Previous Article | Next Article 
Volume 17, Number 15,
Issue of August 1, 1997
pp. 5843-5857
Copyright ©1997 Society for Neuroscience
Caenorhabditis elegans Levamisole Resistance Genes
lev-1, unc-29, and unc-38 Encode
Functional Nicotinic Acetylcholine Receptor Subunits
John T. Fleming1, 6,
Michael D. Squire2, 3,
Thomas M. Barnes1,
Camilla Tornoe3,
Kazuhiko Matsuda3,
Joohong Ahnn4,
Andrew Fire4,
John E. Sulston1,
Eric A. Barnard2,
David B. Sattelle3, and
James A. Lewis5
1 Laboratory of Molecular Biology and
2 Molecular Neurobiology Unit, Medical Research Council
Centre, Cambridge CB2 2QH, United Kingdom, 3 The Babraham
Institute Laboratory of Molecular Signalling, Department of Zoology,
Cambridge CB2 3EJ, United Kingdom, 4 Department of
Embryology, Carnegie Institute of Washington, Baltimore, Maryland
21210, 5 Division of Life Sciences, University of Texas at
San Antonio, San Antonio, Texas 78249, and 6 Department of
Pediatric Hematology/Oncology, Massachusetts General Hospital, Boston,
Massachusetts 02114
ABSTRACT
- INTRODUCTION
- MATERIALS AND METHODS
- RESULTS
- DISCUSSION
- FOOTNOTES
- REFERENCES
ABSTRACT 
We show that three of the eleven genes of the nematode
Caenorhabditis elegans that mediate resistance to the
nematocide levamisole and to other cholinergic agonists encode
nicotinic acetylcholine receptor (nAChR) subunits.
unc-38 encodes an 
subunit while lev-1 and unc-29 encode non- subunits. The nematode nAChR
subunits show conservation of many mammalian nAChR sequence features,
implying an ancient evolutionary origin of nAChR proteins. Expression
in Xenopus oocytes of combinations of these subunits
that include the unc-38 subunit results in
levamisole-induced currents that are suppressed by the nAChR
antagonists mecamylamine, neosurugatoxin, and
d-tubocurarine but not -bungarotoxin. The mutant
phenotypes reveal that unc-38 and unc-29
subunits are necessary for nAChR function, whereas the
lev-1 subunit is not. An UNC-29-GFP fusion shows that
UNC-29 is expressed in body and head muscles. Two dominant mutations of
lev-1 result in a single amino acid substitution or
addition in or near transmembrane domain 2, a region important to ion
channel conductance and desensitization. The identification of viable
nAChR mutants in C. elegans provides an advantageous system in which receptor expression and synaptic targeting can be
manipulated and studied in vivo.
Key words:
acetylcholine receptor;
levamisole resistance genes;
receptor mutations;
Caenorhabditis elegans;
evolution;
nematode, unc-29;
unc-38;
lev-1;
transmembrane domain mutation;
Xenopus oocyte expression;
GFP;
confocal microscopy;
receptor localization
INTRODUCTION
Nicotinic acetylcholine receptors (nAChRs) are the
most thoroughly characterized receptors in the family of ligand-gated
ion channels (Karlin, 1993
; Unwin, 1993a,b, 1995). The vertebrate muscle nAChR is a pentamer of four subunit types in the stoichiometry 2, 
, 
, and 
. Each subunit contains four
hydrophobic, putative transmembrane regions (TM1-TM4), with TM2 in
each subunit contributing to the lining of the channel
(Devillers-Thiery et al., 1993). A main part of the binding sites for
ACh has been localized to each of the two subunits, close to a pair
of vicinal cysteines (positions 192 and 193 in the Torpedo
subunit) that define subunits in all nAChRs (Kao and Karlin,
1986). Residues of the and subunits also contribute to ACh
binding (Karlin, 1993). The subunits of vertebrate neuronal nAChRs are
encoded by a separate set of genes and fall into two major classes,
either or non-, each with several isoforms (2-9 and
2-5) (Sargent, 1993; Ortells and Lunt, 1995).
Beyond cloning the subunits of nAChRs, considerable effort has been
expended both in vitro and in vivo toward
understanding the precise contribution of each subunit and the
identities and functions of proteins that interact with the nAChR
(Gautam et al., 1995; Karlin and Akabas, 1995; Gautam et al., 1996). To
aid in this endeavor, Caenorhabditis elegans offers a
genetic facility for defining the molecules associated with nAChR
function that would be difficult to achieve in more complex
animals.
Nematodes possess nAChRs (Johnson and Stretton, 1980; Fleming et al.,
1993; Ajuh and Egwang, 1994; Squire et al., 1995; Treinin and Chalfie,
1995; Ballivet et al., 1996; Wiley et al., 1996). Although >20 nAChR
sequences have been uncovered in the C. elegans genome
sequencing project, our attention has been focused on the levamisole
receptor. Levamisole is a more potent agonist than acetylcholine at
nematode muscle nAChRs (Lewis et al., 1980b; Harrow and Gration, 1985;
Martin et al., 1991; Robertson and Martin, 1993). Mutants resistant to
levamisole define 11 genes (Brenner, 1974; Lewis et al., 1980a). These
mutants fall into three classes: uncs, pseudo-wild
types, and twitchers (Table 1). Mutants
in six genes with the unc phenotype exhibit extreme
levamisole resistance, uncoordinated motor behavior, and resistance to
other cholinergic agonists. Weakly resistant mutants
(pseudo-wild types) move normally but have
severalfold higher resistance to levamisole and other cholinergic
agonists. All genes mutable to extreme resistance (except
unc-50) also produce weaker mutant alleles having a
partially resistant phenotype (Table 1). lev-1 is the only
locus for which the predominant mutant phenotype is that of partial
resistance but for which two rare unc extreme resistance
alleles, x21 and x61, have also been found. These
two alleles are the only extreme levamisole resistance mutations that
show any dominance.
Table 1.
Major levamisole resistance loci of Caenorhabditis
elegans
| Levamisole resistance
phenotype |
Gene |
Phenotypesa |
Number of
alleles |
[3H]MAL
bindingb |
Gene product |
|
| Extremely resistant
unc |
lev-1 |
s + w |
2 + 13 |
Variable |
Non--nAChR subunitc
|
|
unc-29 |
s + w |
74 + 2 |
 |
Non--nAChR
subunitc |
|
unc-38 |
s + w |
44 + 3 |
+/ |
-nAChR subunitc
|
|
unc-63 |
s + w |
58 + 1 |
+/ |
Unknown
|
|
unc-74 |
s + w |
27 + 1 |
|
Unknown
|
|
unc-50 |
s |
5 |
|
Not an nAChR
subunitd |
| Partially resistant pseudo-wild
type |
lev-8 |
w |
1 |
+ |
Unknown
|
|
lev-9 |
w |
3 |
+ |
Unknown
|
|
lev-10 |
w |
1 |
+ |
Unknown
|
| Twitcher |
unc-22 |
w |
16 |
+ |
Muscle-specifice
|
|
lev-11 |
w |
1 |
+ |
Muscle-specificf |
|
|
a
Phenotypes: s, strong; w, weak. Only a
limited effort was made to isolate and characterize weak, partially
levamisole-resistant alleles. The number of weak alleles isolated thus
mainly reflects their relative ease of isolation. This table summarizes
discussion of previously reported work described in the text (Lewis et
al., 1980a, 1987b; work cited in other footnotes).
b
The [3H]MAL binding
characteristic of the most levamisole-resistant alleles of each gene is
indicated. +, Substantial specific [3H]MAL
binding; , little or no specific [3H]MAL
binding.
c
This work.
d
M. O. Hengartner, N. Tsung, J. A. Lewis, and H. R. Horvitz, unpublished data.
e
Moerman et al. (1988).
f
Williams and Waterston (1994).
|
|
Using [3H]meta-aminolevamisole (MAL),
nAChR binding has been detected in nematode extracts (Lewis et al.,
1987a,b). Mutants of the six loci that give rise to strong resistance
have deficient or altered receptor binding. Such receptor mutants are
only moderately impaired in motor behavior as adults but are severely
incapacitated at early larval stages.
