Previous Article | Next Article 
Volume 17, Number 16,
Issue of August 15, 1997
pp. 6094-6104
Copyright ©1997 Society for Neuroscience
Detection of Functional Nicotinic Receptors Blocked by
-Bungarotoxin on PC12 Cells and Dependence of Their Expression
on Post-Translational Events
Edward M. Blumenthal,
William G. Conroy,
Suzanne J. Romano,
Paul
D. Kassner, and
Darwin K. Berg
Department of Biology, University of California, San Diego, La
Jolla, California 92093
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
A major class of nicotinic receptors in the nervous system is one
that binds
-bungarotoxin and contains the
7 gene product. PC12
cells, frequently used to study nicotinic receptors, express the
7
gene and have binding sites for the toxin, but previous attempts to
elicit currents from the putative receptors have failed. Using
whole-cell patch-clamp recording techniques and rapid application of
agonist, we find a rapidly desensitizing acetylcholine-induced current
in the cells that can be blocked by
-bungarotoxin. The current
amplitude varies dramatically among three populations of PC12 cells but
correlates well with the number of toxin-binding receptors. In
contrast, the current shows no correlation with
7 transcript; cells
with high levels of
7 mRNA can be negative for toxin binding and yet
have other functional nicotinic receptors. Northern blot analysis and
reverse transcription-PCR reveal no defects in
7 RNA from the
negative cells, and immunoblot analysis demonstrates that they contain
full-length
7 protein, although at reduced levels. Affinity
purification of toxin-binding receptors from cells expressing them
confirms that the receptors contain
7 protein. Transfection
experiments demonstrate that PC12 cells lacking native toxin-binding
receptors are deficient at producing receptors from
7 gene
constructs, although the same cells can produce receptors from other
transfected gene constructs. The results indicate that nicotinic
receptors that bind
-bungarotoxin and contain
7 subunits require
additional gene products to facilitate assembly and stabilization of
the receptors. PC12 cells offer a model system for identifying those
gene products.
Key words:
nicotinic;
acetylcholine receptors;
-bungarotoxin;
PC12 cells;
7 gene product;
7 subunits;
neuronal
INTRODUCTION
One of the most abundant nicotinic
acetylcholine receptors (AChRs) in the vertebrate nervous system is a
species that binds
-bungarotoxin (
Bgt) and contains
7 subunits
(Sargent, 1993
; Role and Berg, 1996
). The receptor is a
cation-selective ligand-gated ion channel with a high relative
permeability to calcium and rapid desensitization (Couturier et al.,
1990
; Schoepfer et al., 1990
; Zorumski et al., 1992
; Alkondon and
Albuquerque, 1993
; Bertrand et al., 1993
; Seguela et al., 1993
;
Alkondon et al., 1994
; Zhang et al., 1994
). It is capable of diverse
functions, including presynaptic modulation of transmitter release
(McGehee et al., 1995
; Gray et al., 1996
), postsynaptic generation of
synaptic currents (Zhang et al., 1996
), and regulation of
calcium-dependent cellular events (Pugh and Berg, 1994
; Vijayaraghavan
et al., 1995
). Recent evidence also links it to a form of schizophrenia
(Freedman et al., 1997
).
Heterologous expression of the
7 gene in Xenopus oocytes
and stably transfected cell lines produces functional
Bgt-sensitive receptors with pharmacological properties similar to those of native
receptors containing
7 subunits (Couturier et al., 1990
; Anand et
al., 1993
; Gopalakrishnan et al., 1995
; Quik et al., 1996
). The
7
gene product may assemble into homomeric receptors, although a
requirement for additional kinds of subunits has not been excluded.
Heteromers of
7 and
8 subunits have been found among chick AChRs
but represent a minority of the receptors containing
7 protein
(Schoepfer et al., 1990
; Keyser et al., 1993
; Gotti et al., 1994
).
Interestingly, when Xenopus oocytes are injected with the
7 gene alone, expression of functional AChRs requires a cyclophilin
acting either as a prolyl isomerase or as a chaperone (Helekar et al.,
1994
). It is not known whether neurons have a similar requirement for
cyclophilin.
A continuing challenge to our understanding of receptors containing
7 subunits is that presented by the rat pheochromocytoma cell line
PC12 (Greene and Tischler, 1976
). PC12 cells express the
7 gene
product, along with other nicotinic receptor genes (Boulter et al.,
1986
, 1990
; Rogers et al., 1992
; Henderson et al., 1994
). Although the
cells can assemble receptors that bind
Bgt, no electrophysiological
response or ion flux has been attributed to the receptors despite
attempts for nearly two decades (Patrick and Stallcup, 1977a
,b
; Amy and
Bennett, 1983
; Kemp and Edge, 1987
; Daly et al., 1991
; Rogers et al.,
1991
). In contrast, autonomic neurons, which express a similar
complement of AChR genes (Listerud et al., 1991
; Corriveau and Berg,
1993
; Mandelzys et al., 1994
), assemble substantial numbers of
functional
Bgt-sensitive AChRs that contain
7 subunits and lack
the other known AChR gene products present (Vernallis et al., 1993
;
Zhang et al., 1994
). The one indication of functional
Bgt-sensitive
AChRs on PC12 cells comes from studies showing that
Bgt blocks the
effects of nicotine on neurite outgrowth from the cells (Chan and Quik,
1993
). We reexamine here the question of whether PC12 cells express
AChRs that contain
7 subunits and generate
Bgt-sensitive
currents.
MATERIALS AND METHODS
PC12 cells. PC12 cells were obtained from M. Quik
(McGill University) (PC12-A), S. Rogers (University of Utah) (PC12-B),
and R. T. Boyd (Ohio State University) (PC12-C). The cell lines
were grown at 37°C in a humidified incubator under 8%
CO2 and passaged when 70-80% confluent (trypsin was used
to passage the PC12-A cells). The cultures were replaced after 2-3
months of passage by thawing a fresh aliquot of frozen cells. Each
strain was maintained in culture medium of the composition used by the
source laboratory: PC12-A received DMEM with 4.5 gm/l glucose, 5%
heat-inactivated fetal bovine serum (Gemini Bio-Products, Calabasas,
CA), and 10% heat-inactivated donor horse serum (Gemini); PC12-B
received DMEM with 1 g/l glucose, 10% heat-inactivated fetal bovine
serum (Characterized; HyClone, Logan, UT), and 5% heat-inactivated
donor horse serum (Gemini); PC12-C received RPMI 1640 medium with 5%
heat-inactivated fetal bovine serum (Gemini) and 10% heat-inactivated
donor horse serum (Gemini). All media contained 2 mM
glutamine and 50 U/ml penicillin and streptomycin. In some experiments
the culture medium was supplemented with 50-100 ng/ml nerve growth
factor (7 S NGF; Promega, Madison, WI) for 3-5 d before assaying the
cells.
Electrophysiology. For electrophysiological experiments,
cells were plated at low density on 35 mm tissue culture dishes and used the following day. For PC12-A cells the dishes were first coated
with poly-L-lysine (Sigma, St. Louis, MO). Currents were recorded using the whole-cell patch-clamp configuration controlled by
an Axopatch 200A amplifier (Axon Instruments) as described previously
(Hamill et al., 1981
; Zhang and Berg, 1995
). The extracellular solution
contained (in mM) 140 NaCl, 3 KCl, 2 MgCl2, 2 CaCl2, 10 glucose, and
10 HEPES, pH 7.4 (with NaOH). The pipette solution contained (in
mM) 140 CsCl, 1 MgCl2, 10 EGTA, 10 glucose, and 10 HEPES, pH 7.2 (with CsOH). Electrode resistances were
~3 M
. Series resistance was always <6 M
and was 80%
compensated. Cells were clamped at
60 mV, and 500 µM
ACh was rapidly applied as follows. Solutions were delivered from a
linear array of glass tubing (370 µm inner diameter, 470 µm outer
diameter; Polymicro Technologies, Phoenix, AZ) mounted on a piezo
bimorph element (Morgan-Matroc, Bedford, OH). Solution flow was
gravity-fed and controlled by a set of solenoid valves (General Valve,
Fairfield, NJ). The valves and the bimorph were all controlled by a
Master-8 programmable stimulator (A.M.P.I., Jerusalem, Israel). Using
this system, the time of solution exchange at an open pipette was
0.5-3 msec as measured by the change in junction potential. Data were filtered at 1 kHz and digitized at either 0.7 or 2 kHz with the pClamp
software (Axon Instruments). Currents were analyzed using Axograph
(Axon Instruments). Maximum activation rates were calculated using the
Axograph subroutine and normalized to peak amplitude.
For recordings from
Bgt-treated cells, the toxin (Biotoxins Inc.,
St. Cloud, FL) was applied at 60 nM for 1-3 hr at 37°C, and 18 nM
Bgt was also included in the recording
solution. For some experiments 1 mg/ml BSA (Sigma; fraction V, cold
alcohol precipitation) was included in the recording solution, because it increased the amplitude of the nicotinic responses that could be
elicited from cells after multiple passages in culture. Exposure to BSA
had no effect on the
Bgt sensitivity of the response; therefore,
results obtained in the presence and absence of BSA were combined in
the present analysis. The mechanism of the BSA effect is unknown,
although it may be similar to the increased nicotinic response seen in
chick ciliary ganglion neurons after acute exposure to BSA (Gurantz et
al., 1993
).
