution of FITC-conjugated goat
anti-rabbit secondary (Cappel) was used to incubate the sample for 4 hr
at RT (or 4°C overnight). Samples were washed for another 6 × 15 min
in PBT and mounted in n-propyl gallate medium or processed
further for double-labeling experiments. For double-labeling, samples
were then incubated with either mouse MAb 22C10 (dilution 1:5), mouse
monoclonal anti- -galactosidase (Promega, Madison, WI) (dilution
1:250), or mouse monoclonal anti-Fasciclin III (dilution 1:5). These
antibodies were revealed with a rhodamine-conjugated goat anti-mouse
antibody (Jackson ImmunoResearch Laboratories, West Grove, PA)
(dilution 1:100).
Confocal microscopy was performed on Bio-Rad MRC600. The CM program was
used throughout. For double-labeling visualization, K1 and K2 filters
were used.
Immunohistochemistry of sections. Cryostat sections of
frozen nonfixed flies were cut, allowed to dry, and fixed for 20 min at
RT with 4% paraformaldehyde. After 6 × 5 min washes with PBT,
sections were incubated overnight at 4°C with anti-APPL antibody
Ab952M diluted 1:25 in PBT. Biotinylated anti-rabbit antibody (Vector
Labs, Burlingame, CA) (dilution 1:100) was used as secondary antibody,
and antigen-antibody complexes were detected using an HRP-conjugated
avidin-biotin complex (ABC diluted 1:100; Vectastain Elite ABC Kit,
Vector Labs). Signal was revealed with DAB or VIP (Vector Labs)
substrates. After they were rinsed in PBS, sections were dehydrated to
xylene and coverslipped.
To obtain higher signal, paraffin sections were subjected to a modified
microwave antigen-retrieval protocol (Sherriff et al., 1994 ). Briefly,
whole flies or heads were fixed in nonalcoholic Bouins overnight at
4°C, dehydrated, and embedded in paraffin. Sections (8 µm) were
mounted onto glass slides, dried overnight at 42°C, deparaffinized in
xylenes, and rehydrated to water. To enhance antigen detection, all
sections on slides were microwave-irradiated at full power in
H2O for 10 min, cooled to RT, and transferred to
fresh H2O for 5 min. Sections were then washed 6 × 5 min with PBT and immunoprocessed following the protocol described
for frozen sections. Although this method is more sensitive and
provides better morphology, the level of immunoreactive signal can vary
between different experiments.
For staging pupal development, white pupae were collected and raised at
25°C and dissected at different intervals thereafter. Under these
conditions, the adult stage is reached in ~100 hr.
RESULTS
APPL protein is differentially distributed in the neuropil
APPL protein is present as a 145 kDa transmembrane protein and a
130 kDa soluble protein (Luo et al., 1990 ). The 145 kDa holoprotein is
converted to the 130 kDa secreted form by proteolytic cleavage. An
in vivo analysis of the intracellular trafficking and
secretion properties of APPL in the neuronal population is informative
for the following reasons. First, the biological properties of neurons
in terms of APPL protein-sorting can be specific, because neurons are
polarized cells where the transport of many proteins to axons and
dendrites is regulated precisely. Second, the metabolism of APPL may
differ between neurons, depending on their developmental and/or
physiological state. Third, the secreted APPL form may localize
extracellularly, and the extracellular localization may be indicative
of a site of function.
To gain insights into the function and intracellular trafficking and
secretion properties of APPL, we analyzed the localization of APPL
protein within the different functional regions of the nervous system
and at a subcellular level. The insect nervous system can be subdivided
operationally into three compartments: the cortical layer where
neuronal somata reside, the neuropil region where processes from the
overlaying cortex and incoming fibers from other centers ramify and
make synaptic contacts, and the fiber pathways that connect cortical
areas to the neuropil or connect adjacent neuropil regions. The
relative distribution of APPL protein in neuronal cell bodies, neuronal
processes, and the extracellular matrix can be revealed by analyzing
the presence of the protein in these three compartments.
To reveal APPL proteins, we used an affinity-purified polyclonal
antibody generated against the amino terminal ectodomain common to both
APPL forms (Ab952M; see Materials and Methods). To test the
immunocytochemical specificity of antibody Ab952M, we immunoprocessed
CNSs and developing eye disks of Canton S (wild type) (Fig.
1A) and
Appld (Fig. 1B) third-instar
larvae and analyzed the preparations with confocal microscopy. As shown
previously (Luo et al., 1990 ), in the eye disk only cells posterior to
the morphogenetic furrow, where photoreceptors are differentiating, are
APPL-immunoreactive. In the CNS, APPL is not detected in regions
containing neuroblasts, such as the optic proliferation centers. These
observations are consistent with the presence of Appl
transcripts in postmitotic neurons (Martin-Morris and White, 1990 ).
Most neurons in the ventral ganglion (VG) and the brain
lobes (BL) show similar levels of APPL immunoreactivity.
Under the same conditions, no immunoreactive signal was detected in
brains from Appld larvae (Fig.
1B). Thus, all the signal revealed with Ab952M is specific
to APPL proteins encoded by the Appl gene.
Fig. 1.
APPL immunoreactivity in wild-type larval CNS.
A, An optical section of a Canton S
(CS) larval CNS immunolabeled with Ab952M showing APPL
immunoreactivity in the neuronal cell bodies in the eye disks
(ed), ventral ganglion (VG), and brain lobes
(BL). Neuroblasts in the optic proliferation centers are not
APPL-immunoreactive (open arrow). Axons of photoreceptors
traveling through the eye stalk (es) show intense APPL
signal. B, An optical section through the CNS of an
Appld larvae stained with Ab952M. Note the
absence of APPL immunoreactivity. C, High magnification of
APPL immunoreactivity in neuronal cell bodies of the ventral ganglion.
APPL is concentrated in punctate structures surrounding nuclei.
D, Horizontal optical section through a CS larval
CNS showing APPL immunoreactivity in neuropil regions. In the ventral
ganglion, APPL is concentrated in the neuropil of the three thoracic
neuromeres (t1, t2, t3). In the connection between the
ventral ganglion and brain lobes, APPL is detected along axonal tracks
(thin arrow). In the central neuropil of the brain lobes,
APPL is concentrated in distinct areas (thick arrows). The
inset shows the posterior tip of the ventral ganglion where
APPL immunoreactivity is detected only in the neuropil of the eighth
abdominal neuromere (a8, small arrows). Anterior is to the
lower left for A and D, and to the
left for B. Scale bars: A, B, D, 50 µm; C, 10 µm.
[View Larger Version of this Image (84K GIF file)]
In the neuronal cell bodies, APPL is present in the cytoplasm and
concentrated in a punctate pattern (Fig. 1C). This pattern
of immunoreactivity is common to all neurons in the ventral ganglion,
brain lobes, and photoreceptors, and it resembles the subcellular
distribution of APP in mammalian cells (Kuentzel et al., 1993 ;
Allinquant et al., 1994 ; Caporaso et al., 1994 ). Similar to what was
observed in salivary gland cells in Drosophila (Luo et al.,
1990 ), APPL immunoreactivity is not detected at the cell surface of the
perikarya.
In contrast to the cortex where the punctate staining appeared
comparable in all areas of the CNS, APPL immunoreactivity in neuropil
areas was not homogeneous. Although some areas of the neuropil had
undetectable levels of APPL signal, other regions were intensely
stained in a reproducible way (Fig. 1D). Double-labeling
experiments using anti-APPL antibody and propidium iodide, which stains
nuclei, confirmed that these areas are devoid of nuclei and thus
correspond to neuropil regions enriched in neuronal processes (data not
shown). Neuropil regions displaying intense APPL signal, however, do
not contain higher density of neuronal processes and/or synaptic
contacts, as revealed by an antibody against the synaptic protein
synaptotagmin (Littleton et al., 1993 ) or the MAb 22C10 that labels
neuronal processes (Fujita et al., 1982 ) (data not shown). Figure
1D illustrates APPL protein distribution in the neuropil of
the CNS; in the ventral ganglion, intense APPL immunoreactivity is
observed in the neuropil of the three thoracic neuromeres
(t1, t2, and t3) and of the eighth
abdominal neuromere (a8; inset). In the rest of
the abdominal neuropil, no detectable levels of APPL protein were
observed (see inset in Fig. 1D). The
immunoreactivity in the intensely stained areas of the ventral ganglion
neuropil seems to be qualitatively different from the punctate signal
seen in cell bodies, because it has a uniform appearance. In the
neuropil of the paired brain lobes, the pattern is more complex,
because APPL protein seems to be concentrated in certain neuropil areas
as well as along certain fiber pathways (Fig. 1D).
