 |
Previous Article | Next Article 
Volume 17, Number 16,
Issue of August 15, 1997
pp. 6086-6093
Copyright ©1997 Society for Neuroscience
Phosphorylation at a Single Site in the Rat Brain Sodium Channel
Is Necessary and Sufficient for Current Reduction by Protein Kinase
A
Raymond D. Smith and
Alan L. Goldin
Department of Microbiology and Molecular Genetics, University of
California, Irvine, California 92697-4025
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Voltage-gated sodium channels respond to excitatory inputs in nerve
cells, generating spikes of depolarization at axon hillock regions and
propagating the initial rising phase of action potentials through
axons. It previously has been shown that protein kinase A (PKA)
attenuates sodium current amplitude 20-50% by phosphorylating serines
located in the I-II linker of the sodium channel. We have tested the
individual contributions of five PKA consensus sites in the I-II
linker by measuring sodium currents expressed in Xenopus oocytes during conditions of PKA induction. PKA was induced by perfusing oocytes with a cocktail that contained forskolin,
chlorophenylthio-cAMP, dibutyryl-cAMP, and 3-isobutyl-1-methylxanthine.
Phosphorylation at the second PKA site (serine-573) was necessary and
sufficient to diminish sodium current amplitude. Phosphorylation at the
third and fourth positions (serine-610 and serine-623) reduced current amplitude, but the effect was considerably smaller at those positions. Introduction of a negative charge at site 2 by substitution of serine-573 with an aspartate constitutively reduced the basal level of
sodium current, indicating that the attenuation of sodium current by
phosphorylation of site 2 by PKA results from the introduction of a
negative charge at this site.
Key words:
ion channel;
modulation;
cAMP;
site-directed mutagenesis;
sodium channel;
phosphorylation;
protein kinase A;
Xenopus
oocytes;
forskolin
INTRODUCTION
Voltage-gated sodium channels play a
key role in the transmission of signals through electrically excitable
cells. If the spatial summation of excitatory and inhibitory inputs
exceeds a threshold level of membrane depolarization, sodium channels that are localized at high density in the axon hillock region of nerve
cells are activated, resulting in initiation of an action potential.
Therefore, one mechanism by which electrical excitability can be
regulated is by altering the activity of sodium channels.
Phosphorylation by protein kinase A (PKA) is a common regulatory
mechanism that is observed for a large number of proteins. In the case
of the voltage-gated rat brain sodium channel, PKA phosphorylation
modifies channel function by reducing the peak current amplitude but
without affecting sodium current kinetics or the voltage dependence of
conductance or inactivation (Gershon et al., 1992 ; Li et al., 1992 ;
Schiffmann et al., 1995 ; Smith and Goldin, 1996 ). When purified PKA was
applied to patches that were excised from transfected Chinese hamster
ovary (CHO) cells, sodium current magnitude was reduced by 40-50%,
resulting from a decrease in the open probability of the channels (Li
et al., 1992 ). Similarly, when the sodium channel was expressed in
Xenopus oocytes, PKA induction either by forskolin or by
isoproterenol stimulation of a coexpressed 2-adrenergic
receptor reduced current amplitude by 20-30% (Gershon et al., 1992 ;
Smith and Goldin, 1996 ). All other electrophysiological properties of
the channel were unchanged. Finally, when PKA was induced in cultured
striatal neurons from neonatal rats by treatment with the dopamine
D1 receptor agonist SKF38393, peak sodium current amplitude
was reduced reversibly by 38% (Schiffmann et al., 1995 ). The decrease
was blocked by pretreatment of the cells with protein kinase inhibitor,
a specific inhibitor of PKA, demonstrating the involvement of PKA. The
excitability of the treated neurons also was reduced, as evidenced by
an elevated threshold for the generation of action potentials.
The sodium channel from rat brain is a substrate for phosphorylation by
PKA (Costa et al., 1982 ; Costa and Catterall, 1984 ; Rossie and
Catterall, 1987 ), and that phosphorylation is restricted to PKA
consensus sites located in the cytoplasmic linker that connects domains
I and II of the channel (Rossie et al., 1987 ; Rossie and Catterall,
1989 ; Murphy et al., 1993 ). We have shown previously that the
attenuation of sodium current by PKA requires specific phosphorylation
at these sites (Smith and Goldin, 1996 ). When five PKA consensus sites
in the I-II linker were eliminated either by deletion or by collective
substitution of the serines with alanines, PKA-mediated attenuation of
current amplitude was prevented. If aspartates were substituted at all
five of the PKA sites to mimic the negative charge resulting from
phosphorylation, sodium current amplitude was reduced constitutively,
suggesting that the reduction of current by phosphorylation is caused
by the introduction of negative charge(s) at one or more of the
sites.
In this report we demonstrate that the second PKA site in the I-II
linker (containing serine-573) is both necessary and sufficient for PKA
current attenuation. Replacement of serine-573 with an aspartate
resulted in a channel that expressed a constitutively reduced level of
current. We also show that phosphorylation at sites 3 and 4 reduced
current amplitude but to a lesser extent than did phosphorylation at
site 2. These results indicate that phosphorylation reduces sodium
current amplitude primarily by introducing a negative charge at
serine-573.
MATERIALS AND METHODS
Site-directed mutagenesis
The plasmid pVA2580 contains the rat brain IIA (RIIA) sodium
channel coding region downstream from a T7 RNA polymerase promoter (Auld et al., 1990 ). Site-directed mutagenesis was performed either by
M13 mutagenesis or by PCR. Each of the mutations was confirmed by DNA
sequencing to confirm the engineered changes and to rule out other
mutations caused by polymerase error.
M13 mutagenesis. The I-II linker region of RIIA, as defined
by the unique Tth111I and SphI restriction sites
in pVA2580, was subcloned into mp18A, a version of mp18 with a
polylinker region that was modified to contain unique restriction sites
in the RIIA coding region. M13 single-strand mutagenesis was used to
create mutations, as previously described (Smith and Goldin, 1996 ). The FLAG epitope (Hopp et al., 1988 ) was incorporated into the N terminus of the sodium channel, using M13 loop-in insertion mutagenesis. The
following oligonucleotides were used for mutagenesis:
S554(A/D)-S555(A/D), GACTGGTGCGGA(G/T) CG(G/T)CAAATCTCTTCTC; S573(A/D),
AGGCTTGCTCTA(C/T) CGTTGCGTCTT; S610(A/D),
GGTACAAATAGA(G/T)CGTCTCTTCTG; S623(A/D), CCTGGCTGACATTG(G/T)CAGGACGCCTTTCTC;
S686(A/D)-S687(A/D)-S688(A/D), GAGACGTGGTAA(G/T)CA(G/T)CG(G/T)CTCTCCTCTTCCT; and FLAG
insertion, GACCGTGCTTTAT CGTCATCGTCTTTATAGTCCATTCTTTGTCGACG.