Monoclonal antibodies. Monoclonal antibodies (mAbs)
318 and 319 were raised against a fusion protein corresponding to the large putative cytoplasmic loop of the chick
7 gene product
(Schoepfer et al., 1990
); mAb 319 cross-reacts with the rat
7
protein in detergent extracts and on immunoblots, whereas mAb 318 does
not (Del Toro et al., 1994
) (W. Conroy and D. Berg, unpublished
observations). mAb A7-1 has not been described previously. It was
raised against a fusion protein corresponding to the large putative
cytoplasmic loop of the rat
7 gene product including amino acids
301-439 (numbering as in Seguela et al., 1993
). The fusion protein was prepared by generating a PCR fragment encoding the desired region, cloning it into the pRSETB expression vector (Invitrogen, San Diego,
CA), and expressing it in bacteria [BL21(DE3)pLysE]. The fusion
protein was purified by metal affinity chromatography and used as an
immunogen for mAb production as described previously (Vernallis et al.,
1993
). Hybridomas were screened for antibodies that could
immunoprecipitate
Bgt binding sites labeled with
125I-
Bgt in PC12 cell extracts. mAb A7-1 was found to
be an IgG1 and was used as diluted ascites fluid for probing
immunoblots. mAb 289 recognizes an epitope between residues 330 and 511 on the
4 gene product (Whiting et al., 1991a
). The anti-myc mAb 9E10
was obtained commercially (Santa Cruz Biotechnology, Santa Cruz,
CA).
Binding assays. The number of
Bgt binding sites on the
surface of PC12 cells was determined as described (Halvorsen and Berg, 1989
). PC12 cells were plated on 24 well plates at
105 cells/16 mm well 24-48 hr before the assay was
conducted. Culture medium was removed and immediately replaced with
identical medium that included 10 nM
125I-
Bgt with and without either 1 µM
Bgt or 250 µM nicotine. The cells were incubated for 1 hr at 37°C and then were rinsed four times with 2 ml aliquots of
HEPES solution (137 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 0.9 mM
NaPO4, 0.4 mM
K2PO4, 1.8 mM
CaCl2, 2 mg/ml BSA, and 10 mM HEPES, pH
7.4). Cells were solubilized and scraped in 0.5 ml of 1N NaOH; bound
radioactivity was quantified by gamma counting. Nonspecific binding
determined in the presence of excess unlabeled
Bgt or nicotine was
subtracted to yield specific binding. Results were normalized to total
protein, which was assayed by scraping cells in 2% SDS and 0.1N NaOH
and conducting the BCA protein assay (Pierce, Rockford, IL) with BSA as
a standard. Determinations were done in triplicate within each
experiment.
Both
Bgt and epibatidine binding were determined in cell extracts by
scraping PC12 cells into PBS containing 5 mM EDTA and 5 mM EGTA, collecting the cells by centrifugation, and
freezing at
80°C until needed. Frozen cells were thawed and
solubilized in 50 mM sodium phosphate, pH 7.4, containing
1% (v/v) Triton X-100 and the following protease inhibitors:
iodoacetamide (0.4 mM), benzamidine (5 mM),
phosphoramidon (5 µg/ml), soybean trypsin inhibitor (10 µg/ml),
leupeptin (10 µg/ml), pepstatin A (20 µg/ml), EDTA (5 mM), EGTA (5 mM), aprotinin (2 µg/ml), and
phenylmethylsulfonyl fluoride (1 mM). Insoluble material
was removed by centrifugation for 15 min in a microfuge at 4°C.
Detergent extracts were assayed in either of two ways. In one, aliquots
(25-50 µl) of the three PC12 lines were incubated with 10 nM 125I-
Bgt or 1-5 nM
3H-epibatidine (DuPont NEN, Boston, MA) for 1 hr at room
temperature. The reaction was stopped by the addition of 4 ml of 10 mM Tris buffer, pH 7.5, containing 0.05% Triton X-100
(Tris-TX) and immediate filtration through Whatman (Maidstone, UK) GF/B
filters treated with 0.5% polyethyleneimine. The filters were washed
twice with Tris-TX and counted in a gamma counter to quantify
125I-
Bgt or in a scintillation counter to measure
3H-epibatidine.
In the second method, detergent extracts were assayed in two-site
solid-phase radioimmunoassays (RIAs) as described previously (Conroy
and Berg, 1995
). Briefly, subunit-specific mAbs were used to
immunotether receptors from detergent extracts in microtiter wells, and
bound receptors were quantified with radiolabeled probes and either
gamma or scintillation counting. AChRs containing
7 protein were
retained with the anti-
7 mAb 318 or 319 and quantified with
125I-
Bgt; AChRs containing the
4 and
2 gene
products were retained with the anti-
4 mAb 289 and quantified with
3H-epibatidine; chimeric receptors containing the
7/5-HT3 receptor construct (see below) were retained
with the anti-myc mAb 9E10 (via an incorporated myc epitope) and
quantified with 125I-
Bgt. Nonspecific binding in both
methods was determined in the presence of 1 µM
Bgt
(
Bgt assay), 1 µM epibatidine (epibatidine assay), or
250 µM nicotine (both assays). Results were normalized to
total protein as described above. Triplicate determinations were done
for each sample.
Receptor purification and immunoblot analysis. PC12-B
and -C cells were harvested from 20 100 mm culture plates and
solubilized with buffer containing 1% Triton X-100 as described above.
Samples were incubated with 20-50 µl
Bgt coupled to Actigel
(Sterogene) for 20 hr at 4°C. For negative controls, 250 µM nicotine was included in the incubation with the
Bgt. After several washes with PBS containing 0.5% Triton X-100,
bound material was eluted with SDS-PAGE sample buffer, and the samples
were subjected to SDS-PAGE, electroblotted onto nitrocellulose, and
probed with anti-
7 mAbs 319 or A7-1 as described (Corriveau et al.,
1995
). Bound mAb was detected with a horseradish peroxidase-coupled
anti-mouse secondary antibody and visualized using enhanced
chemiluminescence (Amersham, Arlington Heights, IL) and
autoradiography.
Total
7 protein was immunoprecipitated from solubilized cell
extracts (1 ml prepared from 30 100 mm plates) of either PC12-B or -C
cells using mAb 319 coupled to Actigel (20 µl), incubating, and
rinsing as above. The bound material was eluted and analyzed on
immunoblots probed with mAb A7-1 as described above.
RNA isolation. Total RNA was isolated from PC12 cell
cultures by acid guanidinium thiocyanate-phenol-chloroform extraction (Chomczynski and Sacchi, 1987
). RNA was quantified by measuring optical
density at 260 nm; RNA integrity was routinely checked by formaldehyde
agarose gel electrophoresis.
RNase protection. 32P-labeled riboprobes used
for RNase protection experiments were generated by "runoff
transcription" from appropriately linearized constructs using methods
described previously (Corriveau and Berg, 1993
). The
3 probe
construct was made by subcloning a fragment encoding amino acids
346-441 from a full-length rat
3 cDNA (Boulter et al., 1986
) into
pGEM-T (Promega). For the
2 probe construct, a 370 base pair
fragment was subcloned into pGEM-T from a full-length rat
2 cDNA to
generate a probe encompassing amino acids 334-457 (Deneris et al.,
1988
). Portions of the rat
5,
7, and
4 cDNAs were isolated by
reverse transcription (RT)-PCR from PC12 total RNA, and the fragments
were directly cloned into PGEM-T. The
4 probe encodes amino acids
343-442, the
5 probe encodes amino acids 339-405 (Boulter et al.,
1990
), and the
7 probe encodes amino acids 305-438 (Seguela et al., 1993
). The undigested and protected probe sizes, respectively, in base
pairs are as follows:
3, 320 and 283;
5, 315 and 203;
7, 507 and 402;
2, 470 and 370; and
4, 372 and 301.
RNase protections were performed essentially as described previously
(Corriveau and Berg, 1993
). For quantification, signals were measured
directly from the gels using a Bio-Rad (Richmond, CA) Molecular Imager.
Direct comparisons between the subunits were made by taking into
account probe-specific activity and the total amount of RNA analyzed.
The linearity of the assay was confirmed by varying the amount of total
mRNA and quantifying the resulting
7 signal.
Northern blots. PC12 RNA samples were fractionated on 1%
agarose gels containing 7.4% formaldehyde and transferred to a Hybond N nylon membrane (Amersham) by capillary blot according to the instructions of the manufacturer. A gel-purified fragment of the
7
cDNA encoding amino acids 305-438 was labeled to about
109 cpm/µg with [
-32P]dCTP using
a random-primed labeling kit (Gibco-BRL, Bethesda, MD). Membranes were
prehybridized and hybridized in Rapid-Hyb solution (Amersham) as
recommended by the supplier. Nonspecific radioactivity was removed by
two 20 min washes at 65°C in 0.1× SSC containing 0.1% SDS. Filters
were exposed to Kodak XAR-5 film at
70°C with a DuPont Cronex
intensifying screen for 1-2 d.
RT-PCR analysis. First-strand cDNA was synthesized from
PC12-B and -C total RNA using a Superscript reverse transcriptase kit
(Gibco-BRL). PCR was performed using the PCR Optimizer kit (Invitrogen)
and the following primers: for fragment a, 5
-aggcatctggctggctctg-3
and 5
-tgattctggtccacttaggc-3
; for fragment b,
5
-ctatgagtgctgcaaagagc-3
and 5
-tgattctggtccacttaggc-3
; for fragment
c, 5
-ctatgagtgctgcaaagagc-3
and 5
-tctgcgcatttcctacttg-3
; and for
fragment d, 5
-acctgctctacattggcttc-3
and 5
-tctgcgcatttcctacttg-3
.
The PCR fragments were separated on 1.1% agarose gels and visualized
by staining with ethidium bromide. Gels were photographed using a
Polaroid instant camera.