The presence of APPL protein in certain axons is evidenced by the
strong APPL immunoreactivity associated with the photoreceptor axons in
the eye stalk (es; Fig. 1A). In the CNS,
the neuropil contains both axons and dendrites, making it difficult to
characterize the relative distribution of APPL in these neuronal
compartments. To determine whether APPL is present in dendrites, APPL
immunoreactivity was analyzed in sensory neurons of the peripheral
nervous system in embryos and leg imaginal disks of third-instar
larvae. In these neurons, APPL immunoreactivity concentrates in cell
bodies, whereas both dendrites and axons show very weak or no APPL
signal (data not shown).
In summary, we have shown that although APPL protein is present in most
if not all neuronal cell bodies in the third-instar larval CNS, its
neuropil distribution is strikingly different in different areas. In
some regions, APPL signal is uniform, as in the thoracic neuropil,
whereas in others, such as the optic stalk, APPL protein seems to be
associated with the fiber tracks.
Different APPL forms contribute to APPL immunoreactivity in
different areas of the neuropil
We were interested in analyzing whether APPL immunoreactivity
detected in the neuropil centers was associated with neuronal fibers or
with the extracellular matrix. Both possibilities are plausible,
because APPL holoprotein is membrane-associated and can be cleaved to
yield a secreted form. To answer this question, we double-labeled
third-instar larval CNS with Ab952M and antibodies against the
following markers for neuronal processes: an epitope recognized by the
antibody MAb 22C10 (Fujita et al., 1982 ); the cytoplasmic
-galactosidase protein expressed under the pan-neural
elav promoter (Luo et al., 1994 ); and the membrane protein
Fasciclin III (Patel et al., 1987 ). Figure 2 shows two
examples of larval brains immunoreacted with Ab952M (green)
and MAb 22C10 (red). Similar results were observed when
neuronal processes were labeled with anti- -galactosidase or
anti-Fasciclin III antibodies (data not shown). Based on the degree of
association between APPL protein and neuronal processes, we found two
opposite situations. In the neuropil of the thoracic neuromeres (Fig.
2E) and in some regions of the central neuropil of brain
lobes (Fig. 2B), APPL protein rarely colocalizes with the
neuronal markers used in this study. In some of these regions, as is
evidenced in Figure 2B (white arrow), APPL
immunoreactivity seems to girdle processes. On the other hand, in the
eye stalk (open arrow; Fig. 2B) and in the
developing neuropil of the optic lobes (Fig. 2D), APPL
immunoreactivity is closely associated with processes.
Fig. 2.
Localization of APPL relative to
neuronal processes labeled with MAb 22C10. A, Larval CNS
stained with anti-APPL (green) and 22C10 (red)
antibodies. Boxed area including eye disk and brain lobe is
shown at a higher magnification in B. B, In the
eye stalk, APPL immunoreactivity colocalizes with 22C10 epitope, as
revealed by the yellow color (open arrow). In the central
neuropil of the brain lobe, APPL seems to be surrounding neuronal
processes (white arrow). C, Optical section of a
larval CNS stained with anti-APPL (green) and 22C10
(red) antibodies. Two boxed areas, comprising the
optic lobe (D) in the brain lobe and the second thoracic
neuromere (E) in the ventral ganglion, are shown at higher
magnification in D and E, respectively.
D, A section through the larval optic lobe stained with
anti-APPL antibody (a), MAb 22C10 (b), and both
antibodies (c). The central semicircular region stained with
APPL corresponds to the neuropil of the medulla. Photoreceptor axons
are intensely stained with both antibodies (small arrow).
The thin arrow points to thick neuronal processes weakly
stained with both antibodies. Thin fibers that run over the surface of
the optic lobe are 22C10-immunoreactive and show APPL immunoreactivity
concentrated in varicosities (arrowhead). E, A
section through the second thoracic neuromere labeled with anti-APPL
(a), 22C10 (b), and both (c). Notice
that APPL immunoreactivity in this neuropil is not associated with
22C10-immunoreactive processes (arrow). In A-E,
anterior is to the left. Scale bars: A, C, 50 µm; B, D, E, 25 µm.
[View Larger Version of this Image (108K GIF file)]
APPL protein associated with neuronal processes might correspond to the
membrane-bound holoprotein, whereas APPL that is not associated with
processes might be the secreted ectodomain. To analyze how the
different forms of APPL protein contribute to APPL immunoreactivity, we
made use of transgenic flies that express wild-type APPL or mutant APPL
proteins, which mimic the membrane-bound or the secreted forms, in an
Appld genetic background. First we studied
the heat-shock response of the hsp:Appl+
transgene (Luo et al., 1992 ) by heat-shocking adult flies for 30 min
and examining the APPL proteins by immunoblot analysis after specified
intervals (Fig. 3A). Maximum levels of
protein are reached 4 hr after the heat shock. Two forms of
APPL+ protein are generated that show a
precursor-product relationship and correspond to the membrane-bound
holoprotein (145 kDa) and the secreted (130 kDa) forms. Therefore,
consistent with what has been shown previously in S2 cells (Luo et al.,
1990 ), in vivo processing of APPL+
protein produced from the heat-shock transgene is similar to the
processing of endogenous APPL protein. On the contrary, mutant
Appld flies carrying the
hsp:Applsd transgene (Luo et al., 1992 )
express a single form of APPL (Fig. 3C) and are unable to
generate a secreted protein. The hsp:Appls
transgene contains a mutated Appl cDNA, in which codon
789GAA has been changed to generate a
translation-stop TAA, so that the encoded protein lacks the
transmembrane and cytoplasmic domains (see Materials and Methods).
Flies carrying this construct in an Appld
background express only a secreted APPL protein (Fig. 3B).
The overall kinetics of expression of APPLsd and
APPLs is similar to that of the
APPL+ proteins when they are expressed under the
influence of heat-shock promoter (Fig. 3A-C).
Fig. 3.
Induction of hsp:Appl*
transgenes. Immunoblot of head protein extracts probed with
APPL-antibody. Adults were heat-shocked for 30 min at 37°C; protein
extracts were made from fly heads at 0, 0.5, 1, 2, 4, 6, 8, 10, and 12 hr after the heat shock. Control extracts from flies before heat shock
are loaded in the lane marked C. A,
Appld;
hsp:Appl+/+; B,
Appld;
hsp:Appls/+; C,
Appld;
hsp:Applsd/+. Same number of heads were
homogenized and loaded in each lane. Thin arrows point to
APPL bands. Arrowheads point to a cross-reactive band,
present also before induction.
[View Larger Version of this Image (74K GIF file)]
We compared APPL immunoreactivity in Canton S brains and in
brains from Appld larvae carrying
hsp:Appl+,
hsp:Applsd, or
hsp:Appls transgenes. The antibody Ab952M
was used, and larval CNSs were fixed and immunoprocessed 2-4 hr after
the heat shock. These preparations were analyzed with confocal
microscopy, and the APPL immunoreactivity was compared in the cortex,
in the thoracic neuropil, and in the optic lobe neuropil.
Because the differential distribution of APPL in the neuropil could be
a consequence of cell-specific differences in the levels of
Appl transcription, we first proceeded to characterize APPL
immunoreactivity generated from the
hsp:Appl+ transgene. Under these
conditions, APPL protein should be produced at similar levels in all
neurons, because the heat-shock response is expected to be the same in
nearly all cells (Bonner and Pardue, 1976 ; Lis et al., 1983 ). In
general, APPL immunoreactivity in heat-shocked transgenic brains is
lower than in the wild-type brain. In the cortex, neuronal cell bodies
show a punctate APPL immunoreactivity (Fig.
4C). In the ventral ganglion, APPL signal in
the cortex is quite uniform (Fig. 4D), and although some
cells show slightly higher levels of protein, the position of these
cells varies from sample to sample and does not correlate with the
pattern of immunoreactivity observed in the neuropil. APPL
immunoreactivity in the neuropil, however, resembles the pattern
observed in wild-type larval CNS, in both the ventral ganglion (Fig.
