 |
Next Article 
Volume 17, Number 13,
Issue of July 1, 1997
pp. 4915-4920
Copyright ©1997 Society for Neuroscience
An NF- B-Like Transcription Factor in Axoplasm is Rapidly
Inactivated after Nerve Injury in Aplysia
Michael Povelones1,
Kathy Tran2,
Dimitris Thanos2, and
Richard T. Ambron1
1 Departments of Anatomy and Cell Biology and
2 Biochemistry and Molecular Biophysics, College of
Physicians and Surgeons of Columbia University, New York, New York
10032
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
We found a protein in Aplysia neurons that has many
characteristics of the transcription factor NF- B. Thus, the protein
recognized a radiolabeled probe containing the B sequence from the
human interferon- gene enhancer element (PRDII), and the binding was not affected by PRDIV, an ATF-2 enhancer sequence from the same gene.
Binding was efficiently inhibited, however, by nonradioactive oligonucleotides containing H2, the B site from the major
histocompatibility complex I gene promotor. In addition, recombinant
mammalian I B- , which associates specifically with the P65 subunit
of NF- B, inhibited the binding to the PRDII probe in a
dose-dependent manner. The nuclear form of the Aplysia protein
was constitutively active. Axoplasm, however, contained the
constitutively active form as well as a latent form. The latter was
activated by treatment with deoxycholate under the same conditions as
mammalian NF- B. Based on these findings, we believe the protein to
be a homolog of NF- B. To investigate the role of apNF- B in the
axon, we crushed the peripheral nerves to the body wall. Surprisingly,
there was a rapid loss of apNF- B binding at the crush site and,
within 15 min, as far as 2.5 cm along the axon. In contrast, exposing
either the intact animal or the nervous system in situ
to levels of 5-HT that induce synaptic facilitation did not affect
apNF- B activity.
Key words:
NF- B;
axon injury;
transcription factor;
axoplasm;
DNA
binding;
injury signal;
nuclear localization signal
INTRODUCTION
Nerve injury initiates changes in transcription
and translation that can culminate in the regeneration of the damaged
axon (Lieberman, 1971 ; Skene, 1989 ; Fawcett and Keynes, 1990 ; Titmus and Faber, 1990 ). How the cell body is informed that its axon has been
damaged is not well understood, and identifying the signals that convey
this information would be a significant advance in the quest to
facilitate nerve repair. Molecular signals of injury can be divided
into two classes (Skene, 1989 ; Clatworthy and Walters, 1994 ; Walters
and Ambron, 1995 ): "negative" signals, which originate from target
tissues, and "positive" signals, which are retrogradely transported
from the site of injury back to the nucleus. Some positive signals are
intrinsic to axoplasm (Ambron et al., 1996 ), whereas others are
extrinsic, i.e., derived from glial cells at the site of the lesion.
Interestingly, many of the programs that are induced by injury in
Aplysia are induced also by conditions that elicit cellular
correlates of learning (Walters et al., 1991 ; Alberini et al., 1994 ;
Noel et al., 1995 ). This implies that there is a convergence of the
intracellular pathways for injury and learning (Walters and Ambron,
1995 ; Ambron and Walters, 1996 ), and some positive axonal signals might
be common to both processes.
A 97 kDa axoplasmic protein, which behaves like a positive injury
signal because it is transported away from the site of a crush injury,
features a nuclear localization sequence (NLS) (Ambron et al., 1996 ).
The NLS can be recognized by the retrograde transport/nuclear import
pathway that conveys proteins along the axon to the soma and into the
nucleus (Ambron et al., 1992 ; Schmied et al., 1993 ). Given the
possibility that an NLS is characteristic of positive signals, we are
screening axoplasm for proteins that are can enter the nucleus (Ambron
and Walters, 1996 ). One candidate is the transcription factor NF- B,
which is found in axons in rat brain (Kaltschmidt et al., 1993 ).
NF- B consists of a p50 and a p65 subunit and has a rel homology
domain comprised of an NLS and a region that recognizes B enhancer
sites on DNA. Under resting conditions, the NLS and DNA binding regions
are masked via an inhibitory protein, I B, and NF- B resides in the
cytoplasm in an (inactive) latent form (Baeuerle and Baltimore, 1988a ;
Beg et al., 1992 ; Liou and Baltimore, 1993 ; Thanos and Maniatis, 1995 ).
The binding of an extracellular ligand to a surface receptor triggers
the degradation of I B by proteasomes and the liberation of NF- B
(Baeuerle and Baltimore, 1988b ; Verma et al., 1995 ). The activated
NF- B is then imported into the nucleus where it regulates
transcription and is ultimately degraded by proteasomes (Cressman and
Taub, 1994 ). Theoretically, activation of latent NF- B in the axon
would expose the NLS, resulting in its transport back to the cell
nucleus. NF- B, then, has many of the properties predicted for a
positive injury signal (Ambron et al., 1992 ; Kaltschmidt et al., 1993 ).