Here we show that three genes associated with levamisole resistance
encode nAChR subunits, and that and non- subunit combinations of
these genes generate functional nAChRs when co-expressed in Xenopus oocytes. The eight other levamisole resistance genes
are candidates for components of nAChR-mediated synaptic signaling. The
ability to exploit C. elegans genetics offers the prospect of identifying additional novel molecular components of nicotinic cholinergic synapses.
MATERIALS AND METHODS
Nematode strains. The wild-type C. elegans
used was Bristol strain N2 (Brenner, 1974). The Bergerac BO transposon
mutator strain (Moerman and Waterston, 1984) was obtained from the
Caenorhabditis Genetics Center, and the TR679 mutator strain
was kindly provided by P. Anderson (University of Wisconsin) (Collins
et al., 1987)
Mutant isolation. Mutants containing restriction fragment
polymorphisms were obtained in the following ways. For the isolation of
spontaneous transposon-induced mutations, 30 (BO strain) or 40 (TR679
strain) adult hermaphrodites were placed on a 100 mm diameter Petri
dish spread with bacteria. After 4-5 d at 20°C, progeny worms were
washed off the plate and placed to one side of a separate plate
containing 1 mM levamisole, as described previously (Lewis
et al., 1980a). Drug plates were then screened at daily intervals for
extreme resistance to levamisole. To isolate -ray-induced mutants,
worms were first irradiated for 6 min with 1500 rads from a
60Co source, and 20 mutagenized adults were transferred to
each Petri plate. Mutants were tested for genetic identity as described previously (Lewis et al., 1980a).
Identification of restriction fragment length polymorphisms in
mutants. The mutator strains used contain high copy numbers of the
transposon Tc1. Genomic probing with Tc1 DNA was used to identify a
novel candidate Tc1 element generating a levamisole resistance
mutation. Extraneous background Tc1 elements were eliminated by
balancing the mutation against a Bristol chromosome containing left-
and right-flanking markers and then back-crossing the mutation 12 times
into a strain homozygous for the same genetic markers. The candidate
mutation was then recombined with the left- and right-flanking markers,
and, if it proved necessary to achieve adequate viability, the mutation
was separated by further recombination from one or both flanking
markers before isolating a strain homozygous for the back-crossed
mutation. Control constructs homozygous for approximately the same
high-copy Tc1 chromosomal region, but otherwise having a Bristol
low-copy Tc1 genetic background, were generated by back-crossing the
wild-type allele present in the parent mutator strain into a Bristol
strain having an ethylmethane sulfonate (EMS)-induced mutation in the
gene of interest, usually flanked by the same left and right genetic
markers used in constructing the mutants. For producing
unc-38 mutant constructs, unc-57(e406) and
dpy-5(e61) marker mutations (0.5 map units to either side of
unc-38) were used. For control constructs,
unc-11(e47) was used instead of unc-57. In the
case of unc-29 constructs, unc-13(e450) and
lin-11(n389), 1.1 and 1.6 map units to either side of
unc-29, were used. For lev-1,
unc-30(e191) and dpy-4(e1166), 0.3 and 4.5 map
units to either side of lev-1, were used.
lev-1 mapping. Several mistakes in the chromosomal placement
of lev-1 were discovered by T.M.B. The needed corrections in its map position were the placement of lev-1 close to
unc-30, the inversion of the unc-26, lev-1 gene
order, and the finding that the deficiency sDf23 complements
lev-1(x38) and therefore does not delete the gene. The
correct position of lev-1 on the genetic map was determined
as follows. First, the two-factor distance between lev-1 and
dpy-4 was measured. From a strain that was
lev-1(x21)tra-3(e1767)dpy-4(e1166)/+++, 74 Lev non-Dpy and
61 Dpy non-Lev recombinants were found among the 3014 progeny
constituting 10 complete broods, giving a distance of 4.5 map units.
For deficiency mapping, the recessive allele x38 was used.
x38/+ males were mated into Df/nT1 strains, and outcross males were scored. The deficiencies sDf21 and
nDf27 failed to complement x38, whereas
sDf22, sDf23, and sDf60 did complement x38. For three-factor mapping, Unc non-Dpy and Dpy non-Unc
recombinants were picked from a strain that was
dpy-20(e1282) + unc-26(e205)/+ lev-1(x21) +. Twenty of 22 Dpy recombinants and 2 of 21 Unc
recombinants contained x21. In a further three-factor
mapping experiment, Unc non-Dpy and Dpy non-Unc recombinants were
selected from a strain that was unc-30(e191) + dpy-4(e1166)/+ lev-1 +, using mutator- or
-ray-generated lev-1 alleles (x505,
x508, x548, and x566) isolated
in this study (see above). The cumulative data were that 4 of 64 Unc
and 24 of 27 Dpy recombinants contained the lev-1 marker. In
summary these data give a gene order of unc-30-lev-1-unc-26. unc-26 is genetically inseparable from the Bergerac polymorphism nP33 both from the left (Yuan et al., 1993) and to the right
(T. M. Barnes and J. Hodgkin, unpublished data). Thus lev-1
was inferred to lie physically between the unc-30-rescuing
cosmid (Jin et al., 1994) and the nP33-detecting cosmid, a
distance of about 120 kb.
Recombinant DNA techniques. Standard recombinant DNA
techniques were used (Sambrook et al., 1989). The Tc1 transposable
element used as a genomic probe was an EcoRV fragment
prepared by D. Bird (North Carolina State University) from an isolate
supplied by S. Emmons (Albert Einstein College of Medicine). The
flanking genomic DNA associated with a novel Tc1-induced mutation was
separated from the Tc1 DNA in any genomic subclone by excision with
EcoRV and purification by gel electrophoresis. Most
hybridizations and washes performed in the course of screening C. elegans genomic libraries were performed under high stringency
conditions (washing at 65°C with 0.2× SSC).
Reduced stringency conditions were used for screening with an 800 bp ard probe (from position 500 to position 1350)
(Hermans-Borgmeyer et al., 1986). The probe was labeled to a specific
radioactivity of about 1 × 109 cpm/µg by
random priming. Suitable hybridization conditions were chosen by
probing a Southern blot of C. elegans genomic DNA with the
ard cDNA. Hybridization was performed at 30°C in 43%
(w/v) formamide and 5× SSC for 48 hr. Filters were washed for 30 min each, twice at room temperature, twice at 37°C in 2× SSC and 0.1% SDS, and then for at least 45 min at 45°C in 1× SSC and 0.1% SDS before autoradiography with intensification at 70°C. Fifty thousand phage from a C. elegans genomic library in 
2001
(approximately eight genome equivalents) were screened.
