Previous Article | Next Article 
Volume 16, Number 21,
Issue of November 1, 1996
pp. 6648-6656
Copyright ©1996 Society for Neuroscience
Subunit Inhibits Neurosteroid Modulation of GABAA
Receptors
Wei Jian Zhu1,
Jian
Feng Wang1,
Karl E. Krueger2, and
Stefano Vicini1
Departments of 1 Physiology and Biophysics and
2 Cell Biology, Georgetown University Medical
Center, Washington, D.C. 20007
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Neurosteroid modulation of GABAA receptors has been
observed with all subunit combinations investigated; however,
hetero-oligomeric GABAA receptors containing
subunits
were not studied previously. We describe the effect of
subunit
expression on 3
,21-dihydroxy-5
-pregnan-20-1
(THDOC)-induced potentiation of GABA-gated currents in
transfected HEK 293 cells and in cerebellar granule cells in
vitro. THDOC (100 nM) significantly potentiated
GABA-gated currents in cells transfected with combinations of
1,
6,
3, and
2 subunit cDNAs, whereas cotransfection of
subunit cDNA inhibited this potentiation. In contrast, the direct
Cl
channel activation by THDOC at higher concentrations
(1-10 µM) was not significantly dependent on
subunit
cotransfection. These results suggest that the presence of the
subunit inhibits GABAA receptor modulation but not the
direct activation by neurosteroids. Cotransfection with
subunit
also affected the negative allosteric modulation by pregnenolone
sulfate. THDOC potentiation of GABA-gated currents was greater in
cerebellar granule cell cultures at 4 d in vitro
(DIV) compared with those at 14 DIV. Single-cell reverse
transcription-PCR analysis of the mRNAs expressed in cultured
cerebellar granule cells shows that an increased number of granule
cells at 14 DIV express
subunit mRNAs as compared with 4 DIV
granule cells. The presence of
subunit mRNAs detected in individual
cells correlated well with the lack of sensitivity to THDOC. These
results suggest that developmental expression of GABAA
receptor
subunits may play an important role in determining the
region-specific neurosteroid-induced modification of fast inhibitory
synaptic function.
Key words:
-aminobutyric acid;
GABAA receptor
subunit;
patch clamp;
allopregnenolone;
single-cell RT-PCR;
cDNA
transfection
INTRODUCTION
Ionotropic GABA receptors (GABAA) are
heteropolymeric proteins that contain an integral ion channel and
account for the majority of fast inhibitory synaptic transmission in
the mammalian CNS (MacDonald and Olsen, 1994
; Luddens et al., 1995
).
GABA-mediated activation of the GABAA receptor channel
complex is modulated by various clinically important drugs acting on
allosteric modulatory sites (MacDonald and Olsen, 1994
; Luddens et al.,
1995
). Neurosteroids, which may be synthesized in glial cells,
allosterically modulate GABA-activated Cl
channels
(Majewska et al., 1986
; for review, see Lambert et al., 1995
). At a
high concentration, neuroactive steroids directly activate the
GABAA receptor channels, showing the same property as
barbiturates (Lambert et al., 1995
). Several studies have suggested
that steroid-induced allosteric modulation requires a specific steroid
binding domain on the GABAA receptor channel complex
separate from those for benzodiazepines and barbiturates (Gee et al.,
1988
; Turner et al., 1989
). In different neuronal populations, distinct
neurosteroids have specific binding characteristics and may act as
positive or negative modulators of GABAA receptor function
(Majewska et al., 1986
, 1988
; Gee et al., 1988
; Puia et al., 1990
,
1993
; Gee and Lan, 1991
; Lan et al., 1991
; Shingai et al., 1991
; Sapp
et al., 1992
; Korpi and Luddens, 1993
).
Molecular biological studies have shown that the GABAA
receptor channel complex is a pentameric structure of
,
,
,
and/or
subunits with unknown stoichiometry and subunit composition
(MacDonald and Olsen, 1994
; Luddens et al., 1995
; Whiting et al., 1995
;
Yeh and Grigorenko, 1995
). The heterogeneous expression of
GABAA receptor subunits confers specific physiological and
pharmacological characteristics of native and recombinant
GABAA receptors (Pritchett et al., 1989
; Sigel et al.,
1990
; Mathews et al., 1994
; Saxena and MacDonald, 1994
, 1996
; Ducic et
al., 1995
; Zheng et al., 1995
). Although there is no absolute subunit
specificity for neurosteroid modulation of GABAA receptors,
it was demonstrated that subunit composition affects their actions,
especially those of the
and
subunits (Puia et al., 1990
, 1993
;
Gee and Lan, 1991
; Lan et al., 1991
; Shingai et al., 1991
; Sapp et al.,
1992
; Korpi and Luddens, 1993
). A tissue-selective expression of
GABAA receptor subunits and the assembly of
GABAA receptors may account for the heterogeneity of
neurosteroid modulation; for example, the greater potentiation of
neurosteroids in the spinal cord has been attributed to region-specific
expression of
3 subunit (Lan et al., 1991
; Lambert et al., 1995
).
The influence of
subunits on steroid modulation is currently
unknown. This subunit is expressed mainly in cerebellum, thalamus, and
hippocampus, and it is developmentally regulated (Bovolin et al., 1991
;
Laurie et al., 1992a
,b; Fritschy et al., 1994
; Fritschy and Mohler,
1995
; Quirk et al., 1995
; Zheng et al., 1995
; Behringer et al.,
1996
).
To address the role of the
subunit expression in neurosteroid
modulation, we used patch-clamp recordings to investigate neurosteroid
allosteric modulation on GABA-gated currents in mammalian cells
transiently transfected with recombinant GABAA receptors.
We also determined
subunit expression in cerebellar granule neurons
at distinct developmental days in culture by the single-cell reverse
transcription (RT)-PCR technique to correlate the presence of
subunit mRNA with neurosteroid-induced modulation.
MATERIALS AND METHODS
Primary cell cultures. Primary cultures of rat
cerebellar granule neurons were prepared from 8-d-old Sprague Dawley
rat cerebella. Cells were dispersed with trypsin (0.25 mg/ml) (Sigma,
St Louis, MO) and plated at a density of 0.8-1.0 × 106 on 35 mm Nunc dishes coated with
poly-L-lysine (1%) (Sigma). Cells were cultured in BME
(Life Technologies, Grand Island, NY) supplemented with 10% bovine
calf serum, 2 mM glutamine, and 100 µg/ml gentamycin
(Life Technologies), and were maintained at 37°C in 6%
CO2. Cytosine arabinoside (10 µM) was added
to all cultures 18-24 hr after plating to inhibit glial proliferation.