The current experiments were undertaken to determine whether NF- B is
present in axons of the marine mollusc Aplysia and to see how it
responds to injury.
MATERIALS AND METHODS
Nerve crush was performed essentially as described (Ambron et
al., 1995 ). Aplysia californica (150-250 gm; Marinus,
Venice, California) were anesthetized with isotonic
MgCl2, and the body wall was incised through the
foot. Care was taken not to disturb the nerves that exit from the
bilateral pair of pedal ganglia; these pedal nerves provide sensory and
motor information to the mid- and posterior body wall. The
MgCl2 was replaced with artificial seawater (ASW), and all
of the nerves on one side were crushed with forceps ~2.5 cm from the
ganglion. This effectively axotomizes the neurons in the pleural
sensory cluster (Walters et al., 1983 ). The contralateral nerves served
as controls (see text).
Axoplasm was extruded from nerve segments into ASW at 4°C (Sherbany
et al, 1979, 1984: Schmied et al., 1993 ). PMSF was added to a final
concentration of 1 mM. After centrifugation at 16,000 × g to remove large organelles, the supernatant was removed
and diluted with an equal volume of buffer (10 mM Tris-HCl,
pH 7.5, 1 mM EDTA, 5% glycerol). The supernatant was then
analyzed by Electrophoretic Mobility Shift Assay (EMSA). Nerve segments
were homogenized on ice in binding buffer without NP-40 and were
centrifuged at 16,000 × g. The supernatant was
removed, and NP-40 was added to 0.1%.
The effects of serotonin (5-HT) treatment were measured by either
exposing the entire animal to 250 µM 5-HT in ASW at
15°C for 2 hr (Alberini et al., 1994 ) or by exposing half of a
dissected animal to 20 µM 5-HT for 2 hr (Dale et al.,
1987 ; Emptage and Carew, 1993 ), whereas the other half served as a
control. Nerve segments were removed rapidly from the animals and
homogenized immediately as described above.
EMSA and the preparation of the radiolabeled probes were as described
(Baeuerle and Baltimore, 1988b ) except that each reaction contained 1 µg of poly dI-dC. The B enhancer sequence from the interferon-
gene enhancer element ( 65 to 54; PRDII) = TCGACCGAGTGGGAAATTCCTCTG and the B site from the major
histocompatibility complex I gene promotor (H2) = TCGACCGAGTGGGAATCCCCTCTG. PRDIV (another enhancer sequence
that does not contain a B site) = TAAATGACATAGGAAAACTGGG (Liou and
Baltimore, 1993 ). The AP-1 oligonucleotide = CTAGATGACTCAGCGCT, and the CRE = CTAGATCCCATGGCCGTCATACTGTGACGTCTTT (Kaang et al., 1993 ).
Nuclei were prepared from neurons of the pleuro-pedal ganglia of
several animals as described (Dignam et al., 1983 ), except that buffer
C was made iso-osmolar using NaCl and the final dialysis step was
omitted. Nuclear extracts were preabsorbed for 30 min on ice with
recombinant I B- . The I B- gene was cloned into a prokaryotic
expression plasmid and isolated by affinity chromatography using Ni-NTA
resin.
Sensory clusters from pleural-pedal ganglia with crushed peripheral
nerves and contralateral control clusters were dissected in 70%
propylene glycol in ASW at 20°C. Individual clusters were washed
once in ice-cold PBS and transferred to tubes containing binding
buffer. Samples were sonicated briefly and frozen at 70°C. Protein
concentration was normalized, and EMSA was performed as described
above.
RESULTS
Aplysia neurons contain an NF- B
We used an EMSA to look for proteins in Aplysia neurons that
bind to B DNA sequences. Two proteins in nuclear preparations recognized a radiolabeled probe containing the B sequence from the
human interferon- gene enhancer element (PRDII) (Fig.
1A, lane 1). The higher
molecular weight protein migrated with mammalian NF- B (p50/p65), and
its binding to the probe was not affected by PRDIV (lane 2),
an ATF-2 enhancer sequence from the same gene. The binding was
inhibited efficiently by nonradioactive oligonucleotides containing H2,
the B site from the major histocompatibility complex I gene promotor
(lane 3). The H2 and PII consensus B regions differ by
three oligonucleotides (see Materials and Methods). The other protein
was not always present, and its binding was not blocked by an excess of
either H2 or PRDIV.
Fig. 1.
