 |
Previous Article | Next Article 
Volume 17, Number 13,
Issue of July 1, 1997
pp. 5070-5079
Copyright ©1997 Society for Neuroscience
A Family of Delayed Rectifier Kv1 cDNAs Showing
Cell Type-Specific Expression in the Squid Stellate
Ganglion/Giant Fiber Lobe Complex
Joshua J. C. Rosenthal,
Taylor I. Liu, and
William F. Gilly
Hopkins Marine Station, Department of Biological Sciences, Stanford
University, Pacific Grove, California 93950
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Squid giant axons are formed by giant fiber lobe (GFL) neurons of
the stellate ganglion (SG). Other large motoneurons in the SG form a
parallel system. A small family of cDNAs (SqKv1A-D) encoding Kv1
-subunits was identified in a squid (Loligo
opalescens) SG/GFL library. Members have distinct 5
untranslated regions (UTRs) and initial coding regions, but beyond a
certain point (nucleotide 34 of SqKv1A) only nine differences exist. 3
UTRs are identical. Predicted -subunits are nearly identical, and only the N termini differ significantly, primarily in length. RNase
protection assays that use RNA isolated from specific SG regions show
that SqKv1A mRNA is expressed prominently in the GFL but not in the SG
proper. SqKv1B yields the opposite pattern. SqKv1D also is expressed
only in the SG. SqKv1C expression was not detectable. In
situ hybridizations confirm these results and reveal that
SqKv1B mRNA is abundant in many large neurons of the SG, whereas SqKv1D
expression is limited to small isolated clusters of neurons. SqKv1A and
B are thus the predominant Kv1 mRNAs in the SG/GFL complex. Activation
properties of SqKv1A and B channels expressed in oocytes are very
similar to one another and compare favorably with properties of native
delayed rectifier channels in GFL neurons and large SG neurons. The Kv1
complement in these squid neurons thus seems to be relatively simple.
Several differences exist between cloned and native channels, however,
and may reflect differences in the cellular environments of oocytes and
neurons.
Key words:
squid giant axon;
cloning;
Kv1 genes;
potassium channels;
expression;
alternative splicing
INTRODUCTION
Squid giant axons are nonmyelinated motor fibers,
up to 500 µm or more in diameter, that innervate circular muscle
fibers of the mantle, and a single axonal action potential excites the entire motor field in an all-or-none manner (Young, 1938 ). These axons
are formed by fusion of hundreds of very small axons, only several
micrometers in diameter, originating from monotypic giant fiber lobe
(GFL) neurons localized to the posterior tip of the stellate ganglion
(SG) (Young, 1939 ). A second, less well characterized motor system
consists of "ordinary" small diameter axons (Prosser and Young,
1937 ) that arise from large cell bodies, up to 100 µm in diameter, in
the SG proper (Young, 1972 ). Repetitive activity in this small axon
system produces graded excitation of circular muscle fibers (Wilson,
1960 ; Gilly et al., 1996 ), and during escape jetting the giant and
small axon systems are recruited in concert (Otis and Gilly, 1990 ).
A major focus of research on the giant axon system has been the Na and
K channels underlying action potential transmission, and recent
physiological and molecular approaches have converged on the delayed
rectifier K conductance (gK). A K
channel with a unitary conductance of 20 pS makes up the delayed
rectifier gK in both cell bodies (Llano and
Bookman, 1986 ; Nealey et al., 1993 ) and giant axons (Perozo et al.,
1991 ), and a cDNA, SqKv1A, has been postulated to correspond to the
mRNA encoding this channel (Rosenthal et al., 1996 ). Other K channel
types exist in giant axons (Llano et al., 1988 ) and GFL cell bodies
(Nealey et al., 1993 ), but they contribute a comparatively minor
fraction of macroscopic gK.
In the course of characterizing SqKv1A expression, in situ
hybridizations suggested that, within the SG, mRNA for this channel was
expressed selectively in GFL neurons. This degree of specificity seemed
surprising, because the proposed functional role for this channel in
action potential transmission could hardly be specific to the giant
axon. If SqKv1A mRNA encodes delayed rectifier K channels for the giant
axon system, what kind of K channels are present in the axons and cell
bodies of the functionally similar small motor axon system?
This paper describes four closely related mRNAs, at least three of
which are expressed in neurons of the SG/GFL complex. All four cDNAs
encode Kv1 channels with predicted structures nearly identical to that
of SqKv1A. Only SqKv1A, however, appears to be expressed in GFL
neurons. One of the new mRNAs, SqKv1B, is expressed widely in cell
bodies distributed in the SG proper, including the largest cells that
constitute the somata of the small axon motor system. Functional
properties of native gK in GFL neurons and large
SG neurons are generally comparable to one another and to properties of
SqKv1A and B expressed in oocytes.
MATERIALS AND METHODS
Library screening. Screening of a SG/GFL cDNA library
( -UNI-ZAP XR; Rosenthal and Gilly, 1993 ) was performed as described elsewhere (Rosenthal et al., 1996 ). Briefly, degenerate primers NEYFFD
and FWWAVV were used to amplify an 858 base pair (bp) fragment of a Kv1
cDNA (pSKC1; see Fig. 1) from GFL mRNA by PCR. 32P-labeled,
random-primed probe (Sambrook et al., 1989 ) was made from pSKC1
template and used to screen ~106 plaques.
Fig. 1.
Structure of the SqKv1 cDNAs. A,
Schematic of SqKv1A coding and UTRs (open and
solid segments, respectively) showing the locations of
oligonucleotides used in this study (see Table 1) and of the probe
(pSKC1; Rosenthal et al., 1996 ) used to screen
the cDNA library. Cross-hatched segments represent
transmembrane regions S1-S6. The restriction sites
indicated are discussed in Materials and Methods and Results.
B, Nucleotide sequences of SqKv1A-D cDNAs. Numbering pertains to SqKv1A. Identities to SqKv1A are
indicated by dashes. Start codons
(boldface and underlined) were assigned as the first Met codon that yielded the longest open reading frame. Stop codons are boxed. The four nucleotide sequences
become virtually identical downstream from position 35 of SqKv1A. The
locations of the NdeI and EagI sites
discussed in Materials and Methods and Results are indicated for
SqKv1A. The complete 5 UTR sequence is given for
SqKv1D; the others have been truncated arbitrarily. Complete sequences will be deposited in GenBank on acceptance of this
manuscript.
[View Larger Version of this Image (63K GIF file)]
Size selection of positive plaques. DNA fragments encoding
5 ends of Kv1-type channels were amplified from individual positive plaques by PCR, using the T3/SKC4 primer pair. Each reaction contained 5 µl of boiled supernatant from the plaque stock [cored primary plaque in sodium-magnesium (SM) buffer (100 mM NaCl, 8 mM MgCl2, 50 mM Tris, pH
7.5, and 0.01% gelatin)], 5 µl of 10× Taq polymerase buffer (100 mM Tris, pH 8.3, 12.5 mM
MgCl2, 500 mM KCl, and 0.1% of both
NP-40 and Triton X-100) containing 1 µM of each primer and 1 U of Taq polymerase. Reactions were performed in a DNA
thermocycler (Perkin-Elmer, Branchurg, NJ) and consisted of 30 cycles
of denaturation (30 sec, 92°C) and elongation (120 sec, 72°C).