The final concentration of KCl in the culture medium was adjusted to 25 mM.
Human embryonic kidney (HEK) 293 cell line. HEK 293 cells
(American Type Culture Collection, Rockville, MD; ATCC No. CRL1573)
were grown in MEM (Life Technologies) supplemented with 10% fetal
bovine serum, 100 U/ml penicillin (Life Technologies), and 100 U/ml
streptomycin (Life Technologies), in a 6% CO2 incubator.
Exponentially growing cells were dispersed with trypsin, seeded at
2 × 105 cells/35 mm dish in 1.5 ml of culture medium,
and plated on 12 mm glass coverslips (Fisher Scientific, Pittsburgh,
PA).
cDNA transient transfection. Rat
1,
3,
2S, and
GABAA receptor subunit cDNAs individually subcloned into
the expression vector pCDM8 (Invitrogen, San Diego, CA) and the
6
subunit cloned into the pCIS2 expression vector were provided by Dr.
Peter Seeburg (Center for Molecular Biology, University of Heidelberg,
Heidelberg, Germany). HEK 293 cells were transfected using the calcium
phosphate precipitation method (Chen and Okayama, 1987
) with various
combinations of pCDM8
1, pCIS2
6, pCDM8
3, pCDM8
2S, and
pCDM8
. The expression of cDNAs cloned into the pCDM8 and pCIS2
vectors is under the control of the same promoter/enhancer system
(Cytomegalo virus promoter). The following plasmid combinations were
mixed:
1:
3:
2,
1:
3,
1:
3:
,
1:
3:
2:
,
1:
1:
,
6:
3:
2,
6:
3,
6:
3:
, and
6:
3:
2:
(1 µg each construct). The coprecipitates were
added to culture dishes containing 1.5 ml MEM medium for 12-16 hr at
37°C under 3% CO2. The media was removed, and the cells
were rinsed twice with culture media and finally incubated in the same
media for 24 hr at 37°C under 6% CO2. Cotransfection
with the plasmid pGreenLantern (Life Technologies) encoding for a
fluorescent protein allowed easy recognition of transfected cells
expressing this fluorescent marker. More than 90% of the cells
expressing the GreenLantern protein also expressed GABAA
receptors.
Electrophysiological studies. Primary cultured granule
cells or transfected HEK 293 cells were voltage-clamped at
50 mV in
the whole-cell configuration using the patch-clamp technique (Hamill et
al., 1981
) on the stage of an Axioskop FS microscope equipped with
Fluorescent and Nomarski optics (Zeiss) at room temperature. The
recording pipette contained (in mM): 145 CsCl, 5 MgCl2, 11 EGTA, 5 NaATP, and 10 mM HEPES at pH
7.2 with CsOH. Cells were bathed in solution consisting of (in
mM): 145 NaCl, 5 KCl, 2 CaCl2, and 5 HEPES at
pH 7.2 with NaOH. Osmolarity was adjusted to 325 mOsm with sucrose. The
culture dish in the recording chamber (<500 µl total volume) was
perfused continuously (5 ml/min) to prevent accumulation of drugs.
Electrodes were pulled in two stages on a vertical pipette puller from
borosilicate glass capillaries (Wiretrol II, Drummond, Broomall, PA).
Typical pipette resistance was 5-7 M
.
Drug application. GABA responses in transfected HEK 293 cells and in primary cultures of cerebellar granule neurons were
elicited by concentrations of GABA close to the EC20
observed in dose-response studies from transfected cells with
combinations of
,
,
, and
subunits (Ducic et al., 1995
;
Saxena and MacDonald, 1996
). Because estimates of EC20 from
these studies did not always match, we performed full
dose-response studies in a few test cells for each cotransfection
experiment to select the concentration producing 20% of the maximal
response to GABA (our unpublished observations). Pregnenolone sulfate
sodium salt (PS) (RBI, Natick, MA), 3
,-hydroxy-5
-pregnan-20-1
(3
-OH-DHP) (RBI), and 3
,21-dihydroxy-5
-pregnan-20-1 (THDOC)
(RBI) were dissolved in bath solution containing dimethylsulfoxide at a
maximal final concentration of 0.01%. Control solution containing
0.01% DMSO (Sigma) failed to modify GABA responses (data not shown).
In studies with PS we used GABA at its EC50 concentration.
Drugs were applied directly by a gravity-fed Y-tubing delivery system
placed within 100 µm of the recorded cell. Drug application had fast
onset (<5msec) and achieved a complete local concentration change of
the recorded cell. In all experiments, neuroactive steroids were
coapplied with GABA, with the exception of PS, which was additionally
preperfused for 30 sec.
Data acquisition and analysis. Currents were monitored with
a patch amplifier (EPC-7; List Electronics, Darmstadt, Germany),
filtered at 1.5 kHz (8-pole low-pass Bessel; Frequency Devices,
Haverhill, MA), and digitized at 3.5 kHz with an IBM PC computer and
the software Axotape 2 (Axon Instruments, Foster City, CA). Origin
(MicroCal Software, Northampton, MA) was used for figure preparation
and statistical analysis using Student's t test with
p < 0.01. The Bonferroni correction was applied
for multiple-group comparison.
Cellular RNA harvest and RT. Patch pipettes were
filled with 8 µl of autoclaved intracellular solutions containing (in
mM): 145 CsCl, 1 MgCl2, 5 EGTA, and 10 HEPES,
to pH 7.2 with CsOH. The silver wire connected to the patch-clamp
electrode was rechlorided electrochemically before recording from each
neuron. At the end of a whole-cell patch recording, negative pressure
was applied to the pipette, and the flow of the contents of the cell
into the pipette tip was monitored under the microscope. The tip of the
pipette containing the aspirated neuronal cytoplasm was broken in a
test tube to expel its contents. To the 6.5 µl usually obtained in
the test tube was added 3.5 µl of solution containing random hexamer
primers, at a final concentration of 5 µM, the four
deoxyribonucleoside triphosphates at a final concentration of 0.5 mM, dithiothreitol (final 5 mM), 100 U of
Moloney murine leukemia virus RT (both from Life Technologies), and 20 U of ribonuclease inhibitor (Promega, Madison, WI). The resulting 10 µl mix was incubated for 1 hr at 37°C for the synthesis of
single-stranded cDNA and kept at
80°C until amplification by
PCR.
