 |
Previous Article | Next Article 
Volume 16, Number 23,
Issue of December 1, 1996
pp. 7550-7556
Copyright ©1996 Society for Neuroscience
Transcription Factor AP-2 Regulates Human Apolipoprotein E Gene
Expression in Astrocytoma Cells
Miguel A. García,
Jesús Vázquez,
Cecilio Giménez,
Fernando Valdivieso, and
Francisco Zafra
Centro de Biología Molecular "Severo Ochoa," Facultad
de Ciencias, Universidad Autónoma de Madrid, Consejo Superior de
Investigaciones Científicas, E-28049 Madrid, Spain
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Apolipoprotein E (apoE), one of the major plasma lipoproteins, also
is expressed in a variety of cell types, including the glial cells of
the nervous system. apoE is involved in processes of degeneration and
regeneration after nerve lesions as well as in the pathogenesis of
Alzheimer's disease (AD). Glial synthesis of apoE is activated in
response to injury both in the peripheral and central nervous system.
We now report that the activity of the proximal apoE promoter in
astrocytes is upregulated by cAMP and retinoic acid, which act
synergistically. Sequence analysis of the apoE promoter indicated the
presence of several AP-2 consensus sequences that could mediate the
stimulatory effect of cAMP and retinoic acid. The possible functional
role of AP-2 was examined by cotransfection of AP-2-deficient HepG2
cells with an apoE promoter construct and a human AP-2 expression
construct. Cotransfection with AP-2 significantly elevated apoE
promoter activity. DNase I footprinting technique revealed the
existence of two binding sites for recombinant AP-2 in regions from
48 to 74 and from 107 to 135 of the apoE promoter. Mutations in
these regions markedly impaired the trans-stimulatory effect of AP-2.
These results indicate the existence of functional AP-2 sites in the promoter region of apoE that could contribute to the complex regulation of this gene in developmental, degenerative, and regenerative processes
of the nervous system.
Key words:
apolipoprotein E;
astrocytes;
AP-2;
cAMP;
retinoic acid;
promoter
INTRODUCTION
Apolipoprotein E (apoE) is a major component of
various classes of plasma lipoproteins. It is a single-chain
polypeptide of 299 amino acids that plays a prominent role in transport
and metabolism of plasma cholesterol and triglycerides as a result of
its ability to interact with lipoprotein receptors (Mahley, 1988 ). The
major site of synthesis is the liver, but the protein also is produced in extrahepatic tissues such as adrenals and nervous system. In brain,
the synthesis take place in astrocytic cells (Boyles et al., 1985 ;
Pitas et al., 1987 ), whereas in the peripheral nervous system apoE is
synthesized by nonmyelinating glial cells and resident macrophages
(Boyles et al., 1985 ). The protein has been implicated both in
peripheral and central nerve regeneration. Synthesis of apoE is
increased dramatically after injury to the sciatic nerve (Müller
et al., 1985 ; Ignatius et al., 1986 ; Snipes et al., 1986 ) as well as
after lesions of the optic nerve or the spinal cord (Boyles et al.,
1989 ). More recently, a link between apoE and Alzheimer's disease (AD)
has been found. The amino acid sequence of the human protein presents
two polymorphic sites that generate three alleles (apoE2, apoE3,
and apoE4). The isoforms differ in arginine or cysteine content at
positions 112 and 158 (Rall et al., 1982 ). Recent genetic studies have
identified the apoE4 allele as a major risk factor for developing AD,
both in sporadic and in familial late onset AD (Corder et al., 1993 ;
Strittmatter et al., 1993 ).
ApoE synthesis is regulated in hepatic and steroidogenic cells by a
complex interaction of developmental, hormonal, and dietary factors
(Basu et al., 1981 ; Lin-Lee et al., 1981 ; Reue et al., 1984 ;
Elshourbagy et al., 1985 ; Kayden et al., 1985 ). The regulatory complexity emerges from interactions of a number of proteins that bind
to the proximal promoter region as well as to far downstream elements
involved in its tissue-specific expression (Paik et al., 1988 ; Smith et
al., 1988 ; Simonet et al., 1990 , 1993 ; Berg et al., 1995 ). The
regulation in brain cells, however, remains unexplored despite the
importance of this protein in processes of degeneration and
regeneration of the nervous system. In this report we have studied the
regulation of the expression of the proximal apoE promoter in
astrocytic cells. We show the presence of two functional binding sites
for the transcription factor AP-2 in this region of the promoter that
mediate the stimulatory effect of the differentiating agents cAMP and
retinoic acid on the activity of the promoter.
MATERIALS AND METHODS
Materials
Taq polymerase was obtained from Perkin-Elmer
(Norwalk, CT). DNase I, DOTAP, ligase, and restriction enzymes were
obtained from Boehringer Mannheim (Mannheim, Germany). Recombinant AP-2 was obtained from Promega (Madison, WI) and poly(dI-dC) from Pharmacia (Uppsala, Sweden). Oligonucleotides were obtained from Isogen (Maarseen, The Netherlands). All other reagents were obtained in the
purest form available.