PCR mutagenesis. To generate mutant channels with single PKA
sites present, we used the PKACOMP-A mutant as a starting PCR template.
For each construct two overlapping PCR products that spanned the region
between the unique restriction sites AatII and
BglII were amplified, using two pairs of primers. The
following primers were used in the combinations A + C and B + D: A (sense primer upstream of AatII),
CGAGCATTGAAAACAATATC; B (antisense primer downstream of
BglII), GGAGATACAAGCGTCTTTCTTG; C (antisense
primers complementary to wild-type PKA sites), S554/S555,
TGGTGCGGAGAGGAAAATCT; S573, CTTGCTCTACTGTTGCGTCT; S610, TACAAATAGAGAGTCTCTTCTGC; S623,
GCTGACATTGCTAGGACGCC; S686/S687/S688,
GGTAAGAACTGGATCTCCTC; and D (sense primer upstream of
wild-type PKA sites), CGGAAATCTGCCTCTGAGGA.
PCR conditions consisted of 2 ng of template, 1.25 µM
dNTPs, 20 µM primers, 1.5 µM
MgCl2, and 0.5 µl of Amplitaq polymerase (2.5 U/100 µl) in Amplitaq polymerase buffer (Perkin-Elmer, Foster City,
CA). The template was heat-denatured at 95°C, oligonucleotides were
annealed at 50°C, and DNA was synthesized by Taq polymerase at
72°C. After 30 amplification cycles the products were gel-purified with a 1% agarose gel and Geneclean (Bio 101, Vista, CA). Then the two
overlapping products for each construct were combined into one tube,
and the region spanning AatII-BglII was
amplified with the primers A and B described above. The final product
was cut with AatII and BglII and ligated into the
corresponding sites in the plasmid containing the full-length sodium
channel.
Transcription of RNA and expression in
Xenopus oocytes
RNA transcripts were synthesized from NotI-linearized
DNA templates by a T7 RNA polymerase Message Machine transcription kit (Ambion, Austin, TX). The yield of RNA was estimated by glyoxal gel
analysis. Stage V oocytes were removed from adult female Xenopus laevis frogs, prepared as previously described (Goldin, 1991 ), and
incubated in ND-96 media (96 mM NaCl, 2 mM KCl,
1.8 mM CaCl2, 1 mM
MgCl2, and 5 mM HEPES, pH 7.5)
supplemented with 0.1 mg/ml gentamicin, 0.55 mg/ml pyruvate, and 0.5 mM theophylline. Sodium channel RNA was injected at ~100
pg/oocyte. After a 40 hr incubation at 20°C in ND-96, sodium currents
were recorded with a two-electrode voltage clamp at room temperature,
as previously described (Patton and Goldin, 1991 ). Sodium current
amplitudes were between 1 and 5 µA. Acquisition and analysis were
performed with pCLAMP 6.0.3 software (Axon Instruments, Foster City,
CA). Capacitive transients and leak currents were corrected by P/4
subtraction. The bath recording solution consisted of ND-96, and PKA
was induced by perfusing oocytes with a cocktail consisting of 25 µM forskolin, 10 µM chlorophenylthio-cAMP
(cpt-cAMP), 10 µM dibutyryl-cAMP (db-cAMP), and 10 µM 3-isobutyl-1-methylxanthine (IBMX) for 10 min. These compounds all increase cytoplasmic cAMP levels and therefore can activate PKA. Forskolin activates adenyl cyclase, cpt-cAMP and db-cAMP
are membrane-permeable stable analogs of cAMP, and IBMX is an inhibitor
of phosphodiesterases that otherwise could convert cAMP to AMP.
Forskolin was prepared at a stock concentration of 50 mM in
dimethyl sulfoxide (DMSO), cpt-cAMP and db-cAMP were prepared at stock
concentrations of 10 mM in water, and IBMX was prepared at
a stock concentration of 10 mM in EtOH. All of these reagents were obtained from Sigma (St. Louis, MO). Stock solutions were
stored at 20°C. The rate of perfusion with bath solution was
adjusted carefully to 0.3 ml/min to minimize fluctuations in current
amplitude resulting from changes in flow rate. In some cases there was
drift in the peak current amplitude even after allowing for recovery
from slow inactivation. In those cases the peak current measurements
were adjusted by subtracting a linear relationship that was fit to data
acquired during the first 10 min before PKA stimulation.
Isolation of sodium channel protein from oocytes
Pools of 40 oocytes were injected with 50 ng/oocyte of wild-type
or mutant sodium channel RNA and 250 nCi of 35S-methionine
(DuPont NEN, Boston, MA). Injection of 50 ng of RNA resulted in sodium
current amplitudes of ~50 µA. The wild-type and mutant sodium
channels contained the FLAG epitope (DYKDDDDK) immediately after the
start methionine codon. Insertion of FLAG did not alter the functional
properties of the channel. 35S-methionine was injected to
determine the total amount of sodium channel protein synthesized.
Sodium channel protein was purified from the membrane fraction of
oocytes by immunoprecipitation with M2 anti-FLAG antibody (VWR,
Cerritos, CA), as previously described (Smith and Goldin, 1996 ). The
proteins were analyzed on a 7.5% SDS polyacrylamide gel with a 3%
stacking gel. The gel was fixed and washed two times with DMSO for 1 hr
each time. To enhance the 35S signal by autoradiography, we
soaked the gel in 2,5-diphenyloxazole (PPO) in DMSO for 1 hr and then
washed it three times with water for 1 hr each. The gel was dried and
analyzed by autoradiography (1 d exposure), and the 35S
signal in bands corresponding to sodium channel protein was quantified
by scanning densitometry. The gel autoradiograph in Figure 5 was
scanned with a Hewlett Packard Scanjet IIcx/T with a transparency
adapter, and band densities were quantified with SigmaScan software
(Jandel, San Rafael, CA). Although all of the samples were treated
identically and run on the same polyacrylamide gel, the lanes
corresponding to the PKACOMP-D and Site2-D channels were positioned
adjacent to the wild-type and PKACOMP-A lanes by Adobe Photoshop. The
otherwise unmodified gel image was labeled and converted to a
print.
