 |
Previous Article | Next Article 
Volume 17, Number 13,
Issue of July 1, 1997
pp. 5027-5037
Copyright ©1997 Society for Neuroscience
Neuronally Restricted RNA Splicing Regulates the Expression
of a Novel GABAA Receptor Subunit Conferring Atypical
Functional Properties
Paul J. Whiting1,
George McAllister1,
Demetrios Vassilatis2,
Timothy P. Bonnert1,
Robert
P. Heavens1,
David W. Smith1,
Louise Hewson1,
Ruth O'Donnell1,
Michael R. Rigby1,
Dalip J. S. Sirinathsinghji1,
George Marshall1,
Sally A. Thompson1, and
Keith A. Wafford1
1 Neuroscience Research Centre, Merck Sharp & Dohme
Research Laboratories, Harlow, Essex CM20 2QR, United Kingdom, and
2 Merck Research Laboratories, Rahway, New Jersey 07065
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
We report the isolation and characterization of a cDNA encoding a
novel member of the GABA receptor gene family, . This polypeptide is
506 amino acids in length and exhibits its greatest amino acid sequence
identity with the GABAA receptor 3 subunit (47%),
although this degree of homology is not sufficient for it to be
classified as a fourth subunit. The subunit coassembles with
GABAA receptor and subunits in Xenopus
laevis oocytes and transfected mammalian cells to form
functional GABA-gated channels. 1 1 GABAA
receptors, like 1 1 2s receptors, are modulated by pentobarbital
and the steroid 5 -pregnan-3 -ol-20-one but, unlike 1 1 2s
receptors, are insensitive to flunitrazepam. Additionally, 1 1
receptors exhibit rapid desensitization kinetics, as compared with
1 1 or 1 1 2s. Northern analysis demonstrates widespread
expression of a large subunit transcript in a variety of
non-neuronal tissues and expression of a smaller transcript in brain
and spinal cord. Sequence analysis demonstrated that the large
transcript contained an unspliced intron, whereas the small transcript
represents the mature mRNA, suggesting regulation of expression of the
subunit via neuronally restricted RNA splicing. In
situ hybridization and immunocytochemistry reveal a pattern of
expression in the brain restricted primarily to the hypothalamus,
suggesting a role in neuroendocrine regulation, and also to subfields
of the hippocampus, suggesting a role in the modulation of long term
potentiation and memory.
Key words:
GABAA receptor;
subunit;
function;
RNA
splicing;
hypothalamus: hippocampus
INTRODUCTION
GABA is the major inhibitory neurotransmitter of
the vertebrate CNS. It modulates inhibitory tone throughout the CNS by
activating two classes of receptors, GABAA and
GABAB. The latter are G-protein-coupled receptors, and
their molecular structure recently has been elucidated (Kaupmann et
al., 1997 ). GABAA receptors are ligand-gated ion channels
and are part of the same gene super family as nicotinic receptors
(Schofield et al., 1989 ). The binding of the agonist GABA to the
receptor complex results in the rapid opening of the intrinsic anion
channel through which anions, primarily chloride, flow into the cell.
This leads to hyperpolarization of the cell membrane and an increase in
the inhibitory tone at that synapse. This receptor is the target for a
number of classes of drugs, including the benzodiazepines,
barbiturates, general anesthetics, neurosteroids, and alcohols (for
review, see Macdonald and Angelotti, 1993 ; Sieghart, 1995 ; Whiting et
al., 1995 ).
Molecular biological approaches have revealed that the
GABAA receptor exists as a gene family of polypeptides.
These are divided into subcategories on the basis of their relative
sequence identities: 1- 6, 1- 4, 1- 4, , and
1- 2 (see Darlison and Albrecht, 1995 ; Sieghart 1995 ; Whiting et
al., 1995 ). 4 and 4 have not been identified in mammals. The
unique pharmacology of receptors formed by 1 or 2 has led to
suggestions that they should be classified as GABAC
receptors (Johnston, 1996 ). Each GABAA receptor subunit has
a unique pattern of expression in the mammalian brain, although the
2 subunit is the most ubiquitous (Laurie et al., 1992 ; Wisden et
al., 1992 ). Subunits are thought to coassemble as pentamers to form a
family of receptor subtypes that are expressed differentially
throughout the mammalian brain. Experiments in a number of laboratories
that use subunit-specific antibodies to characterize native
GABAA receptors indicate that the minimum subunit
composition of native receptors is thought to be   or  
(see Darlison and Albrecht, 1995 ; McKernan and Whiting, 1996 ). Studies
using recombinant receptors have demonstrated that the subunit
composition determines the pharmacology of the receptor and the
affinity for GABA (see Ebert et al., 1994 ; Whiting et al., 1995 ) and
perhaps the targeting of the receptor to different subcellular domains
(Connolly et al., 1996 ). However, relatively little is known about the
biophysical properties of the various GABAA receptor
subtypes.
Here we report the identification of a novel GABA receptor subunit,
, which coassembles with and GABAA receptor
subunits to form a functional receptor with unique properties. The
expression of the mature form of mRNA transcript seems to be
regulated via a neuronally restricted RNA splicing mechanism. The
limited expression of this subunit in hypothalamic and hippocampal
regions suggests a specialized role in inhibitory
neurotransmission.
MATERIALS AND METHODS
Isolation and sequencing of a cDNA encoding the
GABAA receptor subunit. The Merck.EST (Expressed
Sequence Tag) database was searched with the human GABAA
receptor 1 subunit-deduced (GenBank accession number [GenBank]) primary
amino acid sequence, using the BLAST search tool (Altschul et al.,
1990 ), and a number of EST sequences were identified. Two of these,
[GenBank] and [GenBank], were investigated in more detail. PCR was performed to determine whether the two ESTs encoded the same gene product. For
PCR, a sense primer was generated from the R07883 sequence (5
ctgttggagtttggtgtgctcaac 3 ), and an antisense primer was generated
from the R49718 sequence (5 accagctggtacctacaagttaag 3 ). PCR was
performed under standard conditions (Whiting et al., 1990 ), using human
subthalamic nucleus cDNA (Clontech, Cambridge, UK) as a template.
cDNA sequences 5 of the R07883 sequence were obtained by 5 rapid
amplification of cDNA ends (RACE), using the human brain Marathon cDNA
cloning kit (Clontech) according to the manufacturer's protocols. The
nested antisense primers that were used were derived from the R07883
sequence (AS1, 5 catcgtggtcacggaagaagggac 3 ; AS2, 5
gccaaaccgcctgctcacattgaa 3 ). PCR products were subcloned into pMOS
vector (Amersham, Braunschweig, Germany), using standard techniques,
and sequenced by using an Applied Biosystems (Foster City, CA) 373 DNA
sequencer and dye terminator chemistry. One of the PCR products was
found to extend far enough to contain a sequence encoding a putative
initiating methionine and a 5 untranslated region (UT).
A full-length cDNA was generated by PCR with primers derived from
sequences in the 5 UT of the RACE PCR product and the 3 UT sequences
in R49718 (5 caggtggtgcggccgctctccgcggaaatgttgt 3 and 5
ccacagggcggccgctggtacctacaagttaag 3 , both incorporating a
NotI site for subcloning). PCR products (1550 bp) were
subcloned into pCDNAI/Amp and sequenced completely on both strands by
primer walking. Sequence analysis was performed with Inherit (Applied Biosystems) and Genetics Computer Group (University of Wisconsin) computer programs.
Northern blot analysis. Northern blots containing
poly(A+) RNA from various human tissues were
obtained from Clontech. The R07883 intron probe was generated as a 283 bp EcoRI-BspHI fragment by digestion of R07883
cDNA, and the R07883 exon probe was generated as a 365 bp
BspHI-PacI fragment. 32P-labeled
probes were generated by random priming (Prime-It kit, Stratagene, La
Jolla, CA), and blots were probed under high stringency in 5× SSPE
(1× SSPE is 0.18 M NaCl, 10 mM Na phosphate,
pH 7.4, and 1 mM EDTA) containing 50% formamide at 42°C.
Filters were washed in 0.3× SSPE at 65°C and exposed to Kodak XAR
film for 2 d at 70°C, using Cronex QIII intensifying
screens.
Characterization of placental subunit transcript.
Placental cDNA (Clontech) was used as a template for PCR
reactions. To generate PCR products 5 and 3 of the intron, we used
the following oligonucleotide primers: for the 5 PCR, the sense primer
was 5 gcggccgctctccgcggaaatgttgt 3 (bp 1-24) and the antisense
primer was 5 gggttgtgaattatttcagtt 3 (bp 776-795); for the 3 PCR, the sense primer was 5 aactatgtcccttcttccgtg 3 (bp 867-887) and the
antisense primer was 5 gcggccgctggtacctacaagttaag 3 (bp 1532-1552).