Characterization of Aplysia B binding;
representative results from two to five experiments are shown.
A, Radiolabled probes were added to nuclear extracts and
after EMSA, DNA-binding complexes were visualized using
radioautography. Radiolabeled probe PII was added to a nuclear extract
from HeLa cells to determine the position of NF- B (p50/p65)
(arrow). When radiolabeled PII was incubated with 5 µg
of a nuclear extract, two proteins were detected (lane
1). Binding of one of the proteins (arrow) to
the probe was not competed by unlabeled oligonucleotide PIV
(lane 2), but was efficiently blocked by H2 (lane
3). The other protein (arrowhead) was unaffected
by the presence of competitor DNAs. B, Nuclear B-DNA
binding to radiolabeled PII (arrow, lane
1) was inhibited by 1 µg (lane 2) and 2 µg
(lane 3) of recombinant mammalian I B- . The other
protein (arrowhead) was unaffected by I B- . In
addition, binding to a radiolabeled AP-1 enhancer sequence
(CTAGATGACTCAGCGCT; asterisk) was not
affected by I B- at either concentration (lanes 4-6). The portion of the film containing the unbound
probe was removed in this and subsequent figures. C, The
B binding was enriched in axoplasm extruded from the pedal nerves
(lane 1, arrow) relative to that which remains in the
sheath (lane 2). In contrast, most of the AP-1
(asterisk, lanes 3, 4) and
CRE-binding (small arrows, lanes 5,
6) activities were found in the sheath.
D, The B binding to PII in extruded axoplasm
(lane 1) was not affected by excess PIV (lane
2), but was specifically disrupted by excess H2 oligonucleotide
(lane 3). E, Latent B activity was
unmasked when extracts from nerve segments were treated with DOC
(lanes 1, 2). The activity in the
extracts was stimulated by a low concentration of DOC (lanes
3, 4), but was inhibited by 0.8% DOC
(lane 5). Activity was recovered when excess DOC was
removed by 0.85% NP-40 (lanes 2, 6).
[View Larger Version of this Image (62K GIF file)]
The protein in the nucleus that bound to the B probes was
constitutively active. Because the p65 subunit of activated NF- B binds to the inhibitory protein I B- (Liou and Baltimore, 1993 ), we investigated the effects of preincubating nuclear extracts with
recombinant mammalian I B- . As shown in Figure
1B (lanes 1-3), the binding activity was
reduced in a dose-dependent manner. There was no reduction in binding
if BSA or other nonspecific proteins were added (data not shown).
Conversely, the I B- did not affect the binding of nuclear
proteins to an AP-1 probe (lanes 4-6).
Two forms of B binding are present in axoplasm
To determine whether any B binding proteins are present in
axons, we performed EMSAs on axoplasm extruded from pedal nerves to the
body wall and found a protein that recognized the PII probe (Fig.
1C, lane 1). We also assayed the sheath that
remains after extrusion (lane 2). Calculations based on
density scans of the two lanes revealed that 62% of the total B
binding in the nerves was in the extruded axoplasm. Because ~65% of
axoplasm is extruded from nerves by our procedure (Sherbany et al.,
1984 ), most of the protein that binds to the B-probes is probably in
axons. In contrast, when we examined the distribution of other
transcription factors in these same nerves, we found that the axoplasm
contained only 19% of the total AP-1 binding (lanes 3,4) and an
average of 24% for the three CRE oligonucleotide-binding activities
identified previously by Dash et al., (1990) (lanes 5,
6). This is consistent with these factors being in
the glial cells and connective tissues that remain after extrusion.
We found that as with the factor in the nucleus, the binding of the
axoplasmic protein to B probes was inhibited by excess cold H2 (Fig.
1D, lane 3), but not by PRDIV (lane
2) oligonucleotides. The binding was diffuse, however, suggesting
that the protein was being degraded during the extrusion procedure. To
avoid this possibility, we analyzed fractions from intact nerve
segments that were rapidly excised from the animal. The B binding in
the gel was now much more discrete (Fig. 1E,
lane 1).
The data obtained above were consistent with the activity in the
nucleus and axoplasm being attributable to an NF- B-like protein
rather than to one of the other rel homology proteins. It would be
unusual to find an active extranuclear form of NF- B, however,
because it is the latent form of the factor that typically resides in
the cytoplasm (but see Kaltschmidt et al., 1993 ). To determine whether
a latent B activity is also present in axons, we exposed nerve
extracts to deoxycholate (DOC). This detergent dissociates NF- B from
I B and is a diagnostic measure of latent NF- B (Baeuerle and
Baltimore, 1988a ,b ). DOC caused a dramatic increase in B binding,
and the increase was associated with the same protein that was
constitutively active (Fig. 1E, lanes 1, 2). Furthermore, the response mimicked that of vertebrate
NF- B (Baeuerle and Baltimore, 1988a ,b ) in that the binding was
activated by low levels of DOC (lanes 3,
4) and was inhibited by higher levels (lane
5) unless additional NP-40 was also included (lane 6). The NP-40 reduces the effective concentration of the
DOC. We believe that these data warrant calling this protein a homolog of NF- B, which we designate apNF- B.