Annealing (60 sec per cycle) was at 60°C for the first five cycles
and at 50°C thereafter.
Sizes of PCR products were checked on 1% agarose gels, and only
plaques yielding PCR products >600 bp were analyzed further. These
gels were dried and used as a matrix for hybridization with 32P end-labeled oligonucleotides SKC8 and SKC7 in 6× SSC
(150 mM NaCl and 15 mM Na-citrate, pH 7) plus
250 µg/ml sonicated calf thymus DNA. Gels were hybridized with 3 × 106 cpm probe/ml at 55°C for 16 hr, washed in
6× SSC and 0.1% SDS for 3× 30 min at 58°C, dried again, and
exposed to x-ray film.
DNA sequencing. Plasmids containing clones of interest were
excised in vivo (Rosenthal and Gilly, 1993 ). Sequencing of
SqKv1A is described elsewhere (Rosenthal et al., 1996 ). SqKv1B also was sequenced in both directions by constructing nested deletions. SqKv1C
and D were sequenced by using primers derived from SqKv1A and B
sequence. PCR products were sequenced directly by unidirectional PCR
with 33P-ATP end-labeled primers, using the fMol system
(Promega, Madison, WI). All differences among SqKv1A-D described here
were verified by conventional dideoxy sequencing of the 5 untranslated
region (UTR) and coding regions of randomly selected representative
clones of each type.
Tissue preparation and RNA isolation. Loligo
opalescens was collected from Monterey Bay, CA. Squid were
decapitated, and complete SG/GFLs (i.e., SG with GFL attached) were
removed immediately and dissected into three pieces consisting of GFL
tissue, the anterior portion of the SG proper (simply referred to as
SG), and the zone between these regions. This provided highly enriched samples of GFL neurons and SG neurons used for RNA extraction and a
mixed population that was discarded. Tissue samples were frozen in
liquid nitrogen and processed for RNA extraction (Rosenthal and Gilly,
1993 ).
RNase protection assays. So that templates for SqKv1A-D
probe synthesis could be created, full-length cDNAs (cloned into the EcoRI and XhoI sites of pBluescript
SK ) were digested with XhoI and
NdeI, blunt termini were created with Klenow fragment, and
the plasmids were recircularized with T4 DNA ligase. For in
vitro transcription of cRNA probes, the SqKv1A-derived plasmid was
linearized with EagI in the 5 UTR (see Fig. 1), and
SqKv1B-D were linearized with BamHI in the 5 polylinker.
Because the 57 nucleotides (nt) upstream from the NdeI site
(nt 101 in SqKv1A, 68 in SqKv1B, and 2 in SqKv1D) are identical in
SqKv1A-D, it was hoped that protection of this region by nonhomologous
probes could serve as an internal control in these experiments.
Protection of this fragment proved to be variable, however, for unknown
reasons.
32P-labeled cRNA probes were synthesized with T7 RNA
polymerase (Riboprobe kit, Promega) and used for RNase protection
assays as previously described (Rosenthal and Gilly, 1993 ; Rosenthal et
al., 1996 ). Briefly, 5 µg aliquots of GFL or SG total RNA were hybridized with 106 cpm of probe for 16 hr at
48°C. Each probe also was hybridized with 10 µg of tRNA as a
control, and 103 cpm of nondigested probe provided a
size marker.
In situ hybridizations. Complete SG/GFLs were fixed in
cold paraformaldehyde, processed, and frozen as previously described (Liu and Gilly, 1995 ). Frozen sections (12-15 µm) were cut
longitudinally in the plane parallel to the dorsal surface of the
mantle, melted onto silane-coated slides (Polysciences, Warrington,
PA), and stained with cresyl violet. Slides were washed, dehydrated in graded ethanol, and desiccated before use in hybridizations.
Probe templates specific for SqKv1A-D, used to synthesize
35S-labeled antisense cRNA, were constructed by PCR
amplification of unique regions of the 5 end of each cDNA with the
following sense/antisense primers (Table 1): SK30/SKC31
for SqKv1A, T3/SKC32 for SqKv1B, T3/SKC33 for SqKv1C, and T3/SKC34 for
SqKv1D. Products were subcloned into pBluescript
SK . These probes differ from those used for RNase
protection assays in that they contain no sequence shared by the four
SqKv1 cDNAs. A 35S-labeled sense cRNA probe to control for
nonspecific hybridization was transcribed with T3 RNA polymerase from a
squid Na channel template (pNC5 ; Rosenthal and Gilly, 1993 ). All
probes were used at a final working concentration of 5 × 106 cpm/ml. Protocols for probe synthesis and
in situ hybridization are described elsewhere (Simmons et
al., 1989 ; Liu and Gilly, 1995 ).
Table 1.
Oligonucleotides used for PCR amplifications, sequencing,
Southern blots, and cloning procedures
| Name |
Sequence |
Location |
Orientation
|
|
| T3 |
AATTAACCCTCACTAAAGGG |
pBluescript |
Sense
|
| T7 |
AATACGACTCACTATAG |
pBluescript |
Antisense
|
| SKC4 |
GTGCCAAATTTTGGCATGG |
629 647 of SqKv1A |
Antisense
|
| SKC7 |
AGCGACGTGTATGGCTCTTG |
458 478 of SqKv1A |
Sense
|
| SKC8 |
CAACGTGATGTTTAGAAAAG |
7 13 of SqKv1A |
Sense
|
| SKC9 |
ACTAGGACGATTCCCATC |
256 273 of SqKv1A |
Antisense
|
| SKC14 |
TCTGT AATCTTGCCTCCTAC |
212 186 of
SqKv1C |
Sense
|
| SKC16 |
CATA CTCAGACATCGGTTTGC |
1452 1469 of
SqKv1A |
Antisense
|
| SKC20 |
GCAA GAT TTCT CCATGTCTCTTGAC |
16 11
of SqKv1B-pBSTA |
Sense
|
| SKC21 |
TTTAAACTCTCGCGCCATTCC |
895 915 of SqKv1A |
Sense
|
| SKC22 |
TGTGGCAGAAGAGACTGTTG |
1273 1293 of SqKv1A |
Antisense
|
| SKC30 |
TCAGGGATCCCAATGGCAATTACGTTG |
155 139 of
SqKv1A |
Sense |
| SKC31 |
GCCGAAGCTTCTAAACATCACGTTGTTCC |
11 10
of SqKv1A |
Antisense
|
| SKC32 |
TCCGAAGCTTTGGGAGAATATCCTTGCG |
17 3 of
SqKv1B |
Antisense
|
| SKC33 |
TATCAAGCTTCATTTCCGGCCTGGAGGTC |
16 3 of
SqKv1C |
Antisense
|
| SKC34 |
TCCGAAGCTTTCGTCAGACTCCCTTAGTG |
26 7 of
SqKv1D |
Antisense |
|
|
Oligonucleotides used for PCR amplifications, sequencing,
Southern blots, and cloning procedures as indicated in the text are
identified by name, nucleotide sequence, and location of correspondence to the vector or cDNA insert. Nucleotide changes from wild-type sequences are underlined in SKC14, 16, and 20.
|
|
Constructs for functional expression. A plasmid for
synthesis of full-length SqKv1A cRNA (SqKv1A-pBSTA) was constructed
with the pBSTA vector (previously called Chi 7; Rosenthal et
al., 1996 ) that contains 5 and 3 Xenopus -globin UTR.
