Previous Article | Next Article 
Volume 17, Number 16,
Issue of August 15, 1997
pp. 6277-6288
Copyright ©1997 Society for Neuroscience
Sonic Hedgehog Promotes Rod Photoreceptor Differentiation in
Mammalian Retinal Cells In Vitro
Edward M. Levine,
Henk Roelink,
Jennifer Turner, and
Thomas A. Reh
Department of Biological Structure, University of Washington,
Seattle, Washington 98195
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
The hedgehog gene family encodes secreted proteins
important in many developmental patterning events in both vertebrates
and invertebrates. In the Drosophila eye disk, hedgehog
controls the progression of photoreceptor differentiation in the
morphogenetic furrow. To investigate whether hedgehog proteins are also
involved in the development of the vertebrate retina at stages of
photoreceptor differentiation, we analyzed expression of the three
known vertebrate hedgehog genes. We found that Sonic
hedgehog and Desert hedgehog are expressed in
the developing retina, albeit at very low levels, whereas Indian
hedgehog (Ihh) is expressed in the developing
and mature retinal pigmented epithelium, beginning at embryonic day 13. To determine whether hedgehog proteins have activities on developing
retinal cells, we used an in vitro system in which much
of retinal histogenesis is recapitulated. N-terminal recombinant Sonic
Hedgehog protein (SHH-N) was added to rat retinal cultures for 3-12 d,
and the numbers of retinal cells of various phenotypes were analyzed by
immunohistochemistry. We found that SHH-N caused a transient increase
in the number of retinal progenitor cells, and a 2- to 10-fold increase
in the number of photoreceptors differentiating in the cultures when
analyzed with three different photoreceptor-specific antigens. In
contrast, the numbers of retinal ganglion cells and amacrine cells were
similar to those in control cultures. These results show that Hedgehog
proteins can regulate mitogenesis and photoreceptor differentiation in
the vertebrate retina, and Ihh is a candidate factor
from the pigmented epithelium to promote retinal progenitor
proliferation and photoreceptor differentiation.
Key words:
Sonic hedgehog;
Indian hedgehog;
Desert hedgehog;
retina;
mitogenesis;
differentiation;
rod photoreceptor
INTRODUCTION
During retinal development in the
vertebrate, there is a well conserved sequential development of the
various retinal cell types (for review, see Reh, 1992b
). Ganglion cells
and horizontal cells are generated first, followed by cone
photoreceptor cells and amacrine cells. Rod photoreceptor cells,
bipolar cells, and Müller glia develop last. Evidence from
in vitro and in vivo cell ablation experiments
indicates that factors in the local microenvironment are important in
directing the retinal progenitor cells to different fates (Reh and
Tully, 1986
; Reh, 1987
, 1992a
; Watanabe and Raff, 1990
, 1992
; Harris
and Messersmith, 1992
; Altshuler et al., 1993
). In particular, the
factors that restrict the onset and rate of photoreceptor
differentiation in the rat are known to be limiting in dissociated cell
culture, density dependent, and developmentally regulated (Watanabe and
Raff, 1990
, 1992
; Harris and Messersmith, 1992
; Reh, 1992a
; Altshuler
et al., 1993
).
Several laboratories are attempting to identify the factors that
control retinal progenitor cells to adopt particular cell identities by
testing candidate molecules in dissociated cell cultures. Although a
number of different molecules have been identified in the developing
retina that appear to play some role in retinal cell differentiation
(see Discussion), we were interested in determining the effects of the
hedgehog family of signaling molecules on mammalian retinal
development. These molecules make attractive candidates for regulators
of retinal cell differentiation for several reasons. First, in the
Drosophila eye disk, hedgehog controls the timing and rate
of photoreceptor differentiation at the morphogenetic furrow (Ma et
al., 1993
; Tabata and Kornberg, 1994
; Heberlein et al., 1995
). Because
vertebrate and Drosophila eye development appear to require
many of the same transcription factors, it is plausible that they would
require some of the same cell-signaling molecules (for review, see Reh
and Cagan, 1994
). Second, in vertebrates, members of the Hedgehog
family have been shown to act as inducing molecules for particular cell
fates in spinal cord and mesencephalon (Roelink et al., 1994
; 1995
;
Ericson et al., 1995
; Hynes et al., 1995
), and it is likely that these
molecules play important roles in the overall patterning of the
developing nervous system (Ekker et al., 1995b
). Third, in vertebrates,
Sonic hedgehog (Shh) expression in the zone of
polarizing activity can be induced by retinoic acid (RA) (for review,
see Johnson and Tabin, 1995
), and recently we have reported that RA can
act as a rod photoreceptor inducer in embryonic rat retinal cell
cultures (Kelley et al., 1994
, 1995
).
Several studies have recently demonstrated effects of Shh on early
stages of eye development in vertebrates. Several lines of evidence
indicate that Shh expressed in the prechordal plate mesoderm
establishes the midline in the diencephalon and subdivides the eye
field. In zebrafish, Ekker et al. (1995b)
found that ectopic expression
of hedgehog genes inhibits retinal formation by expanding the pax2 expression and the optic stalk. In addition,
suppression of hedgehog signaling either by a dominant-negative
protein kinase A (PKA) expression construct or in the cyclops mutant
disrupts the development of the optic stalk (Concordet et al., 1996
). A similar result was recently obtained from the homozygous deletion of
the Shh gene in mice. The development of the optic stalk was severely disrupted in these animals, and consequently the neural retina
failed to form (Chiang et al., 1996
). Recently, Jensen and Wallace
(1997)
demonstrated that high concentrations of recombinant N-terminal
Shh (SHH-N) (Lee et al., 1994
; Fan et al., 1995
; Roelink et al., 1995
)
in embryonic day (E) 18 mouse pellet cultures caused a marked increase
in progenitor cell proliferation and general increases in the
accumulation of differentiated cell types.
To test the effects of hedgehog proteins in the developing rat retina,
we used a dissociated cell culture system that supports both the
proliferation of retinal progenitor cells and the differentiation of
retinal neurons (Reh and Kljavin, 1989
; Anchan et al., 1991
; Reh,
1992a
,b
; Kelley et al., 1994
). Previous work in our lab and in others
has shown that embryonic and neonatal rat retinal cells cultured at
high density, either as cell pellets or on glass coverslips, developed
at nearly normal rates (Reh and Kljavin, 1989
; Watanabe and Raff, 1990
;
Anchan et al., 1991
; Altshuler et al., 1993
; Kelley et al., 1994
,
1995
). At the time of plating, ~70% of the cells are progenitor
cells when dissociated from E18 retina. This is the percentage of cells
in the retina at E18 that incorporate [3H]-thymidine or bromo-deoxyuridine (BrdU)
(Taylor and Reh, 1990
). Most of these cells also express Mash-1, the
mammalian homolog to the Drosophila achaete-scute proneural
genes (Jasoni and Reh, 1996
). These cells are also immunoreactive for
nestin (Anchan and Reh, 1995
), an intermediate filament protein present
in CNS progenitor cells (Cattaneo and McKay, 1990
). Several labs have also shown that most retinal cell types differentiate in these cultures, including ganglion cells, (Anchan et al., 1991
), amacrine cells (Anchan et al., 1991
; Lillien and Cepko, 1992
; Reh, 1992a
; Kelley
et al., 1994
), bipolar cells (Lillien and Cepko, 1992
), and both rod
and cone photoreceptors (Araki et al., 1987
; Reh and Kljavin, 1989
;
Sparrow et al., 1990
; Watanabe and Raff, 1990
; Kelley et al.,
1995
).
In embryonic rat retinal cell cultures treated with low concentrations
of recombinant SHH-N, we observed a transient mitogenic effect on
retinal progenitors, and a 2- to 10-fold increase in the number of
photoreceptors differentiating in the cultures when analyzed with three
different photoreceptor-specific antigens. In contrast, the numbers of
retinal ganglion cells and amacrine cells were similar to those in
control cultures. Thus, SHH-N specifically promotes the generation of
photoreceptors in rat retinal cultures.
MATERIALS AND METHODS
RNA extraction. E12 and E13 eyes, E15, E16, E18,
postnatal day (P) 0, P4, and P6 adult retinas, E18, P0, P4, P6, and
adult retinal pigmented epithelium (RPE), and P4 lens and sclera were dissected in HBSS with HEPES. The tissues were homogenized in Trizol
(Life Technologies-BRL, Bethesda MD), and total RNAs were isolated
according to the manufacturer's instructions. RNA yields were
determined by A260 on a Beckman DU-70
Spectrophotometer.
Cloning of hedgehog family members from the neural retina and
RPE. Three micrograms of total RNA were reverse-transcribed (RT)
with random hexamer primers for 1 hr at 42°C in a 20 µl reaction containing the following: 50 mM KCl, 20 mM
Tris-HCl, pH 8.3, 2.5 mM MgCl2, 10 mM DTT, 0.001% gelatin, 1 mM dNTP (Pharmacia,
Pleasant Hill, CA), 30 U RNasin (Promega, Madison WI), 100 pmol random hexamers (Pharmacia), and 200 U MoMuLV reverse transcriptase (Life Technologies-BRL). Negative control RT reactions were performed as
above but without the addition of reverse transcriptase. Ten microliters of the RT reaction were then amplified for 30 cycles on a
Perkin-Elmer thermocycler in a 50 µl reaction containing 500 ng
primers, 0.2 mm dNTP 2.5 U Taq polymerase (BRL), and final buffer concentrations of 50 mM KCl, 10 mM Tris
HCl, pH 8.3, and 1.9-2.3 mM MgCl2. Conserved
hedgehog family oligonucleotide primers corresponding to amino acid
sequences IFKDEEN (ATHTTYAARGAYGARGARAA) and the reverse compliment of
AHIHCSVK (TCRTARTANACCCARTCRAA) were used for PCR amplification. The
PCR products were analyzed by Southern blot hybridization and cloned
into the pTA vector (Invitrogen, San Diego CA). Random clones were
isolated, and DNA was sequenced to verify that we had obtained rat Shh
and Desert hedgehog (Dhh) cDNAs. Indian hedgehog (Ihh) clones were
isolated from RT-PCR reactions of E18 RPE and identified by DNA
sequencing.