4A,B) and brain lobes (data not shown). As in the wild type,
only the neuropil regions of the three thoracic neuromeres and the
eighth abdominal neuromere display positive immunoreactivity
(arrowheads, Fig. 4A,B). Thus, in a situation
where all neurons produce similar amounts of APPL protein, APPL
immunoreactivity in the neuropil still mimics the normal pattern,
suggesting that APPL trafficking varies between different neuronal cell
types and results in differential distribution of this protein in the
neuropil.
Fig. 4.
Localization of the APPL+
protein product of the induced hsp:Appl+
transgene. Third-instar larvae of genotype
Appld;
hsp:Appl+/+ were subjected to heat shock at
37°C for 1 hr, allowed to rest for 4 hr, and immunoprocessed as
described (see Materials and Methods). A, Horizontal optical
section through a CNS showing APPL distribution in the neuropil of the
ventral ganglion: APPL is concentrated in the neuropil of the thoracic
neuromeres (t1, t2); APPL is also found along axonal tracts
connecting the ventral ganglion and the brain lobes (arrow).
Compare with Figure 1D. B, Detail of APPL protein
detected in the neuropil (arrowheads) of the eighth
abdominal neuromere. Compare with Figure 1D,
inset. C, High magnification of APPL vesicle-like
signal observed in neuronal cell bodies. Compare with Figure
1C. D, Z-series projection of horizontal optical
sections through the ventral ganglion, exemplifying the uniform APPL
staining observed in the cortex of the heat-shocked larval CNS. In
A, B, and D, anterior is to the
left. Scale bars: A, B, D, 25 µm;
C, 10 µm.
[View Larger Version of this Image (100K GIF file)]
Mutant APPL proteins are detected in cell bodies at levels similar to
the induced wild-type protein, and they display the characteristic
punctate aspect (data not shown); however, in the neuropil the two
mutant forms behave differently. In the thoracic neuropil, induced
APPLs protein showed a distribution similar to
the induced wild-type APPL protein (compare Fig. 5,
A and B). In contrast,
APPLsd induction results in a very low signal in
the thoracic neuropil (Fig. 5C), and the residual
immunoreactive signal frequently is found along axonal tracts (not
shown). The situation in the optic lobe is converse to that in the
thoracic and central brain neuropils (Fig. 5D-F). Although
induced wild-type APPL and secretion-defective
APPLsd proteins show enrichment in this structure
at levels similar to endogenous APPL, the APPLs
form is found at very low levels.
Fig. 5.
Localization of APPL mutant proteins in
larval CNS. Larval CNS of genotypes (A, D)
Appld;
hsp:Appl+/+, (B, E)
Appld;
hsp:Appls/+, and (C, F)
Appld;
hsp:Applsd/+ were heat-shocked at
37°C for 1 hr, allowed to rest for 4 hr, and immunoprocessed with
anti-APPL antibody. A-C, A detail of APPL immunoreactivity
in the thoracic neuromeres in the ventral ganglion showing how
APPL+ (A) and
APPLs (B) proteins are concentrated in
this neuropil region (arrows), whereas
APPLsd is not (C). D-F, A
detail of APPL immunoreactivity in the optic lobe is shown. Although
APPL+ (D) and
APPLsd (F) proteins are found in the
optic neuropil (big arrow; see Fig. 4D for
endogenous APPL signal), APPLs protein
(E) is not detected in this region. Anterior is to the
lower left. Same magnification for A-F. Scale
bar (shown in F): 25 µm.
[View Larger Version of this Image (134K GIF file)]
In summary, these results show that those regions where APPL seems to
be associated with neuronal processes (optic lobes) are the regions
where secretion-defective APPLsd is enriched.
Secreted APPLs, however, concentrates in regions
that are rich in the APPL form that is not associated with processes
(thoracic neuromeres). These data suggest that APPL is secreted in some
areas of the neuropil, whereas in others it remains as a transmembrane
protein, indicating that the proteolytic processing of APPL is
differentially regulated.
APPL distribution in the neuropil is developmentally regulated
The results obtained so far strongly suggest that trafficking and
processing of APPL protein is regulated precisely. These differences
could be ascribed to the physiological or developmental stage of a
specific neuronal population. To gain insights into the biological
significance of the regulation of APPL metabolism, we analyzed the
distribution of APPL protein during metamorphosis, when the nervous
system undergoes dramatic changes, in two regions: the ventral ganglion
and the optic lobes. For this study we used both whole-mount
preparations and paraffin or cryostat sections stained with anti-APPL
antibody Ab952M.
We chose the ventral ganglion as a model to study developmental changes
during metamorphosis in APPL distribution because of the simplicity of
the pattern of APPL immunoreactivity observed and because the process
of remodeling that occurs during metamorphosis has been well
characterized in this structure (for review, see Truman et al., 1993 ).
We have previously observed APPL along the axon tracks in the
longitudinal and transverse commissures of the ventral cord in the
embryo (Luo et al., 1990 ). In the ventral ganglion of third-instar
larval CNS, APPL is no longer discerned along the longitudinal
commissures but is concentrated in certain areas of the neuropil (Fig.
1D). During the first 24 hr of metamorphosis, axons and
dendrites of larval neurons prune back, and new arborizations are
formed. Axonal growth from new adult-specific neurons and from
preexisting larval neurons starts at ~24 hr after pupariation and is
completed by 72 hr. Figure 6 illustrates how APPL
immunoreactivity changes during the metamorphosis of the ventral
ganglion. Immediately after pupariation (Fig. 6A), APPL
distribution in the ventral ganglion resembles that described for the
third-instar larval CNS. The most noticeable changes occur during the
early stages of metamorphosis. Six hours after pupariation, the
neuropil of the thoracic segments shows reduced APPL immunoreactivity
compared with the third-instar larval CNS (Fig. 6B). By 12 hr after pupariation, APPL-immunoreactive signal in the thoracic
neuropil is lower and comparable to that in the abdominal segments
(Fig. 6C). By 48 hr, levels of APPL protein in the neuropil
are very low, and isolated immunoreactive varicosities and processes
are clearly distinguishable (Fig. 6D). This pattern of APPL
immunoreactivity remains unchanged until adult stages (data not shown).
Fig. 6.
APPL immunoreactivity in the ventral ganglion
during metamorphosis. Optical section through whole-mount preparations
of ventral ganglions dissected from Canton S pupae at 0 hr
(A), 6 hr (B), 12 hr (C), and 48 hr
(D) after pupariation and stained with anti-APPL antibody.
Signal in the thoracic neuromere (arrow in A and
B) decreases after 6 hr, and by 12 hr APPL is distributed
evenly in the neuropil of the ventral ganglion (C). By 48 hr, the level of APPL in the neuropil is low, and distinct processes
(thin arrow) and varicosities (small arrow) are
revealed. For A-D, anterior is to the left.
Scale bars: A-D, 25 µm.
[View Larger Version of this Image (146K GIF file)]
Most of the neurons that form the optic lobes are new adult-specific
neurons. Differentiation of these neurons progresses during late larval
and pupal stages and has been well characterized (for review, see
Meinertzhagen and Hanson, 1993 ). The first half of metamorphosis is
characterized by axonal growth, whereas in the second half, synapses
are formed. The process of synaptogenesis seems to continue into the
adult. Thus, the optic lobe provides a well-studied structure for
correlating APPL metabolism and neuronal differentiation. Figure
7 shows APPL immunoreactivity in a section of the optic
lobe in three pupal stages and in the adult. At 0 hr after pupariation
(Fig. 7A), APPL protein is concentrated in photoreceptor
axons within the eye stalk and in the three neuropils of the optic
lobe: lamina (l), medulla (m), and lobula complex
(loc). During development, the optic lobe rotates dorsally,
and the relative position of the optic neuropils changes. By 25 hr,
APPL signal in the optic neuropils remains intense (Fig.
7B). Sixty hours after pupariation, APPL immunoreactivity in
the medulla is arranged in a modular distribution in three layers (Fig.
7C) that are reminiscent of the synaptic layers described in
the adult medulla (Bausenwein and Fischbach, 1992 ; Bausenwein et al.,
1992 ). APPL staining in the lamina becomes more intense, and axons are
distinguished clearly (Fig. 7C). In the adult (Fig.
7D), intense APPL immunoreactivity remains in the lamina
neuropil. APPL signal in the medulla and lobula neuropils is very low
and comparable with the rest of the brain neuropil, except for some
isolated axonal processes observed in the medulla.
Fig. 7.