Fig. 5.
A negative charge at site 2 is sufficient to
decrease sodium current amplitudes. A, Quantification of
sodium channel protein. RNA encoding the sodium channel was injected
into oocytes along with 35S-methionine to label the
proteins metabolically. After 40 hr of incubation at 20°C, sodium
channel protein was immunoprecipitated from the oocyte membrane
fraction and analyzed by SDS-PAGE and autoradiography, as described in
Materials and Methods. The band representing sodium channel protein
(indicated by an arrow; Mr 260 kDa) was scanned and quantified. Molecular weight markers of 200 and 97 kDa were run in the first lane of the gel. B, Sodium current
normalized to the amount of membrane sodium channel protein. Peak
current amplitudes were measured in representative oocytes by
depolarizations to 20 mV from a holding potential of 100 mV
(n = 15 oocytes). The sodium current magnitude was
~50 µA in ND-96 bath solution. To maintain voltage control using a
two-electrode voltage clamp with oocytes expressing such high levels of
current, we reduced sodium in the bath by substitution with choline.
Sodium current was normalized to the amount of protein isolated
(A), and the ratios of current to protein were
normalized to the ratio for the wild-type channel, which was set at
1.0. Data are expressed as mean ± SD. The normalized ratio of
current to protein for the PKACOMP-A channel was not significantly
different from that of the wild-type channel. The asterisk
indicates that the ratios for the PKACOMP-D and Site2-D channels
were significantly reduced, compared with the level of the wild-type
channel, as determined by t test analysis (PKACOMP-D,
p < 0.001; Site2-D, p < 0.05).
[View Larger Version of this Image (26K GIF file)]
RESULTS
PKA sites in the I-II linker are required for
current reduction
To examine the role of the five PKA consensus sites in the I-II
linker of the sodium channel, we altered the sites by site-directed mutagenesis in three ways (Fig. 1).
First, the five sites were eliminated collectively, replacing the
serine residues with alanines to generate the PKA composite alanine
mutant (PKACOMP-A) or with aspartates to generate the PKA composite
aspartate mutant (PKACOMP-D), as previously described (Smith and
Goldin, 1996 ). Because there are two and three serines present at PKA
sites 1 and 5, respectively, all of the serines at those consensus
sites were substituted. Second, to test if the individual sites were
required for the reduction of current, we eliminated each individually
(Fig. 1, Single Site Knock-outs). Finally, to determine if
any of the individual PKA sites were sufficient to enable PKA-mediated
current reduction, we constructed channels with single active sites
(Fig. 1, Single Sites Active).
Fig. 1.
Diagram of PKA site mutant sodium channels.
Diagram of the rat brain sodium channel, emphasizing the presence of
the five consensus PKA phosphorylation sites (RRXS and KRXXS) in the
cytoplasmic linker that connects domains I and II of the channel. Amino
acid positions are indicated above the serine residues
within the consensus sites, and the number of amino acids
separating each site is indicated by the subscripts after
the symbol X. For the PKACOMP-A mutant, all of the PKA sites
were eliminated collectively by replacing all serine residues at the
five sites with alanines. For the PKACOMP-D mutant, the serines were
replaced with aspartates to mimic the negative charges resulting from
phosphorylation. Single PKA sites were eliminated (Single Site
Knock-outs) by replacing serines with alanines at each position. A
second series of channels was constructed in which all of the sites
except one were modified by serine to alanine substitutions
(Single Sites Active). The Site2-D mutant has an
aspartate at position 2 (S573D) in a channel in which all of the
serines at the other I-II linker PKA sites have been replaced with
alanines.
[View Larger Version of this Image (37K GIF file)]
To measure the functional impact of PKA phosphorylation on the channel,
we induced PKA in Xenopus oocytes while eliciting sodium
currents by depolarizing pulses to 10 mV at 1 min intervals over a 50 min time course. Representative wild-type sodium current traces and the
corresponding time course of peak current amplitudes are shown in
Figure 2, A and B.
The basal current level was determined during the first 10 min of
recording. For the results shown in Figure 2, A and
B, there was a slightly increasing trend, which is shown by
the dashed line in Figure 2B. To compensate for the change in basal current, we fit data acquired during the first 10 min
with a linear equation (indicated by the dotted line in Fig.
2B), and we derived final peak current values by
subtracting the linear fit from the measured peak current values (Fig.
2C). Then the adjusted values were normalized to the
baseline current during the first 10 min (Fig. 2C,
dotted line).
Fig. 2.
PKA modulation of the sodium channel.
A, Representative wild-type sodium current traces. Sodium
currents were obtained by depolarizing pulses to 10 mV from a holding
potential of 100 mV. Four traces are shown during
depolarizations at 1, 10, 20, and
40 min during a 50 min time course. PKA was induced in the oocyte as described in B during the 10-20 min time
interval. B, Time course for wild-type peak current
amplitude. Peak sodium current values are shown during a 50 min time
course. The baseline current level was established during an initial 10 min interval (the dotted line represents a linear fit to the
first 10 data points). PKA was induced during the 10 min time period
indicated by the bar denoted Cocktail by
perfusing with a PKA activation cocktail containing 25 µM
forskolin, 10 µM cpt-cAMP, 10 µM db-cAMP, and 10 µM IBMX. Peak current values that correspond to
the current traces in A (at 1, 10, 20, and 40 min) are
indicated by the filled symbols. C, Adjusted and
normalized time course for wild-type sodium channel peak current
amplitude. The current values shown in B were adjusted by
subtracting the linear relationship that was fit to the first 10 data
points to compensate for the change in basal current. The adjusted
values were normalized to the baseline current during the initial 10 min (dotted line). Calibration bars indicate a 20% relative
change in current amplitude and a 10 min interval. D,
Representative PKACOMP-A sodium current traces. Sodium currents were
obtained by depolarizing pulses to 10 mV from a holding potential of
100 mV. Four traces are shown for time points obtained at
1, 10, 20, and 40 min
during a 50 min time course. PKA was induced in the oocyte as described
in B during the 10-20 min time interval. E, Time
course for PKACOMP-A peak current amplitude. Peak sodium current values
are shown during a 50 min time course. The baseline current level was
established during an initial 10 min interval (the dotted
line represents a linear fit to the first 10 data points). PKA was
induced during the 10 min time period indicated by the bar
denoted Cocktail, as described in B. Peak current
values that correspond to the current traces in D (at 1, 10, 20, and 40 min) are
indicated by the filled symbols. F, Adjusted and
normalized time course for PKACOMP-A sodium channel peak current
amplitude. The current values shown in E were adjusted by
subtracting the linear relationship that was fit to the first 10 data
points to compensate for the change in basal current. The adjusted
values were normalized to the baseline current during the initial 10 min (dotted line). The calibration bars are shown in
C and indicate a 20% relative change in current amplitude
and a 10 min interval.