Methods
Plasmid constructions. The 5 region between
positions 1011 and +400 of the apoE gene was amplified by PCR using
human genomic DNA as a template and the following primers:
CAAGGTCACACAGCTGGCAACT and TCCAATCGACGGCTAGCTACC. The amplified
fragment was ligated to the pCRII vector (Invitrogen, San Diego, CA)
(apoE-pCRII construct), and its identity was confirmed by sequencing
with the Fentomol kit (Promega). The 1.4 kb-cloned DNA fragment was
subcloned in front of the luciferase reporter gene in the
XhoI/HindIII sites of the pXP2 vector (Nordeen,
1988 ). Different deletions were generated by using a similar PCR
strategy: oligonucleotides were designed at the desired positions and
used as primers with the apoE-pCRII construct as a template. Amplified
fragments were cloned in the pCRII plasmid, sequenced, and subcloned in
the XhoI/HindIII sites of the luciferase
expression vector pXP2.
Site-directed mutagenesis. The PCR-based site-directed
mutagenesis strategy followed to destroy the AP-2 binding sites of the
apoE promoter was a modification of the method of Higuchi (1990) , as
described by Olivares et al. (1995) . The deleted construct 227 was
used as a template, and the following oligonucleotides were used as
primers: GTCCCGCCCCCT CGGATAGGGCGGGC, which exchanged
the 60 AP-2 element for the underlined SalI restriction site, and CCCTCTGCCCTGCT GGAGAACAGCCCA, which
exchanged the 117 AP-2 element for the underlined EcoRI
restriction site. The mutated PCR fragments were introduced into pCRII,
identified by restriction analysis, sequenced, and transferred to the
XhoI/HindIII sites of the luciferase expression
vector pXP2.
Cell culture and transfections. U87 and HepG2 cells
were grown in DMEM containing 10% fetal bovine serum. The day before
transfection, confluent cells were subcultured by trypsinization, and
1-3 × 104 cells per well were plated in 24 well
tissue culture plates. HepG2 cells were transfected by the calcium
phosphate method. Briefly, calcium phosphate-DNA coprecipitates were
prepared by adding, dropwise, a 220 mM calcium chloride
solution to an equal volume of vortexing HEPES-buffered saline solution
[(in mM) 275 NaCl, 40 HEPES, 10 KCl, 1.4 sodium phosphate,
pH 7.05, and 12 glucose] containing plasmid. Then 0.5 ml of the DNA
precipitates (0.8 µg each of test and reference plasmid
constructions) was added to each well and allowed to incubate with the
cells for 14 hr. HepG2 cells were shocked by adding a 10% DMSO
solution in PBS for 2.5 min at room temperature. Cells were washed once with serum-free DMEM and replenished with growth medium. Then cells
were harvested on day 2 after transfection. U87 cells were transfected
with 0.5 µg of DNA per well by lipofection with
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP; Boehringer Mannheim), according to the
manufacturer's instructions. The different drug treatments were
initiated immediately after the transfection procedure and kept until
cells were harvested.
Luciferase and -galactosidase assays. Cells were
harvested on day 2 after transfection with 150 µl of a lysis buffer
containing 25 mM Tris-phosphate, 2 mM DTT, 2 mM EDTA, 10% glycerol, and 1% Triton X-100. Unsolubilized
material was removed by 2 min of centrifugation, and the luciferase and
-galactosidase activities of the extracts were determined.
Luciferase was measured by the Luciferase Assay System (Promega) in a
Monolight 2010 luminometer (Analytical Luminescence Laboratory, San
Diego, CA) by incubation of 10 µl of cell extract with 90 µl of
luciferase assay reagent, as recommended by the manufacturer.
-Galactosidase was determined in a 96 well microtiter plate by
incubating 20 µl of cellular extract with 80 µl of a solution
containing 3 mg/ml of
o-nitrophenyl- -D-galactopyranoside, as described
(Sambrook et al., 1989 ). Absorbance at 405 nm was determined in an MR
5000 microplate reader (Dynatech, West Sussex, UK).
DNase I protection assay. Oligonucleotides were end-labeled
by T4 polynucleotide kinase in the presence of
[ -32P]ATP. These oligonucleotides were used as PCR
primers as described (Krummel, 1990 ). The amplification products were
purified via a DNA Purification System (Promega). The footprinting
reactions were performed in 20 µl containing 100,000 cpm of labeled
probe and 1-4 footprinting units of AP-2 protein (Promega), containing (in mM): 20 HEPES, pH 7.9, 100 KCl, 0.2 EDTA, 12 MgCl2, 0.5 DTT, and 0.5 phenylmethylsulfonyl fluoride with
20% glycerol, 0.3 µg/ml leupeptin, and 4 µg of poly(dI-dC). The
mixture was incubated for 10 min on ice and for 20 min at room
temperature and treated with DNase I for 30 sec by the addition of 50 µl of a solution containing 1 unit DNase I in 10 mM
MgCl2. The digestion was terminated by adding 150 µl of 8 M urea, 0.5% sodium dodecyl sulfate, and 5 mM
EDTA. The DNA was phenol-extracted and ethanol-precipitated before
being subjected to electrophoresis in a gel containing 6%
polyacrylamide and 6 M urea. The position of the protected regions was determined by comparison with a G+A sequence ladder, as
described (Maxam and Gilbert, 1980 ).
RESULTS
Positive and negative regulatory regions within apoE promoter
mediate expression in astrocytoma cells
The expression of the apoE proximal promoter in astrocytic cells
was studied in a transient expression system that allowed us to map
which sequences were necessary to yield maximal expression of apoE in
these cells. Fragments containing different sequences comprising
between 1011 and +400 of the apoE gene 5 region were generated by PCR
and fused to the coding sequence of the luciferase gene in the pXP2
vector. A series of constructions with various deletions (Fig.