PCR amplification of the GABAA
and
cDNA
fragments. The first PCR reaction was performed in a final volume
of 100 µl containing 50 pmol of each primer, the 10 µl RT reaction
mixture, 200 µM (final concentration) of each
deoxyribonucleotide, 1.5 mM MgCl2, 10 mM Tris-HCl, pH 8.3, 50 mM KCl (final
concentration), and 2.5 U of Taq polymerase (Stratagene,
La Jolla, CA). Thirty cycles (92°C, 40 sec; 55°C, 40 sec; 72°C,
60 sec) followed by 15 min of final extension at 72°C were performed.
The second PCR reaction was performed in a final volume of 50 µl
containing 1 µl of the primary PCR product, 10 pmol of each primer,
and 50 µM of each deoxyribonucleotide, with a protocol
similar to the first PCR reaction but using 35 cycles. Primers used to
amplify
sequences were
5
-AGGGATCCTGGGT(AG)TC(ACT)TT(CT)TGGATCAA [909-926] and
5
-GGCTCGAGCCA(AG)TA(AG)AC(AC)AG (AG)TTGAACA [1405-1424] during
the first round of amplification, and nested primers
5
-AGGGATCCGT(CG)AC(AT)GC(AC)ATGGA(CT)CTCTT [1035-1054] and
5
-AACCTCGAGA(CT)CC(GT)(AG)G(AC)(AG)TAGGAG TC [1365-1377] for
the second round of amplification. Amplification of
sequence
involved the primers 5
-AG GGATCCTGGTCAGAAAACCAGGAGCA [635-654] and
5
-AACCTCGAGATGTTGACTGCTGCAAAG [1354-1372] for the first round,
and nested primers 5
-AAGGATCC AAATCAGCTGGCCAGTTCC [733-752] and
5
-AACCTCGAGACCTATAGGAACCCATGA [1209-1227] during the second round.
Locations of primer sequences are indicated in brackets according to
published sequences given in Shivers et al. (1989)
or Zhao and Joho
(1990)
. The first round of PCR included the first pairs of primers for
and
subunits. The second round of PCR included only one of the
nested primer pairs in each reaction. Primers selected for
subunits
do not amplify genomic sequence, whereas those for the
subunit are
able to amplify genomic sequence that is easily distinguished from mRNA
sequence based on the inclusion of one intron. In single-cell RT-PCR
studies, a product derived from genomic sequence was never
observed.
Southern blot and restriction analysis. PCR products
separated by agarose gel electrophoresis were transferred after
alkaline denaturation to nylon membranes and immobilized by baking at
75°C in a vacuum oven. Oligonucleotide probes (100 ng) were
end-labeled using T4 polynucleotide kinase and
[
-32P]-ATP. The membranes were submerged in 40 ml of
6× SSC (0.1 M NaCl/0.015 M sodium citrate, pH
7.6), 0.2% polyvinylpyrrolidone (w/v), 1% SDS. Radiolabeled probe was
then placed in this buffer and allowed to hybridize at 37°C for 4 hr.
The membranes were then washed four times for 5 min in 6× SSC, 0.1%
SDS before being wrapped in cellophane and subjected to
autoradiography. In addition to Southern analysis, characterization of
subunit PCR products was performed using PstI,
EcoRV, and BclI, which specifically
differentiate
1-,
2-, and
3-derived PCR products,
respectively. Furthermore, restriction analysis for the long and short
forms of
2 subunit cDNAs was performed with EarI,
which specifically cuts the long form of
2L (Kofuji et al., 1991
).
PstI and BclI were from Stratagene, and
EcoRV and EarI were from New England
Biolabs (Beverly, MA).
RESULTS
Subunit transfection reduces neurosteroid-induced potentiation
of GABA-activated currents in recombinant GABAA receptors
containing
6 subunits
To determine the effect of
subunit on GABAA
receptor sensitivity to THDOC, GABAA receptor subunit cDNAs
(
6
3
2,
6
3,
6
3
,
6
3
2
) were transfected
in HEK 293 cells, and responses were elicited by concentrations of GABA
close to the EC20 observed in dose-response studies from
transfected cells with combinations of
,
,
, and
subunits
(see Materials and Methods). GABA was applied in the absence or
presence of increasing neurosteroid concentrations, and induced
Cl
currents in single, isolated HEK 293 cells were
voltage-clamped at a holding potential of
50 mV using the patch-clamp
technique (Fig. 1A). In cells
cotransfected with
6,
3, and
2 subunit cDNAs, THDOC clearly
enhanced the GABA-activated currents, showing a concentration-dependent
potentiation (Fig. 1B). The action of THDOC was also
observed in recombinant GABAA receptors resulting from the
6
3 subunit cotransfection (Fig. 1B), and no
significant difference in THDOC-induced potentiation was detected
between
6
3
2 and
6
3 subunit transfected cells; however,
replacement of
2 with
subunits in the GABAA receptor
subunit cotransfection dramatically reduced the GABAA
receptor sensitivity to THDOC potentiation. GABAA receptors
in cerebellar granule neurons express combinations of
1,
6,
2/3,
2, and
subunits (for review, see Whiting et al., 1995
;
McKernan and Whiting, 1996
). We therefore investigated the
cotransfection of
6,
3,
2, and
subunit cDNAs in HEK 293 cells. The average potentiation of GABA-gated currents by THDOC was
larger in
6
3
2
subunit cDNA transfection than in the
6
3
transfection, but it was much less than that of cells
transfected with the same subunit combinations lacking the
subunit
cDNAs (Fig. 1B). THDOC (1 µM)
potentiation in individual cells transfected with
6
3
2
subunit cDNAs showed a rather broad variation, from a very low
enhancement similar to that observed with the
6
3
subunit
transfection to a potentiation resembling that observed with
6
3
2 or
6
3 subunit transfection (Fig. 1C).
Fig. 1.
Effect of
subunit expression on
neurosteroid-induced modulation of GABA-gated currents in cells
transfected with
6,
3, and
2 subunit cDNAs. A,
HEK cells were transfected with
6
3
2 and
6
3
subunit
cDNAs, and currents were elicited by GABA in the absence or presence of
THDOC. GABA or GABA + THDOC were applied by a Y-tubing system for the
duration indicated by the bars. GABA-induced currents
were recorded from isolated HEK 293 cells voltage-clamped at
50 mV.
