 |
Previous Article | Next Article 
Volume 16, Number 22,
Issue of November 15, 1996
pp. 7366-7375
Copyright ©1996 Society for Neuroscience
Enhanced Amphetamine Sensitivity and Increased Expression of
Dopamine D2 Receptors in Postpubertal Rats after Neonatal Excitotoxic
Lesions of the Medial Prefrontal Cortex
Gonzalo Flores,
Graham K. Wood,
Jin-Jun Liang,
Remi Quirion, and
Lalit K. Srivastava
Douglas Hospital Research Center, Departments of Psychiatry and
Neurology and Neurosurgery, McGill University, Montréal,
Québec, Canada H4H 1R3
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Functional and structural abnormalities in the medial prefrontal
cortex (MPFC) and overactive dopamine (DA) neurotransmission are
thought to be the key pathologies in schizophrenia. To understand the
role of MPFC in the pre- and postpubertal development of the
subcortical DA system, the effects of neonatal [postnatal day 7 (PD7)] MPFC excitotoxic lesions on locomotor behaviors and the
expression of DA receptor subtypes and DA transporter were investigated
in Sprague Dawley rats at PD35 and PD56, respectively. No significant
differences in the novelty or d-amphetamine-induced
locomotion were observed between sham-operated and ibotenic
acid-lesioned rats at PD35. Postpubertally (at PD56), however, the
locomotor activity of lesioned rats in the novel environment and after
d-amphetamine administration was enhanced significantly
compared with controls. The expressions of DA D1, D2, D3, and D4
receptors and DA transporter were then estimated in MPFC-lesioned and
sham-operated rats at PD39 and PD60. The levels of DA D2 receptors,
measured using [3H]-YM-09151-2 binding, and its mRNA by
in situ hybridization, were observed to be significantly
increased at PD60 in striatal and limbic areas of lesioned rats. Levels
of other DA receptor subtypes were not significantly affected at any
time points. Lesioned rats at PD39 show a small increase in DA
transporter level in the shell of nucleus accumbens; however, this
effect seems to wear off at PD60. The data suggest that neonatal MPFC
lesions may alter the functional development and maturation of
mesolimbic/nigrostriatal DA systems in that neonatally lesioned
rats grow into a behavioral/neurochemical deficit.
Key words:
prefrontal cortex;
schizophrenia;
animal model;
nucleus accumbens;
ibotenic acid;
dopamine receptors;
neurodevelopment
INTRODUCTION
Considerable evidence from clinical,
neuropsychological, brain imaging, and postmortem neuroanatomical
studies strongly implicates the medial prefrontal cortex (MPFC) in the
pathophysiology of schizophrenia (for review, see Weinberger et al.,
1994 ). MPFC neuronal activity exerts an important regulatory control on
the subcortical dopamine (DA) system, the overactivity of which is
believed to underlie some of the psychotic symptoms of the disease (for
review, see Goldstein and Deutch, 1992 ). The importance of the MPFC in
regulating the action of the limbic system, especially the mesolimbic
DA system, can be recognized by examining its connectivity. First, the
neurons of the MPFC are interconnected with the limbic cortex directly
through intracortical projections (Goldman-Rakic et al., 1984 ; Jay and
Witter, 1991 ). In addition, the MPFC projects to the substantia nigra
pars compacta and ventral tegmental area (VTA), the sources of striatal
and mesocorticolimbic DAergic projections, respectively (Sesack and
Pickel, 1992 ). Furthermore, MPFC efferents to the VTA control the DA
output to the nucleus accumbens (Taber et al., 1995 ; Karreman and
Moghaddam, 1996 ). Additional MPFC connections include direct
glutamatergic excitatory projections to the caudate-putamen and nucleus
accumbens (Sesack et al., 1989 ; Deutch, 1992 ), which may offer further
control of DA release (Grace, 1991 ; Karreman and Moghaddam, 1996 ).
Biochemical studies have indicated that lesion of the MPFC or
activation of its pathways alters the function of the subcortical DA
systems. For example, excitotoxic lesions of the adult rat MPFC have
been associated with a transiently enhanced DA turnover in limbic
regions (Christie et al., 1986 ), and 6-hydroxydopamine lesions of MPFC
have been reported to increase limbic DA transmission (Pycock et al.,
1980 ; Leccese and Lyness, 1987 ) as well as enhance the responsiveness
of the mesolimbic DA neurons to stress (Deutch et al., 1990 ; Doherty
and Gratton, 1996 ). Chemical and electrical stimulation of the MPFC
have been shown to increase DA release in the striatum (Murase et al.,
1993 ; Taber and Fibiger, 1993 ). Furthermore, adult rats with MPFC
excitotoxic lesions exhibit higher locomotor response to novelty, a
transitory increase in amphetamine-induced locomotor activity (Jaskiw
et al., 1990 ), swim-stress-induced locomotion (Jaskiw and Weinberger,
1992 ), and a decrease of the cataleptogenic effect of haloperidol
(Worms et al., 1985 ), all of which are behaviors related to DA
transmission.