1) were transfected into U87 astrocytoma cells, and the
luciferase activity was determined 48 hr later. Along with the test
constructions, each plate was cotransfected with a -galactosidase
expression vector that served as an internal reference for transfection
efficiency. For comparison we transfected the hepatoma cell line HepG2
with the same constructions. As shown, a stepwise increase in the
luciferase activity was observed in U87 cells by successive deletions
in the 5 end of the promoter region up to the nucleotide 227. The
activity increased from 100% in the longest construct assayed
(construct 1) to 117% in construct 2, 129% in construct 3, and 236%
in construct 4. These data indicated the presence of negative
regulatory elements in this region, especially between nucleotides
227 and 296. The promoter activity pattern was clearly different in
HepG2, where a positive element was defined in the region between
nucleotides 1011 and 611, because the luciferase activity decreased
from 100% in the long construction to 56% in construct 2 (Fig. 1). The increased luciferase activity obtained with construct 3 (160% of
longer construct), as compared with construct 2, defined a negative
element between nucleotides 611 and 296. In addition, a negative
element was defined in both cell types in the first intron, because
deletion of the region +1 to +400 produced a strong increase in the
activity of the reporter, especially in HepG2. Further deletions to
nucleotides 125 and 80 defined a further positive element as the
reporter activity decreased stepwise in both cell types.
Fig. 1.
Promoter activity of different constructs
containing truncated forms of apoE promoter fused to luciferase
reporter gene. The structure of the constructs is shown at the
left. The genomic structure of the apoE gene 5 region
is indicated at the top. Luc, Luciferase
reporter gene. Luciferase/ -galactosidase ratios are expressed at the
right, as percentages of activity of construct 1, for
U87 and HepG2 cells. Values are expressed as the mean ± SEM of
two triplicate determinations and are corrected for the activities
measured by using the promoterless pXP2 plasmid.
[View Larger Version of this Image (18K GIF file)]
cAMP and retinoic acid differentially regulate apoE promoter in
astrocytoma and hepatoma cell lines
Transformation of normal astrocytes to reactive astrocytes, which
occurs in brain after injury, is accompanied by a dramatic increase in
the synthesis of apoE in these cells. Many of the changes that occur in
reactive gliosis can be mimicked in vitro by treatment with
cAMP (Fedoroff et al., 1984 ; Sharma and Raj, 1987 ). To study whether
cAMP had any effect on the activity of the apoE promoter, we examined
reporter expression in U87 astrocytoma cells transiently transfected
with construct 4 and treated with dibutyryl-cAMP (dBcAMP). For
comparison, the same treatment was performed in transfected HepG2
cells. Figure 2 shows that dBcAMP treatment produced a
differential effect in U87 and HepG2 cells, stimulating approximately
fourfold over the basal level in astrocytoma but being ineffective in
hepatoma. Interestingly, the effect of dBcAMP in U87 cells was
potentiated by retinoic acid (RA), a potent morphogenetic and
teratogenic agent. Although the effect of RA alone was rather weak
(140% over the nontreated control), it acted synergistically with
dBcAMP in U87 cells, obtaining a stimulation of 750% when both
substances were added together to the culture medium (Fig.
2A). None of these treatments affected the promoter activity in HepG2 cells (Fig. 2B). Quantitatively
similar results were obtained by transfecting both cell lines with
construct 1 (data not shown). The synergistic effect of RA and dBcAMP
was observable at RA concentrations of 10 7 M
but was maximal at 10 6 M (Fig.
3A). Other treatments, such as addition of
cholera toxin, which is known to increase the intracellular cAMP
content, were also stimulatory of the apoE promoter activity (Fig.
3B), although the observed effect was less remarkable.
Fig. 2.
Effect of cAMP and RA on the apoE promoter
activity. U87 (A) or HepG2 (B) cells
transiently transfected with construct 4 and a -galactosidase
expression construct were incubated for 48 hr in the absence
(C) or the presence of 1 µM RA
(RA), 1 mM dBcAMP (cAMP), or
both agents simultaneously (RA+cAMP). Luciferase and -galactosidase activities were determined as indicated in Materials and Methods. Results are expressed as a percentage of activities of
untreated control cells (C). Values are the mean ± SEM of two triplicate determinations and are corrected for the
activities measured by using the promoterless pXP2 plasmid.
[View Larger Version of this Image (38K GIF file)]
Fig. 3.
Effect of RA at different concentrations and
cholera toxin on the apoE promoter activity. U87 cells were
transiently transfected with construct 4 and a
-galactosidase expression construct. A, Cells
were incubated for 48 hr in the absence (C) or
the presence of 1 mM dBcAMP (+cAMP) plus
either 0 (RA 0), 10 7
(RA-7), 10 6
(RA-6), or 10 5 M RA
(RA-5). B, Cells were incubated in the
absence (C) or the presence of 1.25 µg/ml cholera
toxin (ChTx), or 1.25 µg/ml cholera toxin plus 1 µM RA (ChTx+RA). Luciferase and
-galactosidase activities were determined as indicated in Materials
and Methods. Results are expressed as a percentage of activities of
untreated controls. Values are the mean ± SEM of two triplicate
determinations and are corrected for the activities measured by using
the promoterless pXP2 plasmid.