Chimeric construct. An
7/5-HT3 chimeric
receptor gene construct similar to that described previously (Elsele et
al., 1993
) was made that encoded the N-terminal portion of the chicken
AChR
7 subunit extending up to the first putative transmembrane
domain (through Thr230) and then continued with the
remainder of rat 5-HT3 receptor subunit (starting with
Pro258; designating the methionine initiation codon
as number 1). A sequential overlapping PCR method was used to join the
two cDNAs in frame without the need for matching restriction
endonuclease sites (Herlitze and Koenen, 1990
). The
7 cDNA was used
as a template with oligo-A7NdeIdn (atcttggacatatggaggctgg) and 1u
(aataaaggagttctgcgtctcatg). The 5-HT3 receptor cDNA was
used as a template with oligo-1d (gcagaactcctttattctacgcag) and
oligo-5HT3RXhoI (accctcgagggaataatgccaaatg). The resulting overlapping products were gel-purified and used together as a template
with the A7NdeIdn and 5HT3RXhoI oligos. The product was subcloned into the pGEM-T vector (Promega), and double-stranded dideoxy
sequencing (Sequenase; United States Biochemicals, Cleveland, OH) was
performed to confirm the sequence. The
SacI-EcoRI fragment of pOPCMVSL
7myc
(constituting a portion of the pOPCMVSL vector and 5
coding region of
7) and EcoRI-PflMI and PflMI-XhoI fragments of
the PCR product were cloned into the SacI-XhoI
fragment of pOPCMVSL
7myc (the remaining portion of the pOPCMVSL
vector).
Transfections. Transient transfection of PC12 cells was
accomplished using LipofectAMINE (Gibco-BRL) according to the
instructions of the manufacturer and was usually performed in either 60 or 100 mm culture dishes, and the cells were taken for analysis after 20-48 hr. The transfections used the chimeric
7/5-HT3
receptor gene construct (see above), chicken
7 constructs, or
chicken
4 and
2 constructs. The chicken
2 and
4 constructs
were kindly provided by Dr. Paul Whiting (Merck, Sharp, & Dohme
Laboratories, Essex, UK) as expression constructs pCDM8-Ch 23.1 and
pCDM8-Ch 26.1 containing the
2 and
4 cDNAs, respectively, under
cytomegalovirus (CMV) promoters (Whiting et al., 1991b
). The chicken
7 constructs were prepared from chicken
7 cDNA under CMV
promoters in pOPCMVSL with and without myc epitopes at the C terminus
(additional details to be described elsewhere; P. Kassner and D. Berg,
unpublished data).
Materials.
Bgt was purchased from Biotoxins and
radioiodinated to a specific activity of 0.5-0.7 × 1018 cpm/mol using chloramine T. 3H-Epibatidine (56.5 Ci/mmol) was a gift from DuPont NEN;
unlabeled epibatidine was purchased from Research Biochemicals
International. mAbs 289, 318, and 319 were supplied by Dr. Jon
Lindstrom (University of Pennsylvania, Philadelphia, PA). mAb 319- and
Bgt-Actigel were prepared at 2 and 4-6 mg/ml, respectively,
according to the instructions of the manufacturer (Sterogene). The rat
5,
7, and
4 probes and the
7 cytoplasmic fragment were
RT-PCR-cloned by Dr. John Willoughby (University of British Columbia,
Vancouver, Canada). Dr. Jim Boulter (University of California, Los
Angeles, CA) provided the rat
3 and
2 cDNAs. All compounds were
purchased from Sigma unless otherwise indicated.
RESULTS
Discovery of
Bgt-sensitive ACh responses
Whole-cell patch-clamp recording was used to examine ACh-induced
currents in three populations of PC12 cells obtained from three
different laboratories. Agonist was applied by a rapid delivery system
to optimize detection of quickly desensitizing currents. ACh at 500 µM elicited two kinds of responses that could be
distinguished by their apparent kinetics of activation, their rates of
desensitization, and their sensitivity to
Bgt. One was a rapidly
activating current that quickly desensitized and could be blocked by
Bgt. The other was a more slowly activating current that decayed
less quickly and was insensitive to the toxin. The relative proportions
of the two kinds of responses differed dramatically among the three PC12 populations tested (Fig. 1, Table
1). PC12-A cells displayed only the
rapidly desensitizing response that was completely blocked by 60 nM
Bgt (Fig. 1A). PC12-B cells, in
contrast, had only the slowly desensitizing response that was
insensitive to blockade by
Bgt (Fig. 1B). PC12-C
cells had both kinds of responses (Fig. 1C).
Fig. 1.
Bgt blockade of ACh-evoked currents in PC12
cells. Whole-cell patch clamp was used to measure currents evoked in
PC12-A (A), PC12-B (B), and
PC12-C (C) cells by rapid application of 500 µM ACh in the presence and absence of
Bgt. Each panel
shows typical responses from a control cell (light
trace) and a cell incubated with 60 nM
Bgt for
1-3 hr (heavy trace) superimposed. PC12-A cells display
a small, rapidly activating current that quickly desensitizes and is
completely blocked by
Bgt; PC12-B cells show a large, slowly
activating current that is completely insensitive to
Bgt; PC12-C
cells have both kinds of responses. Holding potential,
60 mV.
Calibration bars: horizontal, 100 msec; vertical, 300 pA. The
initiation and duration of ACh application are indicated by the
vertical deflection and heavy horizontal
arrow, respectively.
[View Larger Version of this Image (9K GIF file)]
In the case of mixed responses, one method of detecting the
rapidly desensitizing toxin-sensitive component is to compare the
proportion of the current remaining 30 msec after the peak in the
presence and absence of
Bgt. By this criterion PC12-C cells have a
toxin-sensitive component, whereas PC12-B cells do not (Table 1). A
more sensitive method for revealing even a small amount of the
toxin-sensitive response in the presence of a large insensitive
response is to take advantage of the observed rapid activation kinetics
of the toxin-sensitive component. This was done by calculating the
maximum rate of current activation for each cell and normalizing it to
the peak amplitude of the response. Comparing these values in the
presence and absence of
Bgt again reveals the rapidly activating
Bgt-sensitive current in PC12-C cells but fails to detect such a
component in PC12-B cells (Table 1).
Correlation between
Bgt-sensitive responses and
Bgt
binding sites
The differential effect of
Bgt on the two classes of ACh-evoked
currents suggested that they arose not from different gating modes of a
single class of receptor but rather from two pharmacologically distinct
receptor subtypes. Accordingly, binding studies were performed to
distinguish AChR classes pharmacologically and to correlate them with
the currents observed. 125I-
Bgt was used to quantify
Bgt binding sites both on the cell surface and in cell extracts.
3H-Epibatidine was used to quantify other classes of
nicotinic receptors in the extracts. Epibatidine binds with high
affinity to many nicotinic receptor subtypes but not those containing
rat or chick
7 subunits (Gerzanich et al., 1995
) (W. Conroy and D. Berg, unpublished observations). Binding to the cell surface was not
attempted with 3H-epibatidine, because it seems to cross
the cell membrane.
PC12-A cells had a small but significant number of
Bgt binding sites
on the cell surface, whereas PC12-C cells had substantially more (Fig.
2). Both had even greater numbers in cell
extracts, implying the existence of intracellular pools of the
receptors. PC12-B cells, in contrast, had no detectable sites on the
surface and few, if any, in the cell extracts. This pattern of
expression could not be explained by the different culture media used
for the three populations. Growing the PC12-B cells in culture medium normally used for PC12-C cells did not result in the expression of
Bgt binding sites. Conversely, PC12-C cells grown in PC12-B medium
continued to express
Bgt binding sites (data not shown).
Fig. 2.
Differences among PC12 populations in their
relative levels of AChRs that bind
Bgt and epibatidine.
125I-
Bgt was used to measure binding sites on intact
cells, whereas both 125I-
Bgt and
3H-epibatidine were used to quantify sites in cell
extracts. The results were normalized for total protein. Nonspecific
binding was determined by adding 1 µM
Bgt (
Bgt
assays), 1 µM epibatidine (epibatidine assay), or 250 µM nicotine (both assays) to the binding reactions and
was subtracted from the values shown. PC12-A and -C cells express
significant amounts of
Bgt binding sites both on the surface
(solid bars) and in cell extracts (stippled
bars), whereas PC12-B cells have few if any specific
Bgt
binding sites. All three populations have significant epibatidine
binding (hatched bars). Data represent the mean ± SEM of triplicate determinations from four to seven independent
experiments.
[View Larger Version of this Image (18K GIF file)]
NGF increases the excitability of PC12 cells (Dichter et al.,
1977
; Mandel et al., 1988
) and can induce long-term expression of a
sodium channel gene after even a brief exposure (Toledo-Aral et al.,
1995
). Because NGF also increases AChR expression in at least some
populations of PC12 cells (Dichter et al., 1977
; Henderson et al.,
1994
), its effects on PC12-B cells were tested to determine whether it
could induce the appearance of
Bgt-sensitive AChRs. Exposure of the
cells to 100 ng/ml NGF for 4 d failed to induce any morphological
changes or to arrest cell growth and division. Consistent with their
nonresponsive phenotype, PC12-B cells in the presence of NGF did not
express detectable levels of
Bgt binding (two experiments gave
values of 0.0 ± 2.0 and 0.2 ± 1.0 fmol of
Bgt binding/mg
of protein). NGF treatment stopped cell division in PC12-C cells and
caused them to extend neurites, as previously reported for the parent
line (Greene and Tischler, 1976
), but it had no effect on the
expression of
Bgt binding sites by the cells (two experiments gave
277 ± 29 and 371 ± 12 fmol/mg protein compared with the
mean of about 280 fmol/mg protein for untreated control cells as shown
in Fig. 2).