ApNF- B is affected rapidly by axon injury
To examine the response of axonal apNF- B to injury, we crushed
peripheral nerves to the body wall (Fig.
2A) and 20 hr later, compared
apNF- B activity in axoplasm extruded from the 0.5 cm crush segment
with that in axoplasm extruded from a 0.5 cm segment of noncrushed
nerve. Surprisingly, in all four experiments, each involving axoplasm
pooled from two to three animals, there was no B binding in the
crush axoplasm (Fig. 2B, lanes 1,
2). In a separate experiment, a loss of activity was also
seen when we examined nuclei isolated from neurons, the axons of which
had been crushed 20 hr earlier (Fig. 2B, lanes
3-5). As expected, DOC did not unmask any latent activity in the
nucleus (lane 5).
Fig. 2.
Loss of apNF- B DNA-binding activity after nerve
crush. A, Schematic showing the crush site on nerves p8
and p9 to the tail. Crush refers to the nerve segment adjacent to the
crush site, and P1 and P2 refer to segments more proximal. Each segment
was 0.5 cm long. Segments of equal size on the contralateral nerves served as controls. Extruded axoplasm, or intact segments, from two to
three animals was pooled for each experiment, and representative results are shown. Tissue fractions were assayed for B binding by
EMSA using the PII probe. B, Soluble axoplasm (10 µg)
from control and crush segments was analyzed 20 hr after nerve crush. Constitutive apNF- B-DNA binding was present in the control
(lane 1) but absent in the crush segment (lane
2). Activity was reduced in nuclear extracts (10 µg) pooled
from the pleuro-pedal neurons of four animals 20 hr after nerve crush,
relative to that in control nuclear extracts (lanes 3,
4), and activity was not recovered with DOC
(lane 5). All of the pedal nerves were crushed in the experimental and none in the control. C, Five minutes
after crush injury, 4 µg of protein from the segments was analyzed.
Comparisons showed a loss of apNF- B activity in the crush segments
(lane 2) relative to controls (lane 1).
D, To examine the loss of apNF- B along the axon after
crush injury, 4 µg of protein from the crush, P1, P2, and control
segments was analyzed at 15 min (lanes 1-4) and
45 min (lanes 5-8). Constitutive apNF- B binding was
present in the controls 15 min (lanes 1) and 45 min
(lane 5) after injury, but was absent in the crush
(lanes 2, 6), P1 (lanes
3, 7), and P2 (lanes 4, 8)
segments at both times. E, DOC treatment of 4 µg of
extract from control segments unmasked latent activity (lanes 1, 2) but had no effect on the crush segments 15 min (lanes 3, 4) or 45 min
(lanes 5, 6) after injury. F,
Forty-five minutes after nerve crush, the sensory cell cluster from the
crush-injured and control sides were excised and homogenized, and 600 ng of protein was analyzed. There was a dramatic loss of apNF- B
(lanes 1, 2) that was not recovered by
DOC (lanes 3, 4).
[View Larger Version of this Image (41K GIF file)]
The effects of injury on the axons were intriguing, because an
extranuclear loss of NF- B activity had not been reported previously. Moreover, the loss occurred rapidly. In one series of experiments, we
waited only 5 min after nerve crush before analyzing the nerve segments
just proximal to the crush site and the contralateral noninjured
control segments (Fig. 2A). Segments were used to
minimize the manipulations before analysis. EMSAs from three
experiments revealed an average 65% reduction in B-binding activity
(Fig. 2C). How far along the axon from the crush site does
the loss of apNF- B extend? To address this issue, we waited 15 min
after crush injury and analyzed two additional 0.5 cm segments, P1 and P2, located more proximally along each nerve (Fig.
2A). In all three experiments, there was no
constitutive apNF- B binding at either the crush site (Fig.
2D, lane 2) or in either of the two proximal segments (lanes 3, 4). The same
result was obtained when we waited 45 min after crush (Fig.
2D, lanes 5-8).
One explanation for the loss of constitutive activity in the axon after
injury would be a reassociation of apNF- B with I B. However, DOC
treatment unmasked <5% of the latent activity relative to the
controls (Fig. 2E), meaning that nerve crush also
caused a loss of the latent form.