[View Larger Version of this Image (53K GIF file)]
AP-2 upregulates apoE by binding to 117 and 60 AP-2
consensus sequences
It is well established for a number of genes that regulatory
responses to cAMP can be transduced by CRE, AP-2, or NF B binding sites located in their promoter regions. A search of consensus recognition patterns in the apoE promoter revealed the presence of
several putative regulatory sequences, among them four AP-2 binding
sites (Fig. 4). AP-2 is known to be upregulated by RA; moreover, HepG2 is an AP-2 deficient cell line. Therefore, our data
suggested the possibility that cAMP and RA could upregulate the apoE
gene by a mechanism mediated by AP-2. To investigate this hypothesis,
we studied the ability of AP-2 to stimulate transcription from the apoE
promoter by cotransfecting the apoE promoter-luciferase construct 4 with an expression vector of AP-2. The experiments were performed in
HepG2, which, as mentioned above, is deficient in AP-2. Cotransfection
of construct 4 and AP-2 produced a stimulation of 1040 ± 60%
(mean ± SEM of two triplicate determinations) of the reporter
activity, as compared with control cells transfected with construct 4 (100 ± 5%), thus suggesting a regulatory role of AP-2 over apoE
promoter.
Fig. 4.
Nucleotide sequence of the upstream region of the
human apoE gene. The sequence is numbered relative to the transcription start site (+1). Localization of some of the putative regulatory elements is indicated below the sequence.
TATA, The TATA box element; SP1, the GC
box element; AP-2, AP-2-like binding sequence;
ERE, element with homology to the estrogen-responsive
elements; A, B1, and B2 are the apoE A,
B1, and B2 elements, respectively, as defined by Smith et al.
(1988) .
[View Larger Version of this Image (19K GIF file)]
To analyze whether the observed effect of AP-2 was attributable to
direct binding of this transcription factor to apoE promoter, we first
studied the ability of recombinant AP-2 to bind the end-labeled DNA
fragment 1 to 227. As shown in Figure 5, DNase I
footprinting experiments identified two protected areas in this DNA
fragment. The boundaries of the binding sites were located in
nucleotides 48 to 74 (footprint 60) and 104 to 135 (footprint
117). The two footprints were observed in both the noncoding (Fig.
5A) and the coding strands (Fig. 5B). Second, the
functional importance of these regions in AP-2 stimulatory effect was
confirmed by site-directed mutagenesis of the two footprints. Mutants
in the 117 and in the 60 AP-2 binding sites of construct 4 were
generated and cotransfected with the AP-2 expression vector in HepG2
cells. As shown in Figure 6, mutations at both the 117
and the 60 sites markedly reduced the trans-stimulatory effect of
AP-2 (52 and 66% inhibition, respectively; Fig. 6A),
although the simultaneous mutation of both 117 and 60 footprints
did not produce a higher level of inhibition. These experiments clearly
established that these two binding sites are used functionally by AP-2.
A weaker protection by recombinant AP-2 also was observed in the 85
to 100 region (Fig. 5). However, site-directed mutagenesis of this
area did not affect the trans-stimulatory effect of AP-2 (data not
shown). Mutations in the other putative AP-2 site located around
nucleotide 40 were also ineffective (data not shown).
Fig. 5.
DNase I footprinting analysis of the proximal apoE
promoter. A DNA fragment containing 1 to 227 bp of the apoE
promoter was end-labeled with [32P]ATP on the antisense
(A) or sense (B) strands. Lane
G+A in A and B represents the
Maxam and Gilbert sequencing ladder of the apoE promoter. Lane
1 in A and B represents reactions
performed in the absence of recombinant AP-2. Lanes 2
and 3 in A and B represent reactions performed in the presence of 1 or 4 footprinting units of
recombinant AP-2, respectively. The protected sequence boundaries around the 60 and the 117 footprints are indicated.
[View Larger Version of this Image (30K GIF file)]
Fig. 6.
Effect of site-directed mutagenesis of footprints
117 and 60 on apoE promoter activity. A, HepG2 cells
were transiently transfected with pXP2 (pXP2),
construct 4 (pXP2-227), or construct 4 mutated at the 117 (pXP2-m117), 60
(pXP2m-60), or both footprints (pXP2m-60m-117). Cells were cotransfected
with an AP-2 expression construct (hatched bars) or with
pBluescript (empty bars). B, U87 cells
were transfected with the indicated construct and incubated in the
absence (empty bars) or presence (hatched
bars) of 1 mM dBcAMP. Luciferase activity was
determined 48 hr later. Fold induction values are relative to those
obtained with untreated construct 4. Values are the mean ± SEM of
two triplicate determinations and are corrected for the activities
measured by using the promoterless pXP2 plasmid.
[View Larger Version of this Image (22K GIF file)]
Finally, to confirm that the stimulatory effect of cAMP in astrocytic
cells was mediated by interaction with these two sites, we transfected
the mutant constructs into U87 cells and measured the luciferase
activity after cAMP treatment (Fig. 6B). Mutation in
the 117 region clearly reduced the stimulatory effect of cAMP by
69%, strongly suggesting that cAMP effect in astrocytes was mediated
via the AP-2 binding site in the 117 region. However, mutation of the
60 region yielded more complex results, because basal activity of
this mutant was greatly augmented (625% of the wild type) in untreated
cells. This effect was cell-specific, because it was not observed in
HepG2. Moreover, treatment with cAMP of U87 cells transfected with this
mutant did not further increase the activity of the promoter but was
inhibitory (56% of the corresponding basal level) (Fig.
6B).