An analogous SqKv1B-pBSTA construct was created as follows.
BglII sites were introduced adjacent to the start and stop
codons of SqKv1B by PCR amplification of the complete coding region by
using primers SKC20 and SKC16 (Table 1). SKC20 contains a consensus
translation initiation sequence (Kozak, 1989 ), and incorporation of
this feature resulted in changing the second amino acid of SqKv1B from
the wild-type Ser to Ala. To avoid errors introduced by Taq
DNA polymerase, we replaced the NdeI-SpeI
fragment of SqKv1B-pBSTA (nt 68-1113; see Fig. 1), containing most of
the SqKv1B coding region, with the same region from the original SqKv1B
cDNA. Regions upstream of the NdeI site and downstream of
the SpeI site were resequenced.
Oocyte preparation and patch-clamp recording. Stage IV
Xenopus oocytes were treated with 1.5 mg/ml collagenase Type
IA (Boehringer Mannheim, Indianapolis, IN) in Ca-free saline containing
(in mM): 82 NaCl, 2 KCl, 1 MgCl2, and 5 HEPES, pH 7.6, before injection with ~10 ng of cRNA synthesized from
5 µg of SqKv1A- and SqKv1B-pBSTA plasmid (linearized with
NotI) using a kit (Message Machine version 9055, Ambion,
Austin, TX). Injected oocytes were incubated in ND96 medium containing
(in mM): 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES plus penicillin
(104 U/ml), streptomycin (10 mg/ml),
and 2.5 mM Na-pyruvate at 17°C for 2-4 d. Immediately
before recordings were made, an oocyte was bathed in a hypertonic
solution containing (in mM): 200 NMG-aspartate, 20 KCl, 10 EGTA, 1 MgCl2, and 10 HEPES, pH 7.4, for 5-10 min, and the vitelline membrane was removed manually.
Cell-attached patch recordings were made at ~18°C. Pipettes (1-2
M ) were filled with (in mM): 118-90 NaCl, 2-30 KCl, 6 MgCl2, and 5-10 HEPES, pH 7.2. NaCl was replaced
with KCl on an equimolar basis for the bath solution. The voltage-clamp
and data acquisition system were conventional (Rosenthal et al., 1996 ).
Signals were filtered at 5 or 0.5 kHz with an 8-pole Bessel filter
before sampling at 20-50 or 2 kHz, respectively.
Recordings from squid neurons. Complete SG/GFLs were
dissected as described above into GFL and SG portions, which then were treated with nonspecific protease (7 mg/ml Type XIV, Sigma, St. Louis,
MO) for 50 min (room temperature) to isolate cell bodies for short-term
culture (Gilly et al., 1990 ). Cell-attached patch recordings were
performed at ~18°C within 1-2 d of isolation. The bath solution
contained (in mM): 115 NaCl, 385 KCl, 10 MgCl2, 10 CaCl2, and 10 HEPES, pH
7.5 (980 mOsm). Pipettes were filled with (in mM): 400 NaCl, 100 KCl, 10 MgCl2, 10 CaCl2, 10 HEPES, and 0.0005 TTX, pH 7.5 (980 mOsm).
Conventional whole-cell recordings were performed on dissociated GFL
neurons as described in detail elsewhere (Mathes et al., 1997 ). The
external solution, designed to approximate the ionic strength and
composition of the pipette solution for oocyte recordings, contained
(in mM): 75 NaCl, 20 KCl, 20 MgCl2, 5 CaCl2, 10 HEPES, and 0.003 TTX, pH 7.5, plus sucrose
to attain 980 mOsm. The internal (pipette) solution for whole-cell
recordings was also of low ionic strength and contained (in
mM): 25 KF, 25 KCl, 50 K-glutamate, 10 K2-EGTA,
pH 7.4, and sucrose to attain 980 mOsm.
RESULTS
Identification of squid Kv1 cDNAs
Our initial screen of the SG/GFL cDNA library used a probe derived
from a partial squid Kv1 cDNA that was isolated by PCR from GFL mRNA
(pSKC1; Rosenthal et al., 1996 ). Sixty-nine positive clones were
identified, and the corresponding cored phage plaques were tested with
PCR by using a sense primer to the cloning vector (T3, Table 1) and an
antisense primer specific to sequence encoding the intracellular linker
between transmembrane segments S1 and S2 of SqKv1A (SKC4, Fig.
1A, Table 1). Eleven of these
reactions failed to amplify, and PCR analysis with primers T3 and T7
revealed that the inserts were significantly smaller than the
full-length coding region of a typical Kv1 cDNA. These clones were not
analyzed further. Of the 58 successfully amplified products, 30 were 600 bp in size and therefore probably sufficiently large
to include the complete N-terminal coding region. The clone yielding
the largest PCR product contained SqKv1A, a full-length cDNA encoding a
squid Kv1 channel (Rosenthal et al., 1996 ). The remaining 29 clones
were analyzed as described below.
A family of SG/GFL Kv1 cDNAs based on 5 diversity
N termini of Kv1 -subunits, even closely related ones in the
same species, are highly divergent. This can be attributable to
alternative mRNA splicing, as occurs with the Shaker locus in Drosophila (see also Discussion; Papazian et al., 1987 ),
or to the existence of different genes, as seen in mammalian RCK1-5 [Stuhmer et al. (1989) ; see also Jegla et al. (1995) ]. We therefore analyzed N-terminal diversity in our 30 potentially full-length Kv1
cDNAs. An oligonucleotide probe spanning the assigned translation start
site of SqKv1A (SKC8; Fig. 1A, Table 1) was
hybridized under stringent conditions to a Southern blot of the PCR
products encoding the 5 ends of these 30 clones. Only 19 samples
yielded positive hybridization signals, whereas hybridization with
another oligonucleotide (SKC7, Fig. 1A, Table 1) that
encodes a region of SqKv1A highly conserved among all Kv1 channels
(Drewe et al., 1990; Li et al., 1992 ) occurred with all 30. Direct
sequencing of the 19 SKC8-positive PCR products that used T3 and SKC9
primers (Fig. 1A, Table 1) established that these
cDNAs were identical to SqKv1A in this region.
Sequencing of the 11 PCR products that failed to hybridize to SKC8
revealed three additional species of Kv1 cDNAs. The nomenclature of
these cDNAs and their frequency of occurrence in the described set of
30 clones are SqKv1A (n = 19), SqKv1B
(n = 9), SqKv1C (n = 1), and SqKv1D
(n = 1). A representative of each type was sequenced to
completion, and nucleotide sequences for SqKv1A-D are given in Figure
1B. Each squid Kv1 cDNA has a unique 5 end
corresponding to sequence upstream from nt 35 of SqKv1A. Sequence
downstream of this site is highly homologous in all four cDNAs but does
exhibit sporadic differences (10 total) that are all A-G conversions, with the exception of the position corresponding to nt 35 of
SqKv1A.