Tissue distribution and developmental expression of Shh and Ihh
mRNAs. P4 lens, P4 retina, P4 RPE, P4 sclera, E12 eye, E13 eye,
all stages of RPE (1.5 µg of each), and 3 µg each of E15, E16, E18,
P0, P6, and adult retinal total RNAs were used as templates for RT
reactions. RT reactions (1.5 µl) were used as templates for the PCR
reactions. All PCR reactions were performed as above with the following
modifications: 2.5 µCi [32P]-dCTP (3000 Ci/mmol), 1.5 mM MgCl2, and 50 pmol per
primer (except Ihh reverse primer at 100 pmol). Shh PCR reactions were
performed as follows: 94°C for 3 min; 26 cycles of 94°C for 30 sec,
56°C for 30 sec, and 72°C for 45 sec. The sequences of the Shh
specific primers used were CGGCCGATATGAAGGGAAGA (forward primer) and
CGGAGTTCTCTGCTTTCACA (reverse primer). Ihh PCR reactions were performed
as follows: 94°C for 3 min; 26 cycles of 94°C for 30 sec, 64°C
for 30 sec, and 72°C for 45 sec. The sequences of the Ihh specific
primers used were CCTCATGACCCAGCGCTGCAAG (forward primer) and
GCCGARTGCTCDGACTTGAC (reverse primer). Actin PCR reactions were
performed as follows: 94°C for 3 min; 15 cycles of 94°C for 30 sec,
56°C for 30 sec, and 72°C for 45 sec. The sequences of the actin
specific primers were AAGAGAGGCATCCTGACCCT (forward primer) and
TACATGGCTGGGGTGTTGAA (reverse primer). Reaction products were
size-resolved by electrophoresis in 5% native polyacrylamide gels.
Gels were fixed, dried, and analyzed by autoradiography (13.5 hr at
70°C with an intensifying screen).
Quantification of Shh expression. Full-length Shh cDNA in
pBluescript was linearized, and sense RNA was generated by in
vitro transcription. Template DNA was removed with DNase I, and
the RNA was extracted with 1:1 phenol/chloroform and precipitated in
0.4 M LiCl and 3 vol of 100% EtOH. After resuspension of
the RNA pellet in H2O, the RNA concentration was determined
by A260. Increasing concentrations of Shh sense RNA (0, 0.3, 3, and 30 pg) were added to 3 µg aliquots of P10 rat brain RNA
and used as templates in RT reactions as above. Shh and actin PCR
reactions and subsequent analysis were performed as described
above.
Cell culture. Timed pregnant Sprague Dawley rats were
obtained from Simonsen Laboratories. E18 pregnant females were killed with CO2, and the embryos were dissected into
sterile HBSS with HEPES buffer at 4°C. Neural retinas were dissected
from the embryos and dissociated by mild trituration after a 10-15 min
incubation at 37°C in calcium-magnesium-free saline with trypsin
(0.025%). Total cell number was determined with a hemacytometer. Cells
were plated onto coverslips in 24-well plates at a density between 200,000 and 500,000 cells per well. Coverslips were coated sequentially with polylysine and Matrigel (1:100 dilution in HBSS; Collaborative Research, Bedford MA). For low density cell survival experiments, cells
were plated at 40,000 cells per well onto coverslips coated with a
fibrillar collagen gel in a 24-well plate. The fibrillar collagen-coated coverslips were prepared using Vitrogen, according to
the manufacturer's specifications (Collagen Corporation). All cultures
were maintained at 37°C and 5% CO2 for periods of 2-14 d. The culture medium contained DMEM/F12 (without glutamate or aspartate), 25 µg/ml insulin, 100 µg/ml transferrin, 60 µM putrescine, 30 nM selenium, 20 nM progesterone, 100 U/ml penicillin, 100 µg/ml streptomycin, 0.05 M HEPES, and 1% fetal bovine serum
(Life Technologies-BRL). One half of the media in each well was changed
every 48 hr.
SHH-N was added on the first day of culture. Unless indicated, 12 nM SHH-N protein was the final concentration. To obtain recombinant SHH-N, a cDNA encoding SHH-N (residues 1-198 of rat SHH)
(Roelink et al., 1994
) was cloned in a baculovirus expression vector
(modified from Invitrogen), and SHH-N protein was purified (Porter et
al., 1995
) from supernatant of viral-infected 5B1-4 (High-Five) cells.
Protein concentration was determined by dye binding and comparison
using ELISA with Escherichia coli-derived mouse SHH-N
(provided by Dr. P. Beachy, Johns Hopkins University).
Determination of cell phenotypes. After culture periods of
2-14 d, coverslips were fixed in 4% paraformaldehyde for 1 hr to overnight and then rinsed in PBS before processing for
immunohistochemistry. In some experiments, the cells in each of the
culture wells were dissociated with trypsin, counted with a
hemacytometer, and then allowed to adhere to polylysine-coated
coverslips for 2-6 hr before fixation and subsequent
immunohistochemistry. To identify specific types of retinal cells in
each of the cultures, the coverslips were processed for
immunohistochemistry using a previously published protocol (Reh and
Kljavin, 1989
; Kljavin and Reh, 1991
). Primary antibodies used in these
experiments were as follows: (1) rod-specific opsin, 4D2 monoclonal
antibody from Dr. R. Molday and Dr. D. Hicks, University of British
Columbia (Hicks and Barnstable, 1987
); (2) recoverin, affinity-purified
polyclonal rabbit antisera from Dr. J. Hurley, University of Washington
(Dizhoor et al., 1991
; Milam et al., 1993
); (3) cellular retinoic acid
binding protein C1 interphotoreceptor retinal-binding protein (IRBP)
monoclonal antibodies from Dr. J. Saari, University of Washington (De
Leeuw et al., 1990
); (4) nestin monoclonal antibody from the
Developmental Hybridoma Bank; and (5) Brn3.0, affinity-purified
polyclonal antisera from Dr. E. Turner, University of California San
Diego. The Brn3.0 gene encodes a POU domain transcription
factor with retinal expression limited to retinal ganglion cells
(Turner et al., 1994
; Xiang et al., 1995
). Primary antibody labeling
was detected using fluorosceinated or biotinylated secondary antibodies
and peroxidase-conjugated avidin (where appropriate). Labeled cells
were viewed on a Zeiss standard compound microscope with
Epi-Fluorescent illumination, and the number of labeled cells on each
coverslip was quantified in most cases by counting all of the labeled
cells in either a vertical or horizontal strip across the entire
coverslip. In some of the experiments, where the distribution of the
cells was more uniform, the labeled cells in 6-10 random fields were
counted.
RESULTS
Shh, Dhh, and Ihh are expressed in the developing rat eye
To determine whether hedgehog genes are expressed in
the developing rat retina, we amplified cDNAs from total retinal RNA of
newborn rats using RT-PCR and hedgehog-specific degenerate oligonucleotide primers. The amplification products were analyzed by
Southern blot hybridization using a digoxygenin-labeled oligonucleotide probe internal to the original primer set to verify that the
amplification products contained hedgehog cDNAs. The cDNAs were then
cloned into pTA and sequenced. Two previously identified
hedgehog genes, Shh (Echelard et al., 1993
;
Krauss et al., 1993
; Riddle et al., 1993
; Chang et al., 1994
; Roelink
et al., 1994
) and Dhh (Echelard et al., 1993
), were
identified. When a similar amplification was performed using the RPE as
the source of the RNA, we obtained clones of Ihh but not
Shh or Dhh.
We further characterized the expression of Shh in the developing retina
and other ocular tissues at various times during eye development using
quantitative RT-PCR. In P4 ocular tissues, Shh mRNA was not
detected in the lens or sclera but was detected in the retina, and a
minute quantity was detected in RPE, which may be attributed to
carryover of retinal tissue during tissue dissection (Fig.
1A). Shh was
detected in the retina as early as E16 (Fig. 1B), and
its expression continues throughout development and into the adult.
When compared with an Shh standard of in vitro transcribed RNA in parallel RT-PCR reactions (Fig. 1C), we determined
that Shh is expressed at ~5-10 ppm of polyA RNA,
suggesting that Shh mRNA is at very low levels in the rat
retina.
Fig. 1.
Hedgehog gene expression in the developing
rat eye by RT-PCR. A, In P4 ocular tissues,
Shh and Ihh mRNAs were not detected in
lens or sclera. Shh was detected in the retina and a
minute quantity was detected in the RPE. Ihh was
detected in RPE, and a minute quantity was detected in the retina.
B, Shh was first detected in the
developing retina at E16 and was detected at all stages of development
examined and in the adult. C, The amount of
Shh expressed in the retina was quantified using serial
dilutions (0.3, 3, 30 pg) of in vitro transcribed
full-length Shh RNA mixed with 3 µg of P10 rat brain
RNA before RT-PCR. In all experiments, actin RT-PCR reactions served as
normalization controls. Shh and Ihh PCR
reactions were amplified for 26 cycles, and actin PCR reactions were
amplified for 15 cycles. Amplification products were not observed when
reverse transcriptase was omitted from the reactions. D,
Ihh was first detected in the eye at E13 and expressed
in the RPE at E18 and in all subsequent stages examined, including the
adult.
[View Larger Version of this Image (55K GIF file)]
The RPE is known to be important for retinal development, and so we
also further analyzed the expression of Ihh in this tissue by RT-PCR.
In P4 ocular tissues, Ihh mRNA was not detected in the lens
or sclera but was detected in the RPE, with a minute quantity detected
in the retina, which may be attributed to carryover of RPE tissue
during the tissue dissection (Fig. 1A).
Ihh is first expressed in the developing RPE at E13 (Fig.
1D), shortly after the onset of differentiation in
this layer. The expression of Ihh was maintained throughout
eye development and into adult animals. This pattern of expression is
consistent with the RPE serving as an extraretinal source of Hedgehog
protein for regulating retinal development, in a manner analogous to
the way in which the notochord regulates floor plate differentiation in
the embryonic spinal cord.