B, Potentiation was calculated by comparing current
levels induced by coapplications of GABA + THDOC to GABA alone (0%
potentiation). GABA concentrations were as follows:
6
3
2, 0.05 µM;
6
3, 0.05 µM;
6
3
2
, 0.1 µM; and
6
3
, 0.3 µM. Each point
represents the mean ± SEM of the percent potentiation observed at
each concentration studied in at least 10 cells.
Asterisk indicates statistical significance
(p < 0.01) when compared with the
6
3
2 subunit cotransfection. C, Potentiation of
GABA-activated currents induced by 1 µM THDOC for
individual cells transfected with
6
3
2,
6
3,
6
3
2
, or
6
3
. Bars represent the mean values.
[View Larger Version of this Image (20K GIF file)]
In 14 cells transfected with combinations of the
6,
3,
2, and
subunit cDNAs, we compared the effect of increasing concentrations
of another neurosteroid, 3
-OH-DHP, on GABA-activated
Cl
currents. We observed a dramatically reduced
potentiation, similar to the effects of THDOC, whenever the
subunits were cotransfected (not shown).
Subunit transfection reduces THDOC-induced potentiation of
GABA-activated currents in recombinant GABAA receptors
containing
1 subunits
We also examined the
1 subunit cotransfected with
combinations of
3 and
2 and/or
subunit cDNAs. Whole-cell
currents were elicited by GABA concentrations at the EC20
observed in transfected cells with combinations of
,
,
, and
subunits (see Materials and Methods). As shown in Fig.
2A, cells transfected with
1,
3,
and
2 subunit cDNAs show very large enhancements of GABA-gated
currents by the coapplication of THDOC in a concentration-dependent
manner. The substitution of
1 with
6 subunit cDNA produced
receptors endowed with a greater apparent potentiation by THDOC (Fig.
2), consistent with a previous report (Puia et al., 1993
). Similar to
6 subunit transfection, however, GABAA receptor
sensitivity to THDOC was attenuated by substitution of
2 with
.
The mean potentiations of GABA-gated currents by THDOC are summarized
in Figure 2B, which shows a significant reduction of
THDOC-induced potentiation whenever the
subunit was transfected.
Our studies also demonstrate that omitting the
2 subunit cDNA from
the cotransfection mixture has no significant effect on THDOC-induced
potentiation, but including the
subunit cDNA in the
1
3
2
transfection greatly decreases the THDOC-induced enhancement of
GABAA-gated currents (Fig. 2B).
Furthermore, no significant difference was found between the
1
3
and
1
1
transfection (Fig. 2B).
Figure 2C shows the variability in potentiation of GABA
responses in individual cells at one neurosteroid concentration (1 µM) after transfection with the various combinations of
1,
,
2, and
subunits. These data show that with a few
exceptions, most cells within each cotransfection group exhibit a
potentiation that is close to the average of all cells from that
transfection experiment. These data suggest that the expression of
subunits confers the functional distinction among the recombinant
GABAA receptors.
Fig. 2.
Effect of
subunit expression on
neurosteroid-induced modulation of GABA-gated currents in cells
transfected with
1,
1,
3, and
2 subunit cDNAs.
A, HEK cells were transfected with
1
3
2 and
1
3
subunits, and currents were elicited by GABA in the absence
or presence of THDOC. GABA or GABA + THDOC were applied by a Y-tubing
system for the duration indicated by the bars.
GABA-induced currents were recorded from isolated HEK 293 cells
voltage-clamped at
50 mV. B, Potentiation was
calculated by comparing current levels induced by coapplications of
GABA + THDOC to GABA alone. GABA concentrations used were as follows:
1
3
2, 0.5 µM;
1
3, 0.1 µM;
1
3
2
, 0.5 µM;
1
3
, 0.8 µM; and
1
1
, 1 µM. Each point
represents the mean ± SEM of the percent potentiation observed at
each concentration in at least 12 cells. Asterisk
indicates statistical significance (p < 0.01) when compared with the
1
3
subunit cotransfection.
C, Potentiation of GABA-activated currents induced by 1 µM THDOC for individual cells transfected with
1
3
2,
1
1
,
1
3,
1
3
2
, or
1
3
.
Bars represent the mean values.
[View Larger Version of this Image (20K GIF file)]
Subunit transfection fails to alter the direct activation
by THDOC
It has been shown previously that THDOC directly activated
recombinant GABAA receptors and that this action was
blocked by GABAA receptor antagonists (Puia et al., 1990
).
Figure 3A shows the extent of direct
activation of recombinant GABAA receptors obtained in cells
transfected with the various combinations of
1,
6,
3,
2,
and
subunit cDNAs. We failed to observe significant differences
among distinct subunit combinations (Fig. 3A). In most
experiments, THDOC combined with GABA was then tested to evaluate the
extent of potentiation by the neurosteroid in that particular cell.
In cells transfected with cDNAs for
subunits, the extent of
potentiation was equal to or less than the sum of the direct activation
of Cl
channels by GABA and THDOC. For example, the ratios
between the response to THDOC (10 µM) combined with GABA
and the sum of the direct activation by GABA (at the EC20
concentration) and THDOC (10 µM) applied independently
were 0.9 ± 0.1 for the
1
3
and 1.0 ± 0.2 for the
6
3
transfection (mean ± SEM; n = 8). In
contrast, whenever the cDNA for the
subunit was omitted, these
ratios were 2.5 ± 0.6 for
1
3
2, 2.0 ± 0.2 for
1
3, and 2.0 ± 0.3 for
6
3 transfections (mean ± SEM; n = 9).
Fig. 3.
Neurosteroid actions on GABAA receptor
in transfected HEK 293 cells. A, THDOC-induced direct
activation of GABAA receptors in transfected HEK 293 cell.
HEK 293 cells were cotransfected with a combination of
1
3
2,
1
3
,
1
3,
6
3, or
6
3
subunit cDNAs. The
peaks of the Cl
currents obtained at a holding potential
of
50 mV by Y-tubing application of THDOC at three distinct
concentrations are shown as mean ± SEM. Data were obtained in at
least 10 transfected cells per each combination studied. No statistical
significance was observed when data at each concentration were compared
for distinct cDNA transfections. B, PS-induced
modulation of GABA-gated currents in transfected HEK 293 cells.