Examination of homology at the 3 end of SqKv1A-D cDNAs
All 30 full-length cDNAs discussed above also were tested for 3
diversity. PCR primers SKC21 and SKC22 (Fig. 1A,
Table 1) were used to amplify the coding region flanking and including the S5 and S6 transmembrane regions of SqKv1A (nt 915-1292). This region includes a short (24 nt) stretch of DNA that is highly divergent
in closely related rat Kv1 cDNAs (Stuhmer et al., 1989 ) and encodes
part of the pore-forming region (Jan and Jan, 1992 ; Pongs, 1992 ).
Direct sequencing of the 30 amplified fragments revealed no
variability, however. Similarly, analysis of the C-terminal coding
region and 3 UTR by direct sequencing of PCR products obtained with T7
and SKC21 primers showed no variability. Although SqKv1A-D cDNAs have
distinct 5 UTR and N-terminal coding sequence, they share C-terminal
coding and a 3 UTR sequence.
Comparison of primary structures
The predicted amino acid sequence of SqKv1A has been compared with
that of Shaker B elsewhere (Rosenthal et al., 1996 ). None of
the SqKv1 cDNAs includes a well defined translation initiation sequence
(Kozak, 1989 ), and putative start sites in each case (Fig.
1B) were assigned to the methionine codon that
yielded the longest open reading frame. Differences in the locations of
the start sites and scattered base differences in SqKv1A-D lead to predicted N termini that differ in length and composition (Fig. 2A). After the position equivalent to
G48 of SqKv1A (diamonds in Fig. 2), SqKv1A-D differ at only
four residues, as indicated in Figure 2B. Overall
identities between SqKv1A and SqKv1B, C, and D are 96, 97, and 92%,
respectively.
Fig. 2.
Differences in predicted primary structure of
squid Kv1 -subunits, based on SqKv1A-D cDNAs. A,
Alignment of the predicted N-terminal portions of SqKv1A-D. Identical
residues are boxed. Illustrated sequences stop at the
position equivalent to G48 (diamond) of SqKv1A because
all four of the predicted SqKv1 channels are identical after this
point, with the exception of the four sites noted in B.
The complete sequence of SqKv1A is given elsewhere (Rosenthal et al.,
1996 ). A consensus intracellular PKC site (asterisk) is
indicated near the start of the NAB domain (indicated by white bar below the sequences). B, Schematic of the
SqKv1A protein between G48 (diamond) and the C terminus.
The four residues downstream from G48 that differ in SqKv1A-D are
noted, and their approximate locations are indicated. The white
segment of the channel corresponds to the continuation of the
NAB domain. Consensus intracellular PKC sites
(asterisks) and extracellular N-linked glycosylation sites (filled circles) are indicated. SqKv1A-D
show no consensus PKA sites.
[View Larger Version of this Image (30K GIF file)]
Although variability exists in the N termini of SqKv1A-D, the
functional significance of this is unknown. SqKv1A begins with a unique
stretch of 12 amino acids, and residues 5-10 are unusually hydrophobic, as revealed by Kyte-Doolitte hydropathy analysis of a
number of Kv1 -subunits (data not shown). Although this structure
has the motif of a conventional leader peptide (Von Heinje, 1990 ;
Dalbey and Von Heinje, 1992 ), it is probably too short to function in
this capacity. SqKv1B and C both lack this hydrophobic N terminal and
are nearly identical to one another. SqKv1D has the shortest N
terminus, lacking the first 34 residues of SqKv1A.
None of the predicted differences among SqKv1A-D occurs within a
putative membrane-spanning, pore-forming, or intracellular linker
region (Jan and Jan, 1992 ; Pongs, 1992 ). Potentially significant differences do exist, however, in the NAB domain (Drewe et al., 1992 ),
the cytoplasmic N-terminal region known to mediate both - (Li et
al., 1992 ; Shen and Pfaffinger, 1995 ; Xu et al., 1995 ) and - (Yu
et al., 1996 ; Sewing et al., 1996 ) subunit interactions. Positions
corresponding to S47 and G87 of SqKv1A are replaced by Gly and Arg,
respectively, in SqKv1B-D. A Ser at the equivalent S47 position seems
to be universally conserved among Kv1-4 -subunits, based on
alignments of 44 Kv1, 7 Kv2, 10 Kv3, and 5 Kv4 members provided by Dr.
M. Li (Johns Hopkins University, Baltimore, MD), except for SqKv1B-D.
SqKv1A, however, seems to be unique in having a Gly at the position
equivalent to G87. In the same 66 Kv -subunits, as well as in
SqKv1B-D, an Arg appears at this position, and the six residues
immediately upstream of this site (NEYFFD) are also absolutely
conserved. A third difference in the NAB domain occurs at K132 of
SqKv1A, which is replaced by a Glu in SqKv1B-D. A basic residue at
this position is found in many, but not all, Kv1 -subunits. The
significance of these anomalous residues in the SqKv1 members is
unclear.
Specificity of expression of SqKv1A-D mRNAs within the
stellate ganglion
RNase protection assays
A series of antisense cRNA probes was used to detect the unique 5
ends of SqKv1A-D mRNAs and thereby determine their distribution patterns in the SG/GFL complex. Only results for SqKv1A, B, and D are
illustrated here; results with SqKv1C probe have been inconclusive because of nonspecific hybridization in control tests with tRNA. 32P-labeled probes were used in separate RNase protection
assays with RNA isolated from either GFL or anterior SG samples (see Materials and Methods), and results are shown in Figure
3A-D. SqKv1A probe is predicted to produce a
fully protected band of 204 nt with its complementary RNA, and a band
of this size (determined by a parallel assay with SqKv1A cRNA; not
illustrated) is obvious in the GFL lane of Figure 3A. Only a
very weak band exists in the SG lane. Conversely, in Figure
3B SqKv1B probe yields a strong, protected band of 347 nt
only with SG RNA. This segregated pattern of distribution also is
demonstrated by another experiment in which both probes were applied
simultaneously to GFL and SG RNA samples (Fig. 3C).
Fig. 3.
Expression of SqKv1A, B, and D mRNAs in the SG/GFL
complex, as determined by RNase protection assays. Predicted sizes for undigested probes and fully protected bands are (in nt)
234/204 (SqKv1A), 404/347 (SqKv1B), and
215/175 (SqKv1D). A, RNase protection assays were performed with SqKv1A probe (Probe A) and
RNA selectively isolated from either SG and GFL, as indicated at the
top of each lane. GFL, Giant fiber lobe;
SG, anterior portion of stellate ganglion (see Materials
and Methods). tRNA served as a negative control.
Nondigested probe provided a size marker. A fully protected band is
prominent in the GFL lane (7 d exposure).
B, RNase protection assays were performed with SqKv1B
probe (Probe B) in the manner described. A prominent,
fully protected band is evident in the SG lane (7 d
exposure). C, Results of another experiment in which assays were performed with both SqKv1A and B probes (Probe A/B Mixed). A 204 nt band corresponding to SqKv1A mRNA is very
prominent in the GFL lane; a 347 nt band corresponding
to SqKv1B is apparent in the SG lane. D,
RNase protection assays performed with SqKv1D probe (Probe
D) yield a clear band only in the SG lane (1 d
exposure; same experimental series as A,
B). See text for additional details.