To determine whether Ihh mRNA in the RPE is more abundant
than Shh in the neural retina, we performed a titration for
Ihh similar to that of Shh using a mouse
Ihh cDNA (kindly provided by Dr. A. MacMahon, Harvard
University). The primer sequences match 100% with this construct, and
we found that Ihh is expressed in the RPE within the same order of
magnitude as Shh expression in the neural retina (data not
shown).
SHH-N stimulates proliferation of retinal progenitor cells
Previous studies have shown that when dissociated E18 rat retinal
cells are cultured at high cell density, the retinal progenitor cells
continue to proliferate and generate neurons for up to 1 week in
vitro. We and others have previously assayed effects of several
mitogenic factors, including TGF-
, fibroblast growth factor (FGF),
and TGF
-3 (Anchan et al., 1991
; Lillien and Cepko, 1992
; Anchan and
Reh, 1995
). To determine whether SHH-N is mitogenic for retinal
progenitors, we analyzed the total number of cells in the SHH-N-treated
and control cultures after various periods in vitro (Fig.
2A). In the
SHH-N-treated cultures, there was a noticeable increase in cell number
over control cultures after 2 and 4 d in vitro (DIV).
This effect was transient, and by 6 DIV the control cultures had the
same number of total cells as the SHH-N-treated cultures. We also
quantified the number of nestin+ progenitor cells in
these cultures (Fig. 2B). Consistent with the
increase in total cell numbers, we found an increase in the number of
nestin+ progenitor cells in the SHH-N-treated
cultures over control after 2 and 4 DIV. After 6 DIV, the number of
progenitor cells in the SHH-N cultures was nearly the same as that in
control cultures.
Fig. 2.
SHH-N effects on progenitor proliferation
in vitro. A, Total cells in the wells of
SHH-N and control cultures were determined by redissociating the
cultures of retinal cells with trypsin and counting a sample on a
hemacytometer after 2, 4, and 6 DIV. Shown are the means and SEs of
three to five independent experiments expressed as a ratio of the
SHH-N-treated cultures to control cultures. There was an initial
increase in cell number in the SHH-N-treated cultures after 2 and 4 DIV; however, the difference did not reach statistical significance at
any day using an ANOVA and pairwise comparisons. After 6 DIV, the ratio
between SHH-N and control wells was 1.16. B,
Nestin+ progenitor cells were quantified after
redissociation and immunostaining. The numbers of
nestin+ progenitor cells were greater in the
SHH-N-treated cultures (
) than in control cultures (
) after 4 DIV; however, by 6 DIV, the numbers of nestin+
progenitor cells were the same in SHH-N-treated and control
cultures.
[View Larger Version of this Image (7K GIF file)]
To further confirm the mitogenic effect of SHH-N, in three separate
experiments BrdU was added to the cultures for the last 24 hr at 1-6
DIV. In all experiments, we observed an increase in the number of
BrdU+ cells in the SHH-N-treated cultures. At 2 and
4 DIV, SHH-N-treated cultures had an approximately 2.5-fold increase in
the number of BrdU+ cells over controls (2 DIV:
control, 190.3 cells/field; SHH-N, 433.3 cells/field; and 4 DIV:
control, 245.7 cells/field; SHH-N, 606.7 cells/field). By 6 DIV,
however, there was little difference in the number of
BrdU+ cells between control and SHH-N-treated
cultures (6 DIV: control, 360.3 cells/field; SHH-N, 322.7 cells/field;
values at all time points are the means of three random fields;
n = 1). Thus, SHH-N stimulates proliferation in retinal
progenitor cells but does not sustain it for more than a few days, and
the total cell number, the number of nestin+ cells,
and the number of BrdU+ cells in the control
cultures appear to "catch up" to SHH-N-treated cultures between 6 and 8 DIV.
Sonic Hedgehog selectively promotes the differentiation of
photoreceptors in the developing rat retina in vitro
To test for the activity of Hedgehog proteins on retinal
differentiation, we used a previously characterized dissociated cell culture assay. Dissociated E18 retinal cells in culture for 7 DIV under
control conditions express antigens and exhibit morphologies characteristic of most retinal cell types. Figure
3A shows cells labeled with
the C1 antibody, which is specific for amacrine cells in the rat
retina. The C1+ cells also have a characteristic
morphology in vitro
a large cell body with many processes
extending directly from the soma
consistent with their in
vivo morphology. Figure 3C shows the immunoreactivity for the protein recoverin, normally expressed in both rod and cone
photoreceptors and in a small number of bipolar cells. Note that the
morphology of these cells is different from that of the C1+ amacrine cells, in that the majority of the
recoverin+ cells have a more simple morphology, more
consistent with their photoreceptor identification. Figure
3E shows cells labeled with a rod photoreceptor antibody 4D2
(opsin), a monoclonal antibody raised against rod-specific opsin
protein. Throughout the first week of culture at this density, cells in
the cultures are also immunoreactive for ganglion cell antigens,
Brn3.0, and neurofilament protein. In addition, previous studies have
also shown that these cultures develop other amacrine cell- and bipolar
cell-specific antigens, including HPC-1 (syntaxin) for amacrine cells
(Kelley et al., 1994
), and PCP-2 and PKC-
for bipolar cells (Kelley
et al., 1994
). Although several of the retinal cell types are present after 7 DIV under control conditions, a majority of the cells in the
cultures incorporate BrdU and express nestin, an intermediate filament
protein present in neuronal progenitor cells (Anchan and Reh, 1995
). By
14 DIV, however, most cells express antigens characteristic of retinal
neurons and photoreceptors (Kelley et al., 1994
, 1995
). Thus, high
density cultures of E18 rat retinal cells support differentiation into
all of the retinal cell types after 7-14 DIV.
Fig. 3.
SHH-N selectively promotes rod photoreceptor
differentiation in E18 rat retinal progenitor cells in
vitro. E18 rat retinal cells were dissociated, plated at high
density, and cultured for 7 DIV in the absence (A, C, E)
or presence (B, D, F) of SHH-N. Cells in
A and B are labeled with the C1 antibody,
which labels most amacrine cells in the rat retina. Cells in
C and D are labeled with anti-recoverin,
a protein present in both rod and cone photoreceptors and the cone
bipolar cells. Cells in E and F are
labeled with the rod photoreceptor-specific 4D2 antibody (opsin).
Although there was some increase in the number of
recoverin+ cells in the SHH-N-treated cultures as
compared with the control cultures, the most dramatic effect of SHH-N
was on the number of opsin+ cells (compare
E and F).
[View Larger Version of this Image (124K GIF file)]
To determine the effects of SHH on cellular differentiation, E18 rat
retinal cells were cultured in the presence or absence of recombinant
rat SHH-N for 2-14 DIV. SHH-N was added to the medium at a
concentration of ~12 nM. Figure 3 shows the effects we
observed after 7 DIV on C1+ amacrine cells
(A and B), recoverin+
photoreceptors (C and D), and
opsin+ rod photoreceptors (E and
F) in control cultures (A, C,
and E) and SHH-N-treated cultures (B,
D, and F). Although the numbers of
amacrine cells were not significantly different between the treated and
control cultures, the number of recoverin+ cells
increased moderately in the SHH-N-treated wells, and the number of
opsin+ cells increased dramatically after SHH-N
treatment.
Quantification of cell number for several retinal antigens indicates
that SHH-N specifically promotes expression of photoreceptor specific
antigens after 7 DIV (Fig.
4A). The results of
seven experiments were combined and expressed as a percentage of
control. The numbers of C1+ amacrine cells,
Brn3.0+ ganglion cells, and
nestin+ progenitor cells were not different between
the treated and control cultures; however, the number of
recoverin+ cells increased twofold on average, the
number of IRBP+ cells increased more than threefold,
and the number of opsin+ cells increased typically
10-fold. Thus, the numbers of cells immunoreactive for all three
photoreceptor antigens increase after SHH-N treatment of E18 rat
retinal cells.
Fig. 4.
SHH-N promotes expression of photoreceptor
specific proteins in retinal cells in vitro.
A, E18 rat retinal cells were cultured for 6 or 7 DIV,
and the numbers of cells expressing several different cell
type-specific antigens were quantified. The graph shows the ratios of
cells in SHH-N-treated cultures compared with control cultures from
three to seven independent experiments (expressed as means and SEs).
Rod opsin+ cells show the greatest increase in the
SHH-N-treated cultures (~10-fold) compared with control cultures, but
two other photoreceptor antigens, IRBP and recoverin, also show an
increase in SHH-N-treated over control cultures. Antigens expressed in
other types of retinal neurons (Brn3.0 and C1) and progenitor cells
(nestin) were not significantly increased in the SHH-N-treated cultures
after 6-7 DIV. B, A dose-response relationship for the
effect of SHH-N on photoreceptor differentiation. SHH-N was added to
E18 cultures at concentrations ranging from 1.2 to 12 nM,
and the number of opsin+ cells was quantified after
6 DIV. The number of opsin+ cells was 20-fold
greater in 2.4 and 12 nM SHH-N-treated cultures than
control cultures, and fivefold greater when 1.2 nM SHH-N was added. C, The dose-response was
extended to concentrations of 24 and 120 nM in a separate
experiment. To compare the data represented in B with
the higher concentrations of SHH-N, each experimental series is shown
as % control of opsin+ cells. Control for each
experiment was normalized to 100%.
[View Larger Version of this Image (19K GIF file)]
A dose-response relationship for the effect of SHH-N on photoreceptor
differentiation is shown in Figure 4B. SHH-N was
added to E18 cultures at concentrations ranging from 1.2 to 12 nM, and the number of opsin+ cells was
quantified after 6 DIV. The addition of 2.4 and 12 nM SHH-N
resulted in a 20-fold increase in the number of
opsin+ cells over control cultures, and a fivefold
increase when 1.2 nM SHH-N was added. The minimal
concentration of SHH-N necessary to observe an effect on photoreceptor
differentiation is similar to that reported for motor neuron induction
in neural tube (Roelink et al., 1994
).
In a parallel set of experiments, we assayed for the effects of SHH-N
protein added at concentrations of 24 nM and 120 nM and cultured for 7 DIV. At these concentrations, the
ratio of opsin+ cells in treated versus untreated
was similar to that observed at 12 nM (Fig. 4C).