DISCUSSION
In the present report we describe the upregulation of the apoE
promoter by cAMP and RA in astrocytic cells. This regulatory process is
mediated by two AP-2 binding sites located in the proximal region of
the promoter. The determination of the molecular mechanism involved in
the regulation of apoE synthesis in brain is currently a matter of the
greatest importance, considering the possible roles of this protein in
processes of repair after traumatic injury (Müller et al., 1985 ;
Ignatius et al., 1986 ; Boyles et al., 1989 ) or in the pathogenesis of
AD (Corder et al., 1993 ; Strittmatter et al., 1993 ). The reactive
gliosis accompanying these pathologies involves a series of
morphological and biochemical changes in the astrocytes. One of the
more abundant proteins produced by activated astrocytes is apoE
(Poirier et al., 1991 ). The exact physiological role of this increased
expression remains primarily speculative, but experiments in
vitro have shown an effect of apoE on neurite morphogenesis by
cultured neurons. Thus, apoE reduces the amount of neurite branching
and promotes neurite extension (Handelmann et al., 1992 ; Nathan et al.,
1994 ). Interestingly, this effect was observed only with the addition
of the apoE3 isoform, whereas addition of the apoE4 isoform,
which is associated to a high risk of late onset AD, resulted in a
reduction of both branching and extension of the neurites (Nathan et
al., 1994 ).
Regulation of the apoE promoter has been investigated thoroughly in a
variety of cell types, mainly hepatoma cells, where it has been shown
to contain an array of tissue-specific cis-acting regulatory elements
that are distributed along a 20 kb region spanning the apoE gene (Smith
et al., 1988 ; Simonet et al., 1990 , 1993 ). The regulatory elements
required for an efficient expression in HepG2 cells are located in the
proximal 5 -flanking region and in the first intron (Paik et al., 1988 ;
Smith et al., 1988 ; Berg et al., 1995 ). Data in the present report also
indicate that this region of the apoE promoter drives efficient
expression in astrocytoma cells, with the maximal activity of the
promoter being obtained with the fragment located between nucleotides
1 and 227. Our truncation and site-directed mutagenesis studies
show that the pattern of positive and negative regulatory elements is
different in astrocytoma and hepatoma cells, indicating that, as in
other cell types, synthesis of apoE in astrocytes is regulated by
tissue-specific factors.
In a variety of in vitro experimental systems, including
primary astrocytic cultures or glioblastoma cultures, it has been shown
that many of the changes occurring in reactive gliosis can be mimicked
by treatment with cAMP (Fedoroff et al., 1984 ; Sharma and Raj, 1987 ).
In our experimental system, cAMP stimulated the activity of the apoE
promoter by a molecular mechanism that involves the transcription
factor AP-2. This factor is a 52 kDa protein that binds as a dimer to
the palindromic recognition sequence 5 -GCCNNNGGC-3 (Mitchell et al.,
1987 ; Williams et al., 1988 ), although many AP-2-binding sites deviate
from this consensus (Williams and Tjian, 1991 ). Cell culture and
in vitro experiments have demonstrated a role for AP-2 in
regulating a variety of target genes, including human
metallothionein-IIA (Imagawa et al., 1987 ), human growth hormone (Courtois et al., 1990 ), human T-cell leukemia virus type I
(Muchardt et al., 1992 ), human proenkephalin (Hyman et al., 1989 ),
acetylcholinesterase (Ekström et al., 1993 ), or
Na+/H+ exchanger (Dyck et al., 1995 ). Sequence
analysis of the apoE promoter indicated the presence of a consensus
sequence around position 117. The DNase I footprinting experiments
described herein indeed showed that purified AP-2 protects the region
located between nucleotides 105 to 134, and the site-directed
mutagenesis experiments also supported the functionality of this AP-2
binding site. A second binding site also was identified by the same
approaches and was targeted to the region located between nucleotides
48 and 74. These findings are consistent with the presence of
another putative AP-2-binding site in the same region. The sequence
analysis also indicates that this region may be the target of a complex regulation by a number of other transcription factors; specifically, two putative SP1 binding sites exist that flank the AP-2 core sequence.
These predictions are also consistent with our observation that
mutations in this AP-2 site dramatically increase the apoE promoter
expression basal level in astrocytoma cells, but not in HepG2 cells,
strongly suggesting the existence of an astrocyte-specific inhibitory
factor that interacts with the same region of the promoter. The
proximal region of the apoE promoter has been shown to be extremely
rich in regulatory sequences in cells of diverse tissular origin (Paik
et al., 1988 ; Smith et al., 1988 ; Berg et al., 1995 ), indicating that
this region could be involved in some aspects of the complex
tissue-specific regulation of the apolipoprotein E gene.
AP-2 is expressed by neurons and astrocytes, and it has been suggested
to play a role in the development of the neuronal and astrocytic cell
linages as well as in the cAMP-dependent activation of astrocytes
(Lüscher et al., 1989 ; Mitchell et al., 1991 ; Philipp et al.,
1994 ). Moreover, the expression of AP-2, which is low in primary brain
astrocytes, is induced rapidly and strongly by cAMP stimulation of
these cells (Philipp et al., 1994 ). On the other hand, RA, a potent
morphogenetic and teratogenic agent on the developing nervous system,
also is known to regulate at the transcriptional level the expression
of AP-2 (Lüscher et al., 1989 ). Therefore, it is reasonable to
presume that the observed synergistic effect of RA and cAMP on the apoE
promoter described in the present work is probably attributable to a
RA-promoted increase in the cellular content of AP-2, followed by a
post-transcriptional increase of the AP-2 activity mediated by cAMP
(Imagawa et al., 1987 ; Lüscher et al., 1989 ).