[View Larger Version of this Image (24K GIF file)]
A PKA activation cocktail containing a mixture of 25 µM
forskolin, 10 µM cpt-cAMP, 10 µM db-cAMP,
and 10 µM IBMX was perfused for a 10 min interval, as
indicated by the bar denoted Cocktail (Fig. 2B,
C). For the wild-type channel, activation of PKA reduced sodium current amplitude at the 20 min time point by 17% relative to
baseline (Fig. 2A-C), but there was no
effect on the kinetics of inactivation. In addition, there were no
effects on either the voltage dependence of conductance or inactivation
(data not shown). These results are in agreement with previous reports
showing that PKA phosphorylation attenuates sodium currents without
affecting either the kinetics or voltage-dependent properties of the
channels (Gershon et al., 1992 ; Li et al., 1992 ; Smith and Goldin,
1996 ).
When sodium currents were measured from the PKACOMP-A channel, a
consistent and marked decrease in basal current amplitude was observed
(Fig. 2D, E). This decreasing trend was
linear over a 50 min interval in oocytes in which PKA was not induced
(data not shown). For the representative data shown in Figure
2E, the current amplitude decreased from ~1550 to
1450 nA during the first 10 min before PKA activation. The
magnitude of this baseline change was the largest that we observed with
any of the mutants. To compensate for the changing baseline, we fit
data acquired during the first 10 min with a linear equation (Fig.
2E, dotted line), which was subtracted
from the measured peak current values, as described for the wild-type
channel. The adjusted values were normalized finally to the level of
current during the first 10 min of recording (Fig.
2F, dotted line).
In contrast to the wild-type channel, the PKACOMP-A sodium channel did
not show a reduction in current in response to PKA induction,
confirming that the five PKA sites are essential for PKA-mediated
current reduction (Smith and Goldin, 1996 ). Instead, elimination of the
five PKA sites resulted in a channel that showed an enhancement of
current in response to PKA induction. The increase in current size for
the representative example shown in Figure 2F was
15% at the 20 min time point, but the current continued increasing
until reaching a final level of 32% above baseline at the 40 min time
point (30 min after PKA induction). The mechanism that causes this
enhancement of current is not understood, but it is consistent with
previous studies on the rat brain (Smith and Goldin, 1992 , 1996 ) and
cardiac (Frohnwieser et al., 1997 ) sodium channels. Apparently, there
is a secondary PKA-triggered event that increases the amplitude of
whole-cell sodium current in oocytes. Although this enhancement of
current is striking, we do not address this effect in this paper.
Instead, we have focused on whether the presence or absence of the
individual I-II linker sites enables reduction of sodium current
amplitude by PKA.
Site 2 is necessary for current reduction by PKA
To test the importance of each of the five PKA sites for mediating
sodium current reduction, we individually eliminated the sites by
replacing serines with alanines (Fig. 1, Single Site Knock-outs). The responses of these channels to PKA induction are
summarized in Figure 3, B and
C. For the purpose of comparison, representative responses
to PKA induction are shown again for the wild-type and PKACOMP-A
channels (Fig. 3A). The average reduction in current size
for the wild-type channel in multiple oocytes was 9% at the 20 min
time point, as indicated in Figure 3C. The average increase
in current amplitude for the PKACOMP-A channel measured in multiple
oocytes was 6% at the 20 min time point. Elimination of PKA sites 1, 3, 4, or 5 did not significantly alter the response of the channel to
PKA induction when compared with the wild-type channel. Each of these
mutants demonstrated reductions in current amplitude that ranged
between 4 and 8% at the 20 min time point. In marked contrast, removal
of site 2 ( Site2) completely eliminated the PKA-mediated reduction
of current amplitude. Instead, this channel showed a pronounced 12%
enhancement of current, similar to the response of the PKACOMP-A
channel in which all of the PKA sites are absent. The data are
summarized in Figure 3C and demonstrate that only the
removal of site 2 abolishes the reduction of current by PKA. Therefore,
site 2 is necessary for PKA-mediated current attenuation.
Fig. 3.
Site 2 is necessary for current reduction by PKA.
A, Representative time courses for wild-type and PKACOMP-A
channels. Adjusted and normalized peak current amplitudes are shown for
representative oocytes injected with RNA encoding the wild-type and
PKACOMP-A mutant channels. Currents were elicited by step
depolarizations from a holding potential of 100 to 10 mV, with a
sampling interval of 1 min. Peak current amplitudes were adjusted and
normalized as described in Figure 2C, F. The
basal level of current, indicated by the dashed lines, was
established during an initial 10 min interval. PKA was induced by
perfusion with a cocktail (25 µM forskolin, 10 µM cpt-cAMP, 10 µM db-cAMP, and 10 µM IBMX) for 10 min, as indicated by the solid
bar denoted Cocktail. The 20 min time point (indicated
by solid circles) was chosen to emphasize the reduction in
current for the wild-type channel and the enhancement of current for
the PKACOMP-A channel after PKA induction. Scale bars indicate a 10 min
interval and a 20% change in current amplitude. B,
Representative time courses for single site knock-out mutants. Adjusted
and normalized peak current amplitudes are shown for sodium channels
lacking single PKA sites. PKA was induced by a 10 min perfusion of
cocktail, as indicated by the solid bars. Recording
conditions and time and amplitude scales are the same as in
A. C, Average percentage of changes in current
amplitudes. The percentages of current change at the 20 min time points
are plotted for each of the channels represented in A and
B. The values reflect the average change in current
amplitude with corresponding SD values for each of the different sodium
channels 10 min after PKA induction. Sample sizes were wild-type, 9;
PKACOMP-A, 8; and 5 for each of the single site knock-out
mutants.