[View Larger Version of this Image (71K GIF file)]
These results confirm that SqKv1A mRNA is much more abundant in GFL
neurons than in SG neurons (Rosenthal et al., 1996 ) and show that the
opposite is true for SqKv1B mRNA. SqKv1D mRNA also is expressed in the
SG and not in the GFL, and this is shown by results of an assay with
SqKv1D probe (Fig. 3D) in which a fully protected band of
175 nt is detectable only in the SG sample. The level of expression for
SqKv1D relative to that of SqKv1B (or A) cannot be ascertained from
these experiments alone, because specific activities of the probes are
not known. Based on the intensity of the nondigested probe signal in
Figure 3D, the specific activity of probe D in this
experiment would seem to be anomalously high. This, however, permits
detection of the smaller protected fragments predicted to be ~57 bp
in both SG and GFL samples because of probe sequence that is common to
SqKv1A, B, and D (see Materials and Methods and Fig.
1B). The presence of these bands is consistent with
an abundant amount of SqKv1B mRNA in the SG sample and shows that
spurious RNase contamination of the GFL sample was not responsible for
the negative result with the SqKv1D probe.
In situ hybridizations
In situ hybridization was used to map the distributions
of SqKv1A-D mRNAs in the SG/GFL complex more. Figure
4Ai shows a stained section in which
the GFL comprises the left portion of the ganglion, and tracts of
fusing axons arising from GFL neurons (arrowheads) project
toward the central neuropil of the SG proper. Portions of stellar
nerves are visible, and giant axons in two of them are denoted by
asterisks. The border between the GFL neurons and the much larger
neurons of the SG is quite distinct (Fig. 4Aii).
Fig. 4.
Selective expression patterns of SqKv1A, B, and D
mRNAs in the SG/GFL complex. Ai, Horizontal section of a
stellate ganglion stained with basic fuchsin and toluidine blue. The
GFL lies on the left (posterior), and the SG proper is
on the right surrounding the large pale neuropil region.
Stellar nerves project laterally (bottom), and two giant
axons are indicated (asterisks). Tracts of fusing GFL
axons are indicated by arrowheads. Scale bar equals 0.5 mm in Ai, Bi, Ci, and
Di and 0.1 mm in Aii, Bii,
Cii, Dii, and E.
Aii, Higher magnification of the boxed
region in Ai illustrating the boundary between
GFL neurons and the much larger SG neurons in the bottom right
corner. Bi, In situ hybridization
of 35S-labeled cRNA probe specific for SqKv1A detects signal only from GFL neurons.
Bii, Higher magnification of the boxed
region in Bi enclosing the SG/GFL boundary.
Virtually no cells are labeled in the SG proper, although a very small
number of cells near the boundary seem to express SqKv1A. One such cell
is visible in the bottom right corner.
Ci, In situ hybridization of
35S-labeled cRNA probe specific for SqKv1B detects signal
almost exclusively in SG neurons. Cii, Higher
magnification of the boxed region in Ci
enclosing the SG/GFL boundary. Several very large SG neurons are
heavily labeled. Di, Control in situ
hybridization of 35S-labeled cRNA sense probe.
Dii, Higher magnification of the boxed region in Di. This region of the SG proper
includes neuropil (bottom right) and tracts of small
axons projecting from the GFL into the SG (top).
E, In situ hybridization of
35S-labeled cRNA probe specific for SqKv1D of a SG region
equivalent to that in Dii. Tracts of GFL axons are at
the top. A cluster of fairly large neurons in the
center of the picture is labeled above background and
lies just below these axons.
[View Larger Version of this Image (126K GIF file)]
SqKv1A probe selectively labeled GFL neurons (Fig.
4Bi,Bii), whereas the SqKv1B-specific probe
identified many large neurons in the SG but very few, if any, in the
GFL (Fig. 4Ci,Cii). Signals from both of these probes are
far above the background level shown by control sections hybridized
with a sense probe (Figs. 4Di,Dii). Probe for SqKv1D
consistently labeled small groups of moderately sized SG neurons, but
labeling intensity was always weak (Fig. 4E). This
field is from an area corresponding to that in Figure 4Dii taken from a serial section of the same
ganglion. Clusters of such neurons were present in various portions of
the SG, but none was present in the GFL. SqKv1C mRNA was not detectable
with in situ hybridizations.
Regardless of the probe used, hybridization was restricted to cell
bodies and never occurred in the SG neuropil, in tracts of fusing axons
within the GFL, in the cytoplasm of the giant axons, or in Schwann cell
sheaths surrounding axons in the stellar nerves. Thus, mRNA for these
Kv1 -subunits seems to be restricted to neuronal cell bodies.
Functional expression in oocytes and comparison to native K
currents in squid neurons
Patch-clamp measurements of voltage-gated K current
(IK) in oocytes expressing SqKv1A
channels and of native delayed rectifier IK in
GFL neurons and giant axons were described by Rosenthal et al. (1996) ,
who proposed that SqKv1A corresponds to the native 20 pS K channel. In
the present study cell-attached patch recordings were performed on
oocytes injected with SqKv1A or SqKv1B cRNA to perform a preliminary
comparison of properties of IK for the two
cloned channels and to compare SqKv1B currents with
IK recorded from large SG neurons that seem to
express this mRNA. We have not yet expressed SqKv1C or D.
Activation properties
Macroscopic IK records from an oocyte
expressing SqKv1A channels are shown in Figure
5A, and analogous data for SqKv1B are given
in Figure 5B. SqKv1B currents closely resemble those for SqKv1A but were expressed routinely at a higher level. Cell-attached patch recordings from the somata of a GFL neuron (Fig. 5C)
and large SG neuron (Fig. 5D) are illustrated also.
IK in these cell types, which selectively
express these mRNAs, shows obvious similarity to each other and to the
respective traces from oocytes.
Fig. 5.
Activation properties of macroscopic
IK recorded from oocytes and squid neurons.
Cell-attached patch currents are illustrated at the indicated voltages
from oocytes injected with cRNA for SqKv1A (A) or
SqKv1B (B) and from cell bodies of GFL neurons
(C) and large SG neurons
(D). The general form of
IK is similar in all cases.
E, Comparison of voltage dependence of
gK for cloned and native K channels.
Relative gK was estimated as
I/ V after repolarization at the
time of peak IK (see inset).
Symbol code is indicated on the figure. Plotted
points are mean values ± 1 SEM. The number of
patches (n) is indicated, except where
n = 3 or 4. Error bars are omitted when smaller
than the symbol or when n < 3. F,
Activation kinetics (t1/2) were
assayed as the time to reach 50% peak IK.
Symbols are plotted as in A.
[View Larger Version of this Image (27K GIF file)]
K conductance (gK) was determined
as I/ V on termination of the activating
pulse at the time of peak IK (see
inset to Fig. 5E), and
gK-V relations for oocytes
expressing SqKv1A or SqKv1B are very similar (Fig. 5E). Each
cloned channel displays a gK-V relation that is displaced by 10 to 15 mV (at the foot) with respect to data from GFL and SG neurons. This may reflect the different
Ca concentrations in the two sets of experiments (0 mM in
oocytes vs 10 mM in neurons). Although
gK-V curves from neurons and oocytes
begin to rise with similar slopes, native gK in
both types of neurons approaches saturation more gradually than does
gK in oocytes. This result is not attributable
to the difference in ionic strength in the two sets of experiments, as demonstrated by the whole-cell data obtained from GFL neurons with
solutions of an ionic composition similar, except for the Ca level, to
those for oocyte recordings (asterisk in Fig.