APPL immunoreactivity in the optic lobe
during metamorphosis. Horizontal paraffin section of heads of 0 hr
(A), 25 hr (B), and 60 hr (C) pupae
and adult (D) stained with anti-APPL antibody. A,
0 hr after pupariation, APPL-immunoreactive photoreceptor axons project
from the eye disk (ed) through the eye stalk (es)
into the optic lobe. The lamina (l), the outer and inner
medulla neuropils (m), and the two neuropils in the lobula
complex (loc) in the optic lobes are highly stained with
APPL. B, By 25 hr after pupariation, APPL immunoreactivity
in the medulla neuropil starts to split into three layers, the two
outer ones being connected by processes. In the lobula complex, the
lobula (lo) and lobula plate (lop) neuropils are
intensely stained. C, 60 hr after pupariation, the optic
neuropils have rotated. In the lamina (l), axons are
distinguishable. In the medulla (m), APPL is arranged in
three layers, showing a columnar organization. D, In adult,
intense APPL signal remains only in the lamina neuropil (l).
In the medulla, isolated processes are APPL-im-munoreactive (thin
arrows). Some cell bodies show higher APPL immunoreactivity
(arrowhead; lamina cortex). For A-D, anterior is
at the top and lateral at the left. Same
magnification was used for all. Scale bar (shown in D): 25 µm.
[View Larger Version of this Image (164K GIF file)]
We have seen that during metamorphosis, the pattern of APPL
immunoreactivity in the neuropil of the nervous system displays dynamic
changes. In the ventral ganglion, these changes coincide with the
period of axon retraction and outgrowth. During the major period of
synaptogenesis in the optic lobes, the APPL immunoreactivity pattern in
the neuropil resembles the distribution of the synaptic layers.
In the adult, APPL is concentrated in the mushroom bodies
Larval CNS contains both fully differentiated and developing
neurons, whereas pupal CNS is composed essentially of developing
neurons. We wanted to study APPL distribution in adult brains, where
all neurons are physiologically mature. APPL immunoreactivity was
analyzed in frozen and paraffin sections of adult CNS. The cell bodies
of adult neurons display punctate APPL immunoreactivity. Some isolated
cells in the brain (Figs. 7D and 8B) and thoracic
ganglion (not shown) show higher levels of APPL expression. As shown
previously (Fig. 7D), the lamina is highly stained, and
separate processes are detected in the medulla. Interestingly, the
highest levels of APPL protein are localized in the neuropil of the
mushroom bodies (Fig. 8). Mushroom bodies are a
principal site of olfactory information processing and are involved in
associative olfactory learning and memory in Drosophila
(Heisenberg et al., 1985 ; for reviews, see Davis, 1993 ; Heisenberg,
1994 ). They consist of two complex bilaterally symmetrical groups of
neurons (Kenyon cells) in the dorsal-posterior brain that receive input
predominantly from the antennal lobes. Kenyon cell dendrites form the
calyces, whereas their axons extend through the peduncle to the
anterior of the brain. There, these axons form three different
neuropils: the lobe, which extends dorsally, and the and lobes, which extend medially. Figure 8 illustrates APPL
immunoreactivity in the mushroom bodies. All of the mushroom body
axonal neuropils are intensely stained, including the peduncle
(p), lobe (Fig. 8A), and /
lobes (Fig. 8B). The cell bodies of the Kenyon cells show
slightly higher signal than the rest of the cortex. Their dendrites,
however, do not appear enriched in APPL protein (Fig. 8C).
APPL protein is also detected in the central complex (cc;
Fig. 8A,B), the major structure of Drosophila
brain controlling locomotor behavior (Strauss and Heisenberg, 1993 )
that has been shown to play an important role in learning in
Drosophila (Heisenberg et al., 1985 ; Bouhouche et al., 1993 ;
for review, see Heisenberg, 1994 ). In the rest of the brain neuropil,
some isolated processes are highly stained (Fig. 8A).
Fig. 8.
APPL immunoreactivity in the adult mushroom
bodies. A-D, Horizontal paraffin sections of Canton
S adult heads stained with APPL antibody. A, Dorsal
section of a brain showing APPL concentrated in the lobes ( ) and
in the peduncle (p). In addition, APPL
immunoreactivity is significantly higher in the central complex
(cc) and in isolated processes (thin arrows).
B, A section illustrating APPL immunoreactivity along the
whole peduncle and in the / lobes. APPL signal is higher in the
cell bodies of the Kenyon cells (lower arrowhead) and in
isolated neurons throughout the cortex (right arrowhead).
C-D, Two adjacent paraffin sections showing APPL
immunoreactivity absent from the dendritic fields in the calyces
(open arrow) but present in axonal neuropils, such as the
peduncle (p), and in Kenyon cell bodies
(arrowhead). Small arrows in C point
to Kenyon axons that converge to form the peduncle. E-F, An
adult of the genotype Appld;
hsp:Appl+/+ was heat-shocked for 30 min at
37°C. After a 4 hr resting period, the head was processed for
paraffin sectioning and immunolabeled with anti-APPL antibody as
described (see Materials and Methods). Two alternate sections are
shown. E, Dendrites in the calyx do not show enrichment of
APPL protein (open arrow), whereas the Ken- yon
axons converging to form the peduncle do (small arrows).
F, Intense APPL signal is seen in the lamina neuropil
(l) and in the peduncle (p) of the
mushroom body. For A-F, anterior is to the top.
Same magnification was used for all. Scale bar (shown in F): 25 µm.
[View Larger Version of this Image (183K GIF file)]
The concentration of APPL protein detected in the axonal neuropil of
the adult mushroom bodies directed our attention to the distribution of
APPL in the larval mushroom bodies. As shown in Figure
9A, APPL is found in the neuropil of the
larval mushroom bodies, although the relative amount of protein in
these structures, differing from what is observed in the adult brain,
is comparable to or even lower than the levels of APPL protein detected
in other brain and ventral ganglion neuropil areas. Interestingly, the
mutant protein APPLsd concentrates in the
mushroom bodies at much higher levels than the endogenous APPL protein
(Fig. 9C), whereas induced wild-type APPL (not shown) and
mutant APPLs (Fig. 9B) protein are
detected at very low levels in this structure.
Fig. 9.
APPL immunoreactivity in the larval mushroom
bodies. A, A semi-horizontal optical section of a wild-type
larval CNS, where APPL signal in the neuropil of the mushroom bodies
[ (short arrow) and / (long arrow)
lobes] is evidenced. B-C, Larval CNSs of genotypes
(B) Appld;
hsp:Appls/+ and (C)
Appld;
hsp:Applsd/+ were heat-shocked at 37°C
for 1 hr, allowed to rest for 4 hr, and immunoprocessed with anti-APPL
antibody. Semi-horizontal optical sections are shown. B,
APPLs protein is not enriched in the neuropil of
the larval mushroom bodies. C, APPLsd
protein is highly concentrated in the neuropil of the larval mushroom
bodies. For A-C, anterior is to the top. Same
magnification was used for all. Scale bar (shown in B): 25 µm.
[View Larger Version of this Image (69K GIF file)]
In the adult, although a higher rate of synthesis of APPL protein in
the Kenyon cells is suggested by the immunohistochemistry (Fig.
8B-D), we were interested in examining whether the
differential metabolism of APPL protein could account for part of the
selective neuropil staining, as seen in larval brain. For APP, it has
been shown that cell activity can affect secretion and distribution of
the protein (Nitsch et al., 1993 , 1994 ). Using the same rationale
applied to the study of APPL localization in larval brains, we analyzed
the distribution of APPL protein expressed under a heat-shock promoter
in Appld;
hsp:Appl+/+ adult brains. As shown in
Figure 8F, 4 hr after the heat shock, induced wild-type APPL
protein is especially concentrated in the axonal neuropil of the
mushroom bodies and in the lamina, those areas where endogenous APPL is
enriched. As is the case with the endogenous protein, the mushroom body
calyces do not show enrichment of induced APPL (Fig. 8E).
Similar to what was observed in larvae, mutant
APPLsd protein induced in adult brains was found
enriched in the axonal neuropil of the mushroom bodies and along
processes going from the lamina into the medulla (not shown). The
staining observed with APPLs in adult brains was
quite variable. In the mushroom bodies, APPLs
immunoreactivity ranged from no signal to some discernible staining. In
no case was enrichment of the signal comparable to wild type observed.
Nevertheless the variability in signal precludes any conclusions about
the distribution of the APPLs form in the adult
brain.
In the adult, APPL is concentrated in regions known to mediate
behavioral plasticity. It is interesting that APPL is found enriched in
the axons but not in the dendrites of the Kenyon cells. Moreover, the
cell-type specificity of APPL processing and trafficking is involved in
generating its differential distribution in the adult neuropil.