Currents were evoked by a GABA concentration close to the
EC50 reported for each particular combination. The
coapplication of the indicated PS concentrations with GABA in HEK cells
transfected with
6
3
2 or
6
3
reduced the GABA-gated
currents in a concentration-dependent manner. Reduction was calculated
by comparing the current level induced by applications of PS + GABA to
GABA alone (0% reduction). Each point represents the mean ± SEM
of the percent reduction measured in at least 12 cells.
Asterisk indicates statistical significance
(p < 0.01) when compared with the
6
3
subunit cotransfection.
[View Larger Version of this Image (27K GIF file)]
Subunit cDNA transfection inhibits the negative modulation by
pregnenolone sulfate
In addition to positive modulation by neurosteroids, we wanted to
test the effects of PS, a negative modulator of GABAA
receptors (Majewska, 1988). In these experiments we used GABA
concentrations close to those producing a half-maximal response. Figure
3B shows the comparison between the effect of PS on
GABA-elicited currents in HEK 293 cells transfected with
6
3
2
versus
6
3
subunit cDNAs. The replacement of the
2 subunit
with the
subunit cDNA in the transfection mixture significantly
reduced PS-induced inhibition of GABA-gated currents in HEK 293 cells.
Modulation of GABA-gated Cl
currents by THDOC in
cerebellar granule cells
To test neuroactive steroid-induced modulation of GABA-gated
currents in native receptors comprising the
subunit, we
investigated the potentiation by THDOC using patch-clamp recordings
from rat cerebellar granule neurons in primary culture. GABA-activated
currents were elicited at their EC20 concentrations (Zheng
et al., 1995
) from single granule neurons at 4 or 14 d in
vitro (DIV) at the holding potential of
50 mV (Fig.
4A). As shown in Figure
4A, coapplication of 10 nM THDOC has
little effect on GABA-gated currents, whereas a large enhancement was
found by coapplication of 1 µM THDOC, showing the
concentration-dependence of the potentiation. The extent of
potentiation was significantly lower in 14 DIV granule cells than at 4 DIV (Fig. 4B). A summary of results obtained with
THDOC potentiation of GABA-gated currents from individual neurons at
different times in culture is shown in Figure 4C, indicating
that neurosteroid potentiation was highly variable from cell to cell
but that GABAA receptors assembled in older cells often
have a lower sensitivity to the neuroactive steroid.
Fig. 4.
In vitro development decreases
neurosteroid-induced modulation of GABA-gated currents in cerebellar
granule cells. A, GABA-induced currents in the absence
or presence of THDOC recorded from cultured cerebellar granule cells at
4 or 14 DIV voltage-clamped at
50 mV. GABA or GABA + THDOC were
applied by a Y-tubing system for the duration indicated by the
bars. B, THDOC dose-responses in
cerebellar granule cells at 4 and 14 DIV. Potentiation was calculated
by comparing current levels induced by coapplications of GABA and THDOC
to GABA alone. Each point represents the mean ± SEM of the
potentiation obtained in at least 15 cells. Asterisk
indicates statistical significance (p < 0.01) when compared with 14 DIV cells. C, Potentiation
of GABA-activated currents induced by 1 µM THDOC for
individual cells at 4 and 14 DIV. Bars indicate the average
values.
[View Larger Version of this Image (20K GIF file)]
Correlation between neurosteroid-induced potentiation and
subunit mRNA expression
A previous report (Puia et al., 1993
) and our results described
above suggest that neurosteroid potentiation is diminished when cells
are transfected with
6 versus
1 subunit cDNA. Therefore the
developmental increase of the
6 subunit expression in cerebellar
granule neurons in culture (Laurie et al., 1992a
,b; Zheng et al., 1993
,
1995
; Mathews et al., 1994
) could be an important determinant in the
change of neurosteroid modulation during development. On the other
hand, our recombinant cDNA studies indicated that the
subunit is
another important determinant in the inhibition of the allosteric
modulation of GABAA receptors in HEK 293 cells. Therefore,
we decided to study the correlation between the presence of
GABAA receptor
subunit mRNA in cerebellar granule
neurons and THDOC-induced potentiation of GABA-gated currents. For
comparison, we also examined the presence or the absence of
subunit
mRNA. The
and
subunit mRNAs in single, cerebellar granule
neurons were detected using single-cell RT-PCR, and the THDOC-induced
potentiation of GABA currents was measured by patch-clamp technique.
Cerebellar granule neurons were identified according to their
morphological characteristics. Cells were clamped at
50 mV, and
GABA-activated currents were recorded in the absence or presence of
THDOC. After a complete dose-response with THDOC was obtained, the
cell content was harvested by application of negative pressure in the
pipette to be processed for RT-PCR of
and
subunit mRNAs. For
each PCR experiment, controls were performed to verify the absence of
contaminating mRNA. Shown in Figure 5 are controls in
which whole-cell recording was not performed, but a small amount of
medium was removed from the bath in the presence of the cerebellar
culture. Other negative controls included RT-PCR subjected to all
reaction components (without the addition of cellular cytoplasm) and
removal of cytoplasm without RT. All results from a set of PCR
reactions were discarded when control samples yielded PCR products.
Data presented here were limited to cells in which either
or
subunit mRNAs or both were detected, typically >75% of the cells
investigated. We observed granule cells expressing both
and
mRNAs, as well as cells in which the exclusive presence of
or
mRNAs was detected (Fig. 5). The identity of the
subunit subtype
was characterized further in all cases with the use of specific
restriction enzymes. The
2 subunit was exclusively found in >90%
of all cells expressing
subunit mRNA, and only these cells were
considered. In all cells in which
2 subunit mRNA was detected,
further restriction analysis revealed the presence of the short form of
the
2 message. The correct correspondence of the PCR product was
confirmed by Southern Blot analysis (Fig. 5B). In a total of
27 granule cells at 14 DIV, 23 were positive for
2 subunits (85%)
and 14 were positive for
subunits (52%). At 4 DIV, all 13 cells
were
2-positive, and none was positive for
subunits. In one cell
at 4 DIV and in five cells at 14 DIV, the long form of the
2 message
was also found.
Fig. 5.
Single-cell RT-PCR analysis in cultured cerebellar
granule cells. Granule cells from 4 DIV (A) or 14 DIV
(B) cultures were analyzed by single-cell RT-PCR as
described in Materials and Methods. A and
B show three representative cells from each culture. For
each PCR experiment, controls were performed to verify the absence of
contaminating cDNA. Shown here are controls (Co) in
which whole-cell recording was not performed, but a small amount of
medium was removed from the bath solution with the patch pipette.