This demonstrates that in high density monolayer cultures, effects of
SHH-N protein are saturating by 12 nM.
To determine whether the effects of SHH-N addition on opsin expression
were specific to SHH-N, monoclonal antibody 5E1 raised against SHH-N
(Ericson et al., 1996
) was added to E18 cultures in the presence and
absence of SHH-N protein. We found that 5E1 supernatant in the presence
or absence of SHH-N repressed opsin expression to levels slightly below
control values (no 5E1 or SHH-N added) after 8 DIV, thereby blocking
the effects of exogenous SHH-N on rod photoreceptor differentiation
(data not shown).
To further characterize the specific effect on photoreceptor
differentiation, we analyzed SHH-N-treated and control cultures at 3, 6, and 9 DIV. Figure 5 shows the number
of cells immunoreactive for four different antigens as a function of
DIV. The number of amacrine cells steadily increased in both the
control and treated wells over 9 DIV without significant differences
between the control and SHH-N-treated wells (Fig. 5A),
indicating that the continued generation and differentiation of these
cells was not affected by SHH-N in the medium. The number of
Brn3.0+ ganglion cells did not change in their
numbers over the period of culture (Fig. 5A), consistent
with the fact that by E18, most of the ganglion cells of the retina
have already been generated.
Fig. 5.
SHH-N selectively promotes rod photoreceptor
differentiation. E18 rat retinal cells were cultured at high density
for 3, 6, or 9 DIV, and the numbers of cells labeled with one of four
different antibodies were quantified by counting labeled cells in six
fields at 400×. The means and SEs are plotted as a linear scale in
A and as a 10log scale in B
and C. A, The numbers of amacrine cells,
labeled with the C1 antibody (circles), and ganglion
cells, labeled with a Brn3.0 antibody (squares), were
not significantly different between the SHH-N-treated cultures
(open symbols) and control cultures (solid
symbols). B, The number of
recoverin+ cells (expressed in all photoreceptor
cells and cone bipolar cells) was greater in the SHH-N-treated cultures
(open squares) after 3, 6, and 9 DIV than in control
cultures (solid squares). C, The number
of opsin+ cells was approximately 10-fold greater in
the SHH-N-treated cultures (open squares) than in
control cultures (solid squares) after 6 and 9 DIV.
Note: opsin+ cells were not observed in the six
fields counted in either the SHH-N or control cultures after 3 DIV.
[View Larger Version of this Image (10K GIF file)]
That neither ganglion cell nor amacrine cell numbers were affected by
the addition of SHH-N to the medium suggested that the effects on
photoreceptor numbers were not attributable to an overall survival
promoting effect of this factor. In whole retinal explant culture and
high density, dissociated retinal cell cultures, retinal ganglion cells
are the most susceptible to death, whereas other retinal cell types
survive without significant loss in cell numbers (Kelley et al., 1994
).
That Brn3.0+ ganglion cell numbers were not
different between SHH-N-treated and control cultures suggests that
SHH-N is not acting as a survival factor. It is difficult, however, to
adequately assess a small survival effect of a particular factor in
high density cultures, because endogenous growth factors known to have
trophic effects are synthesized in the retina (for review, see Reh et
al., 1995
). To directly test the effects of SHH-N on retinal cell
survival, we cultured retinal cells in serum-free medium at low
density. This sufficiently limits the availability of endogenous
factors, and many of the retinal cells undergo apoptotic death within a few days of culture (Bermingham-McDonogh et al., 1996
). We found no
significant difference in the number of isolated E18 retinal cells
after 6 DIV between SHH-N-treated and control cultures (mean and SD of
three experiments; SHH-N: 56 ± 12.5; control: 46 ± 7.7).
Adding SHH-N to the retinal cells caused the numbers of
recoverin+ and rod opsin+ cells
to increase in the cultures at all time points examined. Because the
number of opsin and recoverin+ cells per field in
both the treated and control wells increased substantially over the
culture period, the results are expressed on a 10log scale.
Figure 5B shows that there was an approximately twofold increase in the number of recoverin+ cells in
SHH-N-treated cultures over control cultures after 3 DIV (10 cells per
field in SHH-N treated vs 5 cells per field in the control), and this
difference was maintained after 6 DIV (19 cells per field in SHH-N
compared with 9 cells per field in control) and at 9 DIV as well. The
numbers of opsin+ cells were also quantified after
3, 6, and 9 DIV (Fig. 5C). There were no
opsin+ cells in either the control or treated wells
after 3 DIV; however, at both 6 and 9 DIV, there were from 10 (6 DIV)
to 30 times (9 DIV) more rod opsin+ cells in the
SHH-N-treated cultures than in the control cultures.
In a separate series of experiments, the high density cultures were
redissociated (see Materials and Methods) and replated briefly at a
lower density before fixation and immunohistochemistry. This allowed us
to determine the percentages of the total cells that were
immunoreactive for rod opsin and recoverin. The results of these
experiments are shown in Figure 6. In the
control cultures (Fig. 6A), the percentage of
recoverin+ cells increased from ~10% of the total
after 4 DIV to nearly 40% after 14 DIV. By contrast, there were no
opsin+ cells after 4 DIV, and the percentage of
opsin+ cells plateau at ~10% of the total cells,
even after 14 DIV. These results suggest that there is a limiting
factor for opsin expression even in the high density control cultures.
In contrast, addition of SHH-N increased the percentage of total cells
expressing opsin to levels nearly identical to that of recoverin,
although with a 1-2 d lag. As a result, by 14 DIV the percentage of
rod opsin+ cells reached nearly 40% of the total
cells.
Fig. 6.
SHH-N promotes opsin expression in cultured rat
retinal cells. E18 rat retinal cells were cultured for 4, 6, 8, 10, and
14 DIV in the presence or absence of SHH-N protein, and the percentages of the total cells in the cultures that expressed rod opsin and recoverin were determined. A, In control cultures, the
percentage of cells that expressed recoverin increased with time in
culture up to 40%; however, the percentages of cells that expressed
opsin only reached 10%, even after 14 DIV. B, In
contrast, the percentages of recoverin+ and
opsin+ cells increased in parallel in the
SHH-N-treated cultures, and both antibodies labeled ~40% of the
retinal cells after 14 DIV.
[View Larger Version of this Image (10K GIF file)]
In some experiments, we double-labeled cultures with opsin and
recoverin antibodies at 7 DIV. In previous studies (Kelley et al.,
1994
, 1995
) and in the control cultures of these experiments, virtually
all of the opsin+ cells examined were also
recoverin+ (data not shown). This finding is
consistent with previous in vitro and in vivo
data which show that recoverin is expressed before opsin during rat
retinal development (Kelley et al., 1994
, 1995
). Similarly, in the
SHH-N-treated cultures, the majority of the cells were either
double-labeled with opsin and recoverin (Fig.
7, arrows) or with recoverin
alone (Fig. 7A, asterisks); however, we
identified a subset of opsin+ cells that were
recoverin negative (Fig. 7B, arrowheads),
suggesting that SHH-N may have direct effects on opsin expression.
Fig. 7.
Nearly all recoverin immunoreactive cells also
express rod opsin after 2 weeks of culture with SHH-N. E18 rat retinal
cells were cultured for 14 DIV in SHH-N-containing media and then
labeled with antibody anti-recoverin and a fluorescein-conjugated
secondary antibody (A). The same cultures were
then labeled with anti-rod opsin and a rhodamine-conjugated secondary
antibody (B). As expected, most cells in the
field were immunoreactive for both proteins (arrows) or
recoverin alone (asterisks). Unexpectedly, a subset of
cells were identified that were labeled only with opsin
(arrowheads).
[View Larger Version of this Image (147K GIF file)]
DISCUSSION
Hedgehog proteins in vertebrate eye development
We found that Shh, Dhh, and Ihh
are expressed in the eye during development and in adult rats. Within
the eye, Shh and Dhh are expressed in the neural
retina and Ihh is expressed in the RPE throughout much of
retinal histogenesis and differentiation. The only other
hedgehog family member found to be expressed in the
vertebrate eye thus far is the Xenopus Banded hedgehog
(Bhh) (Ekker et al., 1995a
). To date, a mammalian homolog to
Bhh has not been reported. The hedgehog family
degenerate primers we used to search for hedgehog genes
expressed in the eye failed to detect a Bhh-like sequence.
Although the primer sequences are conserved in Bhh, the
possibility remains that a mammalian Bhh exists and that
other more novel hedgehog genes expressed in the eye have yet to be discovered.
Ihh expression has been described previously in cartilage
and the developing hindgut (Bitgood and McMahon, 1995
). We found that
Ihh is also expressed in the RPE very early in ocular development, as
early as pigmentation begins. The expression of Ihh is
maintained throughout the period of rod photoreceptor differentiation,
consistent with the actions of SHH-N in vitro. The
restricted expression of Ihh to the RPE is interesting in
light of previous studies that show a role for this tissue in
photoreceptor differentiation (for review, see Grondona et al., 1996
).
For example, conditioned medium experiments have shown that diffusible
factors from the RPE can promote photoreceptor differentiation in
vitro (Spoerri et al., 1988
).
Jensen and Wallace (1997)
reported that Shh is expressed
early in retinal histogenesis in a small subset of cells that localize to the zone of postmitotic differentiating progenitors cells. In the
fully differentiated mouse retina, Shh expression is
localized to a small subset of cells in the ganglion cell layer and in
the inner tier of the inner nuclear layer. In addition, Patched, a component of the hedgehog receptor complex (Marigo et al., 1996
; Stone
et al., 1996
), is expressed early during retinal development in the
neuroblast zone, which in later developmental stages is primarily
composed of mitotic progenitors and differentiating rod photoreceptors.
In the mature retina, patched is expressed in the middle
tier of the inner nuclear layer, which corresponds to expression in
bipolar cells and/or Müller glia. These results suggest that
progenitor cells and possibly differentiating photoreceptor cells
contain a component of the hedgehog signaling pathway that is capable
of receiving the hedgehog signal. Furthermore, the localization of
Shh to the inner retina and Ihh to the RPE
suggests that the developing retina is exposed to a combination of
hedgehog signals, which may in part contribute to the complexity of the effects observed in vitro.