[View Larger Version of this Image (21K GIF file)]
Site 2 is sufficient for current reduction by PKA
To determine if single PKA sites when present alone are sufficient
to mediate a reduction in current amplitude, we tested channels in
which each of the five sites was individually present (Fig. 1,
Single Sites Active). For the purpose of comparison, representative responses to PKA induction of the wild-type and PKACOMP-A channels are shown again in Figure
4A. When the channels with single sites active were tested, it was observed that a single PKA
site at position 1, 3, 4, or 5 did not enable current reduction at the
40 min time point (Fig. 4B, C). In fact,
these channels behaved in a manner similar to the PKACOMP-A mutant,
showing increases of 11-33% in current size (Fig. 4C). In
striking contrast, when only the PKA site at position 2 was active
( Site2), there was a pronounced 28% reduction in current amplitude,
similar to the type of response observed with the wild-type channel
(Fig. 4B, C). Therefore, the results for
the Site2 and Site2 channels are in complete accordance and,
taken together, show that PKA phosphorylation of serine 573 is both
necessary and sufficient for the attenuation of sodium current
amplitude.
Fig. 4.
Site 2 is sufficient for current reduction by PKA.
A, Representative time courses for the wild-type and
PKACOMP-A channels. Adjusted and normalized peak current amplitudes are
shown for representative oocytes injected with RNA encoding the
wild-type and PKACOMP-A mutant channels. Currents were elicited by step depolarizations from a holding potential of 100 to 10 mV at a
sampling interval of 1 min. Peak current amplitudes were adjusted and
normalized as described in Figure 2C, F. The
basal level of current (indicated by the dashed lines) was
established during an initial 10 min interval. PKA was induced by
perfusion with a cocktail (25 µM forskolin, 10 µM cpt-cAMP, 10 µM db-cAMP, and 10 µM IBMX) for 10 min, as indicated by the solid
bar denoted Cocktail. The 20 and 40 min time points
(indicated by solid circles) were chosen to emphasize the
PKA-mediated reduction in current at both times for the wild-type
channel, in contrast to the enhancement of current for the PKACOMP-A
channel. Scale bars indicate a 10 min interval and a 20% change in
current amplitude. B, Representative time courses for
channels with single active PKA sites. Adjusted and normalized peak
current amplitudes are shown for sodium channels that have single PKA
sites present. PKA was induced by a 10 min perfusion of cocktail, as
indicated by the solid bars. Recording conditions and time
and amplitude scales are the same as in A. The 20 and 40 min
time points (solid circles) are highlighted to emphasize the
initial reduction in current at 20 min for the Site3 and Site4
channels and the enhancement of current at 40 min for these channels
after PKA induction. C, Average percentage of changes in
current amplitudes at 40 min. The percentage of current change at the
40 min time points is shown for each of the channels represented in
A and B. These values reflect the average change
in current amplitude with corresponding SD values for each of the
channels 30 min after PKA induction. Sample sizes were wild-type, 9;
PKACOMP-A, 8; and 8, 6, 7, 8, and 5 for channels with single sites
active at positions 1-5, in that order. D,
Average percentage of changes in current amplitudes at 20 min. The
percentage of current change at the 20 min time points is shown for
each of the channels represented in A and B.
These values reflect the average change in current amplitude with
corresponding SD values for each of the channels 10 min after PKA
induction. The sample sizes were the same as for
C.
[View Larger Version of this Image (25K GIF file)]
PKA can act through sites 3 and 4 to produce a minor amount of
current reduction
Although the PKA sites at positions 3 and 4 ( Site3 and
Site4) did not mediate a reduction in current at the 40 min time point, there was initially a minor reduction in current at the 20 min
time point for both of these channels (Fig. 4B,
D). The magnitude of the reduction was significantly less
than that for the wild-type and Site2 channels. The Site2 channel
showed a dramatic reduction in current of 21%, whereas the Site3
and Site4 channels demonstrated average reductions of only 1 and
5%, respectively. The reductions for the Site3 and Site4
channels were significantly (p < 0.05)
different from the 6% increase observed for the channel lacking all
five PKA sites (PKACOMP-A). The decreases for the Site3 and Site4
channels were followed by increases in current amplitude by the 40 min
time point (Fig. 4C). At 40 min, the Site2 channel
continued to show an average reduction in current of 28%, whereas the
Site3 and Site4 channels demonstrated significant increases of 16 and 11%, respectively. Therefore, sites 3 and 4 mediated small
reductions in sodium current amplitude, but the effects were
considerably smaller than that observed for site 2.
Negative charge at site 2 reduces sodium current
We previously reported that addition of negative charges at all
five of the PKA sites resulted in a channel that expressed a
constitutively reduced level of current (Smith and Goldin, 1996 ). This
channel was called the PKA site composite aspartate mutant (PKACOMP-D)
and is depicted in Figure 1. Having established that phosphorylation at
site 2 alone is sufficient to reduce the level of sodium current, we
wanted to determine if a single negative charge at position 2 could
reduce the basal level of current. We therefore replaced the serine
residue at site 2 with an aspartate (Fig. 1, Site2-D).
The basal level of current was compared for the wild-type, PKACOMP-A,
PKACOMP-D, and Site2-D channels (Fig. 5). Because it was possible that these
different sodium channels were expressed at different levels, we
normalized the current amplitude that was measured in representative
oocytes expressing each mutant to the corresponding amount of membrane
channel protein that subsequently was isolated from the same oocytes.
To quantify sodium channel protein, we metabolically labeled the
oocytes with 35S-methionine, followed by
immunoprecipitation of the sodium channels from the oocyte membrane
fraction. Then the proteins were analyzed by SDS polyacrylamide gel
electrophoresis and autoradiography (Fig. 5A). Finally, the
ratios of current to protein were all normalized to the ratio for the
wild-type channel, which was set at 1.0 (Fig. 5B). The basal
current amplitudes that were expressed for the wild-type and PKACOMP-A
channels were not significantly different from each other. On the other
hand, the basal current amplitudes for the PKACOMP-D and Site2-D
channels were reduced significantly to 43 ± 19 and 53 ± 29% relative to the level of the wild-type channel, respectively.
Therefore, a single negative charge at site 2 (serine-573)
significantly reduced basal sodium current amplitude.