Analysis of AP-2 expression during embryogenesis has suggested that
AP-2 may be required during differentiation of some neural cell types
(Lüscher et al., 1989 ; Mitchell et al., 1991 ). In the mouse
embryo, AP-2 is expressed in neural crest cells and in specific
portions of the nervous system, where it may play a role during
establishment of the peripheral nervous system and its connection with
the central nervous system (Mitchell et al., 1991 ). More recently,
multiple congenital defects and perinatal death have been reported in
mice containing a homozygous disruption of the AP-2 gene (Schorle et
al., 1996 ; Zhang et al., 1996 ). Nevertheless, it remains unexplored
whether apoE is involved in some of the AP-2-dependent processes during
embryogenesis and whether AP-2 is induced in the brain after diverse
types of brain injury. In this context, it is suggestive of the
increase in the synthesis of AP-2 in primary afferents that have been
described to take place during acute inflammation (Donaldson et al.,
1995 ). Our finding that AP-2 could participate in the regulation of
apoE expression in astrocytes provides a common background to improve our understanding of the action mechanisms by which these proteins play
their roles in the development and repairing of the nervous system and
in several pathogenic conditions, such as Alzheimer's disease.
In summary, the results reported herein indicate the existence of
functional AP-2 sites in the promoter region of apoE that could
contribute to the complex regulation of this gene in developmental, degenerative, and regenerative processes of the nervous
system .
FOOTNOTES
Received July 22, 1996; revised Sept. 13, 1996; accepted Sept. 20, 1996.
This work was supported by Boehringer Ingelheim España, S.A.,
Spanish Dirección General de Investigación
Científica y Técnica (Grant PB93-0182), and an
institutional grant from the Fundación Ramón Areces. M.A.G.
is a recipient of a fellowship from the Spanish Ministerio de
Educación y Ciencia. We thank Dr. Buettner for providing us with
the AP-2 expression vector.
Correspondence should be addressed to Dr. Francisco Zafra, Centro de
Biología Molecular "Severo Ochoa," Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid,
Spain.
REFERENCES
-
Basu SK,
Brown MS,
Ho YK,
Havel RJ,
Goldstein JL
(1981)
Mouse macrophages synthesize and secrete a protein resembling apolipoprotein E.
Proc Natl Acad Sci USA
78:7545-7549 .
[Abstract/Free Full Text]
-
Berg DT,
Calnek DS,
Grinnell BW
(1995)
The human apolipoprotein E gene is negatively regulated in human liver HepG2 cells by the transcription factor BEF-1.
J Biol Chem
270:15447-15450 .
[Abstract/Free Full Text]
-
Boyles JK,
Pitas RE,
Wilson E,
Mahley RW,
Taylor JM
(1985)
Apolipoprotein E associated with astrocytic glia of the central nervous system and with nonmyelinating glia of the peripheral nervous system.
J Clin Invest
76:1501-1513 .
-
Boyles JK,
Zoellner CD,
Anderson LJ,
Kosik LM,
Pitas RE,
Weisgraber KH,
Hui DY,
Mahley RW,
Gebicke-Haerter PJ,
Ignatius MJ,
Shooter EM
(1989)
A role for apolipoprotein E, apolipoprotein A-I, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve.
J Clin Invest
83:1015-1031 .
-
Corder EH,
Saunders AM,
Strittmatter WJ,
Schmechel D,
Gaskell PC,
Small GW,
Roses AD,
Haines JL,
Pericak-Vance MA
(1993)
Gene dose of apolipoprotein E type 4 allele and the risk of AD in late onset families.
Science
261:921-923 .
[Abstract/Free Full Text]
-
Courtois SJ,
Lafontaine DA,
Lemaigre FP,
Durviaux SM,
Rousseau GG
(1990)
Nuclear factor-I and activator protein-2 bind in a mutually exclusive way to overlapping promoter sequences and transactivate the human growth hormone gene.
Nucleic Acids Res
18:57-64 .
[Abstract/Free Full Text]
-
Donaldson LF,
McQueen DS,
Seckl JR
(1995)
Induction of transcription factor AP-2 mRNA expression in rat primary afferent neurons during acute inflammation.
Neurosci Lett
196:181-184 .
[Web of Science][Medline]
-
Dyck JRB,
Silva NLCL,
Fliegel L
(1995)
Activation of the Na+/H+ exchanger gene by the transcription factor AP-2.
J Biol Chem
270:1375-1381.
[Abstract/Free Full Text]
-
Ekström TJ,
Klump WM,
Getman D,
Karin M,
Taylor P
(1993)
Promoter elements and transcriptional regulation of the acetylcholinesterase gene.
DNA Cell Biol
12:63-72 .
[Web of Science][Medline]
-
Elshourbagy NA,
Liao WS,
Mahley RW,
Taylor JM
(1985)
Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets.
Proc Natl Acad Sci USA
82:203-207 .
[Abstract/Free Full Text]
-
Fedoroff S,
McAuley WAJ,
Houle JD,
Devon RM
(1984)
Astrocytic cell linage. V. Similarity of astrocytes that form in the presence of dBcAMP in culture to reactive glia.
J Neurosci Res
30:359-371.
-
Handelmann GE,
Boyles JK,
Weisgraber KH,
Mahley RW,
Pitas RE
(1992)
Effects of apolipoprotein E,
-very low density lipoproteins, and cholesterol on the extension of neurites by rabbit dorsal root ganglion neurons in vitro.