The distribution of
Bgt binding sites among the three cell
populations correlates with the presence of
Bgt-sensitive currents evoked by ACh in the cells. The other class of receptors, namely those
binding epibatidine, is likely to be responsible for the
Bgt-insensitive currents evoked by ACh. Extracts from all three strains had significant numbers of such receptors, but only the PC12-B
and PC12-C cells displayed the slow, toxin-insensitive response (see
Discussion).
Lack of correlation between
Bgt-sensitive responses and
7 mRNA
Because AChRs that bind
Bgt in autonomic neurons have been
shown to contain the
7 gene product (Schoepfer et al., 1990
; Vernallis et al., 1993
), experiments were performed to compare the
levels of
7 transcript among the three PC12 populations. RNase
protection assays revealed the presence of
7 mRNA in all three types
of PC12 cells (Fig. 3A). In
fact, PC12-B cells, which lack detectable
Bgt binding sites, had by
far the greatest abundance of
7 transcripts (Fig. 3B).
PC12-B cells also expressed substantial amounts of the other four AChR
gene transcripts tested:
3,
5,
2, and
4. PC12-A and -C
cells expressed the same five genes, with the exception of
4 in
PC12-A. The lack of
4 transcripts in PC12-A cells might account for
the absence of a slow
Bgt-insensitive response, which was prominent
in PC12-B and -C cells.
Fig. 3.
Relative amounts of AChR gene transcripts in three
PC12 populations. RNase protection assays were used to measure the
levels of
3,
5,
7,
2, and
4 transcripts in
PC12-A-PC12-C cells. A, Representative RNase protection
autoradiogram in which 20 µg samples of total RNA were hybridized
with a 32P-labeled
7 riboprobe (Probe
lane, arrowhead). tRNA (15 µg) served as a
negative control; neither it nor probe alone protected a radiolabeled
species (tRNA lane). Each PC12 RNA sample protected an
7 band of the expected size (arrow); the levels of
7 mRNA varied among the three cell populations, with the PC12-B
cells expressing the most. B, The protected species
obtained with each of the five probes was quantified on a Bio-Rad
Molecular Imager. The results represent the mean ± SEM for three
to seven determinations from a total of three or four RNA preparations
and are normalized to the signal obtained for
3 transcript in PC12-A
cells.
[View Larger Version of this Image (27K GIF file)]
One explanation for the finding that PC12-B cells express
7 mRNA and
yet fail to assemble
Bgt-binding AChRs is that the transcripts may
be defective. A first test of this was performed by Northern blot
analysis. Total RNA was extracted from both PC12-B and PC12-C cells and
probed on Northern blots with a random-primed, 32P-labeled
7 probe. A single band of about 6.4 kb was observed in the two
samples (Fig. 4). The results indicate
that the defect preventing accumulation of
Bgt-sensitive AChRs in
PC12-B cells is unlikely to result from a large truncation or deletion
in the
7 transcript.
Fig. 4.
Northern blot analysis demonstrating
7
transcripts of equivalent size in PC12-B and PC12-C cells. Total RNA
was isolated from each population and subjected to electrophoresis on a
formaldehyde-agarose gel followed by capillary blotting onto a nylon
membrane. The blot was hybridized with random-primed,
32P-labeled probe directed to the cytoplasmic domain of
7. Bars indicate the 28 and 18 S ribosomal RNAs. Both populations
express a single
7 transcript ~6.4 kb in length
(arrowhead). The results are qualitative with respect to
band intensity and should not be used to assess relative abundance of
the transcripts. Similar results were obtained in four other
experiments.
[View Larger Version of this Image (31K GIF file)]
Bovine adrenal chromaffin cells express a truncated splice variant of
the
7 transcript that lacks 87 nucleotides corresponding to an exon
encoding the M2 domain and adjacent regions (Garcia-Guzman et al.,
1995
). When co-injected with full-length
7 transcript into
Xenopus oocytes, the truncated splice variant inhibits the expression of functional AChRs. A deletion of this size would probably
not have been detected in the Northern analysis. Therefore, RT-PCR
analysis was performed over the region in question as well as adjacent
regions to determine whether such a deletion might account for the
inability of PC12-B cells to produce competent
Bgt-binding AChRs.
Primers were chosen to amplify fragments corresponding to nucleotide
positions 18-1000 (a), 627-1000 (b), 627-1534 (c), and 1148-1534
(d) (Fig. 5A; numbering as in
Seguela et al., 1993
). Only the expected full-length fragment was
obtained in each case, and no size differences were detected between
PC12-B and -C cells (Fig. 5B). The small 627-1000 fragment
includes the M2 region; even a deletion of 10-20 nucleotides should
have been apparent. The RNase protections (covering positions
913-1314), the PCR analysis, and the Northern blots found no defects
in the
7 mRNA from PC12-B cells.
Fig. 5.
RT-PCR analysis comparing the coding regions of
7 mRNA from PC12-B and -C cells. A, Schematic showing
the
7 transcript nucleotide sequence (heavy line)
with the start coinciding with the A of the AUG start codon (Seguela et
al., 1993
). The expected PCR fragments (thin lines) were
a (982 bp), b (373 bp), c
(907 bp), and d (386 bp). Primer locations corresponded
to nucleotide positions 18-38 (lightly stippled box),
627-646 (heavily stippled box), 981-1000 (open
box), 1148-1167 (solid box), and 1516-1534
(hatched box). The sequence encoded by the RNase
protection probe is indicated by the hatched bar.
B, Agarose gels showing the amplified PCR fragments.
First-strand cDNA was synthesized using reverse transcriptase and total
RNA isolated from PC12-B and -C cells as templates. PCR was performed
with the indicated sets of primers. Aliquots of the PCR reactions were
run on 1.1% agarose gels, which were stained with ethidium bromide and
photographed using a Polaroid camera. Lanes 1 and
10, M, Molecular weight standards (100 bp ladder from
Gibco-BRL); lanes 2 and 3, PCR fragment
a; lanes 4 and 5, fragment b;
lanes 6 and 7, fragment c; lanes
8 and 9, fragment d. B, PC12-B
RNA as template; C, PC12-C RNA as template. No
differences were detected in the fragments amplified from the PC12-B
and -C RNA, and in each case the fragment had the full size expected. Similar results were obtained when PCR was performed on cDNA
synthesized from two independent RNA preparations.
[View Larger Version of this Image (28K GIF file)]
Presence of
7 protein in PC12 AChRs
In view of the transcript analysis, it became important to confirm
that PC12 receptors capable of binding
Bgt actually contain
7
subunits. This was demonstrated by using
Bgt-Actigel to affinity purify the receptors from PC12 cell extracts and then analyzing the
eluted protein on immunoblots. The blots were probed with the anti-
7
mAb A7-1 generated against a fusion protein corresponding to the large
putative cytoplasmic loop of the rat
7 gene product. A single
component of ~60 kDa was recognized by the mAb in extracts from
PC12-C cells (Fig. 6A).
It was comparable in size to the monomeric
7 species obtained from
chick brain and ciliary ganglion (Schoepfer et al., 1990
; Vernallis et
al., 1993
). Competition with 250 µM nicotine during the
affinity purification caused the complete loss of the PC12 component,
confirming the specificity of the purification. No specific bands were
detected in extracts prepared from PC12-B cells. The results
demonstrate that the
Bgt-binding species in PC12 cells contains the
7 gene product.
Fig. 6.
Immunoblot analysis showing
7 protein in PC12
AChRs. A, AChRs that bind
Bgt were affinity-purified
from PC12-B and -C cell extracts by adsorption to
Bgt coupled to
Actigel beads. The adsorbed material was eluted and analyzed by
immunoblots probed with the anti-
7 mAb A7-1 and visualized using a
horseradish peroxidase-coupled secondary antibody followed by enhanced
chemiluminescence. A single species of about 60 kDa was obtained from
PC12-C samples (lane 1). Nicotine at 250 µM (lane 2) blocked adsorption of the
component to the
Bgt-Actigel, indicating the specificity of the
affinity purification. No components were obtained specifically when
PC12-B cell extracts were analyzed by similar methods (lanes
3 and 4). Molecular weight standards
(Bio-Rad) are as follows: phosphorylase B, 97 kDa; serum albumin, 66 kDa; ovalbumin, 45 kDa; and carbonic anhydrase, 31 kDa. Similar results
were obtained in a second experiment using mAb A7-1 as probe and in
two experiments using mAb 319 as probe. B, Total
7
protein from PC12-B and -C cell extracts was analyzed by
immunoprecipitating protein with the
7-specific mAb 319 coupled to
Actigel and probing immunoblots of the purified material with mAb
A7-1. A species of 60 kDa component was obtained from both PC12-C
(lane 1) and PC12-B (lane 2) cell
extracts, although the latter contained much less of the component.
Similar results were obtained in a second experiment. The band was
absent when rat IgG-Actigel was substituted for the mAb 319-Actigel as
a negative control (data not shown).
[View Larger Version of this Image (30K GIF file)]
Immunoblot analysis of immunopurified material was used to compare the
total amounts of
7 protein in extracts prepared from PC12-B and -C
cells. mAb 319 coupled to Actigel was used to immunoprecipitate
7
protein, whereas mAb A7-1 was used to detect it on the blots. Although
7 protein could be detected in both cases, PC12-C cells contained
much more of it than did PC12-B cells (Fig. 6B). The size of the monomeric
7 protein in PC12-B and -C cells is the same,
consistent with the PCR and Northern analyses finding no differences in
transcript size.