In recent years, various evidence has accumulated that implicates
cortical neuronal maldevelopment in schizophrenia (for review, see
Weinberger and Lipska, 1995 ). Although studies on MPFC lesions induced
in the adult rat provide important insights into the regulatory
functions of this structure on DA systems, they do not address the
consequences of lesions to the MPFC on the development of subcortical
DAergic activity. Because schizophrenia symptoms typically appear after
puberty, i.e., in adolescence or early adulthood, it is important to
understand the role of early neurodevelopmental lesions on the
maturation of DA systems before and after puberty. Recently, the
developmental aspects of disrupting the prefrontal-temporal
connectivity were addressed by performing neonatal lesions of the
ventral hippocampus (VH) (Lipska et al., 1992 , 1993a ,b). These studies
have shown that neonatal lesions of the VH result in a delayed,
postpubertal onset of behavioral hyperactivity (Lipska et al.,
1993a ,b), which may be associated with decreased DA D3 receptors in the
nucleus accumbens (Flores et al., 1996 ). In the present investigation,
we have assessed the developmental consequence of neonatal ibotenic
acid-induced lesions of MPFC in postnatal day (PD) 7 rats. At pre- and
postpubertal ages, animals were tested in behavioral paradigms commonly
used to asses the functioning of the mesolimbic DA system, which
demonstrated a postpubertal onset of increased amphetamine-induced
locomotion in the neonatally lesioned rats. DA receptor subtypes and
the DA transporter were also measured at both ages and revealed an
increase in the DA D2 receptors that correlated with the onset of
behavioral changes in the MPFC-lesioned animals. The results suggest an
important role of developing MPFC in the functional maturation of
subcortical DA activity.
MATERIALS AND METHODS
Materials. d-Amphetamine sulfate, ibotenic
acid, ketanserine, butaclamol, 8-OH-DPAT, GTP, GBR-12909, and DA were
purchased from RBI (Natik, MA); 1,3-di(2-5-tolyl)guanidine (DTG) was
from Sigma (St. Louis, MO). [3H]-SCH23390 (70 Ci/mmol),
[3H]-YM-09151-2 (86 Ci/mmol), and
[3H]-WIN-35428 (84 Ci/mmol) were obtained from DuPont NEN
(Boston, MA). [3H]-7-OH-DPAT (139 Ci/mmol),
[3H]-Hyperfilm, and microscale tritium standards were
purchased from Amersham Canada (Toronto, Ontario). Oligonucleotides
probes were synthesized by the Sheldon Biotechnology Facility of McGill
University (Montreal, Quebec). 2-Methyl-butane was purchased from BDH
(Montreal, Quebec), and EDTA from Boehringer Mannheim (Laval, Quebec).
Gelatin and bovine serum albumin were purchased from Fisher Scientific
(Montreal, Quebec) and Calbiochem (La Jolla, CA) respectively. All
others chemical used were also of analytical reagent quality.
Neonatal MPFC lesions. Pregnant Sprague Dawley rats were
obtained at gestational day 14-17 from Charles River Canada (St.
Constant, Quebec). Animals were housed individually in a temperature-
and humidity-controlled environment on a 12 hr light/dark cycle with
free access to food and water. The day after birth, litters of six to
eight male pups were formed, and on PD7 each pup (weighing 15-17 gm)
was assigned to either a sham (n = 16) or a lesion
(n = 20) group. All surgical procedures described in
this study have been approved previously by McGill University Animal
Care Committee in accordance with the guidelines of the Canadian
Council for Animal Care. After the induction of anesthesia by
hypothermia, pups were positioned on a platform fixed to a stereotaxic
Kopf instrument. An incision was made over the skull and 0.3 µl
ibotenic acid (10 µg/µl) or an equal volume of vehicle (0.1 M PBS, pH 7.4) was injected in each side of the MPFC during
a 2 min period through a 30 gauge stainless steel cannulae positioned
at the following coordinates: anteroposterior, +2.5 mm; mediolateral, ± 0.4 mm to bregma; ventrodorsal 2.2 mm from dura. The cannulae
remained in place for 5 min after completion of the infusion. After the
procedure, the pups were placed under a warming lamp for recovery and
then returned to their mothers. On PD21 animals were weaned and grouped
two or three animals per cage.
Behavioral testing. Four (PD35) or 7 weeks (PD56)
after neonatal lesions, the locomotor activity of sham-operated and
ibotenic acid-lesioned rats was assessed in two-photocell activity
boxes connected to an IBM computer equipped with a software (ACTANAL)
developed by Concordia University (Montreal, Quebec). The locomotor
activity of each animal was assessed under the following testing
conditions. (1) Locomotion after exposure to a novel environment:
unacclimatized rats were placed in the activity boxes, and the beam
crosses were recorded for 60 min. (2) Locomotion after
d-amphetamine injection: 2 d after the first test, rats
were again placed in the activity boxes, and basal locomotor activity
was recorded for 60 min. Animals were injected first with 0.9% NaCl,
and then after 60 min of locomotor assessment with
d-amphetamine sulfate (1 mg/kg, s.c., dissolved in 0.9%
NaCl); locomotion was monitored further for the next 120 min. Locomotor
activity results were analyzed by applying two-way ANOVA followed by
Newman-Keuls tests for post hoc comparisons, with lesion
and age as independent factors (p < 0.05 was
considered significant).
Brain processing. Four sham-operated and five lesioned rats
per group were selected at random and killed by rapid decapitation 48 hr after the last testing day (PD39 and PD60, respectively). Brains
were removed rapidly, frozen in isopentane ( 40°C), and stored at
80°C until use. For assessment of lesion size, coronal sections at
the level of the MPFC were stained with 0.5% cresyl violet and
examined using a light microscope where lesions and probe placement
could be visualized. Frozen brains were sectioned at 15 µm thickness
on the coronal plane using a Leitz cryostat. Sections were collected on
cleaned, gelatin-coated microscope slides (four sections/slides),
thaw-mounted, desiccated under vacuum at 4°C overnight, and then
stored at 80°C until the day of the experiment.