DISCUSSION
In this study, we have performed an immunocytochemical
analysis of the distribution of wild-type and mutant APPL proteins in
the Drosophila CNS. Rescue experiments of the behavioral
defects of Appld flies demonstrated the
functional homology between APPL and at least one member of the
APP-family (Luo et al., 1992 ). The advantages of using
Drosophila to gain insights into the function of the
APP-family of proteins are the following: (1) neurons in different
developmental and physiological states can be examined and compared in
the same preparation; (2) neuronal soma and processes are delineated
spatially so that the relative distribution of the protein in these
subcellular compartments can be examined; (3) it is possible to study
APPL wild-type and mutant proteins generated by transgenes expressed
under heat-shock induction in an Appl-null background; and
(4) the Appl gene is expressed exclusively in the nervous
system and seems not to be alternatively spliced. Thus, the
Appl gene of Drosophila offers a simpler in
vivo situation when compared with the complexities encountered
with the APP-family in mammals where three distinct but closely related
genes with multiple splicing variants have been identified that show
broad and overlapping tissue distribution (Kang et al., 1987 ; Wasco et
al., 1992 , 1993 ; Slunt et al., 1994 ).
Subcellular localization of APPL proteins
Because anti-APPL antibody Ab952M recognizes the ectodomain of
APPL present in both transmembrane holoprotein and soluble protein, our
studies cannot differentiate between the two forms. Therefore, to
distinguish between these two forms we have used transgenes that
express mutant proteins: APPLs, which lacks the
transmembrane and cytoplasmic domain, and APPLsd,
in which the cleavage site is deleted. We have found that in the
neuronal cell body, APPL immunoreactivity is concentrated in punctate
structures that resemble the localization of APP in mammalian cells
(Kuentzel et al., 1993 ; Allinquant et al., 1994 ; Caporaso et al.,
1994 ). Previous experiments have shown that cleavage and secretion of
APPL and the mammalian APP-family members are similar (Luo et al.,
1990 , 1992 ). Moreover, proteolytic processing of APP through the
-secretase pathway is conserved among metazoans, because the protein
is processed normally in insect (Ramakrishna et al., 1991 ; Ramabhadran
et al., 1993 ) and yeast (Hines et al., 1994 ; Zhang et al., 1994 ) cells.
Thus, APPL-immunoreactive cytoplasmic structures may correspond to at
least some of the compartments in which APP has already been found,
such as endoplasmic reticulum and Golgi (Palacios et al., 1992 ;
Caporaso et al., 1994 ).
An intriguing observation is the lack of APPL immunoreactivity at the
plasma membrane of neuronal soma. Cell-surface APPL immunoreactivity is
not observed even for the transmembrane secretion-defective protein
APPLsd. One possible explanation is that the
protein is inserted at the plasma membrane only after being transported
to the axons. Intracellular or cell-surface localization of APPL within
axons cannot be resolved with the techniques used in this study, but
finding APPL immunoreactivity along axonal tracts in flies expressing
only the APPLsd protein is consistent with this
interpretation. In addition, in cells with a high rate of cleavage and
secretion, the molecules that escape proteolytic processing could be
degraded rapidly and thus rarely reach the cell surface. Finally, the
presence of an internalization signal sequence in the cytoplasmic
domain of APPL suggests that APPL might be internalized in a way
similar to that described for APP (Haass et al., 1992 ; Yamazaki et al.,
1995 ). Recent studies performed on primary cultured neurons suggest
that APP holoprotein can cycle rapidly at the plasma membrane
(Allinquant et al., 1994 ; Yamazaki et al., 1995 ).
In the mushroom bodies, APPL seems to be transported selectively to the
axons but not to the dendrites. Our analysis does not address whether
this polarized transport is specific to the Kenyon cells or whether it
is a general rule. Other neurons, like the sensory neurons of the
embryo and larval disks and the antennal sensory neurons of the adult,
show normal levels of APPL protein in the soma, but no enrichment in
dendrites or axons (data not shown). Thus, polarized transport of APPL
might be regulated selectively in different neuronal populations.
Similarly, APLP2 is present in both pre- and postsynaptic compartments
in the olfactory bulb, but only in postsynaptic sites in hippocampal
and cortical neurons (Thinakaran et al., 1995 ). On the contrary, APLP1
protein has been localized selectively in the postsynaptic densities
(Kim et al., 1995 ), whereas APP has been shown to be transported
anterogradely and retrogradely through the axons (Koo et al., 1990 ;
Sisodia et al., 1993 ; Yamazaki et al., 1995 ) and localized in both
dendrites and axons (Masliah et al., 1992 ; Allinquant et al., 1994 ;
Clarris et al., 1995 ).
Differential trafficking of APPL proteins
APPL-immunoreactive signal can vary dramatically between different
axonal pathways and in different neuropil regions, suggesting that
there is differential regulation of APPL metabolism in different
neurons. We observed differential APPL signal in the neuropil and
axonal tracts even when all cells are synthesizing APPL under the
heat-shock promoter, which indicates that selective synthesis alone
cannot account for the differential APPL distribution. Our data, based
on the degree of association of APPL with axonal markers, suggest that
APPL immunoreactivity associated with neuropil regions can be
attributed to secreted or transmembrane APPL or both, depending on the
region analyzed. A mechanism by which regulated cleavage and
trafficking results in the differential distribution of APPL is further
suggested by the distribution observed with the secreted
APPLs and secretion-defective
APPLsd mutant proteins. Although the localization
of the APPL mutant proteins is consistent with the interpretations of
the double-labeling experiments, an artifactual localization of the
mutant proteins cannot be excluded.
Recent studies on APP in epithelial cells have revealed two independent
mechanisms that operate in the sorting of surface and secreted APP,
respectively: (1) polarized secretion of APP that does not require the
transmembrane and cytoplasmic domains and (2) polarized sorting of
surface APP that depends on signals located in the cytoplasmic domain
(De Strooper et al., 1995 ; Haass et al., 1995 ). Consistent with this
mechanism, APPLs protein lacking the cytoplasmic
and transmembrane domains accumulates in regions where endogenous APPL
accumulates, probably as a secreted form, suggesting that the
transmembrane and cytoplasmic domains are not required for polarized
transport to axons and secretion of the soluble form. Similarly, the
secretion-defective APPLsd is transported to the
axons in certain neuronal populations and is enriched in areas where
APPL is found associated with neuronal processes. As for APP (Kuentzel
et al., 1993 ; Haass et al., 1995 ), experiments in Drosophila
tissue culture cells suggest the existence of an intracellular
proteolytic pathway for APPL (Luo, 1992 ; Luo et al., 1990 ). Therefore,
although both transmembrane and soluble APPL forms co-exist in the
neuronal soma, the axon may contain only one of the two forms by means
of a selective sorting and transport.
We recognize that cleavage of APPL is also likely to be differentially
regulated. For example, a specific mechanism that selectively
transports the secreted APPL form to the axons would preclude the
presence of the holoprotein in those axons.
APPLsd protein, however, is very often found
along axonal commissures in the ventral ganglion, where endogenous APPL
is never detected. Other mechanisms, such as differential stabilization
and internalization, could also contribute to the pattern of APPL
distribution.
Developmental regulation of APPL distribution
The pattern of distribution of APPL during development
indicates that the metabolism of APPL protein is regulated dynamically
during neuronal differentiation. Heterogeneities in the state of
differentiation of neurons can account for at least part of the
differential regulation of APPL metabolism seen in larval brains. It is
worth mentioning that the distribution of at least one protein, the
receptor tyrosine phosphatase DPTP69D, is strikingly similar to APPL in
the neuropil of larval ventral ganglion and optic lobes (Desai et al.,
1994 ). The similar distribution of these two proteins could simply
reflect the specific biological properties of those neuropil areas;
however, it could also be indicative of a functional relationship
between these two proteins.
In the optic lobes of late third-instar larvae, when axonal growth is
taking place, transmembrane APPL is the predominant form detected.
Later, during the major period of synaptogenesis in the optic
neuropils, APPL concentrates in layers that resemble those where
synapses are forming. Similarly, transmembrane APP is associated
preferentially with the rapid elongation of axons (Moya et al., 1994 ),
whereas high levels of secreted APP have been correlated with the major
periods of synaptogenesis (Loffler and Huber, 1992 ; Moya et al., 1994 ).