Phage clones were fingerprinted by A. Coulson [Medical Research
Council (MRC), Cambridge, UK] (Coulson et al., 1986). DNA sequencing
followed the method of McCombie et al. (1991). Cosmids spanning the
unc-38 and unc-29 loci were provided by A. Coulson. Cosmid DNA was microinjected after removal of RNA by LiCl
precipitation and purification by repeated ethanol precipitation. For
reverse transcription (RT)-PCR, except as noted below,
poly(A+) RNA (Jacobson, 1987) was prepared from
total nematode RNA or was obtained as a gift from D. Zarkower (MRC);
5
- or 3-anchored PCR was performed using standard procedures (Frohman
et al., 1988).
lev-1 cDNA. A full-length cDNA of lev-1 was
obtained as follows. An oligonucleotide complementary to bp 2208-2237
of the genomic sequence was used to isolate a partial cDNA clone from a
mixed stage C. elegans library (provided by I. Maruyama,
MRC). The cDNA contained 232 bp of sequence upstream of the predicted
start of translation but lacked the predicted 3 end. The 3-anchored
PCR (Frohman et al., 1988) using an internal primer (position
3181-3200) upstream of the EcoRI site at 3306 was used to
generate a fragment containing the 3 end of the message. The available
partial cDNA clone contained what appeared to be an unspliced 48 bp
intron, but because there was no termination codon in this intron and the reading frame was maintained, it was not clear whether this sequence was present in the mature mRNA. Therefore we analyzed the
splicing pattern across this region using RT-PCR. The data (not shown)
were consistent with the quantitative removal of this intron.
Therefore, a partial cDNA lacking the 48 bp intron was cleaved with
EcoRI (which cleaves in the 3 primer as well), and the
resulting fragment was cloned into the EcoRI site of the
original cDNA, thus regenerating a complete cDNA.
Cloning unc-29. The mutator-induced unc-29
mutation x513 was back-crossed into the wild-type strain and
recombined with the closely linked left and right flanking markers
unc-13(e450) and lin-11(n389) to reduce the
background of unrelated Tc1 elements. Hybridization of a Tc1 probe to
EcoRI-digested DNA from the back-crossed strain showed a
novel 3.7 kb EcoRI fragment not present in the wild-type
strain. The Tc1 element was not separable from the x513 mutation in 12 recombination events with either the unc-13
or the lin-11 flanking markers. The x513 Tc1
element was cloned, and the genomic DNA flanking the insert was used as
a probe to identify nine wild-type genomic clones in an EMBL4 phage
library (supplied by C. Link and W. Wood, University of Colorado). The physical map position of these phage was the same as that of the putative nAChR homolog JF#WA33 isolated by cross-hybridization with
ard and was consistent with the genetic map location of
unc-29 on chromosome I (Brenner, 1974; Lewis et al., 1980a)
(Fig. 1B). Southern blots of a
-ray-induced mutant and five additional mutator-induced mutants all
revealed chromosomal rearrangements when DNA from one of the EMBL4
phage (ZZ#1) was used as a probe (data not shown). Of the putative
transposon-induced unc-29 mutants, four had insertions in
either a 1.4 or 5.0 kb EcoRI fragment. These
EcoRI fragments lie immediately downstream from the 2.0 kb
EcoRI fragment in which both x513 and another
insertion occurred (Fig. 1B). The insertions in two
of these six mutants were lost in spontaneously occurring revertants to
the wild-type phenotype, further indicating association of the
restriction fragment length polymorphisms (RFLPs) with the
unc-29 gene.
Fig. 1.
Structures of the
lev-1, unc-29, and unc-38
nAChR subunit genes. A, lev-1 structure.
The position of lev-1 on the genetic map of chromosome
IV is shown in relation to nearby genetic markers. The relative contig
positions on the physical map of cosmids W07H6, C43C9, and B0564 and
phage clones JF#WA10 and JF#WA18 derived from the
lev-1 region are indicated. The genomic organization of
the lev-1 gene is shown. Restriction enzyme sites are
indicated to define possible limits of mutations: R,
EcoRI; S, SalI;
H, HindIII; X,
XhoI; and B, BamHI. Mutant
alleles found to have substantial DNA sequence rearrangements or Tc1
insertions are diagrammed. The open bar for
x548 represents a deletion with a range of end points
indicated. x416, x427, x438, and
x566 represent complex rearrangements, mostly insertions
of the sizes indicated, affecting the restriction fragments spanned by
the bar shown for each mutation. For
x504, x508, and x562, the
positions of 1.6 kb Tc1 insertions are indicated by
arrows. For e211, e289,
x21, x38, x61, x400, and
x505, no DNA differences were detected. GenBank entry
X98601 gives the DNA sequence of lev-1. B,
unc-29 structure. The position of unc-29
on the genetic map of chromosome I is shown in relation to nearby
genetic markers. The relative contig positions on the physical map of
cosmids C45D10, C11C3, and C34D2 and phage clones ZZ#1, ZZ#2, and
JF#WA33 derived from the unc-29 region are indicated. The genomic organization of the unc-29 gene is shown.
Restriction enzyme sites: R, EcoRI;
S, SalI; and H,
HindIII. The positions of a mutation caused by DNA
rearrangement and of six mutations caused by apparent transposon
insertion are shown relative to the EcoRI fragments that
span the unc-29 gene. The sizes of the apparent inserts
found were 1.6 kb each for x513, x522,
x544, x545, and x554 and
2.5 kb for x520. The inserts of x520,
x544, and x554 were lost in revertants,
and the insert of x513 hybridized to Tc1. The exact
nature and extent of the x415 mutation are unknown, but
at least several hundred bases near the 3 end of the coding seem to be
involved (see Materials and Methods). For x401,
x417, x429, and x433,
noDNA differences were detected. The DNA sequence of
unc-29 is given by GenBank entry U81144.
C, Structure of the unc-38 nAChR subunit gene. The position of unc-38 on the genetic map
of chromosome I is shown in relation to nearby genetic markers. The
relative contig positions on the physical map of cosmids C09C3, B0241,
and C04E4 and phage clones ZZ#11 and ZZ#15 are indicated. The
genomic organization of the unc-38 gene is shown.
Restriction enzyme sites: P, PstI; and
H, HindIII. Mutations associated with Tc1
insertion or DNA rearrangements within the HindIII
fragment spanning the unc-38 gene are indicated. For
x402, x404, x414, and
x511, no DNA differences were found in this fragment. Other than causing a size alteration of the 3.2 kb
HindIII fragment, the exact nature and extent of the
x411 and x419 mutations are unknown. The
DNA sequence of unc-38 is given by GenBank entry X98599.
[View Larger Version of this Image (25K GIF file)]
A 6.0 kb HindIII fragment contained within the 8.7 kb of DNA
spanned by the three neighboring EcoRI fragments associated
with the unc-29 mutation was sequenced (GenBank accession
number U81144). The subcloned 1.4 kb EcoRI fragment (Fig.
1B) was used as a probe to isolate a full-length
cDNA. The cDNA had an SL1 trans-spliced leader sequence at
its 5 end, as commonly found on many nematode mRNAs (Krause and Hirsh,
1987; Zorio et al., 1994), eight nucleotides upstream of the ATG
start.
Cloning unc-38. A Southern blot containing
HindIII-digested genomic DNA from three back-crossed
unc-38 mutator-induced mutants, five nonmutant back-crossed
control strains, and the Bristol wild-type strain was probed with Tc1.
All three unc-38 mutants contained a 4.8 kb
HindIII band not present in the wild-type strain and all
nonmutant controls. The 4.8 kb fragment from unc-38(x525) was subcloned, and the genomic DNA flanking the Tc1 site was used as a
probe on Southern blots of five mutator-induced and five -ray-induced unc-38 mutants. Four of the mutator-induced
(including the Tc1 mutants probed above) and two of the -ray mutants
showed a size distinct from that seen in the wild-type strain (3.2 kb). The subcloned DNA flanking the x525 Tc1 element was used as
a hybridization probe to identify corresponding phage from a
wild-type EMBL4 genomic library. The physical map position of the phage was consistent with the unc-38 genetic map position on
chromosome I (Brenner, 1974; Lewis et al., 1980a) (Fig. 1C).