Receptor autoradiography. Coronal brain sections taken at
the level of the nucleus accumbens and caudate-putamen [plate 10-11
of Paxinos and Watson atlas (1986)] were used in the following
protocols. For D1-like receptor binding, sections were first
preincubated for 10 min at room temperature in buffer containing 50 mM Tris-HCl, pH 7.4, 154 mM NaCl, 1 mM EDTA, and 0.1% bovine serum albumin. Sections were then
incubated for 90 min at room temperature in the same buffer with the
addition of 2 nM [3H]-SCH-23390 (74 Ci/mmol)
and 30 nM ketanserin (to mask possible binding of ligand to
serotonergic 5-HT2 sites). Nonspecific binding was determined on
adjacent brain sections by adding 1 µM (+)-butaclamol to
the buffer. Incubations were terminated by dipping the slides in
ice-cold buffer followed by two consecutive 10 min washes in buffer.
After a final dipping in ice-cold distilled water, slides were dried at
room temperature and apposed to [3H]-Hyperfilm for 5 d, alongside microscales-calibrated tritium standards.
For D2-like and D4 receptor binding, the slides were first preincubated
for 10 min at room temperature in buffer containing 50 mM
Tris-HCl, pH 7.4, 120 mM NaCl, 1 mM EDTA, 5 mM KCl, 1.5 mM CaCl2, and 4 mM MgCl2. Sections were then incubated for 2 hr
at room temperature in the same buffer containing 1 nM
[3H]-YM-09151-2 (86 Ci/mmol) with or without 100 nM raclopride, for assessment of D4 or D2 receptor
bindings, respectively. 8-OH-DPAT (50 nM) was added in each
case to mask possible binding of the ligands to serotonergic 5-HT1a
sites. Nonspecific binding was determined on adjacent brain sections by
adding 1 µM (+)-butaclamol in the buffer. Incubations
were terminated by dipping the slides in ice-cold buffer followed by
two consecutive 10 min washes in the same buffer. After a final dipping
in ice-cold distilled water, slides were dried at room temperature and
apposed to [3H]-Hyperfilm for 12 d, alongside
microscales-calibrated tritium standards.
[3H]-7-OH-DPAT binding to D3 receptor was assessed
according to the procedure of Lévesque et al. (1992) , with minor
modifications (Flores et al., 1996 ). Tissue sections were first
preincubated for 30 min in buffer containing 50 mM
Tris-HCl, pH 7.4, 100 mM NaCl, and 300 µM
GTP. Sections were then incubated for 2 hr at room temperature with 2 nM [3H]-7-OH-DPAT, 50 mM
Tris-HCl, pH 7.4, 100 mM NaCl, 300 µM GTP,
and 5 µM DTG (to block binding to site). 1 µM DA was used in adjacent sections to determine
nonspecific labeling. Incubations were terminated by washing the brain
sections twice for 10 min each in ice-cold 50 mM Tris-HCl,
pH 7.4. After a brief dipping in ice-cold distilled water, brain
sections were dried rapidly and apposed to [3H]-Hyperfilm
for 6 weeks, alongside microscales-calibrated tritium standards.
DA transporter binding was assayed essentially according to the method
of Kaufman et al. (1991) . The sections were first preincubated for 20 min at 4°C in 50 mM Tris-HCl, pH 7.4, containing 100 mM NaCl. Sections were then incubated for 2 hr at 4°C in
the same buffer containing 10 nM
[3H]-WIN-35428 (84 Ci/mmol). Nonspecific binding was
determined on adjacent brain sections by adding 1 µM
GBR-12909 in the buffer. Incubations were terminated by washing the
brain sections twice for 1 min each in ice-cold 50 mM
Tris-HCl, pH 7.4. After a brief dipping in ice-cold distilled water,
brain sections were dried rapidly and apposed to
[3H]-Hyperfilm for 6 week.
In situ hybridization. The probe for D2 receptor was a
39-mer oligonucleotide complementary to nucleotides 937-975 of the
coding region of rat D2 receptor cDNA (5 -GGT
CCGGGTTTTGCCATTGGGCATGGTCTGGATCTCAAA) (Bunzow et al., 1988 ) and
recognizes both alternatively spliced isoforms (D2L and D2S) of the
receptor mRNA. The probe for D1 receptor was a 39-mer oligonucleotide
complementary to nucleotides 1240-1278 of the coding region of rat D1
receptor cDNA
(5 -ATAGTCCAATATGACCGATAAGGCTGGGGACAGCTTCTC)
(Zhou et al., 1990 ). The oligonucleotides were 3 -end-labeled with
[ -35S] dATP and terminal transferase and purified
through an NACS column (Bethesda Research Labs, Mississauga, ON).
In situ hybridization was performed on 15 µm coronal
sections, essentially according to previously described procedure
(Srivastava et al., 1992 ). The sections were fixed in 4%
paraformaldehyde, and after acetylation (triethanolamine and acetic
anhydride) and defatting the sections were hybridized by placing
80-100 µl of hybridization mixture containing
[ -35S]-labeled oligonucleotide probe (3 × 105 cpm), 5× SSC, 50% formamide, 2× Denhardt's
solution, 10% dextran sulfate, 100 µg/ml salmon sperm DNA, and 50 µg/ml yeast tRNA at 42°C for 15-18 hr in a humidified box. They
were washed 4 × 30 min in 2× SSC at room temperature, 2 × 30 min in 0.1× SSC at 45°C, and finally 1 × 15 min in 0.1×
SSC at room temperature. After a brief rinse in ethanol containing 0.3 M ammonium acetate, pH 7.0, sections were air-dried and
apposed to [3H]-Hyperfilm.
Data analysis. Films from autoradiography and in
situ assays were analyzed using a computerized image analysis
system (MCID-4, Imaging Research, St. Catherine, Ontario). The binding
data were analyzed in brain subregions according to Paxinos and Watson
(1986) , namely, the dorsolateral, dorsomedial, and ventral
caudate-putamen, the fundus striatum, the shell and core of the nucleus
accumbens, olfactory tubercles, and the islands of Calleja, and are
expressed as femtomole per milligram wet tissue. Optical density of
in situ films was analyzed in the same regions, and the
results are expressed in random optical density units. Comparison
between groups was carried out by applying two-way ANOVA and post
hoc Newman-Keuls, with lesion and age as independent factors and
p < 0.05 considered significant.