J Lipid Res
33:1677-1688 .
[Abstract]
-
Higuchi R
(1990)
Recombinant PCR.
In: PCR protocols
(Innis, MA,
Gelfand, DH,
Sninsky, JJ,
White, TJ,
eds)
, p. 177. New York: Academic.
-
Hyman SE,
Comb M,
Pearlberg J,
Goodman HM
(1989)
An AP-2 element acts synergistically with the cyclic AMP- and phorbol ester-inducible enhancer of the human proenkephalin gene.
Mol Cell Biol
9:321-324 .
[Abstract/Free Full Text]
-
Ignatius MJ,
Gebicke-Haerter PJ,
Skene JHP,
Schilling JW,
Weisgraber KH,
Mahley RW,
Shooter EM
(1986)
Expression of apolipoprotein E during nerve degeneration and regeneration.
Proc Natl Acad Sci USA
83:1125-1129 .
[Abstract/Free Full Text]
-
Imagawa M,
Chiu R,
Karin M
(1987)
Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP.
Cell
51:251-260 .
[Web of Science][Medline]
-
Kayden HJ,
Maschio F,
Traber MG
(1985)
The secretion of apolipoprotein E by human monocyte-derived macrophages.
Arch Biochem Biophys
239:388-395 .
[Web of Science][Medline]
-
Krummel B
(1990)
DNase I footprinting.
In: PCR protocols
(Innis, MA,
Gelfand, DH,
Sninsky, JJ,
White, TJ,
eds)
, p. 184. New York: Academic.
-
Lin-Lee YC,
Tanaka Y,
Lin CT,
Chan L
(1981)
Effects of an atherogenic diet on apolipoprotein E biosynthesis in the rat.
Biochemistry
20:6474-6480 .
[Medline]
-
Lüscher B,
Mitchell PJ,
Williams T,
Tjian R
(1989)
Regulation of transcription factor AP-2 by the morphogen retinoic acid and second messengers.
Genes Dev
3:1507-1517 .
[Abstract/Free Full Text]
-
Mahley RW
(1988)
Apolipoprotein E: cholesterol transport protein with expanding role in cell biology.
Science
240:622-630 .
[Abstract/Free Full Text]
-
Maxam AM,
Gilbert W
(1980)
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol
65:499-560 .
[Medline]
-
Mitchell PJ,
Wang C,
Tjian R
(1987)
Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV-40 T antigen.
Cell
50:847-861 .
[Web of Science][Medline]
-
Mitchell PJ,
Timmons PM,
Hebert JM,
Rigby PW,
Tjian R
(1991)
Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis.
Genes Dev
5:105-119 .
[Abstract/Free Full Text]
-
Muchardt C,
Seeler JS,
Nirula A,
Gong S,
Gaynor R
(1992)
Interleukin-1
regulates proenkephalin gene expression in astrocytes cultured from rat cortex.
Glia
6:206-212.
[Web of Science][Medline]
-
Müller HW,
Gebicke-Härter PJ,
Hangen DH,
Shooter EM
(1985)
A specific 37,000-dalton protein that accumulates in regenerating but not in nonregenerating mammalian nerves.
Science
228:499-501 .
[Abstract/Free Full Text]
-
Nathan BP,
Bellosta S,
Sanan DA,
Weisgraber KH,
Mahley RW,
Pitas RE
(1994)
Differential effects of apolipoprotein E3 and E4 on neuronal growth in vitro.
Science
264:850-852 .
[Abstract/Free Full Text]
-
Nordeen SK
(1988)
Luciferase reporter gene vector for analysis of promoters and enhancers.
Biotechniques
6:454-457 .
[Web of Science][Medline]
-
Olivares L,
Aragón C,
Giménez C,
Zafra F
(1995)
The role of N-glycosylation in the targeting and activity of the GLYT1 glycine transporter.
J Biol Chem
270:9437-9442 .
[Abstract/Free Full Text]
-
Paik YK,
Chang DJ,
Reardon CA,
Walker MD,
Taxman E,
Taylor JM
(1988)
Identification and characterization of transcriptional regulatory regions associated with expression of the human apolipoprotein E gene.
J Biol Chem
263:13340-13349 .
[Abstract/Free Full Text]
-
Philipp J,
Mitchell PJ,
Malipiero U,
Fontana A
(1994)
Cell type-specific regulation of expression of transcription factor AP-2 in neuroectodermal cells.
Dev Biol
165:602-614 .
[Web of Science][Medline]
-
Pitas RE,
Boyles JK,
Lee SH,
Foss D,
Mahley RW
(1987)
Astrocytes synthesize apolipoprotein E and metabolize apolipoprotein E-containing lipoproteins.
Biochim Biophys Acta
917:148-161 .
[Medline]
-
Poirier J,
Hess M,
May PC,
Finch CE
(1991)
Astrocytic apolipoprotein E mRNA and GFAP mRNA in hippocampus after entorhinal cortex lesioning.
Mol Brain Res
11:97-106 .
[Medline]
-
Rall SC Jr,
Weisgraber KH,
Mahley RW
(1982)
Human apolipoprotein E. The complete amino acid sequence.
J Biol Chem
257:4171-4178 .
[Free Full Text]
-
Reue KL,
Quon DH,
O'Donnell KA,
Dizikes GJ,
Fareed GC,
Lusis AJ
(1984)
Cloning and regulation of messenger RNA for mouse apolipoprotein E.
J Biol Chem
259:2100-2107 .