B, Bottom panels show Southern blot analyses of the
corresponding PCR products using radiolabeled
2-specific primer
5
-AGCAACCGGAAACCAAGCAAGGATAAAGAC, which was then stripped and the
membrane was rehybridized with the
-specific primer
5
-TCAATGCTGACTACAGGAAGAAACGGAAAG. C shows the
potentiation of GABA-activated currents induced by 1 µM
THDOC for individual cells at 14 DIV in which RT-PCR of the individual
cells indicated the presence of
and/or
subunit mRNA as
indicated. Mean potentiations of cells in which the presence of
and
/
subunit mRNA were detected were statistically lower
(p < 0.01) than that for cells in which
only the
subunit mRNA was found.
[View Larger Version of this Image (28K GIF file)]
The average THDOC (1 µM) potentiation of GABA-gated
current at 4 DIV was 216 ± 26%, whereas at 14 DIV it was
132 ± 19%. Cells expressing
subunit mRNA or to a lesser
extent those expressing both
2 and
subunit mRNAs showed a
reduced enhancement of GABA-gated currents by THDOC (Fig.
5C). In cells at 14 DIV, THDOC (1 µM)
potentiation of GABA-gated currents in cells expressing exclusively the
2 subunit mRNA was 197 ± 25% (n = 13). In
contrast, cells expressing exclusively the
subunit mRNA exhibited a
potentiation of 42 ± 15% (n = 4); in those cells
expressing the
2 and
subunit mRNAs, the potentiation was 95 ± 22% (n = 10). In cells expressing the
2L
message, the extent of potentiation observed was not significantly
different from that in those cells in which only the short form of
2
was detected (data not shown).
DISCUSSION
Neurosteroid modulation of recombinant
GABAA receptors
Recombinant cDNA studies showed that neurosteroids enhance
GABAA receptor function assembled from various receptor
subunits, including homo-oligomeric receptors, but the potency and
efficacy of neurosteroid modulation were found to vary to some extent
with subunit composition (Lan et al., 1991
; Shingai et al., 1991
; Puia
et al., 1993
). Our data show for the first time that cotransfection of
1
3 or
6
3 subunits with
but not
subunit cDNAs
profoundly alters neurosteroid modulation of GABAA receptor
channels. These findings add to the distinct pharmacological
characteristics of GABAA receptors containing
subunits,
including EC50s of GABA dose-response, allosteric
modulations by benzodiazepines and barbiturates, and lanthanum-induced
potentiation (Saxena and MacDonald, 1994
, 1996
; Ducic et al., 1995
). We
investigated both direct and potentiating effects of neurosteroids on
GABAA receptors. In cells cotransfected with
subunit
cDNA, neurosteroid potentiation is considerably lower than in parallel
transfected cells lacking the
subunit cotransfection; however,
direct activation of GABA-gated currents was observed at THDOC
concentrations
1 µM, as is characteristic of cells
transfected with different GABAA receptor subunit cDNA
combinations. As a consequence, in
subunit cotransfected cells, the
amplitude of currents elicited by the combination of THDOC and GABA was
equal to or less than the sum of amplitudes of the currents observed by
GABA and THDOC applied independently. We thus propose that the presence
of the
subunit in the GABAA receptor assembly produces
receptors that lack neurosteroid modulation but can be activated
directly by neurosteroids.
Our results on the inhibition of THDOC modulation by the
subunit
cotransfection are supported further by similar findings obtained with
3
-OH-DHP and PS, a neurosteroid acting as a negative modulator. The
presence or absence of the
2 subunit, as well as substitution of the
or
subunit, failed to alter the effects of
subunit
cotransfection on neurosteroid modulation. Several reports present data
demonstrating distinct ligand binding and steroid-induced allosteric
modulation of GABAA receptors in various brain regions (Gee
et al., 1988
; Gee and Lan, 1991
; Sapp et al., 1992
). Indeed, in
situ hybridization studies demonstrated a selective abundance of
the mRNAs encoding the
subunit in the granule neurons of the
mammalian cerebellum and hippocampus (Laurie et al., 1992b
), areas in
which distinct effects of neuroactive steroids have been reported (Sapp
et al., 1992
; Cooper et al., 1995
).
In our transfection experiments, we observed a large variability of the
neurosteroid potentiation, even when only two subunit cDNAs were used.
The reasons underlying this observation are not easily interpreted, but
they may relate to the complex interactions between direct receptor
activation and allosteric modulation by neurosteroids combined with
variable receptor numbers from cell to cell and other factors such as
unknown subunit stoichiometry. The reduced variability, however, of the
neurosteroid potentiation observed in our transfection experiments
indicates that 
3
or 
3
2
, and not 
3 or

3
2, are likely to be the dominant isoforms in the
GABAA receptor assembly in cells transfected with

3
or 
3
2
cDNAs, in congruence with a previous
report (Saxena and MacDonald, 1994
). Also in agreement with a previous
report (Puia et al., 1993
), we found that recombinant GABAA
receptors are apparently less sensitive to THDOC-induced allosteric
modulation when transfecting with
6 versus
1 subunit cDNA. We
also confirm that the replacement of different
subunits has no
effect on the modulatory activity of THDOC and that there is no
absolute requirement for the presence of the
subunit to observe
neurosteroid potentiation (Puia et al., 1990
, 1993
). Our results are
therefore consistent with the proposal that steroid potency and
efficacy may be dependent on the cooperation of subunits that are
assembled to form the GABAA receptor (Lambert et al.,
1995
). In our study, we used GABA at the EC20 derived from
dose-response studies in transfected cells with combinations of
,
,
, and
subunits (Ducic et al., 1995
; Saxena and MacDonald,
1996
; our unpublished observations). For the most part, these
observations matched those of different studies; however, there were a
few notable differences. Among them, the most striking is the
considerable response we observed with
6
3 subunit heteromers, in
contrast to the lack of GABA-activated current found by Saxena and
MacDonald (1996)
in cells transfected with this subunit combination. At
present we do not know the reason underlying these results, although it
is possible that the different types of cells used to expressed
recombinant GABAA receptor may contribute to some of these
differences. In any case, our direct estimate of the GABAA
receptor EC20 in each subunit cotransfection setting had to
be used for the study of neurosteroid modulation.