Expression of AChRs from transfected genes
The small amounts of
7 protein in PC12-B cells suggested that
the transcript was competent but that a posttranslational block prevented assembly of the subunits and permitted rapid turnover. The
possibility of a posttranslational block was tested by transfecting cells with chicken AChR gene constructs and then assaying cell extracts
for receptor expression. Because the anti-
7 mAb 318 is specific for
chicken, it enabled the transfected
7 gene product to be
distinguished from the endogenous rat homolog in solid-phase RIAs. The
relative amounts of
Bgt binding in such assays in which only the
chick
7 gene product was measured indicated that PC12-B cells are
two orders of magnitude less efficient than PC12-C cells at producing
AChRs from a competent
7 cDNA construct (Fig.
7A).
Fig. 7.
Expression of transfected receptor gene constructs
in PC12 cells. PC12-B and -C cells were transfected with chicken AChR
cDNA constructs encoding either the
7 or the
4 and
2 subunits
or, in separate experiments, containing either the
7 or the
7/5-HT3 chimeric receptor subunit. Cell extracts were
prepared 20-48 hr later and assayed by RIA for 125I-
Bgt
binding to receptors tethered either by anti-
7 mAb 318, which
recognizes chick but not rat
7 protein, or by anti-myc mAb 9E10,
which recognizes the epitope-tagged
7/5-HT3 receptor protein and by RIA for 3H-epibatidine binding to receptors
tethered with anti-
4 mAb 289, which recognizes chick but not rat
4 protein. The selectivities of the antibodies required that the
receptors contain one or more transfected gene products to be assayed
(receptors containing only endogenous gene components would not have
been retained). A, Ratio of receptor levels in PC12-C
cell extracts divided by that in PC12-B cell extracts obtained from the
same experiment. Values represent the mean ± SEM of three or four
experiments. Absolute levels of
Bgt binding to chick AChRs with
7
subunits in transfected PC12-B and PC12-C cells averaged 6 and 498 fmol/culture, respectively, for the experiments with
4
2 and 4 and
258 fmol/culture, respectively, for the experiments with
7/5-HT3. Levels of epibatidine binding for PC12-B and
PC12-C cells were 43 and 288 fmol/culture, respectively, in the
4
2 experiments; levels of
Bgt binding to 5-HT3
chimeras were 37 and 111 fmol/culture, respectively. PC12-B cells have
a large deficiency in the expression of AChRs with
7 subunits
compared with PC12-C cells. B, Relative number of
Bgt-binding AChRs produced by transfected PC12-B
(B) or PC12-C (C) cells
with chick
7 subunits (
7-AChRs) divided by either the number of receptors with
4 and
2 subunits
(
4
2-AChRs) or
7/5-HT3 chimeric
receptor subunits (
7/5-HT3Rs). PC12-B cells are
significantly more impaired at expressing
Bgt-binding AChRs from the
7 construct than they are at expressing either AChRs from the
4
and
2 constructs (p < 0.03 by Student's
unpaired t test) or receptors from the
7/5-HT3 chimeric construct (p < 0.002).
[View Larger Version of this Image (27K GIF file)]
For comparison, cells were also transfected with the chicken
4 and
2 genes and assayed by RIA using the anti-
4 mAb 289 to
immunotether receptors and 3H-epibatidine to quantify them.
In contrast to the results with the
7 construct, PC12-B cells were
only a few-fold less efficient than PC12-C cells at producing
transfected
4/
2 AChRs (Fig. 7A). A comparison was also
performed using an
7/5-HT3 chimeric receptor gene
construct in which the 5
-terminal portion of the 5-HT3
receptor gene encoding the N-terminal putative extracellular portion of the protein was replaced with the equivalent region of the
7 gene.
The encoded protein retains the ability to bind
Bgt (Elsele et al.,
1993
). The construct was also engineered to encode a myc epitope on the
C terminus so that the anti-myc mAb 9E10 could be used to immunotether
the chimeric receptor in RIAs. Again, PC12-B cells were only a few-fold
less efficient than PC12-C cells at expressing the transfected chimeric
receptors (Fig. 7A).
A different way of analyzing the data is to calculate the ratio of
different receptor types produced by transfected PC12-B cells and then
to compare the ratio with that obtained from transfected PC12-C cells.
This provides a way of normalizing results among experiments and
reduces the inherent variation among transfections. Viewing the results
in this way indicates that PC12-B cells are 10- to 20-fold less able to
produce receptors from the transfected
7 construct than they are
from either the transfected
4 and
2 constructs or from the
transfected
7/5-HT3 chimeric receptor construct compared
with PC12-C cells (Fig. 7B). If all of the differences
between PC12-B and -C cells in expressing either
4/
2 receptors or
7/5-HT3 receptors were considered nonspecific, e.g., attributed to differences in the efficiency of transfection, the results would still demonstrate a substantial difference between the
two cell populations in their ability to produce AChRs with
7
subunits. It is at least as likely, however, that all of the differences arise from the PC12-B defect, and that it is most severe in
the case of the
7 gene product.
Tests for cyclophilin involvement
The possibility was considered that the PC12-B deficiency resulted
from an altered or lost cyclophilin, because a cyclophilin has been
shown to be necessary in Xenopus oocytes for expression of
functional AChRs from the
7 gene (Helekar et al., 1994
). This was
not a strong likelihood in the present case, however, because PC12-B
cells show little deficit in expressing the
7/5-HT3
chimeric receptors, whereas Xenopus oocytes are as dependent
on cyclophilin for 5-HT3 receptors as they are for
receptors composed of
7 subunits (Helekar et al., 1994
).
A requirement for cyclophilin was tested in the present experiments by
exposing PC12-C cells for 24 hr to cyclosporin A, which inhibits
cyclophilin, and then assaying cell extracts to determine whether the
cells had reduced levels of AChRs. Cyclosporin A at 10 µM
had no effect on the amounts of
Bgt-binding AChRs with
7
subunits, either as measured in cell extracts by RIA to assay total
receptors or as measured in cell culture with intact cells to assay
surface receptors selectively (Fig. 8).
Similarly, cyclosporin A at 10 µM had no effect on the
number of AChRs binding epibatidine in RIAs (127 ± 4%, mean ± SEM; n = 3 experiments) compared with untreated
control cells. Higher concentrations of cyclosporin A (30 µM) were toxic and caused substantial cell loss. Blockade of new receptor expression by incubating cells with 0.5 µg/ml tunicamycin (which blocks N-linked glycosylation and prevents receptor
maturation) showed that most of the
Bgt-binding receptors are lost
during a 24 hr period (Fig. 8). The tunicamycin-induced loss was
apparent both in the total receptor population and in those confined to
the cell surface, indicating an ongoing receptor turnover by the cells.
If a cyclosporin A-sensitive cyclophilin were required in PC12 cells,
as it is in Xenopus oocytes for assembly of AChRs composed
of
7 subunits, then the cyclosporin A treatment of PC12-C cells
should have produced a large (90%) reduction in the amount of
Bgt-binding receptors tethered by anti-
7 mAbs in the RIA. It
should also have substantially reduced the number of
Bgt-binding
receptors on the cell surface, given the ongoing turnover. As a result,
it is unlikely that a lost or altered cyclophilin accounts for the
posttranslational deficiency in receptor production by PC12-B
cells.
Fig. 8.
Lack of cyclosporin A effects on levels of PC12
receptors binding
Bgt. PC12-C cells in culture were treated either
with vehicle (Control), tunicamycin (1 µg/ml),
or cyclosporin A (10 µM) for 24 hr and then assayed
either for
Bgt binding in RIAs with mAb 318 (which recognizes the
chick but not rat
7 gene product) to immunotether receptors
(Total Sites) or for
Bgt-binding to intact cells in
culture (Surface Sites). Values represent the mean ± SEM of three or four separate experiments and are expressed as percentages of those obtained from control cells. Tunicamycin treatment
caused a large reduction in
Bgt binding, indicating that receptors
both on the cell surface and inside were normally turning over.
Cyclosporin A treatment had little effect either on the total number of
Bgt-binding receptors assayed or on those present on the cell
surface.
[View Larger Version of this Image (23K GIF file)]
DISCUSSION
This report provides the first demonstration, to our knowledge, of
ACh-evoked currents in PC12 cells that can be blocked by
Bgt. It
resolves a long-standing puzzle in the field and shows that the
currents can vary dramatically among different PC12 populations. The
currents correlate well with the presence of
Bgt-binding AChRs on
the cells, and the receptors contain
7 protein, but there is no
correlation between receptor levels and the amount of
7 transcript
in the cells. Instead, receptor expression is shown to depend on a
posttranslational event that is absent in some PC12 populations. The
posttranslational event seems to be most critical for expression of
AChRs containing
7 subunits, although it may influence less severely
the expression of other ligand-gated ion channels as well.
Like their counterparts on rat hippocampal neurons and chick ciliary
ganglion neurons (Zorumski et al., 1992
; Alkondon and Albuquerque,
1993
; Alkondon et al., 1994
; Zhang et al., 1994
),
Bgt-sensitive
AChRs on PC12 cells seem to activate and desensitize rapidly. The quick
desensitization of the receptors and their variable numbers among PC12
cell populations may explain why previous attempts failed to identify a
current associated with the receptors. Another contributing factor is
likely to have been the large
Bgt-resistant ACh responses that may
often obscure the
Bgt-sensitive component. No antagonists have yet
been identified that selectively block the
Bgt-resistant
receptors.