RESULTS
Verification of the lesion
Bilateral reduction in the size of the frontal cortex was seen in
the neonatally lesioned rats. Cresyl violet-stained sections obtained
from neonatal lesioned animals, at both PD39 and PD60, revealed
moderate bilateral damage to the MPFC, with neuronal loss, atrophy, and
apparent retraction of the MPFC. Small cavities in the MPFC also were
seen occasionally (Figs. 1 and 2).
Fig. 1.
Schematic drawing of coronal sections (modified
from Paxinos and Watson, 1986 ) illustrating lesion boundaries and the
areas of neural loss and gliosis determined from Nissl-stained coronal
sections from PD60 rats with ibotenic acid lesion of the neonatal MPFC.
The stippled lines and solid black areas
indicate the largest and smallest lesions, respectively. Coordinates
refer to distance in millimeters anterior to bregma (Paxinos and
Watson, 1986 ).
[View Larger Version of this Image (21K GIF file)]
Fig. 2.
Photomicrograph of a coronal section of MPFC
stained with cresyl violet showing retraction of the tissue, gliosis,
and neural loss in PD60 neonatally lesioned rats. Scale bar, 160 µm.
[View Larger Version of this Image (156K GIF file)]
Behavioral testing
The prepubertal (PD35) and postpubertal (PD56) effects of neonatal
MPFC lesions on locomotor activity in a novel environment are
illustrated in Figure 3. In the two age groups, both
lesioned and sham-operated animals exhibited active exploratory
behavior when placed in a novel environment. Although no potentiation
of novelty-induced locomotion was seen in neonatally lesioned rats at
PD35, a significant increase in exploratory behavior was observed at
PD56 in neonatally MPFC-lesioned rats during the first 10 min period
(Fig. 3).
Fig. 3.
Locomotor activity (mean number of beam
interruptions per 10 min ± SEM; n = 8-10 per
group) in a novel environment of sham-operated or neonatal
MPFC-lesioned animals tested either at PD35 or PD56. Locomotor activity
was determined as described in Materials and Methods. At PD35, lesioned
animals did not differ from sham-operated animals at any testing
interval. In contrast, at PD56, lesioned rats were more active than the
sham-operated rats during the first 10 min of exploration
(*p < 0.05).
[View Larger Version of this Image (15K GIF file)]
Amphetamine administration induced a marked increase in the locomotor
activity at PD35 and PD56 in neonatally lesioned rats (Fig.
4). Analysis of the entire period of
d-amphetamine effect revealed no significant differences in
the locomotor activity between sham-operated and MPFC-lesioned rats at
PD35. Locomotor activity, however, was significantly increased (83%)
at PD56 in neonatally MPFC-lesioned animals when compared with
sham-operated controls (F(3,32) = 6.035;
p = 0.0022) (Fig. 4). No significant effect of saline
injection (vehicle) was observed in any of the groups (Fig. 4).
Fig. 4.
Locomotor activity after vehicle (saline) and
d-amphetamine administration (1 mg/kg,
s.c) of sham-operated or ibotenic acid-lesioned groups (mean number of
beam interruptions per 10 min ± SEM; n = 8-10 per group). A, Temporal profile of locomotor
activity at PD35. B, Temporal profile of locomotor
activity at PD56. C, Analysis of total activity scores
after d-amphetamine reveals that lesioned rats are
significantly more active than sham-operated rats only at PD56.
*p < 0.01, significantly different from the
sham-operated groups; +p < 0.05, significantly different from PD35 lesioned rats.
[View Larger Version of this Image (20K GIF file)]
[3H]-SCH-23390 binding
D1-like receptors, as measured by [3H]-SCH-23390
binding, are distributed throughout the dorsal and ventral regions of
the striatum. The distribution and density of
[3H]-SCH-23390 binding did not differ significantly
between the sham-operated and neonatal MPFC-lesioned animals at either
PD39 or PD60 (Table 1).
[3H]-YM-09151-2 binding
[3H]-YM-09151-2 binds DA receptor subtypes belonging
to the D2 family (D2, D3, and D4). Total D2-like receptor binding shows
a dorsoventral density gradient maximal in the caudate-putamen region.
The distribution and level of D2-like binding sites did not differ
significantly between the neonatally sham-operated and MPFC-lesioned
animals at PD39 (Table 2, Fig. 5). At
PD60, however, the level of D2-like binding sites was increased
significantly in the nucleus accumbens shell of the MPFC-lesioned
animals compared with sham controls (19%;
F(3,14) = 4.923; p = 0.0159)
(Table 2, Fig. 5). Putative DA D4 receptor binding, measured by
[3H]-YM-01951-2 in the presence of raclopride, did not
differ significantly between control and MPFC-lesioned rats (Table 2).
The level of D2 and D3 receptors, measured by subtracting
[3H]-YM-01951-2 binding in the presence of raclopride
from total [3H]-YM-01951-2 binding, was significantly
increased in the shell of the nucleus accumbens (35%;
F(3,14) = 4.598; p = 0.0193) and
the dorsolateral caudate-putamen (21%; F(3,14) = 4.765; p = 0.0172) (Table 3).
Fig. 5.
Effect of neonatal MPFC lesions on D2 DA receptor
binding in the striatum and nucleus accumbens. Coronal sections were
incubated, as described in Materials and Methods, in the presence of 1 nM [3H]-YM-09151-2. Results from the
quantitative analysis of [3H]-YM-09151-2 binding are
presented in Table 2. Cpu, Caudate-putamen;
Acc, nucleus accumbens; OT, olfactory
tubercles; PD39, postnatal day 39; PD60,
postnatal day 60.