PCR was performed under standard conditions (Whiting et al., 1990 ), and
products were resolved by electrophoresis through 1% agarose gels
stained with ethidium bromide.
To generate PCR products containing the intron sequence, we used the
following oligonucleotide primers: sense, 5 agaactcctggaagctcttccagt 3 (bp 727-750) and antisense, 5 ccaaaccgcctgctcacattgaa 3 (bp 828-850). PCR was performed with Expand Long Template PCR (Boehringer Mannheim, Mannheim, Germany). PCR was performed by using buffer 1, supplied by manufacturers, with a final concentration of 350 µM deoxynucleotide triphosphates, ~10 µM
of each primer, and 0.75 U of enzyme. PCR conditions were as follows: 2 min initial denaturation, followed by 35 cycles of 94°C for 20 sec,
60°C for 1 min, and 68°C for 3 min. PCR products were resolved by
electrophoresis through 0.8% agarose gels stained with ethidium
bromide. PCR products were subcloned into pMOS vector (Amersham), using
standard methodologies and partial sequencing performed by primer
walking, as above.
Cloning from human genomic DNA of subunit sequences
containing the unspliced intron. PCR was performed with rTth DNA
polymerase (XL PCR, Perkin-Elmer, Oak Brook, IL) and 500 ng of human
genomic DNA (Clontech) as a template. Buffer was as supplied by the
manufacturer; the final concentration of other constituents was 200 µM deoxynucleotide triphosphates, 1.1 mM
magnesium acetate, ~10 µM of each primer, and 2 U of
enzyme. Conditions for PCR were as follows: 1 min denaturation at
94°C, followed by 35 cycles each of 30 sec at 94°C and 3 min at
68°C. PCR products were resolved by electrophoresis through 0.8%
agarose gels stained with ethidium bromide. For subcloning, PCR
products were blunt-ended, using T4 DNA polymerase, purified by
electrophoresis, and ligated into EcoRV cut pBluescript
(Stratagene). The PCR product was sequenced completely by primer
walking, as above.
Localization of the subunit in monkey brain by in situ
hybridization. Antisense oligonucleotide probes to the human
subunit sequence were generated on an Applied Biosystems Model 394 DNA synthesizer and purified by preparative polyacrylamide
electrophoresis: probe 1, 5 ggtgacaatcaggcacacaaaagcttcctgatgttggcggg
caca 3 (antisense to bp 1206-1250); probe 2, 5
cctgctgccaggtactgccctcacaatcggg gaccatgcagaagt 3 (antisense to bp
1384-1428). Each oligonucleotide was 3 end-labeled with
[35S]deoxyadenosine 5 -(thiotriphosphate) in a
30:1 molar ratio of 35S-isotope/oligonucleotide, using
terminal deoxynucleotidyl transferase for 15 min at 37°C in the
reaction buffer supplied (Boehringer Mannheim). Radiolabeled
oligonucleotide was separated from unincorporated nucleotides, using
Sephadex G50 spin columns. The specific activities of the labeled
probes in several labeling reactions varied from 1.2-2.3 × 109 cpm/mg. Monkey brains were removed and
fresh-frozen in 1 cm blocks. Sections of 12 µm were taken and fixed
for in situ hybridization. Hybridization of the sections was
performed according to the method of Sirinathsinghji and Dunnett
(1993) . Briefly, sections were removed from alcohol and air-dried;
5 × 105 cpm of each 35S-labeled
probe in 100 µl of hybridization buffer was applied to each slide.
Labeled "antisense" probe also was used in the presence of an
excess (100×) concentration of unlabeled antisense probe to define
nonspecific hybridization. Parafilm coverslips were placed over the
sections that were incubated overnight (~16 hr) at 37°C. After
hybridization the sections were washed for 1 hr at 57°C in 1× SSC
and then rinsed briefly in 0.1× SSC, dehydrated in a series of
alcohols, air-dried, and exposed to Amersham Hyperfilm max x-ray
film. Autoradiographs were analyzed by a microcomputer imaging device
(MCID) computerized image analysis system (Image Research, Ontario,
Canada).
Localization of the subunit in monkey brain and in
transfected HEK 293 cells by immunohistochemistry. A rabbit
antiserum was generated to the synthetic peptide
I-V-T-T-E-G-S-D-G-E-E-R-P-S-C-S-A-Q-Q that was coupled to keyhole
limpet hemocyanin (Affiniti Research Products, Exeter, UK). This
sequence is residues 409-427 of the subunit, located in the
putative cytoplasmic loop between TM3 and TM4. For
immunohistochemistry, antibodies were affinity-purified by using the
synthetic peptide coupled to Sepharose.
A squirrel monkey was deeply anesthetized with ketamine and sodium
pentobarbitone and transcardially perfused with saline, followed by
10% formalin in 0.1 M PBS. The brain was removed, post-fixed in 10% formalin in PBS for 24 hr, and sliced into coronal blocks, which then were embedded in paraffin wax. Coronal sections (10 µm) were cut on a rotary microtome, deparaffinized, rinsed in PBS,
and treated with 0.3% H2O2 for 30 min (to
block endogenous peroxidase activity). Background staining was blocked
by incubating the sections in 3% normal horse serum for 1 hr. Sections
were incubated overnight at 4°C with the anti- subunit rabbit
polyclonal antibody (1:500 dilution). Immunostaining was visualized by
using the ABC elite system (Vector Laboratories, Peterborough, UK), followed by development in diaminobenzidine (DAB). Finally, sections were counterstained in Gill's hematoxylin, dehydrated, and mounted for
microscopical examination. For immunofluorescent labeling of
transiently transfected HEK 293 cells, the procedure was, in general,
similar to that used for brain sections. Cells were transfected with
cDNAs as described below and 48 hr later were processed for immunocytochemistry. The cells were fixed in 4% paraformaldehyde, rinsed in PBS, and incubated with the anti- subunit antibody at a
dilution of 1:1000. Goat anti-rabbit fluorescein isothiocyanate (FITC;
1:100 dilution) was used as the detection system.
Expression in Xenopus oocytes. Adult female
Xenopus laevis were anesthetized by immersion in a 0.4%
solution of 3-aminobenzoic acid ethylester for 30-45 min (or until
unresponsive). Ovary tissue was removed via a small abdominal incision,
and Stage V and Stage VI oocytes were isolated with fine forceps. After
mild collagenase treatment to remove follicle cells (Type IA, 0.5 mg/ml, for 8 min), the oocyte nuclei were injected directly with 10-20
nl of injection buffer (88 mM NaCl, 1 mM KCl,
and 15 mM HEPES, at pH 7, filtered through nitrocellulose)
or sterile water containing different combinations of human
GABAA subunit cDNAs (20 ng/ml) engineered into the
expression vector pCDM8 or pcDNAI/Amp. After incubation for 24-72 hr,
oocytes were placed in a 50 µl bath and perfused at 4-6 ml/min with
modified Barth's medium (MBS) consisting of (in mM): 88 NaCl, 1 KCl, 10 HEPES, 0.82 MgSO4, 0.33 Ca(NO3)2, 0.91 CaCl2, and 2.4 NaHCO3, at pH 7.5. Cells were impaled with two 1-3 M electrodes containing 2 M KCl and voltage-clamped between 40 and 70 mV.
In all experiments, drugs were applied in the perfusate until the peak
of the response was observed. Noncumulative concentration-response curves to agonists were constructed, allowing at least 3 min between each agonist application to prevent desensitization. Curves were fit by
using a nonlinear square-fitting program to the equation f(x) = BMAX/[1+(EC50/x)n],
where x is the drug concentration, EC50 is the
concentration of drug eliciting a half-maximal response, and
n is the Hill coefficient. The effects of GABAA
receptor modulators were examined on control GABA EC20
responses with a preapplication time of 30 sec.
Whole-cell patch clamp of HEK 293 cells transiently transfected
with human GABAA receptors. Experiments were performed
on HEK 293 cells transiently transfected with human cDNA combinations 1 1, 1 1 , and 1 1 2s (6 µg of cDNA total per
coverslip), using calcium phosphate precipitation (Chen and Okayama,
1988 ) as previously described (Hadingham et al., 1993 ). Glass
coverslips containing the cells in a monolayer culture were transferred
to a chamber on the stage of a Nikon Diaphot inverted microscope. Cells
were perfused continuously with a solution containing (in
mM): 124 NaCl, 2 KCl, 2 CaCl2, 1 MgCl2, 1.25 KH2PO4,
25 NaHCO3, and 11 D-glucose, pH 7.2, and
observed with phase-contrast optics. Patch pipettes were pulled with an
approximate tip diameter of 2 µm and a resistance of 4 M with
borosilicate glass and were filled with (in mM): 130 CsCl,
10 HEPES, 10 EGTA, and 3 Mg+-ATP, pH-adjusted to 7.3 with CsOH. Cells were patch-clamped in whole-cell mode with a List
LM-EPC 7 patch-clamp amplifier (List Biologic, Campbell, CA). Drug
solutions were applied by a double-barreled pipette assembly, which was
controlled by a stepping motor attached to a Prior manipulator,
enabling rapid equilibration around the cell. Increasing GABA
concentrations were applied for 10 sec pulses with a 30 sec interval
between applications.