5E).
Activation kinetics were assessed as the time to reach 50% of peak
IK (t1/2), and the
voltage dependence of t1/2 is established in
Figure 5F for oocytes expressing SqKv1A and B as well as for GFL and large SG neurons. IK in oocytes
activates somewhat more slowly at negative voltages than that in
neurons, but the difference is not large.
Deactivation properties
Although activation properties of SqKv1A and B channels are fairly
comparable to those of the native channels in GFL and SG neurons, the
rates of channel closing (deactivation) are markedly different. Figure
6A shows tail currents for SqKv1B
recorded at a series of voltages after a brief pulse to +40 mV. Closing
kinetics are voltage-dependent but much slower than those observed in
either large SG neurons (Fig. 6B) or GFL neurons
(Fig. 6C). Figure 6D illustrates the
voltage dependence of deactivation kinetics
( OFF), obtained by fitting a single exponential
to tail currents. A striking difference between the cloned and native
channel types is evident.
Fig. 6.
Deactivation properties of macroscopic
IK recorded from oocytes and squid neurons.
A, Tail currents in a patch from an oocyte injected with
SqKv1B cRNA were measured at the indicated voltages after a 25 msec
test pulse (see inset). B, Analogous tail
current records from a patch on a large SG neuron. Note the difference in time scale from A. C, Tail currents
from a patch on a GFL neuron. D, Deactivation kinetics
( OFF) were obtained by fitting a single exponential to the tail current after repolarization of a brief test
pulse (usually 25 msec duration). Symbols are plotted as in Figure 5.
[View Larger Version of this Image (21K GIF file)]
DISCUSSION
This paper describes four closely related SqKv1 mRNAs, three of
which show distinct spatial patterns of expression in the SG/GFL
complex. SqKv1A is expressed exclusively in the monotypic pool of GFL
neurons that forms the giant axon system and represents the only Kv1
mRNA we have detected in these neurons. SqKv1B is expressed abundantly
in many neurons of the SG proper, but not in the GFL. Larger SG neurons
expressing SqKv1B mRNA undoubtedly include the cell bodies of the small
axon motor system. SqKv1D is expressed in isolated small clusters of SG
neurons but apparently not at all in GFL neurons.
Our attention thus far has focused on the SG/GFL complex, a peripheral
motor control center. We do not know whether SqKv1 mRNAs are expressed
elsewhere in the nervous system. Preliminary evidence from RNase
protection assays and in situ hybridizations suggests that
SqKv1B is expressed in the optic lobe, but neither SqKv1A nor D mRNA
was detectable. We have not yet explored other regions of the CNS.
Alternative splicing of SqKv1A-D mRNAs?
Although individual SqKv1 mRNAs are expressed at different levels
in distinct cell types, their structures are extremely similar. The 3
UTR and most coding sequences of the four mRNAs are virtually identical. Major differences only exist upstream of a common point and
give rise to distinct 5 UTR and N-terminal coding regions. This
pattern is very suggestive of alternative splicing. We have not
isolated genomic clones for these genes, however, so we cannot prove
this conjecture. Attempts to amplify genomic sequence spanning the
putative splice site (near nt 35 of SqKv1A) with PCR were unsuccessful,
and this would be consistent with the presence of a
large intron and the possibility of splicing. The nucleotide sequence
of SqKv1A, C, and D lying 5 to this site is AG, consistent with the
consensus for 5 exons. SqKv1B nucleotide sequence is AT at the
equivalent positions, but the consensus sequence for 5 exons is not
conserved absolutely (Lewin, 1994 ).
Extensive alternative splicing of the single Shaker Kv1 gene
occurs in Drosophila (Papazian et al., 1987 ; Kamb et al.,
1988 ; Pongs et al., 1988 ; Schwarz et al., 1988 ), but splicing of mRNAs derived from the multiple Kv1 genes characteristic of other phyla seems
to be far more limited (Attali et al., 1993 ; Jegla et al., 1995 ).
Shaker A-D show 5 and 3 splicing, which results in
-subunits with distinct N and C termini. Different splice variants
are expressed in specific neural tissues (Schwarz et al., 1990 ;
Tseng-Crank et al., 1991 ), and tissue-specific 3 splicing has been
demonstrated in the nervous system (Mottes and Iverson, 1995 ).
Physiological properties of Shaker channels encoded by these
splice variants differ in regard to inactivation, with 5 variants
differing in N-type inactivation and 3 variants differing in C-type
(Timpe et al., 1988 ; Hoshi et al., 1990 , 1991 ; Iverson and Rudy, 1990 ; Mottes and Iverson, 1995 ).
Differences in the N termini of SqKv1A and B channels, on the other
hand, do not seem to affect inactivation properties in oocytes
(Rosenthal et al., 1996 ; our unpublished data), nor do any of the SqKv1
-subunits display an "inactivation ball" motif like that of
Shaker variants (Murrell-Lagnado and Aldrich, 1993 ). Furthermore, IK in GFL neurons and large SG
neurons, the cell types expressing the relevant mRNAs, shows no obvious
differences in inactivation properties. These observations are
consistent with the idea that neither SqKv1A nor B possesses N-type
inactivation analogous to that in Shaker, but the mechanism
of inactivation in the cloned squid channels has not yet been studied
thoroughly. Inactivation of delayed rectifier IK
in GFL neurons and giant axons is unusually complex but shows more
similarity to a conventional C-type process than to an N-type one
(Mathes et al., 1997 ).
Isolated point differences in SqKv1A-D mRNAs
If differences in 5 UTR and N-terminal coding sequences among
SqKv1A-D are attributable to alternative splicing, what might be the
basis of the scattered single nucleotide differences? It is very
unlikely that the point differences are attributable to random
sequencing errors, because they occur at discrete sites and 6 of the 10 have been verified in 19 independent SqKv1A and 9 SqKv1B clones
(T3-SKC9 amplification products). One possibility is that these
reflect allelic variations among individual squid, because our cDNA
library was prepared from pooled SG of many individuals. Although these
squid all were captured from a single school in the wild, individual or
even population differences could exist. The fact that every difference
was an A-G exchange is not consistent with normal patterns of allelic
variation, however. An alternative is that these differences reflect
adenosine deamination because of mRNA editing (Scott, 1995 ). A similar
pattern in squid Kv2 mRNAs has been attributed to this mechanism
(Patton and Bezanilla, 1996 ), but editing of SqKv1 mRNAs must, at this
time, be regarded as speculative.
Functional differences between SqKv1 channels in oocytes and native
channels in neurons
Macroscopic IK properties derived from
oocytes expressing SqKv1A and B are generally comparable to those from
GFL and large SG neurons. Limited single channel for SqKv1B in oocytes
(our unpublished data) also revealed properties comparable to those reported for SqKv1A (Rosenthal et al., 1996 ). Thus, unitary conductance for both channels is ~12 pS measured in oocyte solutions (~20 pS
when adjusted for the higher K concentration in squid solutions), and
both channels open with short latency, show prominent bursting, and
inactivate over several hundred milliseconds. These properties are
shared by the 20 pS channels in giant axons and GFL somata.