[View Larger Version of this Image (104K GIF file)]
[3H]-7-OH-DPAT binding
DA D3 receptors, measured by [3H]-7-OH-DPAT binding,
were found principally in the islands of Calleja, the olfactory
tubercle, and the shell of the nucleus accumbens (Table
4). A low level of D3 receptor expression was also
detected in the striatum, particularly in its medial portion. D3
receptor levels in the fundus of caudate-putamen and the core of the
nucleus accumbens were significantly higher at PD60 than PD39 in both
sham-operated and lesioned groups and may indicate an age-related
enhancement in D3 receptors. Compared with sham-operated controls, none
of the MPFC-lesioned animals showed any significant differences in D3
binding levels.
[3H]-WIN-35428 binding
The DA transporters, as measured using
[3H]-WIN-35428, are distributed throughout the dorsal and
ventral part of the striatum. DA transporter levels in the shell of the
nucleus accumbens are lower at PD60 than at PD39 in the sham group. The
distribution and level of DA transporter binding sites do not differ
significantly between the sham-operated and neonatally MPFC-lesioned
animals at PD60 (Table 4). At PD39, however, the level of DA
transporter binding sites was significantly decreased (22%) in the
shell of the nucleus accumbens in the MPFC-damaged animals
(F(3,14) = 10.413; p = 0.0007)
(Table 4).
In situ hybridization
The distribution and level of D1 mRNA did not differ
significantly between the sham-operated and MPFC-lesioned animals in
any age group (Table 1). At PD60, however, D2 receptor mRNA was
significantly increased in the lesioned animals compared with sham
controls in the shell of the nucleus accumbens (24%;
F(3,14) = 36.065; p < 0.0001),
dorsomedial caudate-putamen (28%; F(3,14) = 9.164; p = 0.0013), and fundus caudate-putamen (36%;
F(3,14) = 10.553; p = 0.0007)
(Table 3, Fig. 6). D2 mRNA levels in the nucleus
accumbens were higher at PD60 than at PD39 in both the sham and
lesioned group, whereas in the caudate-putamen of the lesioned group
there were also higher D2 mRNA levels at PD60 compared with PD39.
Fig. 6.
Effect of neonatal MPFC lesions on the expression
of D2 receptor mRNA in the striatum and nucleus accumbens assessed by
in situ hybridization. Coronal sections were fixed and
hybridized with a [ -35S]-labeled D2R probe. Results
from the quantitative analysis of in situ hybridization
are presented in Table 3. Cpu, Caudate-putamen;
Acc, nucleus accumbens; OT, olfactory
tubercles; PD39, postnatal day 39; PD60,
postnatal day 60.
[View Larger Version of this Image (115K GIF file)]
DISCUSSION
The present study demonstrates the age-dependent nature of the
effects of neonatal MPFC excitotoxic lesion on behaviors linked to the
mesolimbic DA system. Neonatally induced MPFC damage by ibotenic acid
produced an increase in locomotor behavior at PD56, evident during the
exploratory period as well as after d-amphetamine
administration. Furthermore, as demonstrated by autoradiography and
in situ hybridization, these behavioral changes at PD56
occur concomitantly with an increase in the expression of DA D2
receptors in the shell of the nucleus accumbens and caudate-putamen
(dorsomedial and fundus). Similarly lesioned rats tested at PD35,
however, did not differ significantly from sham-operated animals either
in terms of behavior or DA receptor expression.
In contrast to neonatal lesions, excitotoxic lesions of the adult
rat MPFC result in a transient (present at 2 but not 4 weeks
postlesion) increase in locomotion in response to a novel environment
(Jaskiw and Weinberger, 1990 ) or d-amphetamine (Jaskiw et
al., 1990 ). We have also observed that novelty and
d-amphetamine effects were not significant 4 or 7 weeks
after MPFC lesion of adult rats, time periods that correspond to the
postoperative intervals of the present study (unpublished results). It
is interesting to note that lesions in the adult rat MPFC have been
associated with an increase in the swim-stress-induced locomotion
(Jaskiw and Weinberger, 1992 ). Furthermore, 6-hydroxydopamine lesions
of the MPFC also enhance responsiveness to stress (Deutch, 1992 ;
Doherty and Gratton, 1996 ). Thus, it is possible that our observation
of an increased locomotor activity in neonatally MPFC-lesioned rats at
PD56 present within the first 10 min after placing the animals in the
locomotor activity boxes could be a result of both previous handling
stress and a novel environment.
Previous reports have suggested that behavioral outcome of frontal
lesion depends on the age at which lesions are made as well as the age
when behavioral assessments are done. For example, animals receiving
early neonatal lesion (PD1-4) show more severe cognitive behavioral
deficits than similarly lesioned adult animals. In contrast, PD7-10
lesioned animals show a sparing or recovery of behavioral deficits
(related to memory and learning) when tested as adults (Kolb and
Whishaw, 1981 ; de Brabander et al., 1991a ; Freeman and Stanton, 1992 ;
Kolb and Gibb, 1993 ). In the light of evidence of functional recovery
after neonatal frontal lesions, our findings support the opposite;
i.e., the behavioral deficit (or at least a behavioral effect) is
dormant prepubertally and seems to express at approximately
postpubertal age. Our results thus are more consistent with early
frontal damage in nonhuman primates, which shows sparing of memory
functions in infants that later becomes a deficit in adults
(Goldman-Rakic et al., 1983 ). Interestingly, our findings in neonatal
MPFC-lesioned rats are similar to previous reports on neonatal
excitotoxic lesion of the VH that also demonstrated postpubertal onset
of enhanced d-amphetamine- and stress-induced
hyperlocomotion (Lipska et al., 1993a ,b; Flores et al., 1996 ). It is
not clear whether there are common mechanisms in the postpubertal onset
of behavioral changes in neonatal MPFC and VH lesions; however, it is
known that the VH sends excitatory projections to regions of the MPFC
(Jay and Witter, 1991 ). Therefore, a neonatal lesion of the VH
(deafferenting MPFC) may affect medial prefrontal cortical functions
during neonatal development and consequently alter DA-related
behaviors, as suggested previously (Lipska et al., 1993a ,b, 1994;
Weinberger and Lipska, 1995 ).