RESULTS
Identification of a novel member of the GABA receptor family
So that new GABA receptor subunits genes could be identified, the
Expressed Sequence Tag (EST) database was searched, using the primary
amino acid sequence of the human GABAA receptor 1 subunit (Schofield et al., 1989 ) as a query. Two ESTs, [GenBank] (from a
human fetal liver/spleen cDNA library) and [GenBank] (from a human infant
brain cDNA library), were identified that exhibited significant deduced
amino acid sequence identity with the 1 subunit but that were not
any known GABA receptor subunit. Further searching of the EST database
using [GenBank] as a query revealed three more ESTs that overlapped with
[GenBank] (Fig. 1). PCR experiments that used primers
derived from [GenBank] and [GenBank] demonstrated that they were derived from
the same gene (data not shown). EST [GenBank] is 650 bp in length, and
further analysis suggested that the 5 270 bp of this cDNA was either a
cloning artifact or, more likely, an intron sequence. Indeed, the
putative intron-exon boundary (Fig. 1) is at exactly the same position
as the 5 splice site of exon 7 of other GABAA receptor
genes such as 1 (Kirkness et al., 1991 ) and (Sommer et al.,
1990 ), and subsequent cloning of genomic DNA confirmed this 270 bp to
be an intron sequence (see below). 5 RACE from human brain cDNA was
used to obtain cDNA sequences of the 5 end of the R07883 gene product.
Then a full-length cDNA was obtained by PCR with oligonucleotide
primers derived from the 5 untranslated region sequence of 5
RACE-generated cDNAs and the 3 untranslated region nucleotide sequence
from R49718. Two cDNAs were sequenced in full on both strands, as well as numerous RACE cDNA products.
Fig. 1.
Schematic representation of a GABAA
receptor subunit indicating the relative positions of the ESTs.
SP, Signal peptide. 1-4, Putative
transmembrane regions 1-4. The hatched area of the
box representing EST R07883 is an intron
sequence. The boxes open at one end representing ESTs
R49718, R19732, T27015,
and T78142 indicate that the 3 end of these sequences
has not been determined.
[View Larger Version of this Image (11K GIF file)]
Primary structure of the subunit
The deduced primary amino acid sequence of the R07883 gene
product, which we have termed , is shown in Figure
2A, aligned with other members of the
GABAA receptor gene family. The subunit has an open
reading frame of 506 amino acids containing the motifs expected of a
member of the ligand-gated ion channel super family exemplified by the
nicotinic receptor: an 18 residue signal peptide [using the prediction
of von Heijne (1986) ], two cysteine residues separated by 13 amino
acids, and four hydrophobic regions, which are putative
transmembrane-spanning domains (TM1-TM4). The putative extracellular
domain contains three potential N-glycosylation sites (Asn residues
134, 252, and 272). The most conserved regions are the putative
transmembrane domains, whereas the putative cytoplasmic loop between
TM3 and TM4 is completely divergent. The subunit has its highest
amino acid sequence identity with the subunits (42-47% identity
with 1- 3) (Pritchett et al., 1989 ; Ymer et al., 1990 ; Hadingham
et al., 1995 ). It exhibits 49% sequence identity with chicken 4
(Harvey et al., 1993 ); the human homolog of this avian subunit has yet
to be identified. However, because the amino acid sequence conservation
of other GABAA receptor subunits between species is >90%,
e.g., between chicken 2 (Glencorse et al., 1990 ) and human 2
(Pritchett et al., 1989 ) it is 92%, the subunit is not the human
homolog of 4. The analysis shown in Figure 2B indicates that represents a novel subfamily of GABA receptor subunits.
Fig. 2.
Comparison of the deduced amino acid sequence of
the subunit with sequences of other GABAA receptor
subunits. A, Alignment of the deduced amino acid
sequences of the human GABAA receptor 1 (Schofield et
al., 1989 ), 1 (Schofield et al., 1989 ), 1 (Ymer et al., 1990 ),
(P. Whiting, unpublished data), and subunits. Positions in
which amino acid residues are conserved in four or more sequences are
boxed. Numbering of amino acids is given
by assigning the initiating methionine as 1. Putative
transmembrane regions TM1-TM4 are indicated by a
solid line, and the two cysteine residues conserved in
the ligand-gated ion channel family are indicated by filled
circles joined by a dotted line.
B, Dendrogram of the deduced amino acid sequences of the
GABAA receptor family, including the subunit. The
analysis was performed by using PileUp (Genetics Computer Group,
University of Wisconsin). The distance along the horizontal is
proportional to the differences between the sequences.
[View Larger Version of this Image (61K GIF file)]
Characterization of subunit transcripts
Northern blot analysis (Fig. 3) that used a probe
derived from the coding region (i.e., exon sequences) of the subunit revealed expression of a large transcript (~5.5 kb) in
numerous peripheral tissues (placenta, pancreas, spleen, prostate,
testis, ovary, and intestine) as well as a smaller transcript (~3.5
kb) in various brain regions, although it was not detectable in
whole-brain mRNA. Spinal cord and also the heart appear to express both
transcripts. When Northern blots were probed with the intron sequence
identified in the R07883 EST (Fig. 1), only the large transcript was
identified, suggesting that the large mRNA species represents
incompletely spliced transcripts.
Fig. 3.
Expression of subunit transcripts in human
tissues by Northern blot analysis. Each lane contains 2 µg of poly(A+) RNA purified from various human
tissues and resolved through 1.2% agarose in formaldehyde (Clontech).
Blots were hybridized with 32P-labeled intron or exon cDNA
probes, as detailed in Materials and Methods. RNA size marker bands are
indicated on the left of the figure.
[View Larger Version of this Image (61K GIF file)]
The widespread expression of the incompletely spliced RNA species
and the more restricted expression of the smaller RNA species suggested
that the expression of the mature transcript is controlled, at
least in part, via a tissue-specific RNA splicing mechanism. To
investigate this further, we characterized the genomic sequence around
the putative incompletely spliced intron sequence, as well as the large
transcript expressed in placenta. PCR from genomic DNA with primers
derived from the exon sequence on either side of the putative intron
yielded a product of ~4000 bp (Fig. 4A). Complete sequencing of the PCR
product (Fig. 4B) indicated that the intron is 3991 bp and that the 3 splice site is identical to the sequence identified
in the EST [GenBank]. PCR from placenta cDNA with the same primer pair
yielded two products of ~3300-3500 bp (Fig. 4A).
In both of these cDNAs the intronic sequence starts at a presumed
cryptic splice site 692 bp from the 5 end of the genomic intron
sequence. The smaller PCR product also contains an additional deletion
of 129 bp, as compared with the genomic intron sequence (Fig.
4B). These data suggest that in peripheral tissues
such as placenta the 5 splice donor of this intron is used, whereas
the 3 splice acceptor is not. As may be expected, the intron sequence
retained in the placental transcripts contained numerous stop codons,
indicating that it would not lead to translation of a GABAA
receptor subunit open reading frame. Additional PCR experiments were
performed with primer pairs flanking the intron-exon splice site and
in the 5 or 3 untranslated region to determine the structure of the
5 and 3 end of the placental subunit RNA. A 5 PCR product of
~800 bp was generated, which is the predicted size (798 bp) if this
region were spliced appropriately so as to contain only exon sequences
(data not shown). Similarly, a 3 PCR product of ~700 bp was
generated, in agreement with the 686 bp size predicted if this region
were spliced appropriately so as to contain only exon sequences (data
not shown). These data suggest that in placental RNA only the intron
between exons tentatively assigned as 6 and 7 has not been spliced
out.
Fig. 4.
Cloning of subunit genomic sequences
containing the intron between exons 6 and 7 and characterization of
placental subunit transcripts. A, Generation of
products containing unspliced intron by PCR, using placenta cDNA or
genomic DNA as a template. PCR primers (indicated by
arrows) were derived from exon sequences flanking the
intron. DNA size markers are indicated to the right of
the figure. The single line represents 5 and 3 UT, the
hatched box represents the coding region, and the
open box with dashed lines represents the
intron. B, Nucleotide sequence of the intron between
exons 6 and 7 cloned from genomic DNA and from two cDNAs cloned from
placental mRNA. The deduced amino acid sequence of the surrounding exon
is shown also, with the amino acid number indicated
above it.