The sequence of the 3 end of the unc-38 gene, which was
missing from the 3.2 kb HindIII fragment, was obtained
directly from cosmid B0241 (Fig. 1C) by linear
amplification sequencing (Craxton, 1991) using oligonucleotide primers
derived from the cDNA sequence that was obtained.
The HindIII fragment was used to screen two C. elegans cDNA libraries (provided by S. Kim, Stanford University;
and R. Barstead, Oklahoma Medical Research Foundation). Three cDNAs
were isolated from 240,000 clones screened. One cDNA was sequenced and
appeared to have the complete 3 end, because it contained a polyA tail 65 bases downstream of the predicted stop codon. Based on the genomic
sequence, the 5 coding region was not present on any of the cDNA
clones. To recover the missing 5 end, a forward primer was made
corresponding to the 5 untranslated leader predicted from the genomic
sequence (nucleotides 273-309, but containing an XbaI site:
ATTCTC
ACACTTTCTTTCAAGGCTTTTCATA). This forward primer
and a reverse primer (nucleotides 854-882) corresponding to the known
partial cDNA sequence were used to amplify total first strand cDNA from
a mixed stage population of C. elegans. The resulting PCR
product was cleaved with XbaI and BamHI (unique BamHI site at position 837) and ligated to the partial, but
mature, cDNA that itself was cleaved with BamHI. The
XbaI site was ligated to the vector polylinker cleaved with
XbaI. The resulting hybrid PCR cDNA sequence corresponded to
the predicted mature full-length cDNA sequence.
To search for null mutations of unc-38 and
unc-29, cDNA clones were generated by RT-PCR using total RNA
prepared according to the method of Chomczynski and Sacchi (1987) with
Trizol (Life Technologies, Gaithersburg, MD) phenol-guanidine
isothiocyanate reagent. The RNA (20 µg) was treated with 10 U of RQ1
RNase-free DNase and 56 U of RNasin (both from Promega, Madison, WI) in
85 µl of buffer for 20 min at 37°C. After phenol/CHCl3
extraction and ethanol precipitation, 1 µg of the resuspended RNA was
used in RT-PCR according to the protocols of the Perkin-Elmer (Norwalk, CT) GeneAmp RNA PCR kit in a Perkin-Elmer Thermocycler 480, using thick-walled GeneAmp tubes. RT-PCR reactions, after a hot start, were
conducted for 45 cycles of 1 min denaturation at 94°, 1 min annealing
at 59°, and 2 min extension at 72°C with a final extension of 5 min. To produce cDNA products from the 5 ends of unc-38 transcripts, a forward primer derived from positions 339-364 in the
genomic sequence was used with a reverse primer from positions 2184-2209 antisense. To obtain an overlapping cDNA from the 3-end of
unc-38 transcripts, forward and reverse primers from
positions 1669-1691 and 3517-3541 antisense were used, respectively.
The 5 and 3 RT-PCR products obtained for unc-38(x411) and
unc-38(x419) were the same sizes as for wild type, 915 and
847 bp, respectively, as was the 3 PCR product of
unc-38(x20). The 5 RT-PCR product from x20 RNA
was only about 760 bp in length in two independent amplifications done
from the same RNA preparation. After purification with the QIAquick PCR
Purification System (Qiagen, Chatsworth, CA), the 5 x20
products were ligated to pT7Blue (Novagen, Madison, WI) and
electroporated into DH12S. Sequencing of the two independent x20 5 clones showed that the base sequence of the third
exon was precisely missing in both clones, accounting for the smaller size of the PCR products. Two independent genomic clones were generated
using the Boehringer-Mannheim (Indianapolis, IN) EXPAND PCR kit with
forward and reverse primers derived from positions 638-663 and
1120-1143 antisense, respectively. Each PCR amplification was done
using the genomic DNA from two adult worms digested with protease K
(Williams et al., 1992) using the shortened cycle times recommended (10 cycles without autoextension followed by 20 cycles with an additional
20 sec each). Unlike the cDNA products, the genomic products seemed to
be of wild-type length (506 bp). In both clones the G found in the
universal 3 splice acceptor AG consensus sequence was found mutated to
an A, accounting for the loss of the third exon in the RNA transcript
(genomic position 764). The finding of apparently normal sizes found
for 5 and 3 RT-PCR products prepared from unc-38(x411) and
unc-38(x419) was surprising, because these mutants showed
significant RFLP differences from the wild type on Southern blots (Fig.
1C). To obtain 5 and 3 RT-PCR products of
unc-29 transcripts, sets of forward and reverse primers were
used from positions 494 to 521 and 2996 to 2972 antisense and from
positions 2632 to 2655 and 4147 to 4170 antisense, respectively. The 5
and 3 RT-PCR products produced from unc-29(x29) and
unc-29(e1072) total RNA were wild type in size (835 and 915 bp, respectively), as was the 5 product of unc-29(x415). No
3 product was obtained for x415 RNA even when a primer 214 bases downstream from the initial reverse primer position was used
(positions 4361-4381). Southern blots showed that the 5.0 kb
EcoRI fragment containing the 3 coding region of
unc-29 was about 200 bases shorter than the wild-type
fragment, consistent with the PCR results and indicating that
x415 contains a rearrangement involving the 3 end of the
unc-29 coding region (Fig. 1B).
Mutant rescue. Germ line transformation of unc-29
and unc-38 was accomplished using the methods developed by
Fire (1986) and Mello et al. (1991).
Construction of UNC-29:: GFP fusions. Two
UNC-29:: GFP fusions were made for this work, and each was
found to rescue the unc-29 mutant phenotypes (both
uncoordinated movement and levamisole insensitivity). Rescue indicates
that transgene expression is physiologically relevant. Details of
transgene construction are as follows. For LJH5, a genomic clone
carrying the unc-29 coding region and 1.5 kb upstream was
fused after the C terminus to the coding region for Aequora
victoria gfp (Chalfie et al., 1994). For these constructs, the
Ser65
Thr variant of GFP (Heim et al., 1994) was used for its
improved fluorescent properties. The gfp coding region in
these constructs also incorporates several consensus nematode introns
to facilitate nuclear export of RNA products (A. Fire, G. Seydoux, J. Ahnn, and S. Xu, unpublished observations). The UNC-29-GFP fusion
junction is just at the C terminus of UNC-29, so that no UNC-29 amino
acids are removed from the construct. The 3 nontranslated region is
from unc-54. Construct LJH9 is similar to LJH5, except that
the unc-29 upstream regions have been replaced by the body
muscle-specific myo-3 promoter (Okkema et al., 1993) to
generate a myo-3:: unc-29:: gfp fusion.
The entire coding sequence from unc-29 is in this construct.
There are six introns from unc-29 (these are introns 6-11
from the 3 end of the endogenous primary transcript), and one upstream
intron is provided by the expression vector, whereas three artificial
introns are present in gfp. The 3 untranslated region is
from unc-54. The unc-29 introns are not necessary
for rescue by the myo-3:: unc-29 constructs; a
simple fusion of the myo-3 promoter to unc-29 cDNA was constructed and found to rescue the unc-29 movement
defect. Injection of these constructs, derivation, and maintenance of transgenic lines were by standard protocols (Mello and Fire, 1995), using the selectable marker rol-6 (Mello et al., 1991).