It has been suggested that changes in cortical dendritic arborization
(dendritic branching or spine density) may be responsible for
behavioral sparing or recovery after frontal cortical lesions (Kolb and
Whishaw, 1989 ; Kolb and Gibb, 1993 ). Integrity of cortical
noradrenergic afferents to cortex seems necessary for behavioral
sparing, because cortical 6-OHDA blocks the behavioral sparing and
alters cortical morphogenesis after neonatal frontal cortex damage in
rats (Kolb and Sutherland, 1992 ). Furthermore, de Brabander et al.
(1991b) showed an increase of the DA innervation to the cortex after
neonatal MPFC lesions in rats. In view of the complex neuroanatomical
and neurochemical reorganization in the frontal cortex after neonatal
injury, the delayed behavioral changes seen in the neonatal ibotenic
acid-lesioned animals may be attributed to neurodevelopmental
disturbances and compensatory changes, such as sprouting and rerouting,
that could cause changes in the pattern of neural projections,
including changes in mesocortical DAergic projections (Kolb et al.,
1994 ). Consistent with the evidence of neural reorganization after
frontal cortical damage, there are reports of alterations in cell
adhesion and extracellular matrix molecules in the rat and mouse
striatum (Poltorak et al., 1993 ; Butler et al., 1994 ) after frontal
cortex lesions.
Another aim of the present study was to evaluate the pre- and
postpubertal expressions of D1-like, D2, D3, and D4 DAergic receptors
and DA transporter in rats that had undergone bilateral ibotenic acid
lesions of the MPFC at PD7. Significant increases in the expression of
D2 receptors were observed at PD60 in the shell of the nucleus
accumbens and dorsomedial and fundus areas of the caudate-putamen. In
contrast, the overall expression of the D1-like, D3, and D4 receptors
did not change significantly after neonatal MPFC lesioning. The
neonatal MPFC lesions also induced a small but significant reduction of
the DA transporter in the shell of the nucleus accumbens at PD39;
however, there were not significant differences at PD60. The reduction
in the prepubertal level of DA transporter seems to be without
significant behavioral consequence, insofar as novelty- and
amphetamine-induced locomotion are concerned. It may be indicative,
however, of the beginning of postlesion compensatory changes in the
mesolimbic DA system occurring prepubertally, which eventually results
in overt behavioral changes at pubertal age, possibly mediated by
increased levels of D2 receptors. Previous studies in MPFC-lesioned
adult rats have not shown significant changes in the effects of
quinpirole, a D2 agonist, on locomotor behavior (Braun et al., 1993 ).
Our studies on neonatal MPFC lesion thus suggest a critical difference
between the consequences of lesions in adult and neonatal animals
insofar as D2 receptors are concerned, albeit indirectly. It is also
possible that the changes in the D2 receptor levels reported here may
not be a consequence of the loss of direct MPFC projection but may
relate to neurodevelopmental disturbances secondary to an early MPFC
damage.
A key finding of the present study, namely the increase in D2 receptors
in the shell of the nucleus accumbens associated with potentiated
amphetamine-induced locomotion, is particularly interesting in light of
our previous report of a decrease in D3 receptors in the same area of
neonatal VH-lesioned rats (Flores et al., 1996 ). Neonatal VH lesions
have been reported to result in postpubertal increase in novelty-,
stress-, and amphetamine-induced locomotor activity in rats (Lipska et
al., 1993a ,b; Flores et al., 1996 ). Thus, the behavioral consequences
of both neonatal VH and MPFC lesions appear to emerge postpubertally,
although differential changes in DA receptor subtypes accompany the
behavioral changes. The reason for a differential effect on DA receptor
subtypes in these two lesion paradigms is not clear. MPFC projects to
both substantia nigra pars compacta and VTA (Sesack and Pickel, 1992 ).
Stimulation of MPFC leads to increased DA release within the nucleus
accumbens through the VTA (Taber et al., 1995 ; Karreman and Moghaddam,
1996 ), whereas stimulation of the VH produces a triphasic DA release
via direct connections to the nucleus accumbens (Fibiger and Phillips,
1996 ). VH lesions, on the other hand, might not affect DA release
through VTA but might directly alter the level of D3 receptors in the
accumbens.
Previous studies in patients with schizophrenia have suggested an
aberration during development of the prefrontal-temporolimbic cortices
(for review, see Weinberger and Lipska, 1995 ). Morphometric studies
have reported cytoarchitectural disorganization of the MPFC in
schizophrenic brains (Benes et al., 1986 , 1991 ; Raine et al., 1992 ),
and positron emission tomography studies in schizophrenic patients have
demonstrated a reduced blood flow and metabolic activity in the
prefrontal cortex (popularly termed hypofrontality) (Ingvar and
Franzen, 1974 , Buchsbaum et al., 1990 ; Andreasen et al., 1992 ; Berman
et al., 1992 ). Increased neuronal density without cell loss has been
reported in prefrontal area 9 and occipital area 17 in the
schizophrenic brain, suggesting neuronal atrophy and loss of dendritic
arborization in these areas (Selemon et al., 1995 ). Along with these
anatomical and functional alterations, increments in the levels of
D2-like DA receptors in the caudate-putamen and nucleus accumbens of
schizophrenics have been reported in many studies, although some of
these changes could be attributed to increases in the D4 receptor
(Seeman and Niznik, 1990 ; Seeman et al., 1993 ). Our findings in
neonatal MPFC-lesioned rats agree with some of the features of human
schizophrenics: for example, postpubertal increase in mesolimbic
DA-related behavior associated with an increment in the level of D2
receptor in the nucleus accumbens.