[View Larger Version of this Image (16K GIF file)]
The regional expression of subunit transcripts in
the brain
In the absence of human brain material, the expression of transcripts was determined in the squirrel monkey brain by in situ hybridization with 35S-labeled oligonucleotide
probes. PCR and sequencing experiments demonstrated that nucleotide
sequences chosen for synthesis of oligonucleotide probes were conserved
between human and monkey (data not shown). The subunit transcript
was highly localized, primarily in the hypothalamus, with high
densities of expression principally within the arcuate-ventromedial
area (ARC-VMH); much weaker expression of the transcript was detected
in the dorsomedial hypothalamus (Fig. 5A).
Dense mRNA expression also was found in the hilus of the dentate gyrus
of the hippocampus (Fig. 5B). It is of interest to note that
no expression was detected in other hippocampal fields nor in the
amygdala or subthalamic nucleus, two regions that, according to the
Northern blot analysis, contained transcripts. This discrepancy may
reflect the difficulties in accurately dissecting human brain regions
for RNA purification. Immunohistochemical labeling of squirrel monkey
brain sections was performed with a polyclonal antiserum generated to a
synthetic peptide derived from amino acids 409-427 of the subunit
sequence. Immunohistochemical staining with the subunit antibody
showed a distribution of immunoreactivity corresponding with the mRNA localization (Fig. 5C,D). Figure 5C shows
labeling of magnocellular cells and numerous smaller cells within the
dorsomedial hypothalamus, and Figure 5D shows labeling of
cells within the hilus and CA3 region of the hippocampus. Other
subfields of the hippocampus showed minimal specific labeling. The
immunohistochemical staining patterns obtained with the subunit
antibody were specific because preabsorption experiments on adjacent
brain sections with the peptide gave no labeling (data not shown).
Similarly, immunofluorescent labeling with the subunit antibody of
HEK 293 cells transiently transfected with 1, 1, and subunits
showed positively labeled cells (Fig. 5E), the pattern of
staining indicating membrane association of the subunit. Nontransfected
cells gave no labeling (Fig. 5F).
Fig. 5.
In situ hybridization
autoradiograms and immunohistochemical staining of squirrel monkey
brain sections and transfected HEK 293 cells showing expression of the
expression of subunit. A, Dense mRNA expression in
the arcuate-ventromedial area (ARC-VMH) and weaker expression in the dorsomedial hypothalamus
(DMH). The signal intensity is indicated in the
scale bar in B, with white representing
the strongest signal. B, Dense mRNA expression in the
hilus (H) of the dentate gyrus of the
hippocampus. C, Immunoreactive cells in the DMH.
Arrowhead indicates a labeled magnocellular neuron.
Brown is the immunostaining reaction product, and
purple is the hematoxylin counterstain.
D, Immunoreactivity in the hilus of the dentate gyrus
and in the CA3 region of the hippocampus. E, subunit immunofluorescent labeling of HEK 293 cells transiently transfected with 1, 1, and subunits.
F, Lack of labeling in untransfected HEK 293 cells.
Scale bars: A, B, 0.5 cm;
C, 10 µm; D, 100 µm.
E, Magnification, 100×.
[View Larger Version of this Image (140K GIF file)]
Functional expression of subunit containing
GABAA receptor
To investigate whether the subunit could form
functional GABA gated channels, we expressed it in Xenopus
oocytes, either alone or in combination with other members of the
GABAA receptor gene family. When expressed alone, failed to show any response to applied GABA, indicating that this
subunit is unable to form functional homomeric channels. Similarly, no
functional channels were formed when was coexpressed in oocytes
with an 1 subunit or a 1 subunit. Coexpression with both an 1
and a 1 subunit resulted in the formation of functional GABA-gated
channels. However, because 1 and 1 are able to coassemble to form
functional receptors, further pharmacological analysis was required.
Maximum current sizes for all three subunit combinations were similar
(Table 1). GABA concentration-effect curves were
generated to 1 1, 1 1 2s, and 1 1 (Fig.
6a). The EC50 for GABA was
similar for both 1 1 and 1 1 subunit combinations
[5.9 ± 1.1 µM (n = 7) and 4.0 ± 1.2 µM (n = 8), respectively]. The
Hill slope, however, was significantly lower for receptors containing
an subunit (0.85 ± 0.08 compared with 1.32 ± 0.06 for
1 1; Table 1). This was found for receptors expressed in oocytes
or in HEK 293 cells and is in contrast to that observed for native
GABAA receptors (Sakmann et al., 1983 ) and other
recombinant GABAA receptor subtypes so far examined (Horne
et al., 1993 ; Verdoorn, 1994 ; Hadingham et al., 1996 ; Saxena and
Macdonald, 1996 ), for which a Hill slope of >1 is observed. This
suggested that was coassembling with 1 and 1. Definitive evidence for coassembly of the subunit came from examining the inhibition of various subunit combinations by zinc.
Zn2+ ions are 175-fold more potent at  than at
  combinations (Fig. 6b, Table 1), demonstrating
that was coassembling with 1 and 1 to form a
GABAA receptor with low affinity for zinc. Additionally,
the zinc inhibition curve could be fit to a single site, suggesting
that a homogeneous population of   receptors (rather than a
mixed population of  and   ) was being formed.
Fig. 6.
Functional expression of receptors containing the
subunit. a, Concentration-response curves to GABA
of 1 1, 1 1 2s, and 1 1 GABAA receptors expressed in
Xenopus oocytes. b,
Concentration-response curves for inhibition of an EC50
concentration of GABA by increasing concentrations of zinc. Data
represent mean curves from the number of cells indicated for each
subtype. Curves were fit as described in Materials and Methods, with
the exception of 1 1 2s, which was best fit with two components
of inhibition.
[View Larger Version of this Image (25K GIF file)]
The ability of different GABAA receptor modulators to act
at 1 1 was investigated (Fig. 7). Unlike
receptors containing a 2s subunit, the GABA currents of 1 1
receptors were not potentiated by the benzodiazepine flunitrazepam (1 µM). The barbiturate pentobarbital (100 µM)
potentiated 1 1 to the same extent as 1 1 2s (200-300% of GABA EC20), but this was significantly lower than
that observed with 1 1 receptors (Fig. 7a). Full
concentration-response curves for the steroid
5 -pregnan-3 -ol-20-one on all three receptor subunit combinations
revealed a similar maximum potentiation of ~250% on all, but a
significantly higher affinity of 78 nM
(p < 0.05) on 1 1, as compared with 194 nM on 1 1 and 114 nM on 1 1 2s
(Fig. 7b, Table 1).
Fig. 7.
Effects of 100 µM pentobarbital, 1 µM flunitrazepam, and 5 -pregnan-3 -ol-20-one on
1 1, 1 1 2s, and 1 1 GABAA receptor subunit combinations in Xenopus oocytes.
a, Potentiation by 100 µM pentobarbital
and 1 µM flunitrazepam. Data represent the percentage of
modulation of an EC20 GABA response determined for each
individual oocyte and are the mean ± SE of at least four
determinations. b, Potentiation of the response to a
GABA EC20 by increasing concentrations of
5 -pregnan-3 -ol-20-one on oocytes expressing 1 1 ( ),
1 1 2s ( ), and 1 1 ( ) GABAA receptors.
Data represent mean ± SE of at least four individual
concentration-response curves, and values calculated from this are
shown in Table 1.
[View Larger Version of this Image (25K GIF file)]
The current-voltage relationship for 1 1 receptors was not
significantly different from receptors consisting of 1 1 (data not
shown). Maximum GABA responses in oocytes expressing 1 1 appeared to show a greater rate of desensitization than those expressing 1 1 or 1 1 2s. To investigate this further, we
transfected these subunits into HEK 293 cells and studied them by using
whole-cell patch-clamp techniques in which rapid solution changes
allowed a more accurate measure of desensitization kinetics. With this method it was clear that was conferring rapid desensitization to
the receptor, as compared with 1 1 and 1 1 2s (Fig.
8). At a concentration of 30 µM, which was
maximum for all combinations, the peak/steady-state (after 10 sec)
ratios were 4.22 ± 0.5 (n = 8) for 1 1 ,
2.17 ± 0.2 (n = 9) for 1 1, and 2.18 ± 0.3 (n = 6) for 1 1 2s, the 1 1 being
significantly higher than the other two combinations
(p < 0.005). Fitting single exponentials to the
desensitization phase revealed rate constants of 1.79 ± 0.33, 4.23 ± 0.83, and 4.55 ± 1.2 sec for 1 1 , 1 1,
and 1 1 2s, respectively. Rapid desensitization may affect the
GABA concentration-response curve in oocytes, and the slightly higher
affinities determined by using patch clamp suggest that this may be the
case; however, the GABA EC50 values and Hill coefficients
showed a similar relationship among the different subunit combinations
to that observed in oocytes (data not shown).
Fig. 8.
GABA-gated current responses of HEK 293 cells
transiently transfected with human 1 1,
1 1 , and 1 1 2s GABAA
receptor subunit cDNAs. Recordings were made under whole-cell
patch-clamp conditions. The concentration of GABA is indicated
above each application. So that peak to steady-state
ratios could be determined, applications lasted 10 sec, with at least
30 sec between applications.