DISCUSSION
Site 2 is necessary and sufficient for current reduction
by PKA
To gather evidence about the molecular mechanism for sodium
current attenuation by PKA, we have measured the relative contributions of the five consensus PKA sites located in the I-II linker of the rat
brain sodium channel. Our key finding is that phosphorylation at site 2 is of primary importance. When site 2 was eliminated ( Site2), the
reduction of current amplitude by PKA induction was abolished
completely, demonstrating that this site is required. Furthermore, when
site 2 was the only PKA site present ( Site2), current amplitude was
reduced by an average of 28% 30 min after PKA induction (the 40 min
time point), demonstrating that this site has the most prominent role
in PKA attenuation. Finally, we demonstrated that the attenuation of
current could be accounted for by the introduction of a negative charge
at PKA site 2.
Minor reduction of current by sites 3 and 4
In addition to the primary effect of PKA at site 2, PKA induction
brought about minor reductions in current when sites 3 or 4 were
present. In those two cases sodium current was reduced by only 1-5%
10 min after PKA induction (the 20 min time point), and these channels
subsequently demonstrated an enhancement of current amplitude. Current
reduction and enhancement are mediated by two separate mechanisms,
because these effects can be separated by eliminating the I-II linker
PKA sites (compare the wild-type and PKACOMP-A channels). We conclude
that the enhancement of sodium current normally competes with
the reduction. These two effects can be distinguished temporally for
the Site3 and Site4 channels for which the reduction of current
is most pronounced at the 20 min time point, whereas the enhancement of
current predominates later. The delay in current enhancement suggests
that the increase in current amplitude may occur by an indirect
pathway, as opposed to the direct phosphorylation of the sodium channel
protein that causes current attenuation.
The sites where modulation occurs are optimal target motifs for
PKA phosphorylation
By comparing peptide sequences from known PKA substrates, it has
been determined that the most common target motif for PKA is RRXS, with
X representing any amino acid (Kemp and Pearson, 1990 ). The sodium
channel PKA consensus sites at positions 2, 3, and 4 are RRNS, RRDS,
and RRPS, respectively, which makes them all optimal targets.
Therefore, it is not surprising that PKA can modulate the channel by
phosphorylation at these sites. However, the KRRSSS sequence at
position 5 also contains the same motif, and yet no functional impact
because of phosphorylation at this site was observed. Perhaps
phosphorylation does occur at site 5 in oocytes, but the functional
effects are either nonexistent or undetectable by this type of
analysis. Finally, the PKA site at the first position is not optimal
(KRFSS), although the consensus KRXXS has been observed to be
phosphorylated by PKA (Kemp and Pearson, 1990 ). We observed no
functional impact when site 1 either was eliminated or was present by
itself, suggesting that this site does not play a significant role in
sodium channel modulation by PKA.
There is biochemical evidence showing selective phosphorylation
of the I-II linker PKA sites both in vivo and in
vitro (Murphy et al., 1993 ). After metabolic labeling, site 5 was
determined to be the most highly phosphorylated in vivo,
followed by sites 2, 4, and 3, in that order. In vitro, site
4 was the most extensively phosphorylated, whereas sites 2, 3, and 5 were phosphorylated to lesser extents. Phosphorylation was not detected
at site 1, consistent with our data that there is no functional
consequence of having site 1 present. Our data are therefore in
agreement with the biochemical data with regard to sites 1, 2, 3, and
4, with the conclusion that PKA phosphorylation occurs at sites 2, 3, and 4, and the addition of phosphate residues at any of these sites
reduces sodium current. However, there is not a good correlation between the extent of phosphorylation at each site and the relative functional impact. Site 2 is phosphorylated to a lesser extent than
site 5, yet site 2 is the primary position at which attenuation of
current occurs. Because the amount of phosphorylation at individual sites does not correlate with the functional impact, this indicates that some sites are more functionally sensitive than others.
The different sensitivities of the PKA sites provides a mechanism by
which sodium channel activity, and hence neuronal excitability, could
be modulated. Site 5 is phosphorylated preferentially, so this site is
likely to be phosphorylated first under conditions of low PKA activity,
but with minimal functional impact. Induction of PKA activity would
result in phosphorylation at some or all of PKA sites 2, 3, and 4. Phosphorylation at sites 3 or 4 would cause minor attenuation of sodium
current, whereas phosphorylation at site 2 would result in a large
reduction in current amplitude. Therefore, nerve cells could attenuate
sodium current incrementally by increasing the level of PKA activity.
Additional regulation could be provided by differential sensitivity of
each of the sites to dephosphorylation by protein phosphatases. Brain
calcineurin, phosphatase 1, and phosphatase 2A are all able to
dephosphorylate the sodium channel differentially at sites 2-5 (Murphy
et al., 1993 ; Chen et al., 1995 ). Therefore, the combined actions of
PKA and phosphatases could allow the sodium current to be regulated precisely.
Molecular models for modulation by PKA phosphorylation
The molecular mechanism by which phosphorylation in the I-II
linker decreases sodium current amplitude is unknown. Given the different functional impact of phosphorylation at positions 2, 3, 4, and 5, it is evident that there must be some positional specificity.
One possibility is that the I-II linker has a specific conformation
that is modified by phosphorylation. The linker might interact either
with other regions of the sodium channel or with other protein
molecules that are in close proximity, and phosphorylation could
dictate whether or not those interactions take place. The rat brain
sodium channel is known to interact with other molecules, such as the
accessory subunits 1 and 2. However,
those interactions are not necessary for functional modulation by PKA
either in Xenopus oocytes (Gershon et al., 1992 ; Smith and
Goldin, 1996 ) or CHO cells (Li et al., 1992 , 1993 ). The rat brain
sodium channel also is known to interact with the cytoskeletal proteins
ankyrin and spectrin (Srinivasan et al., 1988 ), and it is possible that
phosphorylation might affect those interactions, with functional
consequences for the channel.
The onset and development of PKA modulation is quite rapid,
occurring within 5 min after PKA induction. In addition, the reduction in current amplitude is reversible, with a return to baseline levels
within 1 hr after PKA stimulation (Smith and Goldin, 1996 ). The rapid
onset of modulation by PKA is consistent with models that are not
diffusion-limited. The reversibility of current attenuation within a 1 hr time period suggests that it does not occur by a reduction in the
number of sodium channels in the membrane, because the time course is
too rapid to be explained by the addition of new channels to the
membrane from intracellular stores. The reduction is not likely to
involve fast inactivation, because induction of PKA has no impact on
the kinetics of fast inactivation, and the reduction also occurs in a
channel in which fast inactivation has been removed by the IFM to QQQ
mutation (West et al., 1992 ) in the III-IV linker (R. Smith and A. Goldin, unpublished observations). It is more likely that
phosphorylation decreases either the open probability of the channel,
as was shown to be the case in excised patches from transfected CHO
cells (Li et al., 1992 ), or the single-channel conductance. The effects
of PKA induction on these properties of the sodium channel expressed in
Xenopus oocytes will be determined by single-channel
analysis. In either case, the presence of a negative charge at
phosphorylation site 2 in the I-II linker is both necessary and
sufficient for sodium channel modulation by PKA.