In summary, increases in spontaneous and
d-amphetamine-induced locomotor activity are evident in the
PD56 neonatal MPFC-lesioned rats, which may be attributable in part to
increased expression of the DA D2 receptor in the nucleus accumbens.
These data are also consistent with previous studies implicating MPFC
neurons in the modulation of subcortical DA activity in the adult rat.
FOOTNOTES
Received July 10, 1996; revised Aug. 28, 1996; accepted Sept. 3, 1996.
This study was supported in part by grants from the Fonds de la
Recherche en Santé du Québec (FRSQ). G.F. is a postdoctoral
fellow of the Consejo Nacional de Ciencia y Tecnologia, Mexico. G.K.W.
is supported by the Max Stern studentship from McGill University.
L.K.S. and R.Q. are Chercheur-boursier and Chercheur-boursier de
mérite exceptionel of the FRSQ. We are grateful to Dr. Joseph
Rochford for his help and suggestions in behavioral assessments, Dr.
Alain Gratton for a critical reading of this manuscript, and Dr.
Jean-Guy Chabot for help in computer analysis of the autoradiographic
data.
Correspondence should be addressed to Lalit K. Srivastava, Douglas
Hospital Research Center, Neuroscience Division, 6875 Lasalle
Boulevard, Verdun, Québec, Canada H4H 1R3.
REFERENCES
-
Andreasen NC,
Rezai K,
Alliger R,
Swayze II,
VW,
Flaum M,
Kirchner P,
Cohen G,
O'Leary DS
(1992)
Hypofrontality in neuroleptic-naive patients and in patients with chronic schizophrenia: assessment with xenon 133 single photon emission computed tomography and the Tower of London.
Arch Gen Psychiatry
49:943-958 .
[Abstract]
-
Benes FM,
Davidson J,
Bird ED
(1986)
Quantitative cytoarchitectural studies of the cerebral cortex of schizophrenics.
Arch Gen Psychiatry
43:31-35 .
[Abstract]
-
Benes FM,
McSparren J,
Bird ED,
SanGiovanni JP,
Vicent SL
(1991)
Deficit in small interneurons in prefrontal and cingulate cortices of schizophrenic and schizoaffective patients.
Arch Gen Psychiatry
48:996-1001 .
[Abstract]
-
Berman KF,
Torrey EF,
Daniel DG,
Weinberger DR
(1992)
Regional cerebral blood flow in monozygotic twins discordant and concordant for schizophrenia.
Arch Gen Psychiatry
49:927-934 .
[Abstract]
-
Braun AR,
Jaskiw GE,
Vladar K,
Sexton RH,
Kolachana BS,
Weinberger DR
(1993)
Effects of ibotenic acid lesion of the medial prefrontal cortex on dopamine agonist-related behaviors in the rat.
Pharmacol Biochem Behav
46:51-60 .
[ISI][Medline]
-
Buchsbaum MS,
Nuechterlein KH,
Haier RJ,
Wu J,
Sicotte N,
Hazlett E,
Asarnow R,
Potkin S,
Guich S
(1990)
Glucose metabolic rate in normals and schizophrenics during the continuous performance test assessed by positron emission tomography.
Br J Psychiatry
156:216-227 .
[Abstract/Free Full Text]
-
Bunzow JR,
VanTol HHM,
Grandy DK,
Albert P,
Salon J,
Christie M,
Machida CA,
Neve KA,
Civelli O
(1988)
Cloning and expression of a rat D2 dopamine receptor cDNA.
Nature
336:783-787 .
[Medline]
-
Butler AK,
Rougon G,
Chesselet M-F
(1994)
PSA-NCAM in the developing striatum: effects of early post-natal lesions of the cerebral cortex.
Soc Neurosci Abstr
20:988.
-
Christie MJ,
Rowe PJ,
Beart PM
(1986)
Effect of excitotoxin lesions in the medial prefrontal cortex on cortical and subcortical catecholamine turnover in the rat.
J Neurochem
47:1593-1597 .
[ISI][Medline]
-
de Brabander JM,
de Bruin JP,
van Eden CG
(1991a)
Comparison of the effects of neonatal and adult medial prefrontal cortex lesions on food hoarding and spatial delayed alternation.
Behav Brain Res
42:67-75 .
[ISI][Medline]
-
de Brabander JM,
van Eden CG,
de Bruin JP
(1991b)
Neuroanatomical correlates of sparing of function after neonatal medial prefrontal cortex lesion in rats.
Brain Res
568:24-34 .
[ISI][Medline]
-
Deutch AY
(1992)
The regulation of subcortical dopamine systems by the prefrontal cortex: interactions of central dopamine systems and the pathogenesis of schizophrenia.
J Neural Transm [Suppl]
36:61-89 .
[Medline]
-
Deutch AY,
Clark WA,
Roth RH
(1990)
Prefrontal cortical dopamine depletion enhances the responsiveness of mesolimbic dopamine neurons to stress.
Brain Res
521:311-315 .
[ISI][Medline]
-
Doherty MD,
Gratton A
(1996)
Medial prefrontal cortical D1 receptor modulation of the meso-accumbens dopamine response to stress: an electrochemical study in freely-behaving rats.
Brain Res
715:86-97 .