[View Larger Version of this Image (11K GIF file)]
DISCUSSION
coassembles with other GABAA receptor subunits to
form a functional channel
Based on deduced amino acid sequence comparisons, the subunit has 32-49% sequence identity with other GABAA
receptor polypeptides and thus is a member of the GABAA
receptor gene family. does not form functional channels when
expressed alone. Similarly, when coexpressed with other
GABAA receptor subunits, it is unable to substitute for an
or subunit. However, when it is coexpressed with both an and a subunit, a channel with a unique pharmacology is formed,
demonstrating coassembly of the three subunits into a receptor complex.
Most GABAA receptors studied to date are thought to consist
of , , and or subunits (see Darlison and Albrecht, 1995 ;
McKernan and Whiting, 1996 ). Thus seems to be able to substitute
for a or subunit. Detailed immunoprecipitation experiments will
be required to determine the subunit composition of native
-containing receptors.
Zinc ions are known to be negative modulators of GABAA
receptor function (Smart and Constanti, 1990 ), and indeed they have been shown to be more potent at receptors consisting of and subunits than those constituted by , , and subunits (Draguhn et al., 1990 ; Smart et al., 1991 ) (Fig. 6b). Similarly, the
subunit combination 1 1 had 175-fold lower affinity for zinc
than receptors composed of  . A lowering of the potency of zinc is
observed also when the subunit is coexpressed with and ;
zinc has a 20-fold lower affinity at 6 3 , as compared with
6 3 receptors (Thompson et al., 1997 ). Thus, inclusion of a third
subunit into a binary  complex appears to have the general
property of lowering the potency for zinc.
1 1 receptors are not modulated by the benzodiazepine
flunitrazepam. This is perhaps not surprising because it is thought that the benzodiazepine binding site is made up of determinants from
both the and subunits (Pritchett et al., 1989 ; Stephenson et
al., 1990 ). Similarly, GABAA receptors made up of , ,
and subunits are reported not to be modulated by benzodiazepines (Saxena and Macdonald, 1994 ).
The barbiturate pentobarbital interacts with the GABAA
receptor at both a modulatory site and a directly activating site, and
the affinity and efficacy of pentobarbital for direct activation show
subunit selectivity, being higher at 6-containing ( 6 2 2s) receptors, as compared with receptors containing other subunits (Thompson et al., 1996 ). Here we show that the potentiation by 100 µM pentobarbital was not significantly different between
1 1 and 1 1 2s receptors. However, the potentiation at
1 1 receptors by the same concentration of pentobarbital was
significantly higher than at either of the trimeric receptors,
suggesting that the inclusion of a third subunit lowers the efficacy.
Pentobarbital (100 µM) elicited a small response in the
absence of GABA at 1 1 , but not at 1 1 or 1 1 2s
receptors (data not shown).
Concentration-response curves for the steroid
5 -pregnan-3 -ol-20-one demonstrate an equivalent maximum level of
potentiation on all three subunit combinations; however, the 
assembly shows a small but significantly higher affinity for the
steroid over 1 1 or 1 1 2s. The location of the binding
sites for both barbiturates (Thompson et al., 1996 ) and steroids
(Lambert et al., 1995 ) currently is unknown, but it is clearly not
critically dependent on the presence of , , or subunits. The
cloning of the subunit recently has been reported by Davies et al.
(1997) , who also reported insensitivity of -containing receptors to
pentobarbital and pregnenolone; however, the clear potentiation
observed here with both of these agents suggests that does not
confer insensitivity to anesthetics. The reason for this discrepancy is
currently unclear, because it is unlikely that the different and
subunits used in the study could account for this and it is unknown
which subunits coassemble with in vivo. The deduced
amino acid sequence of the subunit reported by Davies et al. (1997)
differs at position 102 (an alanine in the sequence of Davies et al.
(1997) , a serine in the sequence described here), but this difference
does not account for the pharmacological inconsistencies (data not
shown).
A novel observation was the rapid rate of desensitization of
1 1 receptors, as compared with 1 1 or 1 1 2s (Fig.
8). The subunit clearly confers rapid desensitization kinetics to
the GABAA receptor. In contrast, the presence of a subunit (in 1 1 receptors) appears to decrease the rate of
GABA-induced desensitization (Saxena and Macdonald, 1994 ).
Expression of the transcript in brain is highly restricted
Only the subunits, the expression of which is primarily
retinal (Enz et al., 1995 ), and 6, the expression of which is
limited to cerebellar granule cells (Lüddens et al., 1990 ;
Hadingham et al., 1996 ), have a more restricted pattern of expression
than the subunit. The most abundant expression of the mRNA was
found within the hypothalamic region, especially within the
arcuate-ventromedial area. Other GABAA receptor subunits
are known to be expressed in hypothalamic nuclei, primarily, but not
exclusively, 2, 3, and 2 (Wisden et al., 1992 ; Fenelon and
Herbison, 1995 ; Fenelon et al., 1995 ). GABAergic transmission is known
to play a key role in the hypothalamus, modulating the synthesis or
release of vasopressin and oxytocin (Bisset et al., 1990 ), somatostatin
(Gillies and Davidson, 1992 ), luteinizing hormone-releasing hormone
(Mitsushima et al., 1994 ), and pro-opiomelanocortin (Blazquez et al.,
1994 ). Colocalization studies that use anti- subunit and antipeptide hormone antisera will be required to define in detail a role for -containing receptors in the modulation of hormonal systems. Interestingly, the other site of high subunit mRNA expression was
found in the hilus (polymorphic layer) of the dentate gyrus of the
hippocampus. There was also low expression in the granule cell layer,
but no other hippocampal field showed expression. Immunohistochemical
labeling of monkey brain sections showed slight immunoreactivity in
cells of the granule layer but dense immunoreactivity in the
polymorphic layer and in the CA3 region. This is consistent with
labeling of the mossy fibers in the pathway from dentate to CA3 and
indicates that the subunit may play a specific role in the
modulation of this excitatory pathway, with importance to long-term
potentiation and memory.
subunit expression is regulated in part by tissue-specific
RNA splicing
Northern analysis revealed that the subunit was expressed as
two major polyadenylated transcripts. The larger transcript was
expressed in a variety of peripheral tissues, but at barely detectable
levels, in the brain. The smaller transcript was expressed within the
brain but, with the exception of the heart and spinal cord, was not
detectable in peripheral tissues. cDNA cloning revealed that the
smaller transcript was appropriately spliced mature mRNA, whereas the
larger transcript contained an unspliced intron between putative exons
6 and 7. These data suggest that the molecular mechanism for
appropriate splicing of this particular intron is present within
neurons but largely absent in peripheral tissues. Furthermore, because
there is abundant expression of the unspliced transcript in a number of
peripheral tissues, the neuronal-specific expression of mature subunit transcript is being regulated via a neuronally restricted RNA
splicing mechanism. Other mechanisms, such as alternative splicing (for
review, see Lewin, 1994 ) and RNA editing (Sommer et al., 1991 ), are
known by which expression of the gene product can be regulated at the
level of the RNA. Indeed, tissue-specific alternative RNA splicing has
been described for the synaptic terminal protein synaptojanin (Ramjaun
and McPherson, 1996 ) and the Pem homeobox gene (Maiti et
al., 1996 ). The alternative splicing of neural cell adhesion molecule
(NCAM) mRNA, which leads to the inclusion of exon 18 in differentiated
N2a neuroblastoma cells and the omission in undifferentiated cells, has
been characterized in detail and shown to depend on the 5 splice site
of the following intron and is controlled presumably by
trans-acting factors (Tacke and Goridis, 1991 ).
Splicing is obviously not the only mode of regulation of the subunit transcript expression; the discrete regional expression of the
subunit transcript within the brain presumably is being controlled
at the level of the promoter. Two tissues, heart and spinal cord,
expressed both the unspliced and the mature mRNA species. The precise
cellular localization of the two mRNAs within these tissues is not
known, but it is possible that the appropriately spliced mature mRNA is
restricted to neuronal cells. GABAergic inhibition via
GABAA receptors is known to be important in the spinal
cord, and indeed several GABAA receptor subunits,
particularly 2, 3, and 2, are known to be expressed in this
tissue (Persohn et al., 1991 ).
FOOTNOTES
Received Feb. 19, 1997; revised April 7, 1997; accepted April 10, 1997.
Correspondence should be addressed to Dr. Paul J. Whiting, Neuroscience
Research Centre, Merck Sharp & Dohme Research Laboratories, Eastwick
Road, Harlow, Essex CM20 2QR, United Kingdom.
REFERENCES
-
Altschul SF,
Gish W,
Miller W,
Myers EW,
Lipman D
(1990)
Basic local alignment search tool.
J Mol Biol
215:403-410[Web of Science][Medline].