The deficiency of PC12-B cells in producing functional
Bgt-binding
AChRs cannot be ascribed to a defect in their
7 transcripts and,
therefore, differs from that found previously in a PC12 variant (Fanger
et al., 1995
). PC12-B cells have more
7 mRNA than do PC12-C cells,
which make the receptors, and the transcripts are indistinguishable by
Northern blot analysis, RNase protections, and RT-PCR analysis over the
regions examined. Moreover,
7 protein is present in PC12-B cells and
has the same size and antigenicity with respect to mAbs 319 and A7-1
as does
7 protein in PC12-C. The PC12-B transcript, therefore, seems
competent to generate full-length in-frame
7 protein. The results
indicate that a posttranscriptional deficiency is most likely to
account for the limitations of PC12-B cells in producing functional
AChRs with
7 subunits.
Heterologous expression of the
7 gene alone in either
Xenopus oocytes or stably transfected cell lines is
sufficient to generate functional AChRs that are blocked by
Bgt
(Couturier et al., 1990
; Seguela et al., 1993
; Puchacz et al., 1994
;
Gopalakrishnan et al., 1995
; Quik et al., 1996
). The inability of
PC12-B cells to do so despite their having what seems to be competent
7 mRNA, therefore, implies a posttranslational block. Strong
evidence of such a block was provided by the transfection experiments
showing that PC12-B cells are two orders of magnitude less efficient at producing
Bgt-binding AChRs from an
7 gene construct than are PC12-C cells. Differences of only a few-fold were observed between PC12-B and -C cells when comparing their abilities to make receptors containing the
4 and
2 subunits or chimeric
7/5-HT3 receptor subunits from transfected gene
constructs. These small differences may reflect differences in the
efficiency of transfection between PC12-B and -C cells. Alternatively,
the posttranslational defect restricting receptor production in PC12-B
cells applies to many kinds of ligand-gated ion channels but is most
stringent for receptors containing
7 protein.
What is the nature of the posttranslational block? It cannot be
ascribed to differences in growth medium and is not overcome by NGF.
One possibility is that the block is confined to AChRs containing
7
subunits and reflects a requirement for other kinds of subunits to be
co-assembled in the receptors. Failure of
7 subunits to bind
appropriate partners for co-assembly could result in rapid turnover of
the protein and account for the low levels present in PC12-B cells.
Although heterologous expression of the
7 subunit alone can produce
functional
Bgt-sensitive AChRs, as cited above, it is difficult to
exclude the possibility that the usually limited amounts of functional
receptor obtained in such cases are made possible by small amounts of
other required AChR gene products being expressed at low levels by the
host cell. Immunological analysis of native AChRs containing
7
subunits in chick ciliary ganglion neurons, for example, has indicated that the receptors lack all of the known AChR gene products expressed by chick neurons (Vernallis et al., 1993
), but it remains possible that
other AChR genes remain to be identified.
A different possibility is that the posttranslational block reflects
loss of a specific component(s) required for efficient assembly or
stabilization of certain classes of ligand-gated ion channels. The
defect in PC12-B cells is not global in its effects, because the cells
can express other kinds of receptors from both transfected and
endogenous genes. The latter include AChRs capable of binding
epibatidine and generating
Bgt-resistant ACh responses. The fact
that PC12-B cells, however, generally have higher levels of all AChR
transcripts tested (with the exception of
4) and yet lower levels of
epibatidine binding than do PC12-C cells suggests that the PC12-B
defect may extend in a mild form to other kinds of ligand-gated ion
channels. The post-translational defect described here is different
from that preventing expression of NMDA receptors in PC12 cells.
Although the cells synthesize NMDAR1 mRNA, they do not produce
functional NMDA receptors and have little NMDAR1 protein until
transfected with an NMDAR1 cDNA construct (Sucher et al., 1993
). The
simplest interpretation is that the endogenous NMDAR1 transcripts do
not permit significant translation, perhaps because of interference
from their untranslated regions (Sucher et al., 1993
).
Precedent for different requirements in receptor assembly comes from
studies on heterologous expression of AChR genes in Xenopus oocytes. Production of functional homomeric, but not heteromeric, AChRs
containing
7 protein is blocked by cyclosporin A through its
inhibition of cyclophilin (Helekar et al., 1994
). A lost or defective
cyclophilin is unlikely to account for the deficiency detected here in
PC12-B cells, because cyclosporin A treatment did not prevent receptor
production in PC12-C cells. In addition, PC12-B cells are nearly as
efficient as PC12-C cells in expressing an
7/5-HT3
chimeric receptor, whereas expression of 5-HT3 receptors in
Xenopus oocytes mimics that of receptors containing
7
subunits in requiring a cyclophilin (Helekar et al., 1994
).
The inability of PC12-A cells to produce
Bgt-insensitive ACh
responses deserves comment. Some epibatidine binding was detected in
the cell extracts indicating the existence of AChRs. Possibly the
receptors were sequestered in an intracellular pool and therefore unable to generate responses. The low levels of
4 transcript in
PC12-A cells may have limited the ability of the cells to produce receptors targeted for the cell surface. It remains unclear, however, why the
3 and
2 gene products expressed by the cells were not alone sufficient to generate functional
Bgt-resistant AChRs as they
do in Xenopus oocytes (Boulter et al., 1987
; Deneris et al., 1988
; Gross et al., 1991
).
PC12 cells passaged many times in culture under different conditions
might well generate diverse variants. What is interesting about the
present variations is the possibility that they reflect differences in
the machinery cells use to assemble and maintain certain classes of
membrane proteins. Ligand-gated ion channels are multimeric proteins
containing both hydrophobic and hydrophilic transmembrane domains
constituting the channel. They pose considerable challenges from a
structural biological point of view in terms of proper assembly and
insertion into the cell membrane. Neurons must efficiently produce
large numbers of such channel proteins while avoiding potentially
lethal errors such as creating spontaneously active channels or ones
that permit excessive calcium to enter the cell. A gain-of-function
mutation in a Caenorhabditis elegans gene homologous to
7
illustrates the potential danger of producing inappropriate receptors;
the mutation causes cell death (Treinin and Chalfie, 1995
). Quality
control may come in the form of special chaperones that guide the
assembly process and help prevent or discard errors.
FOOTNOTES
Received March 20, 1997; revised May 16, 1997; accepted June 3, 1997.
This work was supported by National Institutes of Health Grants NS12601
and NS35469, the Muscular Dystrophy Association, and the Council for
Tobacco Research. E.M.B. is a Muscular Dystrophy Association
postdoctoral fellow. P.D.K. is a National Research Service Award
postdoctoral fellow. We thank Dr. John Willoughby for RT-PCR cloning of
the rat
5,
7, and
4 probes and the
7 fragment encoding the
putative cytoplasmic fragment and Dr. Jim Boulter for providing the rat
3 and
2 cDNAs. We thank Dr. Jon Lindstrom for providing
monoclonal antibodies and Lynn Ogden for excellent technical
assistance.
Correspondence should be addressed to Darwin K. Berg, Department of
Biology, 0357, University of California, San Diego, 9500 Gilman Drive,
La Jolla, CA 92093.
Dr. Blumenthal's present address: Department of Biology, University of
Virginia, Charlottesville, VA 22903.
Dr. Romano's present address: Biology Department, Ontogen Corp.,
Carlsbad, CA 92009.
REFERENCES
-
Alkondon M,
Albuquerque EX
(1993)
Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes.
J Pharmacol Exp Ther
265:1455-1473[Abstract/Free Full Text].
-
Alkondon M,
Reinhardt S,
Lobron C,
Hermsen B,
Maelicke A,
Albuquerque EX
(1994)
Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. II. The rundown and inward rectification of agonist-elicited whole-cell currents and identification of receptor subunits by in situ hybridization.
J Pharmacol Exp Ther
271:494-506[Abstract/Free Full Text].
-
Amy CM,
Bennett EL
(1983)
Increased sodium ion conductance through nicotinic acetylcholine receptor channels in PC12 cells exposed to nerve growth factors.
J Neurosci
3:1547-1553[Abstract].
-
Anand R,
Peng X,
Lindstrom J
(1993)
Homomeric and native
7 acetylcholine receptors exhibit remarkably similar but non-identical pharmacological properties, suggesting that the native receptor is a heteromeric protein complex.
FEBS Lett
327:241-246[Web of Science][Medline]. -
Bertrand D,
Galzi JL,
Devillers-Thiery A,
Bertrand S,
Changeux JP
(1993)
Mutations at two distinct sites within the channel domain M2 alter calcium permeability of neuronal
7 nicotinic receptor.
Proc Natl Acad Sci USA
90:6971-6975[Abstract/Free Full Text]. -
Boulter J,
Evans K,
Goldman D,
Martin G,
Treco D,
Heinemann S,
Patrick J
(1986)
Isolation of a cDNA clone coding for a possible neural nicotinic acetylcholine receptor
-subunit.
Nature
319:368-374[Medline]. -
Boulter J,
Connolly J,
Deneris E,
Goldman D,
Heinemann S,
Patrick J
(1987)
Functional expression of two neuronal nicotinic acetylcholine receptors from cDNA clones identifies a gene family.
Proc Natl Acad Sci USA
84:7763-7767[Abstract/Free Full Text].
-
Boulter J,
O'Shea-Greenfield A,
Duvoisin RM,
Connolly JG,
Wada E,
Jensen A,
Gardner PD,
Ballivet M,
Deneris ES,
McKinnon D,
Heinemann S,
Patrick J
(1990)
3,
5, and
4: three members of the rat neuronal nicotinic acetylcholine receptor-related gene family form a gene cluster.