Strain PD9253 carries the gfp-tagged unc-29 clone
LJH5, whereas strain PD9254 carries the
myo-3:: unc-29:: gfp fusion construct
LJH9, each as an unstable, extrachromosomal array. A control transgenic PD9258 strain carries just the rol-6 marker. Each of these
transgenics was constructed by injection into a unc-29(e193)
genetic background. To examine the unc-29:: gfp
fusions in other genetic backgrounds, hermaphrodites of strains PD9253
and PD9254 were first crossed with N2 males to obtain the arrays in a
wild-type background. The arrays were then crossed into the background
of other unc-29 mutants and were found to rescue all other
unc-29 mutants tested (mutant alleles x29,
x513, x520, x522, x545, and
e1072).
Confocal microscopy on strains carrying gfp
fusions. Worms were grown at 20°C on NGM plates. Young adult
worms that rolled strongly were picked to a 5% agarose pad containing
1× M9 and 10 mM sodium azide (Bargmann and Avery, 1995)
and covered with a number 11/2 coverslip. Confocal microscopy
was done with a Bio-Rad (Richmond, CA) MRC-1024 microscope equipped
with a 60×, 1.4 numerical aperture oil immersion objective. Specimens
were viewed with 488 nm excitation from a krypton-argon laser at 10%
transmission. Emitted light passing through a 522DF32 filter was
collected at a normal scan speed with an iris setting of 3.4, gain of
1113, and a black level of 2, using Lasersharp software. Each optical section shown represents the accumulation over a 3 µm vertical distance of images scanned every 0.5 µm.
Transient heterologous expression in Xenopus
oocytes. In vitro RNA transcription was performed using
a Riboprobe kit obtained from Promega. Oocytes were obtained from
female Xenopus laevis from Blades Biological (Kent,
UK). The oocytes were kept in standard oocyte saline (SOS) medium
[containing (in mM) 100 NaCl, 5 HEPES, 1.8 CaCl2, 1 MgCl2, and 2 KCl, pH
7.6]. Under the dissecting microscope, individual oocytes were
defolliculated manually (i.e., the outer thecal layer and the follicle
cell layers were removed with forceps), leaving the innermost vitelline
membrane intact. The oocytes were then transferred to 1 mg/ml
collagenase (type 1A; Sigma, St. Louis, MO) in SOS and incubated for 20 min to ensure that any remains of the follicle layer were digested.
After a short recovery period in SOS (10-30 min), the oocytes were
ready for injection. Test oocytes were injected with 50 nl of RNA
solution (1 ng/nl for each subunit transcript) in the vegetal
hemisphere. Control oocytes were either left uninjected or were
injected with sterile distilled water.
Recordings were performed using a standard two-electrode voltage clamp
(Dascal et al., 1984). A single oocyte was placed on the Sylgard base
in a 1 ml experimental chamber. The oocyte was impaled with two glass
microelectrodes (Clarke Electromedical glass GC 150 GF-150), fabricated
using an electrode puller (Scientific and Research Instruments Ltd;
catalog number 2001), and filled with 1 M KCl. Electrodes
with a resistance of 5 M
were used for the voltage electrode, and
current electrodes of 1-2 M were used. Oocytes were voltage-clamped
using a GeneClamp 500 amplifier. Current responses were monitored on an
oscilloscope (Nicolet 3091) and recorded on a Gould BS-272 pen
recorder. In some experiments, responses were recorded and stored using
pClamp5 software installed on an IBM Personal Computer. Medium (SOS)
and drugs were applied by a perfusion pump (Pharmacia LKB pump P-1) at
a rate of 4 ml/min. Levamisole, mecamylamine,
d-tubocurarine, neosurugatoxin, and -bungarotoxin were
each dissolved in the standard SOS medium. Levamisole was bath-applied.
In experiments with nAChR antagonists, oocytes were preexposed to
either mecamylamine (at the concentration indicated),
d-tubocurarine (1 × 10
5
M), or neosurugatoxin (5 × 107
M) for 5 min, and then mecamylamine,
d-tubocurarine, or neosurugatoxin was co-applied with
levamisole for 30 sec. For -bungarotoxin (Mr ~7800),
preexposure was done with a 5.0 × 106
M concentration for 30 min.
Construction of an evolutionary tree. An alignment of 23 receptor sequences was generated using the computer program CLUSTAL V
(Higgins et al., 1992) and edited using Genetic Data Environment. The
resulting data set was analyzed under maximum parsimony conditions using the program Phylogenetic Analysis Using Parsimony (PAUP) (Swofford, 1991). Briefly, a 1000 replicate heuristic search was performed using independent random number seeds and tree bisection reconnection. The resulting tree of length 2384 changes was evaluated using a 1000 replicate bootstrap analysis in PAUP (Swofford and Olsen,
1990; Felsenstein, 1992). The resulting tree was rooted using the rat
GABAA 1 receptor subunit. The data set contains phylogenetic data as determined using the gl statistic bracket (gl = 0.869766; p < 0.01) (Huelsenbeck and Hillis,
1993). An essentially identical tree was generated from the same
starting alignment by nearest neighbor-joining analysis using the
program CLUSTAL W (Thompson et al., 1994), which uses the
neighbor-joining algorithm of Saitou and Nei (1987). The alignment and
the PAUP data file are available from J.T.F., D.B.S., or J.A.L.
The following protein sequences, available from the SWISS-PROT protein
sequence database, were used in constructing Figures 2
and 4. All except GAA1_RAT are nAChR subunits. Rat subunits: ACHA_RAT, ACH2_RAT, ACH3_RAT, ACH4_RAT, ACH5_RAT, ACH6_RAT, and ACH7_RAT (muscle and neuronal 2-7). Rat neuronal subunits: ACHN_RAT, ACHO_RAT, and ACHP_RAT (2-4). Rat muscle non-:
ACHB_RAT, ACHD_RAT, ACHE_RAT, ACHG_RAT (, , 
, and ).
Drosophila subunits: ACH1_DROME, ACH2_DROME, ACH3_DROME,
ACH4_DROME (ALS, SAD, ARD, and SBD). Locust Schistocerca
gregaria L1: ACH1_SCHGR. Rat GABA subunit: GAA1_RAT
(GABAA 1).
Fig. 2.
Amino acid sequence alignment of the
Caenorhabditis elegans presumptive mature nAChR subunit
sequences UNC-38, UNC-29, and LEV-1 with locust (Schistocerca
gregaria) L1, Drosophila
(Dros.) non- ARD, and rat 2 and 2 nAChR subunit
sequences. The alignment was constructed using MACAW, version 2.0.5 (Schuler et al., 1991). Regions of sequence identity or high similarity
within blocks of homology are indicated by dark
coloring. Regions of moderate similarity or regions at
boundaries of homology blocks are indicated by light
coloring. Sequences in regions with no significant similarities between subunits are given in lower case letters, and no
effort was made to align the amino acids in these regions. The
positions of the four transmembrane domains
(TM1-TM4) and the extracellular dicysteine loop
(CL) characteristic of nAChR subunits are indicated. Asterisks indicate the positions of the vicinal
cysteines characteristic of -acetylcholine-binding subunits. The
percent identity and similarity of UNC-38 to the locust and rat sequences are 48 and 58% and 42 and 55%, respectively, as determined
by individual pairwise comparisons. The percent identity and similarity
of UNC-29 to the LEV-1, ARD, and rat sequences are 66 and 77%, 50 and 65%, and 39 and 56%, respectively, determined by pairwise
comparisons.
[View Larger Version of this Image (127K GIF file)]
Fig. 4.
Maximum parsimony phylogenetic tree showing the
relationship between the nAChR subunits. The tree is shown rooted using
the rat GABAA receptor 1 sequence. LEV-1 and UNC-29 are
shown in a class of polypeptides that include mammalian muscle nAChR
non- subunits. UNC-38 is shown clearly related to other invertebrate -like AChR subunits. The values over the branches represent the minimum number of times from 1000 random seeds in the bootstrap analysis that a particular branch is expected to appear
(p < 0.01). Branches without
numbers do not have significant probability of appearing at
that exact point in the tree. Regions with little homology, such as the
intracellular cytoplasmic loop, were not used in the comparison. A tree
of the same shape was generated by nearest neighbor-joining analysis,
and the bootstrap values for 1000 random seeds are shown for comparison
below the branches.