The dynamic regulation of APPL metabolism during axonogenesis and
synaptogenesis suggests a role for Appl function in these
developmental processes and could account for the behavioral
abnormalities observed in flies deficient for the Appl gene
(Luo et al., 1992 ).
Enrichment of APPL in the mushroom bodies
Finally, in the adult brain, the mushroom bodies show high levels
of APPL immunoreactivity. Although not comparable to the levels of
protein detected in the mushroom bodies, the central complex also shows
enrichment in APPL. These two structures are insect brain centers that
are implicated in associative learning and other complex behaviors
(Erber et al., 1980 ; Heisenberg et al., 1985 ; Bouhouche et al., 1993 ;
for review, see Heisenberg, 1994 ). Therefore, the requirement of
Appl function in the mature nervous system could also
explain the behavioral deficits displayed by Appl-null
mutants. The fact that APPL is concentrated in the axon termini, but
not in dendritic fields, suggests that the protein is transported to
the presynaptic terminals in the Kenyon cells. Experiments with mutant
APPL forms indicate that the membrane-bound APPL holoprotein is the
most likely form concentrated in the mushroom bodies. In response to
stimulation of the Kenyon cells, APPL transport, cleavage, and
secretion in the presynaptic site could be regulated, and this
regulation might be involved in modification of synaptic contacts
between Kenyon cells and their synaptic targets. Factors similar to
those that have been implicated in APP secretion and trafficking, e.g.,
protein kinase C (Buxbaum et al., 1990 ; Caporaso et al., 1992 ;
Gillespie et al., 1992 ), extracellular matrix components (Monning et
al., 1995 ), and intracellular levels of calcium (Allinquant et al.,
1994 ), might participate in this regulation.
In summary, by using transgenes expressing normal and mutant APPL
proteins, we have been able to show differential metabolism of APPL in
different neuronal cell types. Moreover, processing and trafficking of
APPL is regulated dynamically in differentiating neurons. In adult
brains, APPL is enriched in centers responsible for behavioral
plasticity in insects. The precise regulation of APPL metabolism
supports the importance of Appl function in the
Drosophila nervous system and suggests that transmembrane
and secreted APPL forms are playing distinct roles and that both may be
biologically active. The use of Drosophila offers an ideal
system to test specific functions for these two forms.
FOOTNOTES
Received April 4, 1996; revised May 1, 1996; accepted May 7, 1996.
This work was supported by National Institutes of Health Grant NS29826
(K.W.) and National Institutes of Health Shared Instrumentation Grant
RR05615. We are grateful to Dr. Toshiro Aigaki for generating the
baculovirus APPL protein and to Drs. Toshiro Aigaki and Maryanne
Fenerjian for generating the anti-APPL antibodies used in these
studies. We thank Drs. H. Bellen, S. Benzer, and C. S. Goodman for
providing the antibodies. We also thank Edward Dougherty for help with
the artwork, and Sandhya Koushika, Hsin Chu, and Patricia Parmenter for
comments on this manuscript.
Correspondence should be addressed to Kalpana White, Biology
Department, Brandeis University, Waltham, MA 02254.
Dr. Luo's present address: The Howard Hughes Medical Institute,
University of California, San Francisco, CA
94143.
REFERENCES
-
Allinquant B,
Moya K,
Bouillot C,
Prochiantz A
(1994)
Amyloid precursor protein in cortical neurons:
coexistence of two pools differentially distributed in axons and
dendrites and association with cytoskeleton.
J Neurosci
14:6842-6854 .
[Abstract]
-
Barger SW,
Fiscus RR,
Ruth P,
Hofmann F,
Mattson MP
(1995)
Role of cyclic GMP in the regulation of neuronal
calcium and survival by secreted forms of
-amyloid precursor.
J Neurochem
6416:2087-2096.
-
Bausenwein B,
Fischbach KF
(1992)
Activity labeling patterns
in the medulla of Drosophila melanogaster caused by motion
stimuli.
Cell Tissue Res
270:25-35 .
[Web of Science][Medline]
-
Bausenwein B,
Dittrich AP,
Fischbach KF
(1992)
The optic lobe
of Drosophila melanogaster. II. Sorting of retinotopic
pathways in the medulla.
Cell Tissue Res
267:17-28 .
[Web of Science][Medline]
-
Bonner JJ,
Pardue ML
(1976)
The effect of heat shock on RNA
synthesis in Drosophila tissues.
Cell
8:43-50 .
[Web of Science][Medline]
-
Bouhouche A,
Vaysse G,
Corbière M
(1993)
Immunocytochemical and learning studies of a
Drosophila melanogaster neurological mutant,
no-bridgeks49, as an approach to the possible
role of the central complex.
J Neurogenet
9:105-121 .
[Web of Science][Medline]
-
Buxbaum J,
Gandy S,
Cicchetti P,
Ehrlich M,
Czernik A,
Fracasso R,
Ramabhadran T,
Unterbeck A,
Greengard P
(1990)
Processing of
Alzheimer
A4 amyloid precursor protein: modulation by agents that
regulate protein phosphorylation.
Proc Natl Acad Sci USA
87:6003-6006 .
[Abstract/Free Full Text]
-
Caporaso GL,
Gandy SE,
Buxbaum JD,
Ramabhadran TV,
Greengard P
(1992)
Protein phosphorylation regulates secretion of
Alzheimer beta/A4 amyloid precursor protein.
Proc Natl Acad Sci USA
89:3055-3059 .
[Abstract/Free Full Text]
-
Caporaso GL,
Takei K,
Gandy SE,
Matteoli M,
Mundigl O,
Greengard P,
De
Camilli P
(1994)
Morphologic and biochemical analysis of the
intracellular trafficking of the Alzheimer
/A4 amyloid precursor
protein.
J Neurosci
14:3122-3138 .
[Abstract]
-
Clarris HJ,
Key B,
Beyreuther K,
Masters CL,
Small DH
(1995)
Expression of the amyloid protein precursor of
Alzheimer's disease in the developing rat olfactory system.
Dev Brain Res
88:87-95 .
[Medline]
-
Daigle I,
Li C
(1993)
apl-1, a Caenorhabditis
elegans gene encoding a protein related to the human beta-amyloid
protein precursor.
Proc Natl Acad Sci USA
90:12045-12049 .
[Abstract/Free Full Text]
-
Davis RL
(1993)
Mushroom bodies and Drosophila
learning.
Neuron
11:1-14 .
[Web of Science][Medline]
-
Desai CJ,
Popova E,
Zinn K
(1994)
A Drosophila
receptor tyrosine phosphatase expressed in the embryonic CNS and larval
optic lobes is a member of the set of proteins bearing the ``HRP''
carbohydrate epitope.
J Neurosci
14:7272-7283 .
[Abstract]
-
De Strooper B,
Craessaerts K,
Dewachter I,
Moechars D,
Greenberg B,
Leuven FV,
Berghe HV
(1995)
Basolateral secretion of amyloid
precursor protein in Madin-Darby canine kidney cells is disturbed by
alterations of intracellular pH and by introducing a mutation
associated with familial Alzheimer's disease.
J Biol Chem
270:4058-4065 .
[Abstract/Free Full Text]
-
Erber J,
Masuhr TH,
Menzel R
(1980)
Localization of the short
term memory in the brain of the bee Apis mellifera.
Physiol Entomol
5:343-358.
-
Fujita SC,
Zipursky SL,
Benzer S,
Ferrus A,
Shotwell SL
(1982)
Monoclonal antibodies against the
Drosophila nervous system.
Proc Natl Acad Sci USA
79:7929-7933 .
[Abstract/Free Full Text]
-
Furukawa K,
Barger SW,
Blalock EM,
Mattson MP
(1996)
Activation of K+ channels and
suppression of neuronal activity by secreted
-amyloid-precursor
protein.
Nature
379:74-78 .
[Medline]
-
Gillespie SL,
Golde TE,
Younkin SG
(1992)
Secretory
processing of the Alzheimer amyloid beta/A4 protein precursor is
increased by protein phosphorylation.
Biochem Biophys Res Commun
187:1285-1290 .
[Web of Science][Medline]
-
Haass C,
Koo EH,
Mellon A,
Hung AY,
Selkoe DJ
(1992)
Targeting of cell surface
-amyloid precursor
protein to lysosomes: alternative processing into amyloid-bearing
fragments.
Nature
357:500-503 .