Heterogeneity of neurosteroid modulation of native
GABAA receptors
GABAA receptor sensitivity to neurosteroids is
markedly decreased with development in a subset of cerebellar granule
neurons in culture. A decreased modulation by neurosteroids at 14 DIV
might be accounted for partly by the developmental increase of the
6
subunit mRNA expression (Laurie et al., 1992a
,b; Zheng et al., 1993
,
1995
; Mathews et al., 1994
). Our results demonstrate that
cotransfection of
with both
6
3 and
6
3
2 subunit cDNAs
significantly reduces the THDOC-induced potentiation, indicating a
determinant role of
subunit in the assembly of
neurosteroid-insensitive GABAA receptor. As a consequence,
we addressed the role of
subunit expression in neurosteroid
modulation of native receptors by using whole-cell recordings combined
with single-cell RT-PCR analysis. The
subunit is present
predominantly in granule neurons of cerebellum and hippocampus (Benke
et al., 1991
; Laurie et al., 1992a
), where it colocalizes with
1,
6,
2/3, and
2 subunits in the cerebellum and with
1,
4,
2/3, and
2L subunits in hippocampus (Laurie et al., 1992a
,b;
Quirk et al., 1994
, 1995
). In the cerebellum,
subunit mRNA and
protein levels increase with development (Bovolin et al., 1991
; Laurie
et al., 1992a
,b; Fritschy et al., 1994
). The results of our single-cell
RT-PCR study are in agreement with previous studies on developmental
expression of
subunit mRNAs in cultured cerebellar granule cells
(Zheng et al., 1995
; Behringer et al., 1996
). Although the mRNA for the
subunit was found in a limited number of neurons at 14 DIV, its
presence in specific cells correlates well with a decreased sensitivity
of GABAA receptors to neurosteroid modulation. Because we
limited our analysis to the expression of the
2 and
subunits, we
cannot rule out that distinct
,
, or
subunits may also affect
GABAA receptor sensitivity to neurosteroids to some extent.
It is clear from our results, however, that the positive identification
of the
subunit mRNA by single-cell RT-PCR correlates closely with
lowered neurosteroid responsiveness. Taken together, our data show that
a reduced sensitivity of native GABAA receptor to
neurosteroids during the development of granule neurons in culture is
related, at least in part, to the developmental increase of
subunit
expression. Similar findings, i.e., a reduced effect of neurosteroids,
were reported for GABAA receptors involved in inhibitory
synaptic currents recorded in hippocampal granule neurons in developing
rat brain slices (Cooper et al., 1995
). Thus, a structural requirement
for the allosteric regulation of GABAA receptor function by
neurosteroids may have important physiological significance for fast
inhibitory neurotransmission.
FOOTNOTES
Received June 26, 1996; revised July 31, 1996; accepted Aug. 9, 1996.
This work was supported by National Institute of Neurological Disorders
and Stroke Grants R01 NS32759 and K04 NS01680. We are grateful to Dr.
Dennis R. Grayson for critical reading of the manuscript.
GABAA receptor subunit expression vectors were kindly
provided by Dr. Peter H. Seeburg, Center for Molecular Biology,
University of Heidelberg, Heidelberg, Germany.
Correspondence should be addressed to Dr. Stefano Vicini, Department of
Physiology and Biophysics, Georgetown University School of Medicine,
3900 Reservoir Road NW, Washington, DC 20007.
REFERENCES
-
Behringer KA,
Gault LM,
Sigel RE
(1996)
Differential regulation of GABAA receptor subunit mRNA in rat cerebellar granule neurons: importance of environmental cues.
J Neurochem
66:1347-1353 .
[ISI][Medline]
-
Benke D,
Meterns S,
Trzeciak A,
Gillesen D,
Mohler H
(1991)
Identification and immunohistochemical mapping of GABAA receptor subtypes containing the
subunit in rat brain.
FEBS Lett
283:145-149 .
[ISI][Medline]
-
Bovolin P,
Santi MR,
Memo M,
Costa E,
Grayson DR
(1991)
Distinct developmental patterns of expression of rat
1,
5,
2S, and
2L
-aminobutyric acidA receptor subunit mRNAs in vivo and in vitro.
J Neurochem
59:62-72.
[ISI][Medline]
-
Chen C,
Okayama H
(1987)
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol Cell Biol
7:2745-2752 .
[Abstract/Free Full Text]
-
Cooper EJ,
Johnston GAR,
Edwards FA
(1995)
Differential sensitivity of synaptic GABAergic currents to a neuroactive steroid in brain slices from male rats.
Soc Neurosci Abstr
21:1345.
-
Ducic I,
Caruncho HJ,
Zhu WJ,
Vicini S,
Costa E
(1995)
-aminobutyric acid gating of Cl
channels in recombinant GABAA receptors.
J Pharmacol Exp Ther
272:438-445 .
[Abstract/Free Full Text]
-
Fritschy JM,
Mohler H
(1995)
GABAA receptor heterogeneity in the adult rat brain: differential regional and cellular distribution of seven major subunits.
J Comp Neurol
359:154-194 .
[ISI][Medline]
-
Fritschy J-M,
Paysan J,
Mohler H
(1994)
Switch in the expression of rat GABAA receptor subtypes during postnatal development: an immunohistochemical study.
J Neurosci
14:5302-5324 .
[Abstract]
-
Gee KW,
Lan NC
(1991)
-Aminobutyric acidA receptor complexes in rat cortex and spinal cord show differential responses to steroid modulation.
Mol Pharmacol
40:995-999 .
[Abstract]
-
Gee KW,
Bolger MB,
Brinton RE,
Coirini H,
McEwen BS
(1988)
Steroid modulation of the chloride ionophore in rat brain: structure-activity requirements, regional dependence and mechanism of action.
J Pharmacol Exp Ther
246:803-812 .
[Abstract/Free Full Text]
-
Hamill OP,
Marty A,
Neher E,
Sakmann B,
Sigworth FJ
(1981)
Improved patch-clamp technique for high-resolution current recording from cell and cell-free membrane patches.
Pflügers Arch
391:85-91 .
[ISI][Medline]
-
Kofuji P,
Wang JB,
Moss SJ,
Huganir RL,
Burt DR
(1991)
Generation of two forms of the gamma-aminobutyric acid A receptor
2 subunit in mice by alternative splicing.
J Neurochem
56:713-715 .
[ISI][Medline]
-
Korpi ER,
Luddens H
(1993)
Regional
-Aminobutyric acid sensitivity of t-butylbicyclophosphoro[35S]thionate binding depends on
-aminobutyric acidA receptor a subunit.
Mol Pharmacol
44:87-92 .