[Abstract/Free Full Text]
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual, 2nd Ed.
. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Schorle H,
Meier P,
Buchert M,
Jaenisch R,
Mitchell PJ
(1996)
Transcription factor AP-2 essential for cranial closure and craniofacial development.
Nature
381:235-238 .
[Medline]
-
Sharma SK,
Raj AB
(1987)
Transient increase in intracellular concentrations of adenosine 3
:5 -cyclic monophosphate results in morphological and biochemical differentiation of C6 glioma cells in culture.
J Neurosci Res
17:137-141.
-
Simonet WS,
Bucay N,
Lauer SJ,
Wirak DO,
Stevens ME,
Weisgraber KH,
Pitas RE,
Taylor JM
(1990)
In the absence of downstream element, the apolipoprotein E gene is expressed at high level in kidneys of transgenic mice.
J Biol Chem
265:10809-10812 .
[Abstract/Free Full Text]
-
Simonet WS,
Bucay N,
Lauer SJ,
Taylor JM
(1993)
A far-downstream hepatocyte-specific control region directs expression of the linked human apolipoprotein E and C-1 genes in transgenic mice.
J Biol Chem
268:8221-8229 .
[Abstract/Free Full Text]
-
Smith JD,
Melián A,
Leff T,
Breslow JL
(1988)
Expression of the human apolipoprotein E gene is regulated by multiple positive and negative elements.
J Biol Chem
263:8300-8308 .
[Abstract/Free Full Text]
-
Snipes GJ,
McGuire CB,
Norden JJ,
Freeman JA
(1986)
Nerve injury stimulates the secretion of apolipoprotein E by non-neuronal cells.
Proc Natl Acad Sci USA
83:1130-1134 .
[Abstract/Free Full Text]
-
Strittmatter WJ,
Saunders AM,
Schmechel D,
Pericak-Vance M,
Enghild J,
Salvesen GS,
Roses AD
(1993)
Apolipoprotein E: high avidity binding to
-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease.
Proc Natl Acad Sci USA
90:1977-1981 .
[Abstract/Free Full Text]
-
Williams T,
Tjian R
(1991)
Analysis of the DNA-binding and activation properties of the human transcription factor AP-2.
Genes Dev
5:670-682 .
[Abstract/Free Full Text]
-
Williams T,
Admon A,
Lüscher B,
Tjian R
(1988)
Cloning and expression of AP-2, a cell type-specific transcription factor that activates inducible enhancer elements.
Genes Dev
2:1557-1569 .
[Abstract/Free Full Text]
-
Zhang J,
Hagopian-Donaldson S,
Serbedzija G,
Elsemore J,
Plehn-Dujowich D,
McMahon AP,
Flavell RA,
Williams T
(1996)
Neural tube, skeletal, and body wall defects in mice lacking transcription factor AP-2.
Nature
381:238-241 .
[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. V. Gafencu, M. R. Robciuc, E. Fuior, V. I. Zannis, D. Kardassis, and M. Simionescu
Inflammatory Signaling Pathways Regulating ApoE Gene Expression in Macrophages
J. Biol. Chem.,
July 27, 2007;
282(30):
21776 - 21785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Xu, A. Bernardo, D. Walker, T. Kanegawa, R. W. Mahley, and Y. Huang
Profile and Regulation of Apolipoprotein E (ApoE) Expression in the CNS in Mice with Targeting of Green Fluorescent Protein Gene to the ApoE Locus.
J. Neurosci.,
May 10, 2006;
26(19):
4985 - 4994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Huang
Apolipoprotein E and Alzheimer disease
Neurology,
January 24, 2006;
66(1_suppl_1):
S79 - S85.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Harris, I. Tesseur, W. J. Brecht, Q. Xu, K. Mullendorff, S. Chang, T. Wyss-Coray, R. W. Mahley, and Y. Huang
Astroglial Regulation of Apolipoprotein E Expression in Neuronal Cells: IMPLICATIONS FOR ALZHEIMER'S DISEASE
J. Biol. Chem.,
January 30, 2004;
279(5):
3862 - 3868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Campillos, J. R. Lamas, M. A. Garcia, M. J. Bullido, F. Valdivieso, and J. Vazquez
Specific interaction of heterogeneous nuclear ribonucleoprotein A1 with the -219T allelic form modulates APOE promoter activity
Nucleic Acids Res.,
June 15, 2003;
31(12):
3063 - 3070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Campillos, M. A. Garcia, F. Valdivieso, and J. Vazquez
Transcriptional activation by AP-2{alpha} is modulated by the oncogene DEK
Nucleic Acids Res.,
March 1, 2003;
31(5):
1571 - 1575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Theuns and C. Van Broeckhoven
Transcriptional regulation of Alzheimer's disease genes: implications for susceptibility
Hum. Mol. Genet.,
October 1, 2000;
9(16):
2383 - 2394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Qin, Y. Sun, and E. N. Benveniste
The Transcription Factors Sp1, Sp3, and AP-2 Are Required for Constitutive Matrix Metalloproteinase-2 Gene Expression in Astroglioma Cells
J. Biol. Chem.,
October 8, 1999;
274(41):
29130 - 29137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Salero, R. Perez-Sen, J. Aruga, C. Gimenez, and F. Zafra
Transcription Factors Zic1 and Zic2 Bind and Transactivate the Apolipoprotein E Gene Promoter
J. Biol. Chem.,
January 12, 2001;
276(3):
1881 - 1888.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|