J Biol Chem
265:4472-4482[Abstract/Free Full Text]. -
Chan J,
Quik M
(1993)
A role for the nicotinic
-bungarotoxin receptor in neurite outgrowth in PC12 cells.
Neuroscience
56:441-451[Web of Science][Medline]. -
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Conroy WG,
Berg DK
(1995)
Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions.
J Biol Chem
270:4424-4431[Abstract/Free Full Text].
-
Corriveau RA,
Berg DK
(1993)
Coexpression of multiple acetylcholine receptor genes in neurons: quantification of transcripts during development.
J Neurosci
13:2662-2671[Abstract].
-
Corriveau RA,
Romano SJ,
Conroy WG,
Oliva L,
Berg DK
(1995)
Expression of neuronal acetylcholine receptor genes in vertebrate skeletal muscle during development.
J Neurosci
15:1372-1383[Abstract].
-
Couturier S,
Bertrand D,
Matter J-M,
Hernandez M-C,
Bertrand S,
Millar N,
Valera S,
Barkas T,
Ballivet M
(1990)
A neuronal nicotinic acetylcholine receptor subunit (
7) is developmentally regulated and forms a homo-oligomeric channel blocked by
-Btx.
Neuron
5:847-856[Web of Science][Medline]. -
Daly JW,
Nishizawa Y,
Edwards M,
Waters JA,
Aronstam RS
(1991)
Nicotinic receptor-elicited sodium flux in rat pheochromocytoma PC12 cells: effects of agonists, antagonists, and noncompetitive blockers.
Neurochem Res
16:489-500[Web of Science][Medline].
-
Del Toro ED,
Juiz JM,
Peng X,
Lindstrom J,
Criado M
(1994)
Immunocytochemical localization of the
7 subunit of the nicotinic acetylcholine receptor in the rat central nervous system.
J Comp Neurol
349:325-342[Web of Science][Medline]. -
Deneris ES,
Connolly J,
Boulter J,
Wada E,
Wada K,
Swanson LW,
Patrick J,
Heinemann S
(1988)
Primary structure and expression of
2: a novel subunit of neuronal nicotinic acetylcholine receptors.
Neuron
1:45-54[Web of Science][Medline]. -
Dichter MA,
Tischler AS,
Greene LA
(1977)
Nerve growth factor induced increase in electrical excitability and acetylcholine sensitivity of a rat pheochromocytoma cell line.
Nature
268:501-504[Medline].
-
Elsele J-L,
Bertrand S,
Galzi J-L,
Devillers-Thiery A,
Changeux J-P,
Bertrand D
(1993)
Chimaeric nicotinic-serotonergic receptor combines distinct ligand binding and channel specificities.
Nature
366:479-483[Medline].
-
Fanger GR,
Brennan C,
Henderson LP,
Gardner PD,
Maue RA
(1995)
Differential expression of sodium channels and nicotinic acetylcholine receptor channels in nnr variants of the PC12 pheochromocytoma cell line.
J Membr Biol
144:71-80[Web of Science][Medline].
-
Freedman R,
Coon H,
Myles-Worsley M,
Orr-Urtreger A,
Olincy A,
Davis A,
Polymeropoulos M,
Holik J,
Hopkins J,
Hoff M,
Rosenthal J,
Waldo MC,
Reimherr F,
Wender P,
Yaw J,
Young DA,
Breese CR,
Adams C,
Patterson D,
Adler LE,
Kruglyak L,
Leonard S,
Byerly W
(1997)
Linkage of a neurophysiological deficit in schizophrenia to chromosome 15 locus.
Proc Natl Acad Sci USA
94:587-592[Abstract/Free Full Text].
-
Garcia-Guzman M,
Sala F,
Sala S,
Campos-Caro A,
Stuhmer W,
Gutierrez LM,
Criado M
(1995)
-Bungarotoxin-sensitive nicotinic receptors on bovine chromaffin cells: molecular cloning, functional expression, and alternative splicing of the
7 subunit.
Eur J Neurosci
7:647-655[Web of Science][Medline]. -
Gerzanich V,
Peng X,
Wang F,
Wells G,
Anand R,
Fletcher S,
Lindstrom J
(1995)
Comparative pharmacology of epibatidine: a potent agonist for neuronal nicotinic acetylcholine receptors.
Mol Pharmacol
48:774-782[Abstract].
-
Gopalakrishnan M,
Buisson B,
Touma E,
Giordano T,
Campbell JE,
Hu IC,
Donnelly-Roberts D,
Arneric SP,
Bertrand D,
Sullivan JP
(1995)
Stable expression and pharmacological properties of the human
7 nicotinic acetylcholine receptor.
Eur J Pharmacol
290:237-246[Web of Science][Medline]. -
Gotti C,
Hanke W,
Maury K,
Moretti M,
Ballivet M,
Clementi F,
Bertrand D
(1994)
Pharmacology and biophysical properties of
7 and
7-
8
-bungarotoxin receptor subtypes inmmunopurified from the chick optic lobe.
Eur J Neurosci
6:1281-1292[Web of Science][Medline]. -
Gray R,
Rajan AS,
Radcliffe KA,
Yakehiro M,
Dani JA
(1996)
Hippocampal synaptic transmission enhanced by low concentrations of nicotine.
Nature
383:713-716[Medline].
-
Greene LA,
Tischler AS
(1976)
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor.
Proc Natl Acad Sci USA
73:2424-2428[Abstract/Free Full Text].
-
Gross A,
Ballivet M,
Rungger D,
Bertrand D
(1991)
Neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes: role of the
subunit in agonist sensitivity and desensitization.
Eur J Physiol
419:545-551.[Web of Science][Medline] -
Gurantz D,
Margiotta JF,
Harootunian AT,
Dionne VE
(1993)
Modulation by albumin of neuronal cholinergic sensitivity.
Mol Pharmacol
43:807-812[Abstract].
-
Halvorsen SW,
Berg DK
(1989)
Specific down-regulation of the
-bungarotoxin binding component on chick autonomic neurons by ciliary neuronotrophic factor.
J Neurosci
9:3673-3680[Abstract]. -
Hamill OP,
Marty A,
Neher E,
Sakmann B,
Sigworth FJ
(1981)
Improved patch-clamp techniques for high-resolution current recordings from cells and cell-free membrane patches.
Pflügers Arch
391:85-100[Web of Science][Medline].
-
Helekar SA,
Char D,
Neff S,
Patrick J
(1994)
Prolyl isomerase requirement for the expression of functional homo-oligomeric ligand-gated ion channels.
Neuron
12:179-189[Web of Science][Medline].
-
Henderson LP,
Gdovin MJ,
Liu CL,
Gardner PD,
Maue RA
(1994)
Nerve growth factor increases the nicotinic ACh receptor gene expression and current density in wild-type and protein kinase A-deficient PC12 cells.
J Neurosci
14:1153-1163[Abstract].
-
Herlitze S,
Koenen M
(1990)
A general and rapid mutagenesis method using polymerase chain reaction.
Gene
91:143-147[Web of Science][Medline].
-
Kemp G,
Edge M
(1987)
Cholinergic function and
-bungarotoxin binding in PC12 cells.
Mol Pharmacol
32:356-363[Abstract]. -
Keyser KT,
Britto LRG,
Schoepfer R,
Whiting P,
Cooper J,
Conroy W,
Brozozowska-Prechtl A,
Karten HJ,
Lindstrom J
(1993)
Three subtypes of
-bungarotoxin-sensitive nicotinic acetylcholine receptors are expressed in chick retina.
J Neurosci
13:442-454[Abstract]. -
Listerud M,
Brussaard AB,
Devay P,
Colman DR,
Role LW
(1991)
Functional contribution of neuronal nAChR subunits revealed by antisense oligonucleotides.
Science
254:1518-1521[Abstract/Free Full Text].
-
Mandel G,
Cooperman SS,
Maue RA,
Goodman RH,
Brehm P
(1988)
Selective induction of brain type II Na+ channels by nerve growth factor.
Proc Natl Acad Sci USA
85:924-928[Abstract/Free Full Text].
-
Mandelzys A,
Pie B,
Deneris ES,
Cooper E
(1994)
The developmental increase in ACh current densities on rat sympathetic neurons correlates with changes in nicotinic ACh receptor
-subunit gene expression and occurs independent of innervation.
J Neurosci
14:2357-2364[Abstract]. -
McGehee D,
Heath M,
Gelber S,
Role LW
(1995)
Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors.
Science
269:1692-1697[Abstract/Free Full Text].
-
Patrick J,
Stallcup WG
(1977a)
Immunological distinction between acetylcholine receptor and the
-bungarotoxin-binding component on sympathetic neurons.
Proc Natl Acad Sci USA
74:4689-4692[Abstract/Free Full Text]. -
Patrick J,
Stallcup WG
(1977b)
-Bungarotoxin binding and cholinergic receptor function on a rat sympathetic nerve line.
J Biol Chem
252:8629-8633[Abstract/Free Full Text]. -
Puchacz E,
Buisson B,
Bertrand D,
Lukas RJ
(1994)
Functional expression of nicotinic acetylcholine receptors containing rat
7 subunits in human SH-SY5Y neuroblastoma cells.
FEBS Lett
354:155-159[Web of Science][Medline]. -
Pugh PC,
Berg DK
(1994)
Neuronal acetylcholine receptors that bind
-bungarotoxin mediate neurite retraction in a calcium-dependent manner.
J Neurosci
14:889-896[Abstract]. -
Quik M,
Choremis J,
Komourian J,
Lukas RJ,
Puchacz E
(1996)
Similarity between rat brain nicotinic
-bungarotoxin receptors and stably expressed
-bungarotoxin binding sites.