[Medline]
-
Haass C,
Koo EH,
Capell A,
Teplow D,
Selkoe DJ
(1995)
Polarized sorting of
-amyloid precursor protein
and its proteolytic products in MDCK cells is regulated by two
independent signals.
J Cell Biol
128:537-547 .
[Abstract/Free Full Text]
-
Harlow E,
Lane D
(1988)
Antibodies: a laboratory manual.
.
-
Heisenberg M
(1994)
Central brain functions in insects:
genetic studies on the mushroom bodies and central complex in
Drosophila.
In: Neural basis of behavioral adaptations
(Rathmayer, W,
eds)
, p. 30. New York: Gustav FischerVerlag.
-
Heisenberg M,
Borst A,
Wagner S,
Byers D
(1985)
Drosophila
mushroom body mutants are deficient in olfactory learning.
J Neurogenet
2:1-30 .
[Web of Science][Medline]
-
Hines V,
Zhang W,
Ramakrishna N,
Styles J,
Mehta P,
Kim KS,
Innis M,
Miller DL
(1994)
The expression and processing of human
beta-amyloid peptide precursors in Saccharomyces cerevisiae:
evidence for a novel endopeptidase in the yeast secretory system.
Cell Mol Biol Res
40:273-284 .
[Web of Science][Medline]
-
Jin L,
Ninomiya H,
Roch J,
Schubert D,
Masliah E,
Otero DA,
Saitoh T
(1994)
Peptides containing the RERMS sequence of amyloid
/A4 protein precursor bind cell surface and promote neurite
extension.
J Neurosci
14:5461-5470 .
[Abstract]
-
Kang J,
Lemaire HG,
Unterbeck A,
Salbaum JM,
Masters CL,
Grzeschik KH,
Multhaup G,
Beyreuther K,
Müller-Hill B
(1987)
The
precursor of Alzheimer's disease amyloid A4 protein resembles a
cell-surface receptor.
Nature
325:733-736 .
[Medline]
-
Kim T,
Wu K,
Xu J,
McAuliffe G,
Tanzi RE,
Wasco W,
Black IB
(1995)
Selective localization of amyloid precursor-like
protein 1 in the cerebral cortex postsynaptic density.
Mol Brain Res
32:36-44 .
[Medline]
-
Koo EH,
Sisodia SS,
Archer DA,
Martin LJ,
Weidemann A,
Beureuther P,
Fisher C,
Masters CL,
Price DL
(1990)
Precursor of amyloid
protein in Alzheimer's disease undergoes fast anterograde axonal
transport.
Proc Natl Acad Sci USA
87:1561-1565 .
[Abstract/Free Full Text]
-
Kuentzel SL,
Ali SM,
Altman RA,
Greenberg BD,
Raub TJ
(1993)
The Alzheimer
-amyloid protein
precursor/protease nexin-II is cleaved by secretase in a trans-Golgi
secretory compartment in human neuroglioma cells.
Biochem J
295:367-378 .
-
Lis JT,
Simon JA,
Sutton CA
(1983)
New heat shock puffs and
-galactosidase activity resulting from transformation of
Drosophila with an hsp70-lacZ hybrid gene.
Cell
35:403-410 .
[Web of Science][Medline]
-
Littleton JT,
Bellen HJ,
Perin MS
(1993)
Expression of
synaptotagmin in Drosophila reveals transport and
localization of synaptic vesicles to the synapse.
Development
118:1077-1088 .
[Abstract]
-
Loffler J,
Huber G
(1992)
Beta-amyloid precursor protein
isoforms in various rat brain regions and during brain development.
J Neurochem
59:1316-1324 .
[Web of Science][Medline]
-
Luo L (1992) Functional analysis of APPL, the
Drosophila homologue of human amyloid precursor protein
associated with Alzheimer's disease. Waltham, MA: Brandeis.
-
Luo L,
Martin-Morris LE,
White K
(1990)
Identification,
secretion, and neural expression of APPL, a Drosophila
protein similar to human amyloid protein precursor.
J Neurosci
10:3849-3861 .
[Abstract]
-
Luo L,
Tully T,
White K
(1992)
Human amyloid precursor
protein ameliorates the behavioral deficits of flies deleted for
Appl gene.
Neuron
9:595-605 .
[Web of Science][Medline]
-
Luo L,
Liao YJ,
Jan LY,
Jan YN
(1994)
Distinct morphogenetic
functions of similar small GTPases: Drosophila Drac1 is
involved in axonal outgrowth and myoblast fusion.
Genes Dev
8:1787-1802 .
[Abstract/Free Full Text]
-
Martin-Morris LE,
White K
(1990)
The Drosophila
transcript encoded by the
-amyloid protein precursor-like gene is
restricted to the nervous system.
Development
110:185-195 .
[Abstract]
-
Masliah E,
Mallory M,
Ge N,
Saitoh T
(1992)
Amyloid precursor
protein is localized in growing neurites of neonatal rat brain.
Brain Res
593:323-328 .
[Web of Science][Medline]
-
Meinertzhagen IA,
Hanson TE
(1993)
The development of the
optic lobe.
In: The development of Drosophila melanogaster
(Bate, M,
Martinez Arias, A,
eds)
, p. 1363. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Milward EA,
Papadopoulos R,
Fuller SJ,
Moir RD,
Small D,
Beyreuther K,
Masters CL
(1992)
The amyloid protein precursor of
Alzheimer's disease is a mediator of the effects of nerve growth
factor on neurite outgrowth.
Neuron
9:129-137 .
[Web of Science][Medline]
-
Monning U,
Sandbrink R,
Weidemann A,
Banati RB,
Masters CL,
Beyreuther K
(1995)
Extracellular matrix influences the biogenesis of
amyloid precursor protein in microglial cells.
J Biol Chem
270:7104-7110 .
[Abstract/Free Full Text]
-
Moya KL,
Benowitz LI,
Schneider GE,
Allinquant B
(1994)
The
amyloid precursor protein is developmentally regulated and correlated
with synaptogenesis.
Dev Biol
161:597-603 .
[Web of Science][Medline]
-
Müller U,
Cristina N,
Li Z,
Wolfer DP,
Lipp H,
Rülicke T,
Brandner S,
Aguzzi A,
Weissmann C
(1994)
Behavioral and
anatomical deficits in mice homozygous for a modified
-amyloid
precursor protein gene.
Cell
79:755-765 .
[Web of Science][Medline]
-
Nishimoto I,
Okamoto T,
Maysuura S,
Okamoto T,
Murayama Y,
Ogata E
(1993)
Alzheimer amyloid protein precursor complexes with
brain GTP-binding protein G0.
Nature
362:75-79 .
[Medline]
-
Nitsch RM,
Farber SA,
Growdon JH,
Wurtman RJ
(1993)
Release of amyloid beta-protein precursor
derivatives by electrical depolarization of rat hippocampal slices.
Proc Natl Acad Sci USA
90:5191-5193 .
[Abstract/Free Full Text]
-
Nitsch RM,
Slack BE,
Farber SA,
Schulz JG,
Deng M,
Kim C,
Borghesani PR,
Korver W,
Wurtman RJ,
Growdon JH
(1994)
Regulation of
proteolytic processing of the amyloid beta-protein precursor of
Alzheimer's disease in transfected cell lines and in brain slices.
J Neural Transm [Suppl]
44:21-27 .
[Medline]
-
Okado H,
Okamoto H
(1992)
A Xenopus homologue of
the human beta-amyloid precursor protein: developmental regulation of
its gene expression.
Biochem Biophys Res Commun
189:1561-1568 .
[Web of Science][Medline]
-
Okamoto T,
Takeda S,
Murayama Y,
Ogata E,
Nishimoto I
(1995)
Ligand-dependent G protein coupling function of
amyloid transmembrane precursor.
J Biol Chem
270:4205-4208 .
[Abstract/Free Full Text]
-
Palacios G,
Palacios JM,
Mengod G,
Frey P
(1992)
Beta-amyloid
precursor protein localization in the Golgi apparatus in neurons and
oligodendrocytes: an immunocytochemical structural and ultrastructural
study in normal and axotomized neurons.
Brain Res Mol Brain Res
15:195-206 .
[Medline]
-
Patel NH,
Snow PM,
Goodman CS
(1987)
Characterization and
cloning of fasciclin III: a glycoprotein expressed on a subset of
neurons and axon pathways in Drosophila.
Cell
48:975-988 .
[Web of Science][Medline]
-
Pirrotta V
(1988)
Vectors for P-mediated transformations in
Drosophila.