Some significant differences in macroscopic properties exist, however,
between the cloned and native delayed rectifier channels. The major
differences are the steeper overall rise of the
gK-V curve and the unusually slow
deactivation kinetics shown by SqKv1A and B. These differences do not
reflect a gross difference in ionic strength or composition of oocyte
versus squid salines, but a precise comparison will require comparisons
under identical ionic conditions, probably with excised patch
recordings. It is also unlikely that the large differences reflect
contamination of native IK by additional channel
types, particularly in GFL neurons that have been well studied in this
regard (see introductory remarks).
Although we have attempted to account for the Kv1 mRNAs expressed in
the SG/GFL complex and find that SqKv1A and B are by far the
predominant species, we cannot rule out the possibility that either of
these -subunits might form heteromultimeric channels in squid
neurons, thereby conferring unique functional properties on the native
channels. For example, SqKv1D -subunits (which we have not yet been
able to express) might assemble with SqKv1B in a very small minority of
SG neurons, but the chances of routinely encountering such cells in our
recordings would seem very remote. Similarly, the existence of
undiscovered -subunits that can assemble with either SqKv1A or B is
difficult to disprove.
If SqKv1A and B mRNAs alone encode the native channels in GFL and large
SG neurons, the idea we favor, then particular functional properties
must be influenced by factors other than primary structure of the
-subunit. Many potential mechanisms could be relevant, including
post-translational processing of some or all of the -subunits,
interactions with other cellular components such as Kv -subunits, or
even differences in membrane composition. Such factors are likely to
differ substantially in squid neurons and frog oocytes, and
accessibility of the native cell types in squid may expedite
identification of modulatory influences that are important to in
vivo operation of molecularly identified channels.
Biological importance of SqKv1A-D mRNAs and channels
Results described in this work are consistent with the idea that
the molecular complexity of the Kv1 -subunit complement in the giant
axon system is rather simple (Rosenthal et al., 1996 ) and suggest that
a similar situation may exist for many of the larger SG neurons that
express SqKv1B. If both of these cell types support long motor axons
and rapid transmission of brief impulses in high frequency bursts (Otis
and Gilly, 1990 ), why should distinct mRNAs exist to express K channels
with such similar functional properties?
This question also applies to other taxa, including vertebrates, and
the answer presently is unknown. The unique N terminals of SqKv1A and B
-subunits, or the anomalous residues in the NAB domain, could lead
to important differences in interactions with other cellular proteins
that also may be specific to individual types of neurons. Such
interactions could affect channel localization or functional
properties. Although properties of K channels in the somata of GFL
cells and large SG neurons are indistinguishable, differences in their
dendrites, motor terminals, or even axons might exist.
Finally, GFL neurons represent a highly specialized pool of monotypic
cells that may express many unique genes. Studies of the distinct 5
UTRs of the SqKv1 mRNAs expressed in the SG/GFL complex might lead to a
deeper understanding of the importance of these elements in regulating
expression of specific channel subtypes in certain neurons. Our
understanding of differentiation in GFL neurons and development of the
giant axon is very limited (Gilly et al., 1991 ), and SqKv1A-specific
probes will provide an important tool to examine these processes.
FOOTNOTES
Received Feb. 7, 1997; revised April 16, 1997; accepted April 21, 1997.
This work was supported by National Institutes of Health Grant NS17510
to W.G., an Office of Naval Research Augmentation Award for Science and
Engineering Research Training to J.R., and an individual United States
Public Health Service award to M. Perri, who contributed to several
aspects of this project.
Correspondence should be addressed to Dr. W. F. Gilly at the above
address.
Dr. Rosenthal's present address: Department of Physiology, University
of California at Los Angeles Medical Center, Los Angeles, CA 90095.
REFERENCES
-
Attali B,
Lesage F,
Ziliani P,
Guillemare E,
Honore E,
Waldmann R,
Hugnot JP,
Mattei MG,
Lazdunski M,
Barhanin J
(1993)
Multiple mRNA isoforms encoding the mouse cardiac Kv1-5 delayed rectifier K+ channel.
J Biol Chem
268:24283-24289[Abstract/Free Full Text].
-
Dalbey RE,
Von Heinje G
(1992)
Signal peptidases in prokaryotes and eukaryotes: a new protease family.
Trends Biochem Sci
17:474-478[Web of Science][Medline].
-
Drewe JA,
Verma S,
Frech G,
Joho RH
(1992)
Distinct spatial and temporal expression patterns of K+ channel mRNAs from different subfamilies.
J Neurosci
12:538-548[Abstract].
-
Gilly WF,
Lucero MT,
Horrigan FH
(1990)
Control of the spatial distribution of sodium channels in giant fiber lobe neurons of the squid.
Neuron
5:663-674[Web of Science][Medline].
-
Gilly WF,
Hopkins B,
Mackie GO
(1991)
Development of giant motor axons and neural control of escape responses in squid embryos and hatchlings.
Biol Bull
180:209-220[Abstract].
-
Gilly WF,
Preuss T,
McFarlane MB
(1996)
All-or-none contraction and sodium channels in a subset of circular muscle fibers of squid mantle.
Biol Bull
191:337-340[Abstract].
-
Hoshi TW,
Zagotta WN,
Aldrich RW
(1990)
Biophysical and molecular mechanisms of Shaker potassium channel inactivation.
Science
250:533-538[Abstract/Free Full Text].
-
Hoshi TW,
Zagotta WN,
Aldrich RW
(1991)
Two types of inactivation in Shaker K channels: effects of alterations in the carboxy-terminal region.
Neuron
7:547-556[Web of Science][Medline].
-
Iverson LE,
Rudy B
(1990)
The role of divergent amino and carboxy domains on the inactivation properties of potassium channels derived from the Shaker gene of Drosophila.
J Neurosci
10:2903-2916[Abstract].
-
Jan LY,
Jan YN
(1992)
Structural elements involved in specific K+ channel functions.
Annu Rev Physiol
54:537-555[Medline].
-
Jegla T,
Grigoriev N,
Gallin W,
Salkoff L,
Spencer AN
(1995)
Multiple Shaker potassium channels in a primitive metazoan.
J Neurosci
15:7989-7899[Abstract].
-
Kamb A,
Tseng-Crank J,
Tanouye MA
(1988)
Multiple products of the Drosophila Shaker gene may contribute to potassium channel diversity.
Neuron
1:421-430[Web of Science][Medline].
-
Kozak M
(1989)
The scanning model for translation: an update.
J Cell Biol
108:229-244[Abstract/Free Full Text].
-
Lewin B
(1994)
In: Genes, Vol V (Lewin B, ed), p 914. Toronto: Oxford UP.
-
Li M,
Jan YN,
Jan LY
(1992)
Specification of subunit assembly by the hydrophilic amino-terminal domain of the Shaker potassium channel.
Science
257:1225-1230[Abstract/Free Full Text].
-
Liu TI,
Gilly WF
(1995)
Tissue distribution and subcellular localization of Na+ channel mRNA in the nervous system of the squid, Loligo opalescens.
Receptors Channels
3:243-245[Web of Science][Medline].
-
Llano I,
Bookman RJ
(1986)
Ionic conductances of squid giant fiber lobe neurons.
J Gen Physiol
88:543-569[Abstract/Free Full Text].
-
Llano I,
Webb CK,
Bezanilla F
(1988)
Potassium conductance of the squid giant axon: single channel studies.