-
Blazquez C,
Jegou S,
Feuillololey M,
Rosier A,
Vandesande F,
Vaudry H
(1994)
Visualization of
aminobutyric acid-A receptors on pro-opiomelanocortin-producing neurons in the rat hypothalamus.
Endocrinology
135:2759-2764[Abstract]. -
Bisset GW,
Chowdrey HS,
Fairhall KM,
Gunn LK
(1990)
Central inhibition by gamma-aminobutyric acid and muscimol of the release of vasopressin and oxytocin by an osmotic stimulus in the rat.
Br J Pharmacol
99:529-535[Web of Science][Medline].
-
Chen CA,
Okayama H
(1988)
Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA.
Biotechniques
6:632-638[Web of Science][Medline].
-
Connolly CN,
Wooltorton JRA,
Smart TG,
Moss SJ
(1996)
Subcellular localization of
-aminobutyric acid type A receptors is determined by receptor subunits.
Proc Natl Acad Sci USA
93:9899-9904[Abstract/Free Full Text]. -
Darlison MG,
Albrecht BE
(1995)
GABAA receptors; which, where, and why?
Semin Neurosci
7:115-126.
-
Davies PA,
Hanna MC,
Hales TG,
Kirkness EF
(1997)
Insensitivity to anaesthetic agents conferred by a class of GABAA receptor subunit.
Nature
385:820-823[Medline].
-
Draguhn A,
Verdoorn TA,
Ewert M,
Seeburg PH,
Sakmann B
(1990)
Function and molecular distinction between recombinant rat GABAA receptor subtypes by Zn2+.
Neuron
5:781-788[Web of Science][Medline].
-
Ebert B,
Wafford KA,
Whiting PJ,
Krogsgaard-Larsen P,
Kemp JA
(1994)
Molecular pharmacology of
-aminobutyric acid type A receptor agonists and partial agonists in oocytes injected with different , , and receptor subunit combinations.
Mol Pharmacol
46:957-963[Abstract]. -
Enz R,
Brandstätter JH,
Hartveit E,
Wässle H,
Bormann J
(1995)
Expression of GABA receptor
1 and 2 subunits in the retina and brain of the rat.
Eur J Neurosci
7:1495-1501[Web of Science][Medline]. -
Fenelon VS,
Herbison AE
(1995)
Characterisation of GABAA receptor gamma subunit expression by magnocellular neurones in the rat hypothalamus.
Mol Brain Res
34:45-56[Medline].
-
Fenelon VS,
Sieghart W,
Herbison AE
(1995)
Cellular localisation and differential distribution of GABAA receptor subunit proteins and messenger RNAs within hypothalamic magnocellular neurons.
Neuroscience
64:1129-1143[Web of Science][Medline].
-
Gillies G,
Davidson K
(1992)
GABAergic influences on somatostatin secretion from hypothalamic neurons cultured in defined medium.
Neuroendocrinology
55:248-256[Web of Science][Medline].
-
Glencorse TA,
Bateson A,
Darlison MG
(1990)
Sequence of the chicken GABAA receptor gamma 2-subunit cDNA.
Nucleic Acids Res
18:7155-7157[Free Full Text].
-
Hadingham KL,
Wingrove P,
Le Bourdelles B,
Palmer KJ,
Ragan CI,
Whiting PJ
(1993)
Cloning of cDNA sequences encoding human alpha 2 and alpha 3 gamma-aminobutyric acid-A receptor subunits and characterization of the benzodiazepine pharmacology of recombinant alpha 1-, alpha 2-, alpha 3-, and alpha 5-containing human gamma-aminobutyric acid-A receptors.
Mol Pharmacol
43:970-975[Abstract].
-
Hadingham KL,
Wafford KA,
Palmer K,
Whiting PJ
(1995)
Cloning of cDNAs encoding the human
-aminobutyric acid type A receptor and characterisation of the pharmacology of 3-containing receptors.
Eur J Pharmacol Mol Pharmacol Sect
291:301-309[Web of Science][Medline]. -
Hadingham KL,
Garrett EM,
Wafford KA,
Bain C,
Heavens RP,
Sirinathsinghji DJ,
Whiting PJ
(1996)
Cloning of cDNAs encoding the human
-aminobutyric acid type A receptor 6 subunit and characterisation of the pharmacology of 6-containing receptors.
Mol Pharmacol
49:253-259[Abstract]. -
Harvey RJ,
Kim HC,
Darlison MG
(1993)
Molecular cloning reveals the existence of a fourth gamma subunit of the vertebrate brain GABAA receptor.
FEBS Lett
331:211-216[Web of Science][Medline].
-
Horne AL,
Macaulay AJ,
Harkness PC,
Hadingham K,
Whiting P,
Kemp JA
(1993)
On the effect of the
2L subunit on modulation of responses to GABAA receptor activation.
Br J Pharmacol
108:711-716[Web of Science][Medline]. -
Johnston GAR
(1996)
GABAB receptors: relatively simple transmitter-gated ion channels?
Trends Pharmacol Sci
17:319-323[Medline].
-
Kaupmann K,
Huggel K,
Heid J,
Flor PJ,
Bischoff S,
Mickel SJ,
McMaster G,
Angst C,
Bittiger H,
Froesti W,
Bettler B
(1997)
Expression cloning of GABAB receptors uncovers similarity to metabotropic glutamate receptors.
Nature
386:239-246[Medline].
-
Kirkness EF,
Kusiak JW,
Fleming JT,
Menninger J,
Gocayne JD,
Ward DC,
Venter JC
(1991)
Isolation, characterization, and localization of human genomic DNA encoding the
1 subunit of the GABAA receptor (GABRB1).
Genomics
10:985-995[Web of Science][Medline]. -
Lambert JJ,
Belilli D,
Hill-Venning C,
Peters JA
(1995)
Neurosteroids and GABAA receptor function.
Trends Pharmacol Sci
16:295-303[Medline].
-
Laurie DJ,
Seeburg PH,
Wisden W
(1992)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. II. Olfactory bulb and cerebellum.
J Neurosci
12:1063-1076[Abstract].
-
Lewin B
(1994)
Eukaryotic transcription and RNA processing.
In: Genes, Vol V, pp 845-964. Oxford: Oxford UP.
-
Lüddens H,
Keinanen K,
Monyer H,
Sprengel R,
Seeburg PH
(1990)
Cerebellar GABAA receptor selective for a behavioral alcohol antagonist.
Nature
346:648-651[Medline].
-
Macdonald RL,
Angelotti TP
(1993)
Native and recombinant GABAA receptor channels.
Cell Physiol Biochem
3:352-373.
-
Maiti S,
Doskow J,
Li-S,
Nhim RP,
Lindsey JS,
Wilkinson MF
(1996)
The Pem homeobox gene: androgen-dependent and independent promoters and tissue-specific alternative RNA splicing.
J Biol Chem
271:17536-17546[Abstract/Free Full Text].
-
McKernan RM,
Whiting PJ
(1996)
Which GABAA receptor subtypes really occur in the brain?
Trends Neurosci
19:139-143[Web of Science][Medline].
-
Mitsushima D,
Hei DL,
Terasawa E
(1994)
-Aminobutyric acid is an inhibitory neurotransmitter restricting the release of luteinizing hormone-releasing hormone before the onset of puberty.
Proc Natl Acad Sci USA
91:395-399[Abstract/Free Full Text]. -
Persohn E,
Malherbe P,
Richards JG
(1991)
In situ hybridisation histochemistry reveals a diversity of GABAA receptor mRNAs in neurons of the rat spinal cord and dorsal root ganglia.
Neuroscience
42:497-507[Web of Science][Medline].
-
Pritchett DB,
Sontheimer H,
Shivers BH,
Ymer S,
Kettenmann H,
Schofield PH,
Seeburg PH
(1989)
Importance of a novel GABAA receptor subunit for benzodiazepine pharmacology.
Nature
338:582-585[Medline].
-
Ramjaun AR,
McPherson PS
(1996)
Tissue-specific alternative splicing generates two synaptojanin isoforms with differential membrane-binding properties.
J Biol Chem
271:24856-24861[Abstract/Free Full Text].
-
Sakmann B,
Hamill OP,
Bormann J
(1983)
Patch-clamp measurements of elementary chloride currents activated by the putative inhibitory transmitters GABA and glycine in mammalian spinal neurons.
J Neural Transm [Suppl]
18:83-95[Medline].
-
Saxena NC,
Macdonald RL
(1994)
Assembly of GABAA receptor subunits: role of the
subunit.
J Neurosci
14:7077-7086[Abstract]. -
Saxena NC,
Macdonald RL
(1996)
Properties of putative cerebellar
-aminobutyric acid-A receptor isoforms.
Mol Pharmacol
49:567-579[Abstract]. -
Schofield PR,
Pritchett DB,
Sontheimer H,
Kettenmann H,
Seeburg PH
(1989)
Sequence and expression of human GABAA receptor
1 and 1 subunits.