[View Larger Version of this Image (31K GIF file)]
RESULTS
Deletion and transposon insertion alleles of the
levamisole resistance genes
The isolation and characterization of nAChR subunit genes is an
essential beginning to understanding the effects of levamisole resistance mutations on synaptic signaling. To clone the subunit genes,
two different experimental approaches were adopted to maximize the
chances of success. One approach was to search for C. elegans nAChR subunit homologs by cross-hybridization and
placement of the clones on the physical map of the nematode genome
(Coulson et al., 1986). The other approach was to generate
levamisole-resistant mutants by transposon insertion followed by
cloning of the insertion site (Greenwald, 1985; Moerman et al., 1986),
allowing genes to be cloned regardless of their actual functions or
homology to known nAChR subunit genes.
Putative transposon insertion mutants were obtained by screening the
progeny of either the Bergerac BO or the TR679 mutator strains (Moerman
and Waterston, 1984; Collins et al., 1987) for spontaneous resistance
to 1 mM levamisole. Isolates showing strong levamisole
resistance were tested by complementation against the six known extreme
levamisole resistance loci (Table 1). To confirm the identity of any
clone found by transposon tagging or by cross-hybridization, mutants
that might represent DNA rearrangements in the same resistance genes
were also isolated by a similar selection scheme using the progeny of
-irradiated worms. New alleles of unc-29, unc-38, unc-63,
unc-74, unc-50, and lev-1 were isolated. All
showed extreme levamisole resistance, except for the lev-1
isolates, which produced only partial resistance, consistent with
partial resistance being the null phenotype for this gene (Lewis et
al., 1980a).
Isolation and identification of phage containing nAChR
subunit gene homologs
To isolate phage carrying nAChR subunit genes, a library of
C. elegans genomic DNA was screened as described in
Materials and Methods with an ard cDNA probe, which encodes
a Drosophila non- subunit (Hermans-Borgmeyer et al.,
1986). Fifty-eight positive hybridizing phage were isolated. DNA from
the 14 strongest positives was isolated and placed on the physical map
by fingerprinting (Coulson et al., 1986). Several of these nAChR
homologs mapped to positions on the physical map that were very close
to the known genetic locations of levamisole resistance genes or
corresponded to clones simultaneously identified by transposon tagging
(unc-38 and unc-29). After revision of the
genetic map position of lev-1 by T.M.B., the map position of
this gene on chromosome IV was also consistent with the physical map
position of two phage clones (JF#WA10 and JF#WA18; Fig.
1A and Materials and Methods).
Characterization of the lev-1 locus
The identity of lev-1 as a gene encoding a
non--nAChR was established as follows. First, sequence analysis of
the phage occupying the expected physical map position of
lev-1 identified a 4.8 kb HindIII fragment that
contained an almost intact nAChR subunit gene, organized into eight
exons (GenBank accession number X98601). Second, a complete cDNA
sequence recovered from this region was found to encode an open reading
frame for a non--nAChR subunit of 507 amino acids clearly homologous
to vertebrate and insect nAChR subunits (Fig. 2). Third, when the
genomic phage clones were used to probe Southern blots of genomic DNA
from 11 mutator- and -ray-induced lev-1 mutants and five
EMS-induced mutants, allele-specific rearrangements were found by
T.M.B. that defined the lev-1 locus (Fig.
1A). Three of four -ray-induced alleles (x416, x427, and x438) and two of
seven mutator-induced alleles (x548 and
x566) were found to have rearrangements that included at least part of the 4.8 kb HindIII fragment identified by
ard hybridization or the adjacent 1.4 kb HindIII
fragment (x416). For three other mutator-induced
alleles, the 4.8 kb HindIII fragment was replaced by a 6.4 kb fragment, consistent with the insertion of a typical 1.6 kb Tc1
transposon element. By using two PCR primers, one an oligonucleotide
corresponding to the ends of the Tc1 element together and the other an
oligonucleotide corresponding to the sequence of either strand at
various positions within the 4.8 kb HindIII fragment
(Barnes, 1990), it was possible to locate precisely the transposon
within the 4.8 kb HindIII fragment (Fig. 1A). These results show that the lev-1
gene and a nAChR homolog co-localize to the same 4.8 kb
HindIII fragment. The null phenotype of lev-1 was
defined by the finding that most, if not all, of the coding region of
the gene is deleted by the x548 mutation and the homozygous
x548 null mutants are viable, partially
levamisole-resistant, pseudo-wild-type mutants.
Characterization of the unc-29 locus
unc-29 was identified as a non--nAChR subunit as
follows. Genomic phage fingerprinting to the region of
unc-29 on chromosome I were isolated based on the
identification of a novel Tc1 insertion associated with the
unc-29(x513) mutation. These phage overlapped the phage
JF#WA33 identified by cross-hybridization with the Drosophila ard probe (Fig. 1B). Hybridization of the phage
to Southern blots of DNA from mutator- and -ray-induced
unc-29 mutant identified RFLPs through a region spanned by a
6.0 kb HindIII fragment (Fig. 1B). The
sequence the 6.0 kb HindIII fragment contained the entire coding region, divided into 12 exons, of a non--nAChR subunit highly
homologous to lev-1 (GenBank accession number X98601). A
full-length 1.7 kb cDNA that contained an open reading frame of 493 amino acids (Fig. 2) was obtained from a C. elegans mixed stage library (provided by R. Barstead).
Mutant rescue experiments confirmed the cloning of unc-29.
Three cosmids that encompass the clone JF#WA33, and thus include all the regions affected by the unc-29 transpositions
described above (Fig. 1B), could rescue the
unc-29 mutant phenotype in transgenic animals. The cosmids
were able to rescue completely the unc phenotype and to
restore levamisole sensitivity, as were the smaller phage clones
ZZ#1 and JF#WA33. Even the 6.0 kb HindIII fragment that spans the unc-29 coding region and contains only 490 bp of
DNA upstream from the translational start site (Fig.
1B) is capable of rescuing unc-29 (S. Kim,
personal communication) (this work).
Because the mutant phenotype can be rescued by a transgene sequence, it
can be inferred that the transgene expression pattern includes those
tissues in which the endogenous gene is required. To monitor transgene
expression, we constructed a set of plasmids in which the coding region
for GFP (A. victoria green fluorescent protein) (Chalfie et
al., 1994) was fused to the C-terminal coding region for UNC-29. An
activated form of GFP (S65T) (Heim et al., 1994) was used to maximize
fluorescent signal. The resulting constructs were capable of rescuing
the mutant phenotypes of unc-29 alleles e193,
x29, x513, x520, x522,
x545, and e1072. A major focus of unc-29 promoter activity was seen in body muscles. To test
the hypothesis that UNC-29 expression in body muscles was sufficient for its function, we produced a construct in which unc-29
upstream sequences ("promoter") were removed and UNC-29/GFP
expression was driven by the body muscle-specific myo-3
promoter. The myo-3:: unc-29:: gfp fusion
was indeed capable of rescuing the mutant phenotypes of
unc-29 mutant animals. This was consistent with the
hypothesis that the primary focus of unc-29 was in body
muscle. The muscle staining is consistent with previous pharmacological data from studying C. elegans (Lewis et al., 1980b) and
physiological data from Ascaris that levamisole-sensitive
nAChRs are present on muscle (Harrow and Gration, 1985). Recent mosaic
studies using a unc-29 clone provided by us also show a
major focus of unc-29 expression to be muscle (Miller et
al., 1996b). We observed a low level of neuronal fluorescence, both
with the unc-29:: gfp fusion and with the
myo-3:: unc-29:: gfp fusion. It is not
clear whether this fluorescence represents bona fide activity in these cells.