Many axons in the pedal nerves originate from neurons in the pleural
sensory cluster. The intact cluster is easy to isolate, and the
response of these neurons to pedal nerve injury has been well studied
(for review, see Ambron and Walters, 1996 ). To determine whether 45 min
is sufficient time for apNF- B to be lost in the cell body, we
crushed all of the pedal nerves 1 cm from the ganglion on one side of
the animal. This effectively axotomizes all of the sensory neurons
(Walters et al., 1983 ). The nerves on the contralateral side were left
untouched. Forty-five minutes later, the sensory clusters were isolated
and examined for apNF- B activity. Three experiments were performed
with variable results. In one experiment, there was no change, in
another, there was a 25% reduction in binding, and in the third, there
was a complete loss of activity (Fig. 2F, lanes
1, 2). We treated samples from the third experiment with
DOC, but as with the crushed axons, there was no activation of the
latent form (lanes 3, 4).
5-HT does not affect apNF- B
Many of the changes induced in Aplysia neurons by axon injury
(Walters et al., 1991 ; Clatworthy and Walters, 1994 ; Noel et al., 1995 ;
Steffensen et al., 1995 ) are also seen after exposing the nervous
system to levels of 5-HT that induce synaptic facilitation, a cellular
correlate of behavioral sensitization (Bailey and Kandel, 1993 ; Byrne
et al., 1993 ; Kaang et al., 1993 ; Alberini et al., 1994 ). We used two
different protocols to determine how 5-HT affects apNF- B. First, we
exposed the intact animal to 250 µM 5-HT for 2 hr
(Alberini et al., 1994 ) but did not detect any changes in either the
activity or the distribution of apNF- B (Fig. 3,
lanes 1, 2). Likewise, exposure of half of an
otherwise intact nervous system in situ to 20 µM 5-HT (Dale et al., 1987 ; Emptage and Carew, 1993 ) had
no affect on the constitutively active (lanes 3,
4) or latent forms (lanes 5,
6) of apNF- B when compared with contralateral controls.
Fig. 3.
5-HT does not affect apNF- B activity in
the axon. To assess the effect of 5-HT on apNF- B activity, an intact
animal was exposed to 250 µM 5-HT for 2 hr. Nerve
segments (2 cm) were homogenized, and 6 µg of the extract was removed
for EMSA using the PII probe. An equal amount of extract from segments
from an animal incubated in seawater was used as a control. There was
no difference in binding between the animal treated with the 5-HT
(lane 2) and the control (lane 1).
Likewise, exposure of half of the nervous system in situ
to 20 µM 5-HT for 2 hr did not alter apNF- B activity in 4 µg of extracts (lane 4) relative to a
similar extract from the contralateral control half incubated for the
same time in seawater (lane 3). There was also no
difference in the latent form (lanes 5,
6).
[View Larger Version of this Image (75K GIF file)]
DISCUSSION
We have identified a B-DNA-binding protein in Aplysia
neurons that has the properties of a homolog of vertebrate NF- B.
Thus, (1) it migrates with authentic NF- B on EMSAs; (2) it
recognizes oligonucleotide probes containing two different consensus
B sequences; (3) the binding to the probes is blocked by recombinant
mammalian I B, which binds specifically to the p65 subunit of
NF- B; (4) it is present in an active form in the nucleus and in a
latent form outside of the nucleus; and (5), the latent form is
activated by the same DOC treatments as vertebrate NF- B. We were
unable to supershift the DNA-apNF- B complex using antibodies to
mammalian NF- B. However, other Aplysia transcription
factors that are the functional equivalent of the vertebrate forms also
exhibit only partial sequence homology (Alberini, 1994; Bartsch et al.,
1995).
Our finding of apNF- B in axoplasm corroborates the earlier report by
Kaltschmidt et al., (1993) and raises the important issue as to what
this transcription factor might be doing in the axon. One possibility
is that it passively enters the axon with the bulk of axoplasm and that
its presence has no functional consequence. This is unlikely, given
that the export of proteins from the cell soma into the axon is
selective (Grafstein and Forman, 1980 ) and would be even less likely
for proteins that are destined to enter the nucleus. We found little,
if any, of the transcription factors that recognize the AP-1 and CRE
enhancer sites in axoplasm, indicating that the entry of NF- B into
the axon is selective.