FEBS Lett
244:361-364[Web of Science][Medline]. -
Sieghart W
(1995)
Structure and pharmacology of
-aminobutyric acid-A receptor subtypes.
Pharmacol Rev
47:181-234[Web of Science][Medline]. -
Sirinathsinghji DJS,
Dunnett S
(1993)
Imaging gene expression in neural graft.
In: Molecular imaging in neuroscience: a practical approach (Sharif NA,
ed), pp 43-70. Oxford: Oxford UP.
-
Smart TG,
Constanti A
(1990)
Studies on the mechanism of action of picrotoxinin and other convulsants at the crustacean muscle GABA receptor.
Br J Pharmacol
99:643-654[Web of Science][Medline].
-
Smart TG,
Moss SJ,
Xie X,
Huganir RL
(1991)
GABAA receptors are differentially sensitive to zinc dependence on subunit composition.
Br J Pharmacol
103:1837-1839[Web of Science][Medline].
-
Sommer B,
Poustka A,
Spurr NK,
Seeburg PH
(1990)
The murine GABAA receptor
-subunit gene: structure and assignment to human chromosome 1.
DNA Cell Biol
9:561-568[Web of Science][Medline]. -
Sommer B,
Kohler M,
Sprengel R,
Seeburg PH
(1991)
RNA editing in brain controls a determinant of ion flow in glutamate-gated channels.
Cell
67:11-19[Web of Science][Medline].
-
Stephenson FA,
Duggan MJ,
Pollard S
(1990)
The
2 subunit is an integral component of the -aminobutyric acid-A receptor, but the 1 polypeptide is the principal site of the agonist benzodiazepine photoaffinity-labeling reaction.
J Biol Chem
265:21160-21165[Abstract/Free Full Text]. -
Tacke R,
Goridis C
(1991)
Alternative splicing in the neural cell adhesion molecule pre mRNA: regulation of exon 18 skipping depends upon the 5
splice site.
Genes Dev
5:1416-1429[Abstract/Free Full Text]. -
Thompson SA,
Whiting PJ,
Wafford KA
(1996)
Alpha subunits influence the action of pentobarbital on recombinant GABAA receptors.
Br J Pharmacol
117:521-527[Web of Science][Medline].
-
Thompson SA,
Thomas D,
Whiting PJ,
Wafford KA
(1997)
Expression and pharmacology of the human GABAA receptor
subunit.
Br J Pharmacol
120:283P. -
Verdoorn T
(1994)
Formation of heteromeric
-aminobutyric acid type A receptors containing two different subunits.
Mol Pharmacol
45:475-480[Abstract]. -
von Heijne G
(1986)
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res
14:4683-4690[Abstract/Free Full Text].
-
Whiting P,
McKernan RM,
Iversen LL
(1990)
Another mechanism for creating diversity in
-aminobutyrate type A receptors: RNA splicing directs expression of two forms of the 2 subunit, one of which contains a protein kinase C phosphorylation site.
Proc Natl Acad Sci USA
87:9966-9970[Abstract/Free Full Text]. -
Whiting PJ,
McKernan RM,
Wafford KA
(1995)
Structure and pharmacology of vertebrate GABAA receptor subtypes.
Int Rev Neurobiol
38:95-138[Web of Science][Medline].
-
Wisden W,
Laurie DJ,
Monyer HM,
Seeburg PH
(1992)
The distribution of 13 GABAA receptor subunit mRNAs in rat brain. I. Telencephalon, diencephalon, mesencephalon.
J Neurosci
12:1040-1062[Abstract].
-
Ymer S,
Draguhn A,
Wisden W,
Werner P,
Keinanen K,
Schofield PR,
Sprengel R,
Pritchett DB,
Seeburg PH
(1990)
Structural and functional characterisation of the
1 subunit of GABA benzodiazepine receptors.
EMBO J
9:3261-3267[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
K. J. Gingrich, P. M. Burkat, and W. A. Roberts
Pentobarbital Produces Activation and Block of {alpha}1{beta}2{gamma}2S GABAA Receptors in Rapidly Perfused Whole Cells and Membrane Patches: Divergent Results Can Be Explained by Pharmacokinetics
J. Gen. Physiol.,
February 1, 2009;
133(2):
171 - 188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. Olsen and W. Sieghart
International Union of Pharmacology. LXX. Subtypes of {gamma}-Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Composition, Pharmacology, and Function. Update
Pharmacol. Rev.,
September 1, 2008;
60(3):
243 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Sarang, S. M. Lukyanova, D. D. Brown, B. S. Cummings, S. R. Gullans, and R. G. Schnellmann
Identification, Coassembly, and Activity of {gamma}-Aminobutyric Acid Receptor Subunits in Renal Proximal Tubular Cells
J. Pharmacol. Exp. Ther.,
January 1, 2008;
324(1):
376 - 382.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Yi and M. D. Ehlers
Emerging Roles for Ubiquitin and Protein Degradation in Neuronal Function
Pharmacol. Rev.,
March 1, 2007;
59(1):
14 - 39.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Jones, P. J. Whiting, and L. P. Henderson
Mechanisms of anabolic androgenic steroid inhibition of mammalian {varepsilon}-subunit-containing GABAA receptors
J. Physiol.,
June 15, 2006;
573(3):
571 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Wagner, M. P. Goldschen-Ohm, T. G. Hales, and M. V. Jones
Kinetics and Spontaneous Open Probability Conferred by the {epsilon} Subunit of the GABAA Receptor
J. Neurosci.,
November 9, 2005;
25(45):
10462 - 10468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. A. Sergeeva, N. Andreeva, M. Garret, A. Scherer, and H. L. Haas
Pharmacological Properties of GABAA Receptors in Rat Hypothalamic Neurons Expressing the {epsilon}-Subunit
J. Neurosci.,
January 5, 2005;
25(1):
88 - 95.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Simon, H. Wakimoto, N. Fujita, M. Lalande, and E. A. Barnard
Analysis of the Set of GABAA Receptor Genes in the Human Genome
J. Biol. Chem.,
October 1, 2004;
279(40):
41422 - 41435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Minier and E. Sigel
Positioning of the {alpha}-subunit isoforms confers a functional signature to {gamma}-aminobutyric acid type A receptors
PNAS,
May 18, 2004;
101(20):
7769 - 7774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Jin, D. Walther, J. Zhang, C. Rowe-Teeter, and G. K. Fu
Serine 171, a Conserved Residue in the {gamma}-Aminobutyric Acid Type A (GABAA) Receptor {gamma}2 Subunit, Mediates Subunit Interaction and Cell Surface Localization
J. Biol. Chem.,
April 2, 2004;
279(14):
14179 - 14183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Berezhnoy, Y. Nyfeler, A. Gonthier, H. Schwob, M. Goeldner, and E. Sigel
On the Benzodiazepine Binding Pocket in GABAA Receptors
J. Biol. Chem.,
January 30, 2004;
279(5):
3160 - 3168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Jin, J. Zhang, C. Rowe-Teeter, J. Yang, L. L. Stuve, and G. K. Fu
Cloning and Characterization of a GABAA Receptor {gamma}2 Subunit Variant
J. Biol. Chem.,
January 9, 2004;
279(2):
1408 - 1414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Baumann, R. Baur, and E. Sigel
Individual Properties of the Two Functional Agonist Sites in GABAA Receptors
J. Neurosci.,
December 3, 2003;
23(35):
11158 - 11166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Baumann, R. Baur, and E. Sigel
Forced Subunit Assembly in alpha 1beta 2gamma 2 GABAA Receptors. INSIGHT INTO THE ABSOLUTE ARRANGEMENT
J. Biol. Chem.,
November 22, 2002;
277(48):
46020 - 46025.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Iwama and T. Gojobori
Identification of Neurotransmitter Receptor Genes Under Significantly Relaxed Selective Constraint by Orthologous Gene Comparisons Between Humans and Rodents
Mol. Biol. Evol.,
November 1, 2002;
19(11):
1891 - 1901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.-Q. Huang and G. H. Dillon
Functional Characterization of GABAA Receptors in Neonatal Hypothalamic Brain Slice
J Neurophysiol,
October 1, 2002;
88(4):
1655 - 1663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-A. Thompson, P. B. Wingrove, L. Connelly, P. J. Whiting, and K. A. Wafford
Tracazolate Reveals a Novel Type of Allosteric Interaction with Recombinant gamma -Aminobutyric AcidA Receptors
Mol. Pharmacol.,
April 1, 2002;
61(4):
861 - 869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A Davies, E. F Kirkness, and T. G Hales
Evidence for the formation of functionally distinct {alpha}{beta}{gamma}{varepsilon} GABAA receptors
J. Physiol.,
November 15, 2001;
537(1):
101 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kasparov, K. A Davies, U. A Patel, P. Boscan, M. Garret, and J. F R Paton
GABAA receptor {varepsilon}-subunit may confer benzodiazepine insensitivity to the caudal aspect of the nucleus tractus solitarii of the rat
J. Physiol.,