The ability of GFP fusions to rescue the mutant phenotype allowed us to
examine the intracellular localization of a biologically functional
unc-29 derivative in living cells. Intracellular
localization in a wild-type background (i.e., in the presence of a
wild-type chromosomal copy of the gene) was somewhat surprising, with
activity predominantly internal to muscle cells. Because the presence
of the natural UNC-29 product might be expected to affect assembly of
the recombinant protein, we examined localization of the protein produced from an LJH5-derived extrachromosomal array in a variety of
unc-29 mutant genetic backgrounds. Several unc-29
mutant backgrounds behaved similarly to wild type in these assays (Fig.
3A-E), with the exogenous GFP fusion present
primarily in the cell body (e193, e1072,
x520, x522, and x545). However, when
the fusions were crossed into the homozygous mutant background provided
by unc-29(x29) (and to a lesser extent, x513),
relative localization was closer to that expected for a
neurotransmitter receptor (head region for x29 homozygote
shown in Fig. 3F-J) In addition, the overall amount
of staining within muscle appeared to decrease. Internal staining of
body muscles almost disappeared with punctate staining found along the
nerve cords. Because of the background of neuronal staining, it was
difficult to say what fraction of the staining in the nerve cords arose
from body muscles. Some staining in the unc-29(x29) mutant
background was still found internally in head muscles, but the relative
amount of staining localized to synaptic regions of the ring (the
central neuropil) greatly increased. These observations are consistent
with the idea that the UNC-29 protein produced from the chromosomal
copy of the unc-29 gene competes in the assembly and
localization of nAChR molecules with the UNC-29-GFP fusion protein.
Paradoxically, from the decrease in overall staining observed in a
unc-29(x29) background, the endogenous gene product may also
help stabilize the GFP fusion protein in assembly intermediates,
possibly suggesting that more than one UNC-29 subunit can be assembled
into an nAChR molecule. The null phenotype of unc-29 has yet
to be defined, but both homozygotes of the unc-29(x29) and
unc-29(e1072) mutations have been shown previously to
contain little or no detectable specific high-affinity [3H]MAL binding (Lewis et al., 1987b). Although
the focus of unc-38 and lev-1 expression has not
been defined in this study, the great similarity in mutant phenotypes
of unc-38 mutants and lev-1 semidominants to
unc-29 mutants makes it likely that muscle is also the major focus for the expression of these genes as well.
Fig. 3.
Serial optical sections showing expression of the
unc-29 promoter-driven
unc-29:: gfp fusion LJH5 in N2 wild type and in
the unc-29(x29) mutant strain. Confocal microscopic
sections through the head region of a wild-type and an
x29 mutant animal were accumulated as described in
Materials and Methods. Each picture represents a succesive 3 µm thickness of the head. A-E, Wild
type. Arrows in A point to fluorescence
in head muscles. Fluorescence is seen more intensely inside the same
muscles in B and also within a body muscle
(arrow). In E, a muscle process entering
the central neuropil next to the isthmus of the pharynx is stained
(arrow). Stain is also accumulated in a neuronal cell
body (arrowhead). F-J,
unc-29(×29) mutant. Less staining is seen overall, and
the stain is relatively concentrated in head muscle processes and nerve
cords with continued neuronal staining. In F, process
from anterior head muscles stain (arrowhead) and
punctate staining is seen in a nerve cord (arrow). In
H, the arrow points to a brightly staining neuronal cell body with a process running to the central neuropil, appearing as a hazy band in the
center. In I, arrows point
to brightly stained areas in the central neuropil immediately adjacent
to the isthmus of the pharynx that appear to be associated with muscle
processes running into the neuropil at this point. The same region is
stained in the center in J, with two
neuronal cell bodies below the
center.
[View Larger Version of this Image (28K GIF file)]
Characterization of the unc-38 locus
The unc-38 gene was identified by a novel
Tc1-containing RFLP found in four of five spontaneously induced
unc-38 mutants (see Fig. 1C and Materials and
Methods). Two of five -ray-induced unc-38 mutants also
showed a restriction size difference from wild type when the subcloned
genomic DNA flanking one of the Tc1 inserts was used as a hybridization
probe on genomic Southern blots. DNA extending through and beyond the
3.2 kb HindIII fragment that was the site of six
unc-38 mutations was sequenced and found to encode a
complete subunit of an nAChR (GenBank accession X98599). A complete
cDNA sequence reconstructed from this region encoded an open reading
frame of 511 amino acids with strong homology to known subunit
sequences of vertebrates and insects (Fig. 2). The fingerprint of
genomic phage containing this subunit gene was consistent with the
genetic map position of unc-38 to the left of
dpy-5 on chromosome I (Fig. 1C).
The cloning of unc-38 was confirmed by mutant rescue. The
injection of either cosmid B0241 or C04E4 into the germ line of unc-38 mutants completely restored normal movement in the L1
stage offspring, and the transgenic worms could now be killed by
exposure to 1 mM levamisole. The B0241 and C04E4 cosmids
completely encompass the phage ZZ#11 and ZZ#15 shown to contain the
sites of the unc-38 mutations (Fig. 1C).
The null phenotype of unc-38 was defined to be that of an
extremely levamisole-resistant unc. This finding was
originally suggested by sequence analysis that showed that the Tc1
insertion site in unc-38(x525) disrupts a reading frame 15 amino acids upstream from the dicysteine loop (amino acids 128-142,
Torpedo numbering) that is characteristic of all nAChR
subunits. Further mutant analysis showed that the EMS-induced mutation
unc-38(x20) is an absolute splicing defect in which the
third exon is skipped because the universal AG intron consensus
sequence at the third exon splice acceptor site is mutated to AA. The
mutation causes a transcript to be produced that is 155 bases shorter
than the wild type when detected by RT-PCR. Homozygous
unc-38(x20) mutants grow well and are among the most
resistant of all levamisole-resistant mutants to the effects of
levamisole and other cholinergic agonists (Lewis et al., 1980b).
Because body muscles of unc-38 mutants are more resistant
than head muscles to agonists, it is likely that there is at least one
other -nAChR subunit participating in the formation of other nAChR
isotypes, and these isotypes differ in tissue distribution from the
receptor formed with the unc-38 subunit.
Sequence comparison of LEV-1, UNC-29, and UNC-38
In Figure 2, the deduced amino acid sequences of the LEV-1,
UNC-29, and UNC-38 proteins are aligned and compared with vertebrate and insect nAChR subunit sequences. Comparison of the C. elegans sequences with database sequences shows that the nematode
sequences are most similar to the Drosophila melanogaster
nAChR subunit sequences ARD and ALS (Hermans-Borgmeyer et al., 1986;
Bossy et al., 1988) and to a partially sequenced putative nAChR subunit of the parasitic nematode Onchocerca volvulus (Ajuh and
Egwang, 1994). The nematode non- subunits UNC-29 and LEV-1 exhibit
the highest amino acid sequence identity to ARD (50 and 46%), whereas the subunit UNC-38 shows 49% identity to the ALS subunit. The predicted mature lengths of the three C. elegans nAChR
subunits are 488 amino acids for UNC-38, 467 for UNC-29, and 473 for
LEV-1. Whereas the subunit of vertebrate muscle is the smallest
muscle nAChR subunit, UNC-38 is the longest of the known nematode nAChR subunits, a relative size difference that holds for other invertebrate and for vertebrate neuronal subunits compared with their non- counterparts. The main structural features of the nAChR
subunits of higher organisms are strikingly conserved in phylogeny down to the nematode, including the positions of the four transmembrane domains (TM1-4), the high sequence similarity found in each TM region,
the variable long loop between TM3 and TM4, and the dicysteine loop,
which is a hallmark of this superfamily and invariably found at the
equivalent to positions 128-142 of the Torpedo subunit (Barnard, 1992). There seem to be additional regions in all subunits of invertebrates that have no counterpart in vertebrates. These insertions occur 25 amino acids N-terminal to the vicinal cysteines (equivalent to positions 192 and 193 of the
Torpedo subunit) and at the C terminus of the
polypeptide. The functional significance of these domains is unknown.