A clue as to the function of NF- B in the axon might be its unique
ability to respond to external cues by undergoing a transition from the
cytoplasmic to the nuclear compartment. This transition occurs because
the I B is removed, activating the NF- B and exposing the NLS. Both
we and Kaltschmidt et al. (1993) found an active NF- B in axons. This
is significant because if the NLS is exposed, as expected, then the
NF- B would have access to a pathway that retrogradely transports
proteins through the axon and into the cell body, where they are
subsequently imported into the nucleus (Ambron et al., 1992 ; Schmied et
al., 1993 ). Indeed, the NLS of the p65 subunit of NF- B (-KKRK-) (Beg
et al., 1992 ) closely resembles that of the SV40 large T antigen
(-KKKRK-), which is one of the proteins that uses this pathway. Axonal
NF- B could therefore participate in a communication system that
links events in the axon and synapse to the biosynthetic machinery in
the cell nucleus (Ambron et al., 1992 ; Kaltschmidt et al., 1993 ). As a
first step in determining the validity of this idea, we are trying to
identify events in the axon that initiate the conversion of the latent to the active form.
One of the first manipulations that we tried was to injure the axon.
Rather than activate the apNF- B, injury caused a rapid and dramatic
loss of DNA binding. Because we are measuring binding, the factor could
be present after nerve crush, but in a form that cannot bind DNA.
Activity could then be recovered by a reactivation mechanism rather
than by de novo synthesis in the cell body. We eliminated an
injury-induced reassociation with I B by showing that activity was
not restored with DOC. Alternatively, injury could cause the
degradation of apNF- B. Previous studies found that other proteins at
the crush site remain intact (Ambron et al., 1995 ), indicating that the
loss of apNF- B is selective. A good candidate is the
ubiquitin/proteasome pathway, which is present in axoplasm (Chain et
al., 1995 ), degrades NF- B after hepatectomy (Cressman and Taub,
1994 ), and is capable of eliminating its substrates very rapidly
(Kawahara and Yokosawa, 1994 ). Moreover, proteasomes can be activated
by Ca2+ (Kawahara and Yokosawa, 1994 ). Studies of
Aplysia neurons in vitro have shown that the levels of
intracellular Ca2+ increase at the crush site (Ziv
and Spira, 1993 ) and probably along the axon in response to action
potentials triggered by the injury.
Still to be explained is why apNF- B DNA binding was not always
destroyed as rapidly in the soma of the sensory cells. Perhaps Ca2+ entry and proteasome activity in the soma and
nucleus is subject to more complex regulation than in axoplasm. For
example, synaptic inputs from other cells that have been injured could
mitigate the influence of injury spikes invading from the axon (Trudeau and Castellucci, 1992 ). The loss of apNF- B binding is interesting because it mimics the effects of a target-derived "negative"
signal. Instead of the injury physically preventing the signal from
reaching the cell body, however, the crush actually causes the loss of the signal.
There are many similarities in the molecular cascades elicited in
Aplysia sensory neurons by injury and learning, and one important
site of convergence is the transcription factor apC/EBP (Alberini et
al., 1994 ). Identifying sites of divergence can also be informative,
and we have been searching for signals that distinguish between these
two processes (Walters and Ambron, 1995 ; Ambron and Walters, 1996 ).
ApNF- B might be such a signal because it is not affected by levels
of serotonin that induce the molecular events that underlie
sensitization, which is an elementary form of learning. If apNF- B is
an injury signal, then our data suggest that it regulates processes
that distinguish regeneration from learning, the most obvious being
those related to growth. Regeneration requires the formation of a new
axon and synapse (Steffensen et al., 1995 ), whereas memory
consolidation involves the expansion of already existing terminals
(Bailey and Chen, 1988; Bailey and Kandel, 1993 ; Bartsch et al., 1995).
The rapid removal of apNF- B after crush injury in Aplysia could
be involved in regeneration of the distal axonal arbor.
FOOTNOTES
Received March 21, 1997; revised April 11, 1997; accepted April 1, 1997.
This work was supported by Graduate Training Grant for Careers in
Molecular Ophthalmology 5T32EY07105 (K.T.), National Institutes of
Health Grant NS-22150 (R.T.A.), and institutional funding from the
Department of Biochemistry and Molecular Biophysics and American Cancer
Society Grant IRG 177D (D.T.). We thank Drs. David Hirsch and Richard
Axel for a helpful comments on this manuscript.
Aplysia were provided by the NCRR National Resource for
Aplysia at the University of Miami under National Institutes of
Health Grant RR10294.
Correspondence should be addressed to Dr. Richard T. Ambron, Department
of Anatomy and Cell Biology, Black Building 1204, Columbia University
Medical Center, West 168th Street, New York, NY 10032.
REFERENCES
-
Alberini CM,
Ghirardi M,
Metz R,
Kandel ER
(1994)
C/EBP is an immediate-early gene required for the consolidation of long-term facilitation in Aplysia.
Neuron
76:1099-1114.
-
Ambron RT,
Walters ET
(1996)
Priming events and retrograde injury signals: a new perspective on the cellular and molecular biology of nerve regeneration.