SHH acts as a mitogen for retinal progenitors
We have shown that SHH-N has a mitogenic activity on retinal
progenitor cells in vitro. This confirms recent findings by
Jensen and Wallace (1997)
. At 12 nM SHH-N, we found an
approximately 1.5-fold increase in both total cell number and
nestin+ cells and more than a twofold increase in
BrdU+ cells as compared with control cultures after
4 DIV. In pellet cultures of dissociated mouse retinal cells, Jensen
and Wallace (1997)
found a twofold increase in the percentage of
BrdU+ cells after 3 DIV at a concentration of 400 nM SHH-N. Interestingly, we found that by 6 DIV and
thereafter, SHH-N-treated and control cultures are nearly identical in
their numbers of total cells, nestin+ cells, and
BrdU+ cells. Thus, SHH-N appears to have a transient
mitogenic effect, followed by an increase in cell differentiation,
allowing the control wells to "catch up."
In the Drosophila eye disk, Heberlein et al. (1995)
found
that ectopic hedgehog expression induces string expression, a protein that drives cells in G2 into M-phase. They concluded that "hedgehog induces cell cycle synchronization and arrest in the furrow and cellular proliferation anterior to the furrow." These conclusions are
consistent with our findings and suggest that SHH may drive the retinal
progenitor cells through a final cell division before promoting their
differentiation.
Experiments in Drosophila have implicated PKA in hedgehog
signaling in imaginal disks. A current model holds that hedgehog activates decapentaplegic and wingless expression in wing and leg disks
by reversing a tonic PKA-mediated inhibition of these genes (Felsenfeld
and Kennison, 1995
; Jiang and Struhl, 1995
; Li et al., 1995
; Strutt et
al., 1995
; Hammerschmidt et al., 1996
). Data from vertebrate studies
also support this model: the SHH-mediated induction of dopaminergic
neurons in the ventral mesencephalon was blocked by increasing the
level of PKA activity with forskolin or 8-bromo-cyclic AMP (cAMP)
(Hynes et al., 1995
). Previous work from our lab has shown that
dibuturyl-cAMP, 8-bromo-cAMP, or forskolin inhibited proliferation in
retinal progenitor cells (Taylor and Reh, 1990
). Thus, the mitogenic
effects of SHH-N are consistent with the Drosophila model of
PKA antagonism. We also found that the number of differentiated retinal
cells (including opsin+ cells) increased after
treatment of retinal progenitors with PKA activators, indicating that
PKA has additional functions in retinal progenitors.
Hedgehog proteins promote photoreceptor differentiation
in vitro
In addition to its effects on cell proliferation, SHH-N also
promotes photoreceptor differentiation in vitro. The
progressive expression of photoreceptor-specific genes suggests that
there are several stages in the differentiation of these cells (Knight and Raymond, 1990
). Thymidine birthdating studies demonstrated that rod
photoreceptor cells are generated in the rodent retina in both neo- and
postnatal periods; however, onset of rod opsin expression occurs 3-4 d
after their birthdate (for review, see Reh, 1992b
). Because SHH-N
stimulates retinal progenitor cell proliferation, it is possible that
SHH-N also induces progenitor cells to differentiate into rod
photoreceptors. This is analogous to the actions of hedgehog in
Drosophila eye disks, in which hedgehog expression also
regulates photoreceptor differentiation at the morphogenetic furrow
(Jiang and Struhl, 1995
; Li et al., 1995
; Strutt et al., 1995
). It is
also possible, however, that hedgehog proteins act later in
photoreceptor differentiation. SHH-N treatment results in a subset of
cells that express the late differentiation marker, rod-specific opsin,
without also expressing recoverin (Fig. 7). Recoverin is normally
expressed in photoreceptors before the onset of rod or cone opsins both
in vitro and in vivo (Reh, 1992b
; Bumsted et al.,
1993
; Kelley et al., 1994
, 1995
; Liou et al., 1994
; Dorn et al., 1995
).
These results suggest that although a temporal order exists in the
onsets of recoverin expression and opsin expression, this order is not
obligatory.
Our results show that SHH-N promoted a two- to threefold increase in
the expression of recoverin+ cells and
IRBP+ cells, whereas the number of
opsin+ cells increased approximately 10-fold.
Several possibilities exist for these observations. One possibility in
considering these differences may lie in the baseline of the numbers of
cells expressing these proteins. At early time points (3-7 DIV), the
number of recoverin+ cells and
IRBP+ cells is significantly higher than those
expressing opsin in the control cultures. Thus, the percentage increase
observed in SHH-N-treated cultures is greater for opsin than for
recoverin and IRBP when the absolute numbers of cells are compared
(Fig. 5). Second, because SHH-N is mitogenic, the increase in
recoverin+ cells and IRBP+ cells
may be indirect and attributable to the increase of progenitors in the
SHH-N-treated cultures. This is unlikely because the numbers of
C1+ amacrine cells did not increase, and these cells
are still being generated in the retina at the time of culture. A third
possibility is that the addition of SHH-N promotes the proliferation of
progenitors at an advanced stage of rod photoreceptor commitment.
Although vertebrate retinal progenitors are multipotent (Turner and
Cepko, 1987
; Holt et al., 1988
; Wetts and Fraser, 1988
), studies have shown heterogeniety in the responses of retinal progenitors to growth
factors and cyclic nucleotide analogs (Taylor and Reh, 1990
; Lillien
and Cepko, 1992
). Furthermore, expression of basic helix-loop-helix
transcription factors such as Mash I and Cash I
are differentially expressed in retinal progenitors at mid to late
stages of retinal development in the mouse and chick, respectively (Jasoni et al., 1994
; Jasoni and Reh, 1996
). Consistent with this possibility is that the increase observed for recoverin- and
IRBP-expressing cells could be attributable to expansion of a
rod-progenitor pool, and the increase in opsin-expressing cells could
be attributable to SHH-N having a later, specific effect on promoting
opsin expression on postmitotic differentiating rods. This is analogous
to the effects of SHH on motor neuron development, where there is an initial requirement for SHH just before the final mitotic division, as
well as a later requirement for differentiation (Ericson et al.,
1996
).
To determine the nature of the factors that control either the rate or
extent of rod differentiation, several groups have tested various
candidate molecules known to be present in the developing retina at the
appropriate stage of development. To date, the following five factors
have been shown to promote rod photoreceptor differentiation: FGF,
taurine, RA, S-laminin, and SHH. These factors can be divided into
those that act on the progenitor cells and those that act at later
stages of differentiation. FGF, taurine, and S-laminin all appear to
act on later stages of photoreceptor differentiation rather than
directly on the retinal progenitor cells. FGF is more likely to play a
survival role for rods than act to promote their generation (Hicks and
Courtois, 1992
; Bugra et al., 1993
; Rakoczy et al., 1993
; Gao and
Hollyfield, 1995
). Another molecule shown to increase the number of
rods that differentiate in neonatal rat retinal cultures is taurine
(Altshuler et al., 1993
). Taurine is present in all cells of the
developing retina at a high concentration and is known to be critical
for rod survival in adult animals (Hayes et al., 1975
; Lake, 1994
).
There is no direct evidence that taurine acts on the retinal progenitor
cells to influence their decision to adopt a rod photoreceptor cell fate; rather, taurine is likely to be critical for the later stages of
rod differentiation because it causes an increase in the number of
opsin+ cells when added to cultures many days after
cells have undergone their final mitotic division (Altshuler et al.,
1993
). S-laminin (Hunter et al., 1992
) is concentrated in the
subretinal space and is also likely to be more important in the later
aspects of photoreceptor differentiation, because mice with targeted
disruption of the S-laminin gene apparently have a normal
numbers of rods, but their outer segments are severely disrupted (Libby
et al., 1995
).
We reported that RA acts on retinal progenitor cells to promote their
differentiation as rod photoreceptor cells (Kelley et al., 1994
).
Treatment of rat retinal cell cultures with either all-trans
or 9-cis RA causes BrdU-labeled progenitor cells to choose
the rod photoreceptor cell fate instead of the amacrine cell fate
(Kelley et al., 1994
). Thus, RA acts at a very early stage in rod
photoreceptor genesis. More recently, we have shown that
all-trans RA has precisely the same effect in
vivo: injection of pregnant rats with all-trans RA
causes an increase in the number of rod photoreceptor cells in the
retina and a corresponding decline in amacrine cells (Kelley et al.,
1995
). Exogenous RA treatment also causes an increase in the number of
rod photoreceptors in zebrafish retina (Hyatt et al., 1995
), suggesting
that RA may have an evolutionary conserved role in rod photoreceptor
generation.
The relationship between SHH and other factors known to promote the rod
photoreceptor cell fate is complex. SHH-N is mitogenic for retinal
progenitor cells and also promotes the differentiation of rod
photoreceptors. Because RA does not act as a mitogen for retinal
progenitor cells (Kelley et al., 1994
), it is unlikely that SHH acts
only to increase RA production or action in the retina. Thus, it is
possible that the two factors act through different mechanisms. In the
developing limb bud of the chick, SHH and RA have been shown to have
partly overlapping effects (Helms et al., 1994
). One possible
explanation is that SHH and RA act for short- and long-range
patterning, respectively. Indeed, it is likely that the complex
overlapping mosaics of the various retinal cell types require several
layers of patterning mechanisms. In this later function, SHH may act
with taurine to regulate the further differentiation of the rod
photoreceptor cells and potentially regulate the levels of opsin
expression in mature retina.
An interesting difference between this study and that of Jensen and
Wallace (1997)
are the effects of SHH-N on retinal differentiation. We
observed significant and specific increases in the numbers of rod
photoreceptors at all concentrations of SHH-N tested (1.2-120 nM). By contrast, Jensen and Wallace (1997)
did not observe
significant increases in any differentiated cell type at medium
concentrations of SHH-N (35 nM); however, 1.5- to twofold
increases in retinal neurons were observed at higher concentrations (70 and 190 nM). The most significant effect they observed was
a twofold and fourfold increase in the number of Müller glia at
70 and 190 nM SHH-N, respectively. One possible reason for
the differences observed between our findings and that of Jensen and
Wallace (1997)
may be the different concentrations of SHH-N that are
used. It is unlikely, however, that concentrations of SHH-N alone can
explain the difference, because we observed significant increases in
the number of opsin+ cells at 120 nM
SHH-N (a concentration that overlaps with their concentration range).