The insertion N-terminal to the vicinal cysteines is 13 amino acids
longer for the nematode UNC-38 subunit than for locust and
Drosophila subunits and is absent from invertebrate
non- subunits.
UNC-29 and LEV-1 are highly homologous: 66% amino acid identity or,
with conservative substitutions, 77% similarity, a resemblance found
for few other nAChR subunit pairs from the same species. They are
categorized as non- subunits by the absence of vicinal cysteines (at
positions 192 and 193, Torpedo numbering) and when
compared with vertebrate nAChRs show the closest homology to neuronal
subunits. Both UNC-29 and LEV-1 are about equally similar to neuronal
and non- of the rat and chick (rat 2-4 and 2-4,
chick 2 and 4 and 2 and 4) with UNC-29 showing slightly
greater over all sequence similarity, ~55 versus ~50% for LEV-1.
Consistent with these results, many aspects of the in situ
pharmacology of muscle nAChRs of C. elegans and
Ascaris resemble those of vertebrate neuronal nAChRs,
including insensitivity to -bungarotoxin, block by mecamylamine
(Lewis et al., 1987a, 1980b; Fleming et al., 1993), and, in the case of
Ascaris suum muscle nAChRs, block by 
-bungarotoxin
(Colquhoun et al., 1993).
Intron-exon structure comparisons and phylogenetic analysis using
accepted mutation parsimony trees
Between unc-29 and the , , and subunits
of vertebrate muscle (Nef et al., 1984; Buonanno et al., 1989), the
positions of 5 of the 11 introns are completely conserved, and an
additional 3 intron positions are within four amino acids of the
equivalent sites in the vertebrate muscle subunits. The inexact
conservation of some intron-exon boundaries may be attributable to
splice junction drift or de novo creation of introns at
"permissible" sites. The locations of four of the seven
lev-1 introns and three of the seven unc-38
introns are identical in unc-29. However, only one intron
location, between exons 5 and 6 in unc-29, is shared between unc-38 and lev-1, and this site is present in all
nAChR subunit genes. The flanking exons seem to form a calcium-binding
domain (Godzik and Sander, 1989), although its significance has not
been well defined. A unc-29-unc-38 common splice
site occurring between exons 3 and 4 of unc-29 is conserved
in all nAChR subunit genes examined except lev-1. These
findings suggest that the conserved splice sites predate the divergence
of nematodes, insects, and vertebrates, which occurred about 600 million years ago. Unique to the nematode receptors is an intron that
interrupts the coding region between TM4 and the C terminus in each of
the three nematode subunits. Although the gene structures of
unc-29 and lev-1 show considerable similarity,
unc-38 is no more homologous to the other C. elegans subunits than any other insect or vertebrate nAChR subunit
genes, suggesting that the divergence between and non- subunits
is very ancient. The intron-exon structure of all three nematode genes
is also more typical of the highly interrupted vertebrate muscle nAChR
genes than it is of the vertebrate neuronal nAChR genes (Nef et al.,
1988), in which there is generally only a single intron between the
conserved splice sites in the extracellular domain and at the end of
the protein.
A maximum parsimony analysis for nAChR polypeptides is shown in Figure
4. The polypeptide sequences of 22 nAChRs and the rat GABAA 1 receptor subunit were aligned. Using PAUP, a
single tree of length 2384 changes was found (Swofford, 1991). The
significance of this tree was evaluated using bootstrap analysis
(Felsenstein, 1992). The resulting tree shows that nAChRs fall into
several distinct classes. The C. elegans subunits LEV-1 and
UNC-29 are very closely related and, of the other sequences analyzed,
are most similar to the Drosophila neuronal subunit ARD.
UNC-38 represents an subunit type closely related to the
Drosophila -like neuronal subunits. Although the
distinctiveness of UNC-38 on the tree is not strongly supported by the
bootstrap analysis, it is consistent with the unique pharmacological
properties of nematode nAChRs as observed for C. elegans and
Ascaris.
Potential glycosylation and phosphorylation signals in UNC-29,
UNC-38, and LEV-1
Sequence prediction of glycosylation sites for the vertebrate
muscle nAChR subunits, now confirmed biochemically (Claudio et al.,
1989), indicated a single glycosylation site for the and subunits, two for the , and three for the muscle subunits. The
vertebrate neuronal sequences usually contain two potential glycosylation signals. The sequences of UNC-29, UNC-38, and LEV-1 predict two, three, and five asparagine-linked glycosylation sites, respectively. There is no glycosylation site common to all three subunits, and only one shared between UNC-29 and LEV-1 at asparagine 50 (UNC-29 numbering), a site that is also present in nearly all invertebrate and vertebrate neuronal sequences (but lacking in human
4 and goldfish non-3). UNC-38 is the only invertebrate sequence
to lack this site, and the three glycosylation signals UNC-38 contains
are not in positions common to any other nAChR. An asparagine
109-linked glycosylation site in LEV-1 is conserved in 2 and 4
neuronal sequences and in the chick muscle subunit.
The Torpedo nAChR can be phosphorylated by at least
three different protein kinases: cAMP-dependent protein kinase (PKA), protein kinase C (PKC), and a tyrosine kinase (TK) (Huganir and Greengard, 1983; Huganir et al., 1984; Huganir, 1988). The region of
the Torpedo receptor that was shown to be phosphorylated is the intracellular loop between TM3 and TM4. In the equivalent regions,
the C. elegans UNC-29 subunit has three PKC sites, one PKA
site, and one TK site; UNC-38 has single PKC and TK sites; LEV-1 has
only a single PKC site. Studies with vertebrate nAChR subunits have
shown phosphorylation to be involved in desensitization, receptor
turnover, and receptor assembly. The in vivo functions of
the glycosylation and phosphorylation sites can be investigated in
C. elegans by mutagenizing a given site and then returning the altered gene to a null mutant strain that cannot otherwise produce
the targeted subunit.
Expression of unc-29, unc-38, and lev-1 in
Xenopus oocytes
In earlier studies, RNA isolated from mixed stage wild-type
C. elegans was injected into Xenopus oocytes with
the result that a dose-dependent depolarization was detected in
response to bath-applied levamisole (Fleming et al., 1991, 1993). The
levamisole response was not blocked by -bungarotoxin (Tornoe et al.,
1995), in agreement with
[3H]meta-aminolevamisole-binding
studies using membrane fragments (Lewis et al., 1987a) and cut worm
muscle contraction assays (Lewis et al., 1980b). Cytoplasmic
co-injection of cRNAs encoding UNC-29, LEV-1, and UNC-38 resulted
in inwardly directed currents (holding potential, 60 mV) in response
to levamisole (1 × 104 M),
whereas oocytes injected separately with message encoding a single
subunit or the equivalent volume of distilled water showed no such
responses (Fig. 5A-E). Pairwise injection of
all possible combinations yielded either no responses or inconsistent
responses. In oocytes inje