November 1, 2001;
536(3):
785 - 796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chang, Y. Xie, and D. S Weiss
Positive allosteric modulation by ultraviolet irradiation on GABAA, but not GABAC, receptors expressed in Xenopus oocytes
J. Physiol.,
October 15, 2001;
536(2):
471 - 478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Baufreton, M. Garret, S. Dovero, B. Dufy, B. Bioulac, and A. Taupignon
Activation of GABAA Receptors in Subthalamic Neurons In Vitro: Properties of Native Receptors and Inhibition Mechanisms
J Neurophysiol,
July 1, 2001;
86(1):
75 - 85.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. SARANG, M. D. PLOTKIN, S. R. GULLANS, B. S. CUMMINGS, D. F. GRANT, and R. G. SCHNELLMANN
Identification of the {{gamma}}-Aminobutyric Acid Receptor {beta}2 and {beta}3 Subunits in Rat, Rabbit, and Human Kidneys
J. Am. Soc. Nephrol.,
June 1, 2001;
12(6):
1107 - 1113.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Nagaya and R. L Macdonald
Two {gamma}2L subunit domains confer low Zn2+ sensitivity to ternary GABAA receptors
J. Physiol.,
April 1, 2001;
532(1):
17 - 30.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Erlitzki, Y. Gong, M. Zhang, and G. Minuk
Identification of gamma -aminobutyric acid receptor subunit types in human and rat liver
Am J Physiol Gastrointest Liver Physiol,
October 1, 2000;
279(4):
G733 - G739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Jorge-Rivera, K. L. McIntyre, and L. P. Henderson
Anabolic Steroids Induce Region- and Subunit-Specific Rapid Modulation of GABAA Receptor-Mediated Currents in the Rat Forebrain
J Neurophysiol,
June 1, 2000;
83(6):
3299 - 3309.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Sinkkonen, M. C. Hanna, E. F. Kirkness, and E. R. Korpi
GABAA Receptor epsilon and theta Subunits Display Unusual Structural Variation between Species and Are Enriched in the Rat Locus Ceruleus
J. Neurosci.,
May 15, 2000;
20(10):
3588 - 3595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Baer, C. Essrich, J. A. Benson, D. Benke, H. Bluethmann, J.-M. Fritschy, and B. Luscher
Postsynaptic clustering of gamma -aminobutyric acid type A receptors by the gamma 3 subunit in vivo
PNAS,
October 26, 1999;
96(22):
12860 - 12865.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Brooks-Kayal, M. D. Shumate, H. Jin, D. D. Lin, T. Y. Rikhter, K. L. Holloway, and D. A. Coulter
Human Neuronal gamma -Aminobutyric AcidA Receptors: Coordinated Subunit mRNA Expression and Functional Correlates in Individual Dentate Granule Cells
J. Neurosci.,
October 1, 1999;
19(19):
8312 - 8318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Srinivasan, C. J. Nichols, G. M. Lawless, R. W. Olsen, and A. J. Tobin
Two Invariant Tryptophans on the alpha 1 Subunit Define Domains Necessary for GABAA Receptor Assembly
J. Biol. Chem.,
September 17, 1999;
274(38):
26633 - 26638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Neelands and R. L. Macdonald
Incorporation of the pi Subunit into Functional gamma -Aminobutyric AcidA Receptors
Mol. Pharmacol.,
September 1, 1999;
56(3):
598 - 610.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. P. Bonnert, R. M. McKernan, S. Farrar, B. le Bourdelles, R. P. Heavens, D. W. Smith, L. Hewson, M. R. Rigby, D. J. S. Sirinathsinghji, N. Brown, et al.
theta , a novel gamma -aminobutyric acid type A receptor subunit
PNAS,
August 17, 1999;
96(17):
9891 - 9896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. F. Owens, X. Liu, and A. R. Kriegstein
Changing Properties of GABAA Receptor-Mediated Signaling During Early Neocortical Development
J Neurophysiol,
August 1, 1999;
82(2):
570 - 583.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Y. Valeyev, J. C. Hackman, A. M. Holohean, P. M. Wood, J. L. Katz, and R. A. Davidoff
GABA-Induced Cl- Current in Cultured Embryonic Human Dorsal Root Ganglion Neurons
J Neurophysiol,
July 1, 1999;
82(1):
1 - 9.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A Guyon, S Laurent, D Paupardin-Tritsch, J Rossier, and D Eugene
Incremental conductance levels of GABAA receptors in dopaminergic neurones of the rat substantia nigra pars compacta
J. Physiol.,
May 1, 1999;
516(3):
719 - 737.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A B Brussaard, P Devay, J L Leyting-Vermeulen, and K. S Kits
Changes in properties and neurosteroid regulation of GABAergic synapses in the supraoptic nucleus during the mammalian female reproductive cycle
J. Physiol.,
April 15, 1999;
516(2):
513 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kapur and R. L. Macdonald
Postnatal Development of Hippocampal Dentate Granule Cell gamma -Aminobutyric AcidA Receptor Pharmacological Properties
Mol. Pharmacol.,
March 1, 1999;
55(3):
444 - 452.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Penton-Rol, S. Orlando, N. Polentarutti, S. Bernasconi, M. Muzio, M. Introna, and A. Mantovani
Bacterial Lipopolysaccharide Causes Rapid Shedding, Followed by Inhibition of mRNA Expression, of the IL-1 Type II Receptor, with Concomitant Up-Regulation of the Type I Receptor and Induction of Incompletely Spliced Transcripts
J. Immunol.,
March 1, 1999;
162(5):
2931 - 2938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pistis, D. Belelli, K. McGurk, J. A Peters, and J. J Lambert
Complementary regulation of anaesthetic activation of human ({alpha}6{beta}3{gamma}2L) and Drosophila (RDL) GABA receptors by a single amino acid residue
J. Physiol.,
February 15, 1999;
515(1):
3 - 18.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Nett, J. C. Jorge-Rivera, M. Myers, A. S. Clark, and L. P. Henderson
Properties and Sex-Specific Differences of GABAA Receptors in Neurons Expressing gamma 1 Subunit mRNA in the Preoptic Area of the Rat
J Neurophysiol,
January 1, 1999;
81(1):
192 - 203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Neelands, J. L. Fisher, M. Bianchi, and R. L. Macdonald
Spontaneous and gamma -Aminobutyric Acid (GABA)-Activated GABAA Receptor Channels Formed by epsilon Subunit-Containing Isoforms
Mol. Pharmacol.,
January 1, 1999;
55(1):
168 - 178.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Sur, K. Quirk, D. Dewar, J. Atack, and R. McKernan
Rat and Human Hippocampal alpha 5 Subunit-Containing gamma -Aminobutyric AcidA Receptors Have alpha 5beta 3gamma 2 Pharmacological Characteristics
Mol. Pharmacol.,
November 1, 1998;
54(5):
928 - 933.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Defazio and J. J. Hablitz
Zinc and Zolpidem Modulate mIPSCs in Rat Neocortical Pyramidal Neurons
J Neurophysiol,
October 1, 1998;
80(4):
1670 - 1677.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Barnard, P. Skolnick, R. W. Olsen, H. Mohler, W. Sieghart, G. Biggio, C. Braestrup, A. N. Bateson, and S. Z. Langer
International Union of Pharmacology. XV. Subtypes of gamma -Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Structure and Receptor Function
Pharmacol. Rev.,
June 1, 1998;
50(2):
291 - 314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Fisher and R. L. Macdonald
The Role of an alpha Subtype M2-M3 His in Regulating Inhibition of GABAA Receptor Current by Zinc and Other Divalent Cations
J. Neurosci.,
April 15, 1998;
18(8):
2944 - 2953.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ebert, S. A. Thompson, K. Saounatsou, R. McKernan, P. Krogsgaard-Larsen, and K. A. Wafford
Differences in Agonist/Antagonist Binding Affinity and Receptor Transduction Using Recombinant Human gamma -Aminobutyric Acid Type A Receptors
Mol. Pharmacol.,
December 1, 1997;
52(6):
1150 - 1156.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. B. Wingrove, S. A. Thompson, K. A. Wafford, and P. J. Whiting
Key Amino Acids in the gamma Subunit of the gamma -Aminobutyric AcidA Receptor that Determine Ligand Binding and Modulation at the Benzodiazepine Site
Mol. Pharmacol.,
November 1, 1997;
52(5):
874 - 881.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. W. Baumann, R. Baur, and E. Sigel
Subunit Arrangement of gamma -Aminobutyric Acid Type A Receptors
J. Biol. Chem.,
September 21, 2001;
276(39):
36275 - 36280.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|