The lack of a specific increase in rod cell number observed by Jensen
and Wallace (1997)
may be explained by the different culture system
used. Because pellet cultures are the highest density cultures possible
for dissociated retinal cells, rod-inhibitory factors produced by
neighboring cells would be in high concentration, even in comparison to
high density monolayer cultures. Possible rod-inhibitory factors are
CNTF and bFGF. CNTF has been shown to be inhibitory for rod
photoreceptor differentiation and is produced by the mammalian retina
(Kirsch et al., 1996
; Ezzeddine et al., 1997
). FGF is produced by the
retina (Rakoczy et al., 1993
) and has been shown to have effects on
proliferation and differentiation of the retina (Lillien and Cepko,
1992
; Pittack et al., 1997
). We observed in E18 high density monolayer
cultures that the addition of bFGF (10 ng/ml) inhibits rod
differentiation. Furthermore, repression of rod differentiation is
observed with bFGF even in the presence of 12 nM SHH-N
(E. M. Levine and T. A. Reh, unpublished observations). Thus,
it is likely that in pellet cultures, rod differentiation is repressed
because of locally high concentrations of a factor such as CNTF or
bFGF, and that this repression is partially relieved at very high
concentrations of SHH-N, allowing for increases in cellular
differentiation.
We propose the following model for the role of hedgehog in retinal
development (Fig. 8). As the pigmented
epithelial cells develop during ocular morphogenesis, they release IHH
into the intraretinal matrix between the RPE and the developing neural retina. The IHH acts on the retinal progenitor cells to stimulate their
mitosis and on the newly postmitotic rod photoreceptors to stimulate
their further differentiation. In this way, an extraretinal source of
hedgehog regulates retinal differentiation in a manner analogous to the
way in which the notochord regulates floor plate differentiation in the
embryonic spinal cord. Consistent with this model is the observation
that the processes that SHH-N promote in vitro occur at the
surface of the retina closest to the RPE in vivo.
Furthermore, Shh is expressed in the inner layers of the
neural retina. Thus, two putative sources of Hedgehog proteins are
present in the developing retina in close proximity to the cells that
are responsive to Hedgehog signals, namely, progenitors and developing
rod photoreceptors.
Fig. 8.
Model for Hedgehog action in the retina. Ihh is
secreted by the RPE into the intraretinal matrix, and Shh is expressed
in cells occupying the inner retina, promoting the mitogenesis of progenitors at the ventricular surface and the differentiation of rods
in the developing outer nuclear layer. Cell types such as amacrine
cells and ganglion cells occupy the inner half of the retina and are
not receptive to Shh signaling.
[View Larger Version of this Image (47K GIF file)]
FOOTNOTES
Received April 21, 1997; revised May 20, 1997; accepted May 27, 1997.
This work was supported by National Institutes of Health Grant RO1
NS28308 to T.A.R and the Foundation Fighting Blindness. E.M.L. was
supported by National Research Service Award EY 66056. We acknowledge
the excellent technical assistance of Roger Williams. We also thank the
members of the Reh laboratory for helpful discussions and criticisms
and appreciate the comments of Drs. Olivia Bermingham-McDonogh, Andrew
Davis, and Yvonne Meyer on this manuscript.
Correspondence should be addressed to Thomas A. Reh, Department of
Biological Structure, Box 357420, University of Washington, Seattle, WA
98195.
REFERENCES
-
Altshuler D,
Lo-Turco JJ,
Rush J,
Cepko C
(1993)
Taurine promotes the differentiation of a vertebrate retinal cell type in vitro.
Development
119:1317-1328[Abstract].
-
Anchan RM,
Reh TA
(1995)
Transforming growth factor-beta-3 is mitogenic for rat retinal progenitor cells in vitro.
J Neurobiol
28:133-145[Web of Science][Medline].
-
Anchan R,
Angello J,
Balliet A,
Walker M,
Reh TA
(1991)
EGF and TGF stimulate retinal germinal neuroepithelial proliferation.
Neuron
6:1-20[Web of Science][Medline].
-
Araki M,
Iiada Y,
Taketami S,
Watanabe M,
Ohta K,
Saito J
(1987)
Characterization of photoreceptor cell differentiation in the rat retinal cell culture.
Dev Biol
124:239-247[Web of Science][Medline].
-
Bermingham-McDonogh O,
McCabe K,
Reh TA
(1996)
GGF/neuregulins promote neuronal survival and neurite outgrowth in rat retinal cells in vitro.
Development
122:1427-1438[Abstract].
-
Bitgood MJ,
McMahon AP
(1995)
Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo.
Dev Biol
172:126-138[Web of Science][Medline].
-
Bugra K, Oliver L, Jacquemin E, Laurent M, Courtois Y, Hicks
D (1993) Acidic fibroblast growth factor is expressed
abundantly by photoreceptors within the developing and mature rat
retina. Eur J Neurosci [Erratum (1994) 6:1062] 5:1586-1595.
-
Bumsted K,
Hendrickson A,
Erickson A,
Szel A
(1993)
Immunocytochemical development of cone opsins in Macaca monkey retina.
Soc Neurosci Abstr
19:52.
-
Cattaneo E,
McKay R
(1990)
Proliferation and differentiation of neuronal stem cells regulated by nerve growth factor.
Nature
347:762-765[Medline].
-
Chang DT,
Lopez A,
von Kesseler DP,
Chiang C,
Simandl BK,
Renbin Z,
Seldin MF,
Fallon JF,
Beachy PA
(1994)
Products, genetic linkage and limb patterning activity of a murine hedgehog gene.
Development
120:3339-3353[Abstract].
-
Chiang C,
Litingtung Y,
Lee E,
Young KE,
Corden JL,
Westphal H,
Beachy PA
(1996)
Cyclopia and defective axial patterning in mice lacking sonic hedgehog gene function.
Nature
383:407-413[Medline].
-
Concordet JP,
Lewis KE,
Moore JW,
Goodrich LV,
Johnson RL,
Scott MP,
Ingham PW
(1996)
Spatial regulation of a zebrafish patched homologue reflects the roles of sonic hedgehog and protein kinase A in neural tube and somite patterning.
Development
122:2835-2846[Abstract].
-
De Leeuw AM,
Gaur VP,
Saari JC,
Milam AH
(1990)
Immunolocalization of cellular retinol-, retinaldehyde- and retinoic acid-binding proteins in rat retina during pre- and postnatal development.
J Neurocytol
19:253-264[Web of Science][Medline].
-
Dizhoor AM,
Ray S,
Kumar S,
Niemi G,
Spencer M,
Brolley D,
Walsh KA,
Philipov PP,
Hurley JB,
Stryer L
(1991)
Recoverin: a calcium sensitive activator of retinal rod guanylate cyclase.
Science
251:915-918[Abstract/Free Full Text].
-
Dorn GM,
Hendrickson LE,
Hendrickson A
(1995)
The appearance of rod opsin during monkey retinal development.
Invest Ophthalmol Visual Sci
36:2634-2651[Abstract/Free Full Text].
-
Echelard Y,
Epstein DJ,
St-Jacques B,
Shen L,
Mohler J,
McMahon JA,
McMahon AP
(1993)
Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity.
Cell
75:1417-1430[Web of Science][Medline].
-
Ekker SC,
McGrew LL,
Lai C-J,
Lee JJ,
von Kessler DP,
Moon RT,
Beachy PA
(1995a)
Distinct expression and shared activities of members of the hedgehog gene family of Xenopus laevis.
Development
121:2337-2347[Abstract].
-
Ekker SC,
Ungar AR,
Greenstein P,
von-Kessler DP,
Porter JA,
Moon RT,
Beachy PA
(1995b)
Patterning activities of vertebrate hedgehog proteins in the developing eye and brain.
Curr Biol
5:944-955[Web of Science][Medline].
-
Ericson J, Muhr J, Placzek M, Lints T, Jessell TM, Edlund
T (1995) Sonic hedgehog induces the differentiation of
ventral forebrain neurons: a common signal for ventral patterning
within the neural tube. Cell [Erratum (1995) 82:165] 81:747-756.
-
Ericson J,
Morton S,
Kawakami A,
Roelink H,
Jessell TM
(1996)
Two critical periods of long-range sonic hedgehog signalling required for the specification of motor neuron identity.
Cell
87:661-673[Web of Science][Medline].
-
Ezzeddine ZD,
Yang X,
DeChiara T,
Yancopoulos G,
Cepko CL
(1997)
Postmitotic cells fated to become rod photoreceptors can be respecified by CNTF treatment of the retina.
Development
124:1055-1067[Abstract].
-
Fan CM,
Porter JA,
Chiang C,
Chang DT,
Beachy PA,
Tessier-Lavigne M
(1995)
Long-range sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway.
Cell
81:457-465[Web of Science][Medline].
-
Felsenfeld AL,
Kennison JA
(1995)
Positional signaling by hedgehog in Drosophila imaginal disc development.
Development
121:1-10[Abstract].
-
Gao H,
Hollyfield JG
(1995)
Basic fibroblast growth factor in retinal development: differential levels of bFGF expression and content in normal and retinal degeneration (rd) mutant mice.
Dev Biol
169:168-184[Web of Science][Medline].
-
Grondona JM,
Kastner P,
Gansmuller A,
Decimo D,
Chambon P
(1996)
Retinal dysplasia and degeneration in RAR
2/RAR
2 compound mutant mice.
Development
122:2173-2188[Abstract]. -
Hammerschmidt M,
Bitgood MJ,
McMahon AP
(1996)
Protein kinase A is a common negative regulator of Hedgehog signaling in the vertebrate embryo.
Genes Dev
10:647-658[Abstract/Free Full Text].
-
Harris WA,
Messersmith SL
(1992)
Two cellular inductions involved in photoreceptor determination in the Xenopus retina.