J Neurochem
67:145-154[Web of Science][Medline]. -
Rogers SW,
Gahring LC,
Papke RL,
Heinemann S
(1991)
Identification of cultured cells expressing ligand-gated cationic channels.
Protein Expr Purif
2:108-116[Medline].
-
Rogers SW,
Mandelzys A,
Deneris ES,
Cooper E,
Heinemann S
(1992)
The expression of nicotinic acetylcholine receptors by PC12 cells treated with NGF.
J Neurosci
12:4611-4623[Abstract].
-
Role LW,
Berg DK
(1996)
Nicotinic receptors in the development and modulation of CNS synapses.
Neuron
16:1077-1085[Web of Science][Medline].
-
Sargent PB
(1993)
The diversity of neuronal nicotinic acetylcholine receptors.
Annu Rev Neurosci
16:403-443[Web of Science][Medline].
-
Schoepfer R,
Conroy WG,
Whiting P,
Gore M,
Lindstrom J
(1990)
Brain
-bungarotoxin binding protein cDNAs and mAbs reveal subtypes of this branch of the ligand-gated ion channel gene superfamily.
Neuron
5:35-48[Web of Science][Medline]. -
Seguela P,
Wadiche J,
Dineley-Miller K,
Dani JA,
Patrick JW
(1993)
Molecular cloning, functional properties, and distribution of rat brain
7: a nicotinic cation channel highly permeable to calcium.
J Neurosci
13:596-604[Abstract]. -
Sucher NJ,
Brose N,
Deitcher DL,
Awobuluyi M,
Gasic GP,
Bading H,
Cepko CL,
Greenberg ME,
Jahn R,
Heinemann SF,
Lipton SA
(1993)
Expression of endogenous NMDAR1 transcripts without receptor protein suggests post-transcriptional control in PC12 cells.
J Biol Chem
268:22299-22304[Abstract/Free Full Text].
-
Toledo-Aral JJ,
Brehm P,
Halegoua S,
Mandel G
(1995)
A single pulse of nerve growth factor triggers long-term neuronal excitability through sodium channel gene induction.
Neuron
14:607-611[Web of Science][Medline].
-
Treinin M,
Chalfie M
(1995)
A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans.
Neuron
14:871-877[Web of Science][Medline].
-
Vernallis AB,
Conroy WG,
Berg DK
(1993)
Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor subtypes.
Neuron
10:451-464[Web of Science][Medline].
-
Vijayaraghavan S,
Huang B,
Blumenthal EM,
Berg DK
(1995)
Arachidonic acid as a possible negative feedback inhibitor of nicotinic acetylcholine receptors on neurons.
J Neurosci
15:3679-3687[Abstract].
-
Whiting PJ,
Schoepfer R,
Conroy WG,
Gore MJ,
Keyser KT,
Shimasaki S,
Esch F,
Lindstrom JM
(1991a)
Expression of nicotinic acetylcholine receptor subtypes in brain and retina.
Mol Brain Res
10:61-70[Medline].
-
Whiting P,
Schoepfer R,
Lindstrom J,
Priestley T
(1991b)
Structural and pharmacological characterization of the major brain nicotinic acetylcholine receptor subtype stably expressed in mouse fibroblasts.
Mol Pharmacol
40:463-472[Abstract].
-
Zhang Z-w,
Berg DK
(1995)
Patch-clamp analysis of glycine-induced currents in chick ciliary ganglion neurons.
J Physiol
487:395-405.[Abstract/Free Full Text]
-
Zhang Z-w,
Vijayaraghavan S,
Berg DK
(1994)
Neuronal acetylcholine receptors that bind
-bungarotoxin with high affinity function as ligand-gated ion channels.
Neuron
12:167-177[Web of Science][Medline]. -
Zhang Z-w,
Coggan JS,
Berg DK
(1996)
Synaptic currents generated by neuronal acetylcholine receptors sensitive to
-bungarotoxin.
Neuron
17:1231-1240[Web of Science][Medline]. -
Zorumski CF,
Thio LL,
Isenberg KE,
Clifford DB
(1992)
Nicotinic acetylcholine currents in cultured postnatal rat hippocampal neurons.
Mol Pharmacol
41:931-936[Abstract].
This article has been cited by other articles:

|
 |

|
 |
 
E. X. Albuquerque, E. F. R. Pereira, M. Alkondon, and S. W. Rogers
Mammalian Nicotinic Acetylcholine Receptors: From Structure to Function
Physiol Rev,
January 1, 2009;
89(1):
73 - 120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Innocent, P. D. Livingstone, A. Hone, A. Kimura, T. Young, P. Whiteaker, J. M. McIntosh, and S. Wonnacott
{alpha}Conotoxin Arenatus IB[V11L,V16D] Is a Potent and Selective Antagonist at Rat and Human Native {alpha}7 Nicotinic Acetylcholine Receptors
J. Pharmacol. Exp. Ther.,
November 1, 2008;
327(2):
529 - 537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Razani-Boroujerdi, R. T. Boyd, M. I. Davila-Garcia, J. S. Nandi, N. C. Mishra, S. P. Singh, J. C. Pena-Philippides, R. Langley, and M. L. Sopori
T Cells Express {alpha}7-Nicotinic Acetylcholine Receptor Subunits That Require a Functional TCR and Leukocyte-Specific Protein Tyrosine Kinase for Nicotine-Induced Ca2+ Response
J. Immunol.,
September 1, 2007;
179(5):
2889 - 2898.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. D. Gueorguiev, S.-Y. Cheng, and E. L. Sabban
Prolonged Activation of cAMP-response Element-binding Protein and ATF-2 Needed for Nicotine-triggered Elevation of Tyrosine Hydroxylase Gene Transcription in PC12 Cells
J. Biol. Chem.,
April 14, 2006;
281(15):
10188 - 10195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Lansdell, V. J. Gee, P. C. Harkness, A. I. Doward, E. R. Baker, A. J. Gibb, and N. S. Millar
RIC-3 Enhances Functional Expression of Multiple Nicotinic Acetylcholine Receptor Subtypes in Mammalian Cells
Mol. Pharmacol.,
November 1, 2005;
68(5):
1431 - 1438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Drisdel, E. Manzana, and W. N. Green
The Role of Palmitoylation in Functional Expression of Nicotinic {alpha}7 Receptors
J. Neurosci.,
November 17, 2004;
24(46):
10502 - 10510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. R. Baker, R. Zwart, E. Sher, and N. S. Millar
Pharmacological Properties of {alpha}9{alpha}10 Nicotinic Acetylcholine Receptors Revealed by Heterologous Expression of Subunit Chimeras
Mol. Pharmacol.,
February 1, 2004;
65(2):
453 - 460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-L. Si and T. J. F. Lee
Presynaptic alpha 7-Nicotinic Acetylcholine Receptors Mediate Nicotine-Induced Nitric Oxidergic Neurogenic Vasodilation in Porcine Basilar Arteries
J. Pharmacol. Exp. Ther.,
July 1, 2001;
298(1):
122 - 128.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. M. Francis, E. Y. Cheng, G. A. Weiland, and R. E. Oswald
Specific Activation of the alpha 7 Nicotinic Acetylcholine Receptor by a Quaternary Analog of Cocaine
Mol. Pharmacol.,
July 1, 2001;
60(1):
71 - 79.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. E. McNerney, D. Pardi, P. C. Pugh, Q. Nai, and J. F. Margiotta
Expression and Channel Properties of alpha -Bungarotoxin-Sensitive Acetylcholine Receptors on Chick Ciliary and Choroid Neurons
J Neurophysiol,
September 1, 2000;
84(3):
1314 - 1329.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cuevas, A. L Roth, and D. K Berg
Two distinct classes of functional {alpha}7-containing nicotinic receptor on rat superior cervical ganglion neurons
J. Physiol.,
June 15, 2000;
525(3):
735 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. T. Dineley and J. W. Patrick
Amino Acid Determinants of alpha 7 Nicotinic Acetylcholine Receptor Surface Expression
J. Biol. Chem.,
April 28, 2000;
275(18):
13974 - 13985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Drisdel and W. N. Green
Neuronal alpha -Bungarotoxin Receptors Are alpha 7 Subunit Homomers
J. Neurosci.,
January 1, 2000;
20(1):
133 - 139.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rakhilin, R. C. Drisdel, D. Sagher, D. S. McGehee, Y. Vallejo, and W. N. Green
{alpha}-Bungarotoxin Receptors Contain {alpha}7 Subunits in Two Different Disulfide-bonded Conformations
J. Cell Biol.,
July 12, 1999;
146(1):
203 - 218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Mahata, M. Mahata, R. J. Parmer, and D. T. O'Connor
Desensitization of Catecholamine Release. THE NOVEL CATECHOLAMINE RELEASE-INHIBITORY PEPTIDE CATESTATIN (CHROMOGRANIN A344-364) ACTS AT THE RECEPTOR TO PREVENT NICOTINIC CHOLINERGIC TOLERANCE
J. Biol. Chem.,
January 29, 1999;
274(5):
2920 - 2928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cuevas and D. K. Berg
Mammalian Nicotinic Receptors with alpha 7 Subunits That Slowly Desensitize and Rapidly Recover from alpha -Bungarotoxin Blockade
J. Neurosci.,
December 15, 1998;
18(24):
10335 - 10344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Nagavarapu, S. Danthi, and R. T. Boyd
Characterization of a Rat Neuronal Nicotinic Acetylcholine Receptor alpha 7 Promoter
J. Biol. Chem.,
May 11, 2001;
276(20):
16749 - 16757.
[Abstract]
[Full Text]
[PDF]
|
 |
|