J Gen Physiol
92:179-196[Abstract/Free Full Text].
-
Mathes C,
Rosenthal JJC,
Armstrong CM,
Gilly WF
(1997)
Fast inactivation of the delayed rectifier potassium conductance in squid giant axon and its cell bodies.
J Gen Physiol
109:435-448[Abstract/Free Full Text].
-
Murrell-Lagnado RD,
Aldrich RW
(1993)
Interactions of amino terminus domains of Shaker K channels with a pore-blocking site studied with synthetic peptides.
J Gen Physiol
103:949-975.
-
Mottes JR,
Iverson LE
(1995)
Tissue-specific alternative splicing of hybrid Shaker/lacZ genes correlates with kinetic differences in Shaker K+ currents in vivo.
Neuron
14:613-623[Web of Science][Medline].
-
Nealey TS,
Spires S,
Eatock RA,
Begenisich T
(1993)
Potassium channels in squid neuron cell bodies: comparison to axonal channels.
J Membr Biol
132:13-25[Web of Science][Medline].
-
Otis TS,
Gilly WF
(1990)
Jet-propelled escape in the squid Loligo opalescens: concerted control by giant and non-giant motor axon pathways.
Proc Natl Acad Sci USA
87:2911-2915[Abstract/Free Full Text].
-
Papazian DM,
Schwarz TL,
Tempel BL,
Jan YN,
Jan LY
(1987)
Cloning of genomic and complementary DNA from Shaker, a putative potassium channel gene from Drosophila.
Science
237:749-753[Abstract/Free Full Text].
-
Patton DE,
Bezanilla F
(1996)
RNA editing generates diverse transcripts encoding squid Kv2 K+ channels.
Biophys J
70:A13.
-
Perozo E,
Jong DS,
Bezanilla F
(1991)
Single channel studies of the phosphorylation of K+ channels in the squid giant axon. II. Nonstationary conditions.
J Gen Physiol
98:19-34[Abstract/Free Full Text].
-
Pongs O
(1992)
Molecular biology of voltage-dependent potassium channels.
Physiol Rev
72:S69-S88.
-
Pongs O,
Kecskemethy N,
Muller R,
Krah-Jentgens I,
Baumann A,
Kiltz HH,
Canal I,
Llamazares S,
Ferrus A
(1988)
Shaker encodes a family of putative potassium channel proteins in the nervous system of Drosophila.
EMBO J
7:1087-1096[Web of Science][Medline].
-
Prosser CL,
Young JZ
(1937)
Responses of muscles of the squid to repetitive stimulation of the giant nerve fibres.
Biol Bull
73:237-241[Abstract/Free Full Text].
-
Rosenthal JJC,
Gilly WF
(1993)
Amino acid sequence of a putative sodium channel expressed in the giant axon of the squid Loligo opalescens.
Proc Natl Acad Sci USA
90:10026-10030[Abstract/Free Full Text].
-
Rosenthal JJC,
Vickery RG,
Gilly WF
(1996)
Molecular identification of SqKv1A: a candidate for the delayed rectifier K channel in squid giant axon.
J Gen Physiol
108:207-219[Abstract/Free Full Text].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Schwarz TL,
Tempel BL,
Papazian DM,
Jan YN,
Jan LY
(1988)
Multiple potassium channel components are produced by alternative splicing at the Shaker locus in Drosophila.
Nature
331:137-142[Medline].
-
Schwarz TL,
Papazian DM,
Carretto RC,
Jan YN,
Jan LY
(1990)
Immunological characterization of K+ channel components from the Shaker locus and differential distribution of splicing variants in Drosophila.
Neuron
2:119-127.
-
Scott J
(1995)
A place in the world for RNA editing.
Cell
81:833-836[Web of Science][Medline].
-
Shen NV,
Pfaffinger PJ
(1995)
Molecular recognition and assembly sequences involved in the subfamily-specific assembly of voltage-gated K+ channel subunit proteins.
Neuron
14:625-633[Web of Science][Medline].
-
Sewing S,
Roeper J,
Pongs O
(1996)
Kv
1 subunit binding specific for Shaker-related potassium channel -subunits.
Neuron
16:455-463[Web of Science][Medline]. -
Simmons DM,
Arriza JL,
Swanson LW
(1989)
A complete protocol for in situ hybridization of messenger RNAs in brain and other tissues with radiolabeled single-stranded RNA probes.
J Histotechnol
12:168-181.
-
Stuhmer W,
Ruppersberg JP,
Schroter KH,
Sakmann B,
Stocker M,
Giese KP,
Perschke A,
Baumann A,
Pongs O
(1989)
Molecular basis of functional diversity of voltage-gated potassium channels in mammalian brain.
EMBO J
8:3235-3244[Web of Science][Medline].
-
Timpe LC,
Jan YN,
Jan LY
(1988)
Four cDNA clones from the Shaker locus of Drosophila induce kinetically distinct A-type potassium currents in Xenopus oocytes.
Neuron
1:659-667[Web of Science][Medline].
-
Tseng-Crank J,
Pollock JA,
Hayashi I,
Tanouye MA
(1991)
Expression of ion channel genes in Drosophila.
J Neurogenet
7:229-239[Web of Science][Medline].
-
Von Heinje G
(1990)
Protein targeting signals.
Curr Opin Cell Biol
2:604-608[Medline].
-
Wilson DM
(1960)
Nervous control of movement in cephalopods.
J Exp Biol
37:57-72[Abstract].
-
Xu J,
Yu W,
Jan YN,
Jan LY,
Li M
(1995)
Assembly of voltage-gated potassium channels: conserved hydrophilic motifs determine subfamily-specific interactions between the
-subunits.
J Biol Chem
270:24761-24768[Abstract/Free Full Text]. -
Young JZ
(1938)
The functioning of giant nerve fibres of the squid.
J Exp Biol
15:171-185.
-
Young JZ
(1939)
Fused neurons and synaptic contacts in the giant nerve fibres of cephalopods.
Phil Trans R Soc Lond [Biol]
229:465-503.
-
Young JZ
(1972)
The organization of a cephalopod ganglion.
Phil Trans R Soc Lond [Biol]
263:409-429[Web of Science][Medline].
-
Yu W,
Xu J,
Li M
(1996)
NAB domain is essential for the subunit assembly of both
- and - complexes of Shaker-like potassium channels.
Neuron
16:441-453[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
T. I. Liu, Z. N. Lebaric, J. J. C. Rosenthal, and W. F. Gilly
Natural Substitutions at Highly Conserved T1-Domain Residues Perturb Processing and Functional Expression of Squid Kv1 Channels
J Neurophysiol,
January 1, 2001;
85(1):
61 - 71.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Baro, A. Ayali, L. French, N. L. Scholz, J. Labenia, C. C. Lanning, K. Graubard, and R. M. Harris-Warrick
Molecular Underpinnings of Motor Pattern Generation: Differential Targeting of Shal and Shaker in the Pyloric Motor System
J. Neurosci.,
September 1, 2000;
20(17):
6619 - 6630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Sweedler, L Li, P Floyd, and W Gilly
Mass spectrometric survey of peptides in cephalopods with an emphasis on the FMRFamide-related peptides
J. Exp. Biol.,
January 12, 2000;
203(23):
3565 - 3573.
[Abstract]
[PDF]
|
 |
|
|