Neuron
9:357-372[Web of Science][Medline].
-
Hayes KC,
Carey RE,
Schmidt SY
(1975)
Retinal degeneration associated with taurine deficiency in the cat.
Science
188:949-951[Abstract/Free Full Text].
-
Heberlein U,
Singh CM,
Luk AY,
Donohoe TJ
(1995)
Growth and differentiation in the Drosophila eye coordinated by hedgehog.
Nature
373:709-711[Medline].
-
Helms J,
Thaller C,
Eichele G
(1994)
Relationship between retinoic acid and sonic hedgehog, two polarizing signals in the chick wing bud.
Development
120:3267-3274[Abstract].
-
Hicks D,
Barnstable CJ
(1987)
Different monoclonal antibodies reveal different binding patterns on developing and adult retina.
J Histochem Cytochem
35:1317-1328[Abstract].
-
Hicks D,
Courtois Y
(1992)
Fibroblast growth factor stimulates photoreceptor differentiation in vitro.
J Neurosci
12:2022-2033[Abstract].
-
Holt CE,
Bertsch TW,
Ellis HM,
Harris WA
(1988)
Cellular determination in the Xenopus retina is independent of lineage and birth date.
Neuron
1:15-26[Web of Science][Medline].
-
Hunter DD,
Murphy MD,
Olsson CV,
Brunken WJ
(1992)
S-laminin expression in adult and developing retinae: a potential cue for photoreceptor morphogenesis.
Neuron
8:399-413[Web of Science][Medline].
-
Hyatt GA,
Schmitt EA,
Dowling JE
(1995)
Retinoic acid induces the expansion of rod photoreceptors in the developing zebrafish retina.
Soc Neurosci Abstr
21:611.10.
-
Hynes M,
Porter JA,
Chiang C,
Chang D,
Tessier-Lavigne M,
Beachy PA,
Rosenthal A
(1995)
Induction of midbrain dopaminergic neurons by Sonic hedgehog.
Neuron
15:35-44[Web of Science][Medline].
-
Jasoni CL,
Reh TA
(1996)
Temporal and spatial pattern of MASH-1 expression in the developing rat retina demonstrates progenitor cell heterogeneity.
J Comp Neurol
368:1-10[Web of Science][Medline].
-
Jasoni CL,
Walker MB,
Morris MD,
Reh TA
(1994)
A chicken achaete-scute homolog (CASH-1) is expressed in a temporally and spatially discrete manner in the developing nervous system.
Development
120:769-783[Abstract].
-
Jensen AM,
Wallace VA
(1997)
Expression of Sonic hedgehog and its putative role as a precursor cell mitogen in the developing mouse retina.
Development
124:363-371[Abstract].
-
Jiang J,
Struhl G
(1995)
Protein kinase A and hedgehog signaling in Drosophila limb development.
Cell
80:563-572[Web of Science][Medline].
-
Johnson RL,
Tabin C
(1995)
The long and short of hedgehog signaling.
Cell
81:313-316[Web of Science][Medline].
-
Kelley MW,
Turner JK,
Reh TA
(1994)
Retinoic acid promotes differentiation of photoreceptors in vitro.
Development
120:2091-2102[Abstract].
-
Kelley MW,
Turner JK,
Reh TA
(1995)
Ligands of steroid/thyroid receptors induce cone photoreceptors in vertebrate retina.
Development
121:3777-3785[Abstract].
-
Kirsch M,
Fuhrmann S,
Wiese A,
Hofmann HD
(1996)
CNTF exerts opposite effects on in vitro development of rat and chick photoreceptors.
NeuroReport
7:697-700[Web of Science][Medline].
-
Kljavin IJ,
Reh TA
(1991)
Müller cells are a preferred substrate for in vitro neurite extension by rod photoreceptors.
J Neurosci
11:2985-2994[Abstract].
-
Knight JK,
Raymond PA
(1990)
Time course of opsin expression in developing rod photoreceptors.
Development
110:1115-1120[Abstract/Free Full Text].
-
Krauss S,
Concordet JP,
Ingham PW
(1993)
A functionally conserved homolog of the Drosophila segment polarity gene hedgehog is expressed in tissues with polarizing activity in zebrafish embryos.
Cell
75:1431-1444[Web of Science][Medline].
-
Lake N
(1994)
Taurine and GABA in the rat retina during postnatal development.
Vis Neurosci
11:253-260[Web of Science][Medline].
-
Lee JJ,
Ekker SC,
von Kessler D,
Porter JA,
Sun BI,
Beachy PA
(1994)
Autoproteolysis in hedgehog protein biogenesis.
Science
266:1528-1537[Abstract/Free Full Text].
-
Li W,
Ohlmeyer JT,
Lane ME,
Kalderon D
(1995)
Function of protein kinase A in hedgehog signal transduction and Drosophila imaginal disc development.
Cell
80:553-562[Web of Science][Medline].
-
Libby RT,
Hunter DD,
Merlie JP,
Sanes JR,
Brunken WJ
(1995)
Characterization of developing mouse retinae lacking S-laminin/laminin
2.
Soc Neurosci Abstr
21:21.11. -
Lillien L,
Cepko C
(1992)
Control of proliferation in the retina: temporal changes in responsiveness to FGF and TGF.
Development
115:253-266[Abstract].
-
Liou GI,
Wang M,
Matragoon S
(1994)
Timing of interphotoreceptor retinoid-binding protein (IRBP) gene expression and hypomethylation in developing mouse retina.
Dev Biol
161:345-356[Web of Science][Medline].
-
Ma C,
Zhou Y,
Beachy PA,
Moses K
(1993)
The segment polarity gene hedgehog is required for progression of the morphogenetic furrow in the developing Drosophila eye.
Cell
75:927-938[Web of Science][Medline].
-
Marigo V,
Davey RA,
Zuo Y,
Cunningham JM,
Tabin CJ
(1996)
Biochemical evidence that Patched is the hedgehog receptor.
Nature
384:176-179[Medline].
-
Milam AH,
Dacey DM,
Dizhoor AM
(1993)
Recoverin immunoreactivity in mammalian cone bipolar cells.
Vis Neurosci
10:1-12[Web of Science][Medline].
-
Pittack C,
Grunwald GB,
Reh TA
(1997)
Fibroblast growth factors are necessary for neural retina but not pigmented epithelium differentiation in chick embryos.
Development
124:805-816[Abstract].
-
Porter JA,
von Kessler DP,
Ekker SC,
Young KE,
Lee JJ,
Moses K,
Beachy PA
(1995)
The product of hedgehog autoproteolytic cleavage active in local and long-range signalling.
Nature
374:363-366[Medline].
-
Rakoczy PE,
Humphrey MF,
Cavaney DM,
Chu Y,
Constable IJ
(1993)
Expression of basic fibroblast growth factor and its receptor in the retina of Royal College of Surgeons rats: a comparative study.
Invest Ophthalmol Vis Sci
34:1845-1852[Abstract/Free Full Text].
-
Reh TA
(1987)
Cell-specific regulation of neuronal production in the larval frog retina.
J Neurosci
7:3317-3324[Abstract].
-
Reh TA
(1992a)
Cellular interactions determine neuronal phenotypes in rodent retinal cultures.
J Neurobiol
23:1067-1083[Web of Science][Medline].
-
Reh TA
(1992b)
Generation of neuronal diversity in the vertebrate retina.
In: Determinants of neuronal identity (Shankland M,
Macagno ER,
eds), pp 433-467. New York: Academic.
-
Reh TA,
Cagan RL
(1994)
Intrinsic and extrinsic signals in the developing vertebrate and fly eyes: viewing vertebrate and invertebrate eyes in the same light.
Perspect Dev Neurobiol
2:183-190[Web of Science][Medline].
-
Reh TA,
Kljavin IJ
(1989)
Age of differentiation determines rat retinal germinal cell phenotype: induction of differentiation by dissociation.
J Neurosci
9:4179-4189[Abstract].
-
Reh TA,
Tully T
(1986)
Regulation of tyrosine hydroxylase containing amacrine cell number in larval frog retina.
Dev Biol
114:463-469[Web of Science][Medline].
-
Reh TA,
McCabe K,
Kelley MW,
Bermingham-McDonogh O
(1995)
Growth factors in the treatment of degenerative retinal disorders.
In: Growth factors as drugs for neurological and sensory disorders, CIBA Foundation Symposium 196 (Bock GR,
Goode JA,
eds), pp 120-134. New York: Wiley.
-
Riddle RD,
Johnson RL,
Laufer E,
Tabin C
(1993)
Sonic hedgehog mediates the polarizing activity of the ZPA.
Cell
75:1401-1416[Web of Science][Medline].
-
Roelink H,
Augsburger A,
Heemskerk J,
Korzh V,
Norlin S,
Ruiz-i-Altaba A,
Tanabe Y,
Placzek M,
Edlund T,
Jessell TM,
Dodd J
(1994)
Floor plate and motor neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord.
Cell
76:761-775[Web of Science][Medline].
-
Roelink H,
Porter JA,
Chiang C,
Tanabe Y,
Chang DT,
Beachy PA,
Jessell TM
(1995)
Floor plate and motor neuron induction by different concentrations of the amino-terminal cleavage product of sonic hedgehog autoproteolysis.
Cell
81:445-455[Web of Science][Medline].
-
Sparrow JR,
Hicks D,
Barnstable CJ
(1990)
Cell commitment and differentiation in explants of embryonic rat neural retina: comparison with the developmental potential of dissociated retina.
Dev Brain Res
51:69-84[Medline].
-
Spoerri PE,
Ulshafer RJ,
Ludwig HC,
Allen CB,
Kelley KC
(1988)
Photoreceptor cell development in vitro: influence of pigment epithelium conditioned medium on outer segment differentiation.
Eur J Cell Biol
46:362-367[Web of Science][Medline].
-
Stone DM,
Hynes M,
Armanini M,
Swanson TA,
Gu Q,
Johnson RL,
Scott MP,
Pennica D,
Goddard A,
Phillips H,
Noll M,
Hooper JE,
de Sauvage F,
Rosenthal A
(1996)
The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog.
Nature
384:129-134[Medline].