FOOTNOTES
Received April 18, 1997; revised May 28, 1997; accepted June 2, 1997.
This work was supported by Grant NS26729 to A.L.G. from National
Institutes of Health. A.L.G. is an Established Investigator of the
American Heart Association. We thank Drs. Kris Kontis, Michael Pugsley,
Linda Hall, Ted Shih, and Marianne Smith for helpful discussions during
the course of this work. We acknowledge Esther Yu and Mimi Reyes for
excellent technical assistance.
Correspondence should be addressed to Dr. Alan L. Goldin at the above
address.
REFERENCES
-
Auld VJ,
Goldin AL,
Krafte DS,
Catterall WA,
Lester HA,
Davidson N,
Dunn RJ
(1990)
A neutral amino acid change in segment IIS4 dramatically alters the gating properties of the voltage-dependent sodium channel.
Proc Natl Acad Sci USA
87:323-327[Abstract/Free Full Text].
-
Chen T-C,
Law B,
Kondratyuk T,
Rossie S
(1995)
Identification of soluble protein phosphatases that dephosphorylate voltage-sensitive sodium channels in rat brain.
J Biol Chem
270:7750-7756[Abstract/Free Full Text].
-
Costa MR,
Catterall WA
(1984)
Cyclic AMP-dependent phosphorylation of the alpha subunit of the sodium channel in synaptic nerve ending particles.
J Biol Chem
259:8210-8218[Abstract/Free Full Text].
-
Costa MR,
Casnellie JE,
Catterall WA
(1982)
Selective phosphorylation of the alpha subunit of the sodium channel by cAMP-dependent protein kinase.
J Biol Chem
257:7918-7921[Abstract/Free Full Text].
-
Frohnwieser B,
Chen L-Q,
Schreibmayer W,
Kallen RG
(1997)
Modulation of the human cardiac sodium channel
-subunit by cAMP-dependent protein kinase and the responsible sequence domain.
J Physiol (Lond)
498:309-318[Abstract/Free Full Text]. -
Gershon E,
Weigl L,
Lotan I,
Schreibmayer W,
Dascal N
(1992)
Protein kinase A reduces voltage-dependent Na+ current in Xenopus oocytes.
J Neurosci
12:3743-3752[Abstract].
-
Goldin AL
(1991)
Expression of ion channels by injection of mRNA into Xenopus oocytes.
Methods Cell Biol
36:487-509[Medline].
-
Hopp TP,
Prickett KS,
Price VL,
Libby RT,
March CJ,
Cerretti DP,
Urdal DL,
Conlon PJ
(1988)
A short polypeptide marker sequence useful for recombinant protein identification and purification.
Biotechnology
6:1204-1210.
-
Kemp BE,
Pearson RB
(1990)
Protein kinase recognition sequence motifs.
Trends Biochem Sci
15:342-346[Web of Science][Medline].
-
Li M,
West JW,
Lai Y,
Scheuer T,
Catterall WA
(1992)
Functional modulation of brain sodium channels by cAMP-dependent phosphorylation.
Neuron
8:1151-1159[Web of Science][Medline].
-
Li M,
West JW,
Numann R,
Murphy BJ,
Scheuer T,
Catterall WA
(1993)
Convergent regulation of sodium channels by protein kinase C and cAMP-dependent protein kinase.
Science
261:1439-1442[Abstract/Free Full Text].
-
Murphy BJ,
Rossie S,
DeJongh KS,
Catterall WA
(1993)
Identification of the sites of selective phosphorylation and dephosphorylation of the rat brain Na+ channel
subunit by cAMP-dependent protein kinase and phosphoprotein phosphatases.
J Biol Chem
268:27355-27362[Abstract/Free Full Text]. -
Patton DE,
Goldin AL
(1991)
A voltage-dependent gating transition induces use-dependent block by tetrodotoxin of rat IIA sodium channels expressed in Xenopus oocytes.
Neuron
7:637-647[Web of Science][Medline].
-
Rossie S,
Catterall WA
(1987)
Cyclic AMP-dependent phosphorylation of voltage-sensitive sodium channels in primary cultures of rat brain neurons.
J Biol Chem
262:12735-12744[Abstract/Free Full Text].
-
Rossie S,
Catterall WA
(1989)
Phosphorylation of the alpha subunit of rat brain sodium channels by cAMP-dependent protein kinase at a new site containing ser686 and ser687.
J Biol Chem
264:14220-14224[Abstract/Free Full Text].
-
Rossie S,
Gordon D,
Catterall WA
(1987)
Identification of an intracellular domain of the sodium channel having multiple cAMP-dependent phosphorylation sites.
J Biol Chem
262:17530-17535[Abstract/Free Full Text].
-
Schiffmann SN,
Lledo P-M,
Vincent J-V
(1995)
Dopamine D1 receptor modulates the voltage-gated sodium current in rat striatal neurones through a protein kinase A.
J Physiol (Lond)
483:95-107[Abstract/Free Full Text].
-
Smith RD,
Goldin AL
(1992)
Protein kinase A phosphorylation enhances sodium channel currents in Xenopus oocytes.
Am J Physiol
236:C660-C666.
-
Smith RD,
Goldin AL
(1996)
Phosphorylation of brain sodium channels in the I-II linker modulates channel function in Xenopus oocytes.
J Neurosci
16:1965-1974[Abstract/Free Full Text].
-
Srinivasan Y,
Elmer L,
Davis J,
Bennett V,
Angelides K
(1988)
Ankyrin and spectrin associate with voltage-dependent sodium channels in brain.
Nature
333:177-180[Medline].
-
West JW,
Patton DE,
Scheuer T,
Wang Y,
Goldin AL,
Catterall WA
(1992)
A cluster of hydrophobic amino acid residues required for fast Na+ channel inactivation.