Mol Neurobiol
13:61-79[Web of Science][Medline].
-
Ambron RT,
Schmied R,
Huang CC,
Smedman M
(1992)
A signal sequence mediates the retrograde transport of proteins from the axon periphery to the cell body and then into the nucleus.
J Neurosci
12:2813-18[Abstract].
-
Ambron RT,
Dulin MF,
Zhang X-P,
Schmied R,
Walters ET
(1995)
Axoplasm enriched in a protein mobilized by nerve injury induces memory-like alterations in Aplysia neurons.
J Neurosci
15:3440-3446[Abstract].
-
Ambron RT,
Zhang X-P,
Gunstream JD,
Povelones M,
Walters ET
(1996)
Intrinsic injury signals enhance growth, survival, and excitability of Aplysia neurons.
J Neurosci
16:7469-7477[Abstract/Free Full Text].
-
Baeuerle PA,
Baltimore D
(1988a)
Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-
B transcription factor.
Cell
53:211-217[Web of Science][Medline]. -
Baeuerle PA,
Baltimore D
(1988b)
I
B: a specific inhibitor of the NF- B transcription factor.
Science
242:540-546[Abstract/Free Full Text]. -
Bailey CH,
Kandel ER
(1993)
Structural changes accompanying memory storage.
Annu Rev Physiol
55:397-426[Web of Science][Medline].
-
Beg AA,
Ruben SM,
Scheinman RI,
Haskill S,
Rosen CA,
Baldwin Jr AS
(1992)
I
B interacts with the nuclear localization sequences of the subunits of NF- B: a mechanism for cytoplasmic retention.
Genes Dev
6:1899-1913[Abstract/Free Full Text]. -
Byrne JH,
Zwartjes R,
Homayouni R,
Critz SD,
Eskin A
(1993)
Roles of second messenger pathways in neuronal plasticity and in learning and memory.
Adv Second Messenger Phosphoprotein Res
27:47-108[Web of Science][Medline].
-
Chain DG,
Hegde AN,
Yamamoto N,
Liu-Marsh B,
Schwartz JH
(1995)
Persistent activation of cAMP-dependent protein kinase by regulated proteolysis suggests a neuron-specific function of the ubiquitin system in Aplysia.
J Neurosci
15:7592-7603[Abstract].
-
Clatworthy A,
Walters ET
(1994)
Comparative analysis of hyperexcitability and synaptic facilitation induced by nerve injury in two populations of mechanosensory neurones of Aplysia californica.
J Exp Biol
190:217-238[Abstract].
-
Cressman DE,
Taub R
(1994)
Physiologic turnover of nuclear factor
B by nuclear proteolysis.
J Biol Chem
269:26594-26597[Abstract/Free Full Text]. -
Dale N,
Kandel ER,
Schacher S
(1987)
Serotonin produces long-term changes in the excitability of Aplysia sensory neurons in culture that depend on new protein synthesis.
J Neurosci
7:2232-2238[Abstract].
-
Dash PK,
Hochner B,
Kandel ER
(1990)
Injection of cAMP-responsive element into the nucleus of Aplysia sensory neurons blocks long-term facilitation.
Nature
345:718-721[Medline].
-
Dignam JD,
Lebovitz RM,
Roeder RG
(1983)
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res
11:1475-1489[Abstract/Free Full Text].
-
Emptage NJ,
Carew TJ
(1993)
Long-term synaptic facilitation in the absence of short-term facilitation in Aplysia neurons.
Science
262:253-256[Abstract/Free Full Text].
-
Fawcett JW,
Keynes RJ
(1990)
Peripheral nerve regeneration.
Annu Rev Neurosci
13:43-60[Web of Science][Medline].
-
Grafstein B,
Forman DS
(1980)
Intracellular transport in neurons.
Physiol Rev
60:1167-1283[Free Full Text].
-
Kaang BK,
Kandel ER,
Grant SGN
(1993)
Activation of cyclic AMP- responsive genes by stimuli that produce long-term facilitation in Aplysia sensory neurons.
Neuron
10:427-435[Web of Science][Medline].
-
Kaltschmidt C,
Kaltschmidt B,
Baeuerle PA
(1993)
Brain synapses contain inducible forms of the transcription factor NF-
B.
Mechan Dev
43:135-147[Web of Science][Medline]. -
Kawahara H,
Yokosawa H
(1994)
Intracellular calcium mobilization regulates the activity of 26 S proteasome during the metaphase-anaphase transition in the ascidian meiotic cell cycle.
Dev Biol
166:623-633[Web of Science][Medline].
-
Lieberman AR
(1971)
The axon reaction: a review of the principal features of perikaryal responses to axon injury.