[Abstract]
-
Lambert JJ,
Belelli D,
Hill-Venning C,
Peters JA
(1995)
Neurosteroids and GABAA receptor function.
Trends Pharmacol
16:295-303 .
[Medline]
-
Lan NC,
Gee KW,
Bolger MB,
Chen JS
(1991)
Differential responses of expressed recombinant human
-aminobutyric acidA receptors to neurosteroids.
J Neurochem
57:1818-1821 .
[ISI][Medline]
-
Laurie DJ,
Seeburg PH,
Wisden W
(1992a)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. II. Olfactory bulb and cerebellum.
J Neurosci
12:1063-1076 .
[Abstract]
-
Laurie DJ,
Wisden W,
Seeburg PH
(1992b)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. III. Embryonic and postnatal development.
J Neurosci
12:4151-4172 .
[Abstract]
-
Luddens H,
Korpi ER,
Seeburg PH
(1995)
GABAA/benzodiazepine receptor heterogeneity: neurophysiological implications.
Neuropharmacology
34:245-254 .
[ISI][Medline]
-
MacDonald RL,
Olsen RW
(1994)
GABAA receptor channels.
Annu Rev Neurosci
17:569-602 .
[ISI][Medline]
-
Majewska MD,
Harrison NL,
Schwartz RD,
Barker JL,
Paul SM
(1986)
Steroid hormone metabolites are barbiturate-like modulators of the GABA receptor.
Science
232:1004-1007 .
[Abstract/Free Full Text]
-
Majewska MD,
Mienville JM,
Vicini S
(1988)
Neurosteroid pregnenolone sulfate antagonizes electrophysiological responses to GABA in neurons.
Neurosci Lett
90:279-284 .
[ISI][Medline]
-
Mathews GC,
Bolos-Sy AM,
Holland KD,
Isenberg KE,
Covey DF,
Ferrendelli JA,
Rothman SM
(1994)
Developmental alteration in GABAA receptor structure and physiological properties in cultured cerebellar granule neurons.
Neuron
13:149-158 .
[ISI][Medline]
-
McKernan RM,
Whiting PJ
(1996)
Which GABAA receptor subtypes really occur in the brain.
Trends Neurosci
19:139-143 .
[ISI][Medline]
-
Pritchett DB,
Sontheimer H,
Shivers BD,
Ymer S,
Kettenmann H,
Schofield PR,
Seeburg PH
(1989)
Importance of a novel GABAA receptor subunit for benzodiazepine pharmacology.
Nature
338:582-584 .
[Medline]
-
Puia G,
Santi MR,
Vicini S,
Pritchett DB,
Purdy RH,
Paul SM,
Seeburg PH,
Costa E
(1990)
Neurosteroids act on recombinant human GABAA receptor.
Neuron
4:759-765 .
[ISI][Medline]
-
Puia G,
Ducic I,
Vicini S,
Costa E
(1993)
Does neurosteroid modulatory efficacy depend on GABAA receptor subunit composition?
Receptors Channels
1:135-142 .
[ISI][Medline]
-
Quirk K,
Gillard NP,
Ragan I,
Whiting PJ,
McKernan RM
(1994)
Model of subunit composition of
-aminobutyric acid receptor subtypes expressed in rat cerebellum with respect to their
and
/
subunits.
J Biol Chem
269:16020-16028 .
[Abstract/Free Full Text]
-
Quirk K,
Whiting PJ,
Ragan CI,
Mckernan RM
(1995)
Characterisation of
-subunit containing GABAA receptors from rat brain.
Eur J Pharmacol
290:175-181 .
[ISI][Medline]
-
Sapp DW,
Witte U,
Turner DM,
Longoni B,
Kokka N,
Olsen RW
(1992)
Regional variation in steroid anesthetic modulation of [35S]TBPS binding to
-aminobutyric acidA receptors in rat brain.
J Pharmacol Exp Ther
262:801-806 .
[Abstract/Free Full Text]
-
Saxena NC,
MacDonald RL
(1994)
Assembly of GABAA receptor subunit: role of the
subunit.
J Neurosci
14:7077-7086 .
[Abstract]
-
Saxena NC,
MacDonald RL
(1996)
Properties of putative cerebellar
-aminobutyric acid (A) receptor isoforms.
Mol Pharmacol
49:567-579 .
[Abstract]
-
Shingai R,
Sutherland ML,
Barnard EA
(1991)
Effects of subunit types of cloned GABAA receptor on the response on the response to a steroid.
Eur J Pharmacol
206:77-88 .
[ISI][Medline]
-
Shivers BD,
Killish I,
Sprengel R,
Sontheimer H,
Köhler M,
Schofield PR,
Seeburg PH
(1989)
Two novel GABAA receptor subunits exist in distinct neuronal sub-populations.
Neuron
3:327-337 .
[ISI][Medline]
-
Sigel E,
Baur R,
Trube G,
Möhler H,
Malherbe P
(1990)
The effect of subunit composition of rat brain GABAA receptors on channel function.
Neuron
5:703-711 .
[ISI][Medline]
-
Turner DM,
Ransom RW,
Yang JS-J,
Olsen EW
(1989)
Steroid anesthetics and naturally occurring analogs modulate the
-aminobutyric acid receptor complex at a site distinct from barbiturates.
J Pharmacol Exp Ther
248:960-966 .
[Abstract/Free Full Text]
-
Whiting PJ,
McKernan RM,
Wafford KA
(1995)
Structure and pharmacology of vertebrate GABAA receptor subtypes.
Int Rev Neurobiol
38:95-139 .
[ISI][Medline]
-
Yeh HH,
Grigorenko EV
(1995)
Deciphering the native GABAA receptor: is there hope?
J Neurosci Res
41:567-571 .
[ISI][Medline]
-
Zhao Z,
Joho RH
(1990)
Isolation of distantly related members in a multigene family using the polymerase chain reaction technique.
Biochem Biophys Res Commun
167:174-182 .
[ISI][Medline]
-
Zheng T,
Santi MR,
Bovolin P,
Marlier LN,
Grayson DR
(1993)
Developmental expression of the
6 GABAA receptor occurs only after cerebellar granule cell migration.
Brain Res Dev Brain Res
75:91-103 .
[Medline]
-
Zheng T,
Zhu WJ,
Puia G,
Vicini S,
Grayson DR,
Costa E,
Caruncho HJ
(1995)
Changes in
-aminobutyrate type A receptor subunits mRNAs, translation product expression, and receptor function during neuronal maturation in vitro.
Pro