Proc Natl Acad Sci USA
89:10910-10914[Abstract/Free Full Text].
This article has been cited by other articles:

|
 |

|
 |
 
W.-H. Lin, D. E. Wright, N. I. Muraro, and R. A. Baines
Alternative Splicing in the Voltage-Gated Sodium Channel DmNav Regulates Activation, Inactivation, and Persistent Current
J Neurophysiol,
September 1, 2009;
102(3):
1994 - 2006.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lee and A. L. Goldin
Role of the amino and carboxy termini in isoform-specific sodium channel variation
J. Physiol.,
August 15, 2008;
586(16):
3917 - 3926.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Beacham, M. Ahn, W. A. Catterall, and T. Scheuer
Sites and Molecular Mechanisms of Modulation of NaV1.2 Channels by Fyn Tyrosine Kinase
J. Neurosci.,
October 24, 2007;
27(43):
11543 - 11551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lavialle-Defaix, H. Gautier, A. Defaix, B. Lapied, and F. Grolleau
Differential Regulation of Two Distinct Voltage-Dependent Sodium Currents by Group III Metabotropic Glutamate Receptor Activation in Insect Pacemaker Neurons
J Neurophysiol,
November 1, 2006;
96(5):
2437 - 2450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Brackenbury and M. B. A. Djamgoz
Activity-dependent regulation of voltage-gated Na+ channel expression in Mat-LyLu rat prostate cancer cell line
J. Physiol.,
June 1, 2006;
573(2):
343 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Rosenkranz and D. Johnston
Dopaminergic regulation of neuronal excitability through modulation of Ih in layer V entorhinal cortex.
J. Neurosci.,
March 22, 2006;
26(12):
3229 - 3244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kwong and L.-Y. Lee
Prostaglandin E2 potentiates a TTX-resistant sodium current in rat capsaicin-sensitive vagal pulmonary sensory neurones
J. Physiol.,
April 15, 2005;
564(2):
437 - 450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hayashida and A. T. Ishida
Dopamine Receptor Activation Can Reduce Voltage-Gated Na+ Current by Modulating Both Entry Into and Recovery From Inactivation
J Neurophysiol,
November 1, 2004;
92(5):
3134 - 3141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Mee, E. C. G. Pym, K. G. Moffat, and R. A. Baines
Regulation of Neuronal Excitability through Pumilio-Dependent Control of a Sodium Channel Gene
J. Neurosci.,
October 6, 2004;
24(40):
8695 - 8703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Baines
Postsynaptic Protein Kinase A Reduces Neuronal Excitability in Response to Increased Synaptic Excitation in the Drosophila CNS
J. Neurosci.,
September 24, 2003;
23(25):
8664 - 8672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Liu, M. Oortgiesen, L. Li, and S. A. Simon
Capsaicin Inhibits Activation of Voltage-Gated Sodium Currents in Capsaicin-Sensitive Trigeminal Ganglion Neurons
J Neurophysiol,
February 1, 2001;
85(2):
745 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Wicher
Peptidergic Modulation of an Insect Na+ Current: Role of Protein Kinase A and Protein Kinase C
J Neurophysiol,
January 1, 2001;
85(1):
374 - 383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Horn and T. G. Waldrop
Hypoxic Augmentation of Fast-Inactivating and Persistent Sodium Currents in Rat Caudal Hypothalamic Neurons
J Neurophysiol,
November 1, 2000;
84(5):
2572 - 2581.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Gorelova and C. R. Yang
Dopamine D1/D5 Receptor Activation Modulates a Persistent Sodium Current in Rat Prefrontal Cortical Neurons In Vitro
J Neurophysiol,
July 1, 2000;
84(1):
75 - 87.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Hanrahan, M. J. Palladino, B. Ganetzky, and R. A. Reenan
RNA Editing of the Drosophila para Na+ Channel Transcript: Evolutionary Conservation and Developmental Regulation
Genetics,
July 1, 2000;
155(3):
1149 - 1160.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. D. Smith and A. L. Goldin
Potentiation of rat brain sodium channel currents by PKA in Xenopus oocytes involves the I-II linker
Am J Physiol Cell Physiol,
April 1, 2000;
278(4):
C638 - C645.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Sampo, N. Tricaud, C. Leveque, M. Seagar, F. Couraud, and B. Dargent
Direct interaction between synaptotagmin and the intracellular loop I-II of neuronal voltage-sensitive sodium channels
PNAS,
March 28, 2000;
97(7):
3666 - 3671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E M Fitzgerald, K Okuse, J N Wood, A C Dolphin, and S J Moss
cAMP-dependent phosphorylation of the tetrodotoxin-resistant voltage-dependent sodium channel SNS
J. Physiol.,
April 15, 1999;
516(2):
433 - 446.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Hoffman and D. Johnston
Neuromodulation of Dendritic Action Potentials
J Neurophysiol,
January 1, 1999;
81(1):
408 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-F. Desaphy, A. De Luca, and D. C. Camerino
Blockade by cAMP of native sodium channels of adult rat skeletal muscle fibers
Am J Physiol Cell Physiol,
December 1, 1998;
275(6):
C1465 - C1472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. C. Tibbs, P. C. Gray, W. A. Catterall, and B. J. Murphy
AKAP15 Anchors cAMP-dependent Protein Kinase to Brain Sodium Channels
J. Biol. Chem.,
October 2, 1998;
273(40):
25783 - 25788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Dib-Hajj, L. Tyrrell, J. A. Black, and S. G. Waxman
NaN, a novel voltage-gated Na channel, is expressed preferentially in peripheral sensory neurons and down-regulated after axotomy
PNAS,
July 21, 1998;
95(15):
8963 - 8968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Marban, T. Yamagishi, and G. F Tomaselli
Structure and function of voltage-gated sodium channels
J. Physiol.,
May 1, 1998;
508(3):
647 - 657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Smith and A. L. Goldin
Functional Analysis of the Rat I Sodium Channel in Xenopus Oocytes
J. Neurosci.,
February 1, 1998;
18(3):
811 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Cantrell, R. D. Smith, A. L. Goldin, T. Scheuer, and W. A. Catterall
Dopaminergic Modulation of Sodium Current in Hippocampal Neurons via cAMP-Dependent Phosphorylation of Specific Sites in the Sodium Channel alpha Subunit
J. Neurosci.,
October 1, 1997;
17(19):
7330 - 7338.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|