In: Vectors: a survey of molecular cloning vectors and their uses
(Rodriguez, RL,
Reinhardt, DT,
eds)
, p. 437. Boston: Butterworths.
-
Ramabhadran TV,
Gandy SE,
Ghiso J,
Czernik AJ,
Ferris D,
Bhasin R,
Goldgaber D,
Frangione B,
Greengard P
(1993)
Proteolytic
processing of human amyloid beta protein precursor in insect cells:
major carboxyl-terminal fragment is identical to its human counterpart.
J Biol Chem
268:2009-2012 .
[Abstract/Free Full Text]
-
Ramakrishna N,
Saikumar P,
Potempska A,
Wisniewski HM,
Miller DL
(1991)
Expression of human Alzheimer amyloid precursor
protein in insect cells.
Biochem Biophys Res Commun
174:983-989 .
[Web of Science][Medline]
-
Rosen RR,
Martin-Morris L,
Luo L,
White K
(1989)
A
Drosophila gene encoding a protein resembling the human
-amyloid protein precursor.
Proc Natl Acad Sci USA
86:2478-2482.
[Abstract/Free Full Text]
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular
cloning: a laboratory manual.
.
-
Sherriff FE,
Bridges LR,
Jackson P
(1994)
Microwave antigen
retrieval of
-amyloid precursor protein immunoreactivity.
Clin Neurosci Neuropathol
5:1085-1088. -
Sisodia SS,
Koo EH,
Hoffman PN,
Perry G,
Price DL
(1993)
Identification and transport of full-length amyloid
precursor protein in rat peripheral nervous system.
J Neurosci
13:3136-3142 .
[Abstract]
-
Sisodia SS,
Slunt HH,
Van Koch C,
Lo ACY,
Thinakaran G
(1994)
Studies on APP biology: analysis of APP secretion
and characterization of an APP homologue, APLP2.
In: Amyloid protein precursor in development, aging and Alzheimer's disease
(Masters, CL,
Beyreuther, K,
Trillet, M,
Christen, Y,
eds)
, p. 121. New York: Springer.
-
Slunt HH,
Thinakaran G,
Koch CV,
Lo AC,
Tanzi RE,
Sisodia SS
(1994)
Expression of a ubiquitous, cross-reactive
homologue of the mouse beta-amyloid precursor protein (APP).
J Biol Chem
269:2637-2644 .
[Abstract/Free Full Text]
-
Spradling AC,
Rubin GM
(1982)
Genetic transformation of
Drosophila with transposable element vectors.
Science
218:348-353.
[Abstract/Free Full Text]
-
Strauss R,
Heisenberg M
(1993)
A higher control center of
locomotor behavior in the Drosophila brain.
J Neurosci
13:1852-1861 .
[Abstract]
-
Thinakaran G,
Kitt CA,
Roskams JI,
Slunt HH,
Masliah E,
von Koch C,
Ginsberg SD,
Ronnett GV,
Reed RR,
Price DL,
Sisodia SS
(1995)
Distribution of an APP homologue, APLP2, in the
mouse olfactory system: a potential role for APLP2 in axogenesis.
J Neurosci
15:6314-6326 .
[Abstract/Free Full Text]
-
Truman J,
Taylor BJ,
Awad TA
(1993)
Formation of the adult
nervous system.
In: The development of Drosophila melanogaster
(Bate, M,
Martinez Arias, A,
eds)
, p. 1245. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Wasco W,
Bupp K,
Magendantz M,
Gusella JF,
Tanzi RE,
Solomon F
(1992)
Identification of a mouse brain cDNA that encodes a
protein related to the Alzheimer disease-associated amyloid
protein
precursor.
Proc Natl Acad Sci USA
89:10785-10762.
-
Wasco W,
Gurubhagavatula S,
Paradis MD,
Romano DM,
Sisodia SS,
Hyman BT,
Neve RL,
Tanzi RE
(1993)
Isolation and characterization
of the human APLP2 gene encoding a homologue of the Alzheimer's
associated amyloid
protein precursor.
Nature Genet
5:95-100 .
[Web of Science][Medline]
-
Weidemann A,
Konig G,
Bunke D,
Fischer P,
Salbaum JM,
Masters CL,
Beyreuther K
(1989)
Identification, biogenesis, and
localization of precursors of Alzheimer's disease A4 amyloid protein.
Cell
57:115-126 .
[Web of Science][Medline]
-
Yamazaki T,
Selkoe DJ,
Koo EH
(1995)
Trafficking of cell
surface
-amyloid precursor protein: retrograde and transcytotic
transport in cultured neurons.
J Cell Biol
129:431-442 .
[Abstract/Free Full Text]
-
Zhang H,
Komano H,
Fuller RS,
Gandy SE,
Frail DE
(1994)
Proteolytic processing and secretion of human
beta-amyloid precursor protein in yeast: evidence for a yeast secretase
activity.
J Biol Chem
269:27799-27802 .
[Abstract/Free Full Text]
-
Zheng H,
Jiang M,
Trumbauer ME,
Sirinathsinghji DJ,
Hopkins R,
Smith DW,
Heavens RP,
Dawson GR,
Boyce S,
Conner MW,
Stevens KA,
Slunt HH,
Sisodia SS,
Chen HY,
Van der Ploeg LHT
(1995)
beta-Amyloid
precursor protein-deficient mice show reactive gliosis and decreased
locomotor activity.
Cell
81:525-531 .
[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
J. Ashley, M. Packard, B. Ataman, and V. Budnik
Fasciclin II Signals New Synapse Formation through Amyloid Precursor Protein and the Scaffolding Protein dX11/Mint
J. Neurosci.,
June 22, 2005;
25(25):
5943 - 5955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. T. Kimberly, J. B. Zheng, T. Town, R. A. Flavell, and D. J. Selkoe
Physiological Regulation of the {beta}-Amyloid Precursor Protein Signaling Domain by c-Jun N-Terminal Kinase JNK3 during Neuronal Differentiation
J. Neurosci.,
June 8, 2005;
25(23):
5533 - 5543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kotani, S. Kitazume, K. Kamimura, S. Takeo, T. Aigaki, H. Nakato, and Y. Hashimoto
Characterization of Drosophila Aspartic Proteases That Induce the Secretion of a Golgi-Resident Transferase, Heparan Sulfate 6-O-Sulfotransferase
J. Biochem.,
March 1, 2005;
137(3):
315 - 322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Finley, P. T. Edeen, R. C. Cumming, M. D. Mardahl-Dumesnil, B. J. Taylor, M. H. Rodriguez, C. E. Hwang, M. Benedetti, and M. McKeown
blue cheese Mutations Define a Novel, Conserved Gene Involved in Progressive Neural Degeneration
J. Neurosci.,
February 15, 2003;
23(4):
1254 - 1264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Taru, K.-i. Iijima, M. Hase, Y. Kirino, Y. Yagi, and T. Suzuki
Interaction of Alzheimer's beta -Amyloid Precursor Family Proteins with Scaffold Proteins of the JNK Signaling Cascade
J. Biol. Chem.,
May 24, 2002;
277(22):
20070 - 20078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. White, G. Multhaup, D. Galatis, W. J. McKinstry, M. W. Parker, R. Pipkorn, K. Beyreuther, C. L. Masters, and R. Cappai
Contrasting, Species-Dependent Modulation of Copper-Mediated Neurotoxicity by the Alzheimer's Disease Amyloid Precursor Protein
J. Neurosci.,
January 15, 2002;
22(2):
365 - 376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Torroja, M. Packard, M. Gorczyca, K. White, and V. Budnik
The Drosophila beta -Amyloid Precursor Protein Homolog Promotes Synapse Differentiation at the Neuromuscular Junction
J. Neurosci.,
September 15, 1999;
19(18):
7793 - 7803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Xu, D. Yang, T. Wyss-Coray, J. Yan, L. Gan, Y. Sun, and L. Mucke
Wild-type but not Alzheimer-mutant amyloid precursor protein confers resistance against p53-mediated apoptosis
PNAS,
June 22, 1999;
96(13):
7547 - 7552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Masliah, J. Raber, M. Alford, M. Mallory, M. P. Mattson, D. Yang, D. Wong, and L. Mucke
Amyloid Protein Precursor Stimulates Excitatory Amino Acid Transport. IMPLICATIONS FOR ROLES IN NEUROPROTECTION AND PATHOGENESIS
J. Biol. Chem.,
May 15, 1998;
273(20):
12548 - 12554.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|