Int Rev Neurobiol
14:49-124[Medline].
-
Liou HC,
Baltimore D
(1993)
Regulation of the NF-
B/rel transcription factor and I B inhibitor system.
Curr Opin Cell Biol
5:477-487[Medline]. -
Noel F,
Frost WN,
Tian L-M,
Colicos MA,
Dash PK
(1995)
Recovery of tail-elicited siphon-withdrawal reflex following unilateral axonal injury is associated with ipsi- and contralateral changes in gene expression in Aplysia californica.
J Neurosci
15:6926-6938[Abstract/Free Full Text].
-
Schmied R,
Huang C-C,
Zhang X-P,
Ambron D,
Ambron RT
(1993)
Endogenous axoplasmic proteins and proteins containing nuclear localization signal sequences use the retrograde axonal transport/nuclear import pathway in Aplysia neurons.
J Neurosci
13:4064-4071[Abstract].
-
Sherbany AA,
Ambron RT,
Schwartz JH
(1979)
Membrane glycolipids: regional synthesis and axonal transport in a single identified neuron of Aplysia californica.
Science
203:78-81[Abstract/Free Full Text].
-
Sherbany AA,
Ambron RT,
Schwartz JH
(1984)
Characterization of glycolipids synthesized in an identified neuron of Aplysia californica.
J Neurosci
4:1875-1883[Abstract].
-
Skene JHP
(1989)
Axonal growth-associated proteins.
Annu Rev Neurosci
12:127-156[Web of Science][Medline].
-
Steffensen I,
Dulin MF,
Walters ET,
Morris CE
(1995)
Peripheral regeneration and central sprouting of sensory neurone axons in Aplysia californica following nerve injury.
J Exp Biol
198:2067-2078[Abstract].
-
Thanos D,
Maniatis T
(1995)
NF-
B: a lesson in family values.
Cell
80:529-532[Web of Science][Medline]. -
Titmus M,
Faber D
(1990)
Axotomy induced alterations in the electrophysiological characteristics of neurons.
Prog Neurobiol
35:1-51[Web of Science][Medline].
-
Trudeau L-E,
Castellucci VF
(1992)
Contribution of polysynaptic pathways in the mediation and plasticity of Aplysia gill and siphon withdrawal reflex: evidence for differential modulation.
J Neurosci
12:3838-3848[Abstract].
-
Verma IM,
Stevenson JK,
Schwarz EM,
Antwerp DV,
Miyamoto S
(1995)
Rel/NF-
B/I B family: intimate tales of association and dissociation.
Genes Dev
9:2723-2735[Free Full Text]. -
Walters ET,
Ambron RT
(1995)
Long-term alterations induced by injury and by 5-HT in Aplysia sensory neurons: convergent pathways and common signals?
Trends Neurosci
18:137-142[Web of Science][Medline].
-
Walters ET,
Byrne JH,
Carew TJ,
Kandel ER
(1983)
Mechanoafferent neurons innervating tail of Aplysia. I.
Response properties and synaptic connections J Neurophysiol
50:1522-1542.
-
Walters ET,
Alizadeh H,
Castro EA
(1991)
Similar neuronal alterations induced by axonal injury and learning in Aplysia.
Science
253:797-799[Abstract/Free Full Text].
-
Ziv NE,
Spira ME
(1993)
Spatiotemporal distribution of Ca2+ following axotomy and throughout the recovery process of cultured Aplysia neurons.
Eur J Neurosci
5:657-668[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
S. S. Bedi, A. Salim, S. Chen, and D. L. Glanzman
Long-Term Effects of Axotomy on Excitability and Growth of Isolated Aplysia Sensory Neurons in Cell Culture: Potential Role of cAMP
J Neurophysiol,
March 1, 1998;
79(3):
1371 - 1383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Kenney and J. D. Kocsis
Peripheral Axotomy Induces Long-Term c-Jun Amino-Terminal Kinase-1 Activation and Activator Protein-1 Binding Activity by c-Jun and junD in Adult Rat Dorsal Root Ganglia In Vivo
J. Neurosci.,
February 15, 1998;
18(4):
1318 - 1328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wellmann, B. Kaltschmidt, and C. Kaltschmidt
Retrograde Transport of Transcription Factor NF-kappa B in Living Neurons
J. Biol. Chem.,
April 6, 2001;
276(15):
11821 - 11829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-D. Delcroix, S. Averill, K. Fernandes, D. R. Tomlinson, J. V. Priestley, and P. Fernyhough
Axonal Transport of Activating Transcription Factor-2 Is Modulated by Nerve Growth Factor in Nociceptive Neurons
J. Neurosci.,
September 15, 1999;
19(18):
RC24 - RC24.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|