[ISI][Medline]
-
Fibiger HC, Phillips A (1996) Cortical and subcortical
regulation of dopamine release: implications for the pathophysiology of
schizophrenia. Can Coll Neuropsychopharmacol Abstr 3.
-
Flores G,
Barbeau D,
Quirion R,
Srivastava LK
(1996)
Decreased binding of dopamine D3 receptors in limbic subregions following neonatal bilateral lesion of rat hippocampus.
J Neurosci
16:2020-2026 .
[Abstract/Free Full Text]
-
Freeman HJ Jr,
Stanton ME
(1992)
Medial prefrontal cortex lesions and spatial delayed alternation in the developing rat: recovery or sparing.
Behav Neurosci
106:924-932.
[ISI][Medline]
-
Goldman-Rakic PS,
Isseroff A,
Schwartz ML,
Bugbee NM
(1983)
The neurobiology of cognitive development.
In: Handbook of child psychology, Vol II, Infancy and developmental psychobiology
(Mussen, PH,
eds)
, p. 281. New York: Wiley.
-
Goldman-Rakic PS,
Selemon LD,
Schwartz ML
(1984)
Dual pathways connecting the dorsolateral prefrontal cortex with the hippocampal formation and parahippocampal cortex in the rhesus monkey.
Neuroscience
12:719-743 .
[ISI][Medline]
-
Goldstein M,
Deutch AY
(1992)
Dopaminergic mechanisms in the pathogenesis of schizophrenia.
FASEB J
6:2413-2421 .
[Abstract]
-
Grace AA
(1991)
Phasic versus tonic dopamine release and the modulation of dopamine system responsivity: a hypothesis for the etiology of schizophrenia.
Neuroscience
41:1-24 .
[ISI][Medline]
-
Ingvar DH,
Franzen G
(1974)
Abnormalities of cerebral blood flow distribution in patients with chronic schizophrenia.
Acta Psychiatr Scand
50:425-462 .
[ISI][Medline]
-
Jaskiw GE,
Weinberger DR
(1990)
Effect of ibotenic acid lesions of the medial prefrontal cortex potentiate FG-7142-induced attenuation of exploratory activity in the rat.
Pharmacol Biochem Behav
36:695-697 .
[ISI][Medline]
-
Jaskiw GE,
Weinberger DR
(1992)
Effect of ibotenic acid lesions of the medial prefrontal cortex augment swim-stress-induced locomotion.
Pharmacol Biochem Behav
41:607-609 .
[ISI][Medline]
-
Jaskiw GE,
Karoum F,
Freed WJ,
Phillips I,
Kleinman JE,
Weinberger DR
(1990)
Effect of ibotenic acid lesions of the medial prefrontal cortex on amphetamine-induced locomotion and regional brain catecholamine concentrations in the rat.
Brain Res
534:263-272 .
[ISI][Medline]
-
Jay TM,
Witter MP
(1991)
Distribution of hippocampal CA1 and subicular efferents in the prefrontal cortex of the rat studied by means of anterograde transport of phaseolus vulgaris-leucoagglutinin.
J Comp Neurol
313:574-586 .
[ISI][Medline]
-
Karreman M,
Moghaddam B
(1996)
The prefrontal cortex regulates the basal release of dopamine in the limbic striatum: an affect mediated by ventral tegmental area.
J Neurochem
66:589-598 .
[ISI][Medline]
-
Kaufman MJ,
Spealman RD,
Madras BK
(1991)
Distribution of cocaine recognition sites on monkey brain: I. In vitro autoradiography with [3H]CFT.
Synapse
9:177-187 .
[ISI][Medline]
-
Kolb B,
Whishaw IQ
(1981)
Neonatal frontal lesions in the rat: sparing of learned but not species-typical behavior in the presence of reduced brain weight and cortical thickness.
J Comp Physiol Psychol
95:863-879 .
[ISI][Medline]
-
Kolb B,
Whishaw IQ
(1989)
Plasticity in the neocortex: mechanisms underlying recovery from early brain damage.
Prog Neurobiol
32:235-276 .
[ISI][Medline]
-
Kolb B,
Gibb G
(1993)
Possible anatomical basis of recovery of function after neonatal frontal lesions in rats.
Behav Neurosci
107:799-811 .
[ISI][Medline]
-
Kolb B,
Sutherland RJ
(1992)
Noradrenaline depletion blocks behavioral sparing and alters cortical morphogenesis after neonatal frontal cortex damage in rats.
J Neurosci
12:2321-2330 .
[Abstract]
-
Kolb B,
Gibb G,
van der Kooy D
(1994)
Neonatal frontal cortical lesions in rats alter cortical structure and connectivity.
Brain Res
645:85-97 .
[ISI][Medline]
-
Leccese AP,
Lyness WH
(1987)
Lesions of dopamine neurons in the medial prefrontal cortex: effects on self-administration of amphetamine and dopamine synthesis in the brain of the rat.
Neuropharmacology
26:1303-1308 .
[ISI][Medline]
-
Lévesque D,
Díaz J,
Pilon C,
Martres MP,
Giros B,
Souil B,
Schott D,
Morgat JL,
Schwartz JC
(1992)
Identification, characterization, and localization of the dopamine D3 receptor in the rat brain using 7-[3H]hydroxy-N-N-di-n-propyl-2-aminotetralin.
Proc Natl Acad Sci USA
89:8155-8159 .
[Abstract/Free Full Text]
-
Lipska BK,
Jaskiw GE,
Chrapusta S,
Karoum F,
Weinberger DR
(1992)
Ibotenic acid lesion of the ventral hippocampus differentially effects dopamine and its metabolites in the nucleus accumbens and prefrontal cortex in the rat.
Brain Res
585:1-6 .
[ISI][Medline]
-
Lipska BK,
Jaskiw GE,
Weinberger DR
|