-
Strutt DI,
Wiersdorff V,
Mlodzik M
(1995)
Regulation of furrow progression in the Drosophila eye by cAMP-dependent protein kinase A.
Nature
373:705-709[Medline].
-
Tabata T,
Kornberg TB
(1994)
Hedgehog is a signaling protein with a key role in patterning Drosophila imaginal discs.
Cell
76:89-102[Web of Science][Medline].
-
Taylor M,
Reh TA
(1990)
Induction of differentiation of rat retinal, germinal, neuroepithelial cells by dbcAMP.
J Neurobiol
21:470-481[Web of Science][Medline].
-
Turner DL,
Cepko CL
(1987)
A common progenitor for neurons and glia persists in rat retina late in development.
Nature
328:131-136[Medline].
-
Turner EE,
Jenne KJ,
Rosenfeld MG
(1994)
Brn-3.2: a Brn-3 related transcription factor with distinctive central nervous system expression and regulation by retinoic acid.
Neuron
12:205-218[Web of Science][Medline].
-
Watanabe T,
Raff MC
(1990)
Rod photoreceptor development in-vitro: intrinsic properties of proliferating neuroepithelial cells change as development proceeds in the rat retina.
Neuron
4:461-467[Web of Science][Medline].
-
Watanabe T,
Raff MC
(1992)
Diffusible rod-promoting signals in the developing rat retina.
Development
114:899-906[Abstract].
-
Wetts R,
Fraser SE
(1988)
Multipotent precursors can give rise to all major cell types of the frog retina.
Science
239:1142-1145[Abstract/Free Full Text].
-
Xiang M,
Zhou L,
Macke JP,
Yoshioka T,
Hendry SH,
Eddy RL,
Shows TB,
Nathans J
(1995)
The Brn-3 family of POU-domain factors: primary structure, binding specificity, and expression in subsets of retinal ganglion cells and somatosensory neurons.
J Neurosci
7:4762-4785.
This article has been cited by other articles:

|
 |

|
 |
 
K. Sakagami, L. Gan, and X.-J. Yang
Distinct Effects of Hedgehog Signaling on Neuronal Fate Specification and Cell Cycle Progression in the Embryonic Mouse Retina
J. Neurosci.,
May 27, 2009;
29(21):
6932 - 6944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Wall, A. J. Mears, B. McNeill, C. Mazerolle, S. Thurig, Y. Wang, R. Kageyama, and V. A. Wallace
Progenitor cell proliferation in the retina is dependent on Notch-independent Sonic hedgehog/Hes1 activity
J. Cell Biol.,
January 12, 2009;
184(1):
101 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Stenkamp, R. Satterfield, K. Muhunthan, T. Sherpa, T. S. Vihtelic, and D. A. Cameron
Age-Related Cone Abnormalities in Zebrafish with Genetic Lesions in Sonic Hedgehog
Invest. Ophthalmol. Vis. Sci.,
October 1, 2008;
49(10):
4631 - 4640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Locker, M. Agathocleous, M. A. Amato, K. Parain, W. A. Harris, and M. Perron
Hedgehog signaling and the retina: insights into the mechanisms controlling the proliferative properties of neural precursors.
Genes & Dev.,
November 1, 2006;
20(21):
3036 - 3048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Merhi-Soussi, B. Angenieux, K. Canola, C. Kostic, M. Tekaya, D. Hornfeld, and Y. Arsenijevic
High Yield of Cells Committed to the Photoreceptor Fate from Expanded Mouse Retinal Stem Cells
Stem Cells,
September 1, 2006;
24(9):
2060 - 2070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Angenieux, D. F. Schorderet, and Y. Arsenijevic
Epidermal Growth Factor Is a Neuronal Differentiation Factor for Retinal Stem Cells In Vitro
Stem Cells,
March 1, 2006;
24(3):
696 - 706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Banin, A. Obolensky, M. Idelson, I. Hemo, E. Reinhardtz, E. Pikarsky, T. Ben-Hur, and B. Reubinoff
Retinal Incorporation and Differentiation of Neural Precursors Derived from Human Embryonic Stem Cells
Stem Cells,
February 1, 2006;
24(2):
246 - 257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, G. D. Dakubo, S. Thurig, C. J. Mazerolle, and V. A. Wallace
Retinal ganglion cell-derived sonic hedgehog locally controls proliferation and the timing of RGC development in the embryonic mouse retina
Development,
November 15, 2005;
132(22):
5103 - 5113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Close, B. Gumuscu, and T. A. Reh
Retinal neurons regulate proliferation of postnatal progenitors and Muller glia in the rat retina via TGF{beta} signaling
Development,
July 1, 2005;
132(13):
3015 - 3026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kolpak, J. Zhang, and Z.-Z. Bao
Sonic Hedgehog Has a Dual Effect on the Growth of Retinal Ganglion Axons Depending on Its Concentration
J. Neurosci.,
March 30, 2005;
25(13):
3432 - 3441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Zahir, H. Klassen, and M. J. Young
Effects of Ciliary Neurotrophic Factor on Differentiation of Late Retinal Progenitor Cells
Stem Cells,
March 1, 2005;
23(3):
424 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Spence, M. Madhavan, J. D. Ewing, D. K. Jones, B. M. Lehman, and K. Del Rio-Tsonis
The hedgehog pathway is a modulator of retina regeneration
Development,
September 15, 2004;
131(18):
4607 - 4621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Shkumatava, S. Fischer, F. Muller, U. Strahle, and C. J. Neumann
Sonic hedgehog, secreted by amacrine cells, acts as a short-range signal to direct differentiation and lamination in the zebrafish retina
Development,
August 15, 2004;
131(16):
3849 - 3858.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Moshiri and T. A. Reh
Persistent Progenitors at the Retinal Margin of ptc+/- Mice
J. Neurosci.,
January 7, 2004;
24(1):
229 - 237.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.-T. Yan and S.-Z. Wang
Requirement of NeuroD for Photoreceptor Formation in the Chick Retina
Invest. Ophthalmol. Vis. Sci.,
January 1, 2004;
45(1):
48 - 58.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C.M. Black, C. J. Mazerolle, Y. Wang, K. D. Campsall, D. Petrin, B. C. Leonard, K. F. Damji, D. G. Evans, D. McLeod, and V. A. Wallace
Abnormalities of the vitreoretinal interface caused by dysregulated Hedgehog signaling during retinal development
Hum. Mol. Genet.,
December 15, 2003;
12(24):
3269 - 3276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. James, A. V. Das, S. Bhattacharya, D. M. Chacko, X. Zhao, and I. Ahmad
In Vitro Generation of Early-Born Neurons from Late Retinal Progenitors
J. Neurosci.,
September 10, 2003;
23(23):
8193 - 8203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. D. Dakubo, Y. P. Wang, C. Mazerolle, K. Campsall, A. P. McMahon, and V. A. Wallace
Retinal ganglion cell-derived sonic hedgehog signaling is required for optic disc and stalk neuroepithelial cell development
Development,
July 1, 2003;
130(13):
2967 - 2980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Perron, S. Boy, M. A. Amato, A. Viczian, K. Koebernick, T. Pieler, and W. A. Harris
A novel function for Hedgehog signalling in retinal pigment epithelium differentiation
Development,
April 15, 2003;
130(8):
1565 - 1577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Green, J. L. Stubbs, and E. M. Levine
Genetic rescue of cell number in a mouse model of microphthalmia: interactions between Chx10 and G1-phase cell cycle regulators
Development,
February 1, 2003;
130(3):
539 - 552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Doerre and J. Malicki
A Mutation of Early Photoreceptor Development, mikre oko, Reveals Cell-Cell Interactions Involved in the Survival and Differentiation of Zebrafish Photoreceptors
J. Neurosci.,
September 1, 2001;
21(17):
6745 - 6757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang and X. Yang
Regulation of retinal ganglion cell production by Sonic hedgehog
Development,
January 3, 2001;
128(6):
943 - 957.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Kenney and D. H. Rowitch
Sonic hedgehog Promotes G1 Cyclin Expression and Sustained Cell Cycle Progression in Mammalian Neuronal Precursors
Mol. Cell. Biol.,
December 1, 2000;
20(23):
9055 - 9067.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Neumann and Nuesslein-Volhard
Patterning of the Zebrafish Retina by a Wave of Sonic Hedgehog
Science,
September 22, 2000;
289(5487):
2137 - 2139.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Tropepe, B. L. Coles, B. J. Chiasson, D. J. Horsford, A. J. Elia, R. R. McInnes, and D. van der Kooy
Retinal Stem Cells in the Adult Mammalian Eye
Science,
March 17, 2000;
287(5460):
2032 - 2036.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. J. Belliveau, T. L. Young, and C. L. Cepko
Late Retinal Progenitor Cells Show Intrinsic Limitations in the Production of Cell Types and the Kinetics of Opsin Synthesis
J. Neurosci.,
March 15, 2000;
20(6):
2247 - 2254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M Hebrok, S. Kim, B St Jacques, A. McMahon, and D. Melton
Regulation of pancreas development by hedgehog signaling
Development,
January 11, 2000;
127(22):
4905 - 4913.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Desai and S. McConnell
Progressive restriction in fate potential by neural progenitors during cerebral cortical development
Development,
January 7, 2000;
127(13):
2863 - 2872.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Rohrer, J. I. Korenbrot, M. M. LaVail, L. F. Reichardt, and B. Xu
Role of Neurotrophin Receptor TrkB in the Maturation of Rod Photoreceptors and Establishment of Synaptic Transmission to the Inner Retina
J. Neurosci.,
October 15, 1999;
19(20):
8919 - 8930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. McCabe, E. Gunther, and T. Reh
The development of the pattern of retinal ganglion cells in the chick retina: mechanisms that control differentiation
Development,
January 12, 1999;
126(24):
5713 - 5724.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Wallace and M. Raff
A role for Sonic hedgehog in axon-to-astrocyte signalling in the rodent optic nerve
Development,
January 7, 1999;
126(13):
2901 - 2909.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Belliveau and C. Cepko
Extrinsic and intrinsic factors control the genesis of amacrine and cone cells in the rat retina
Development,
January 2, 1999;
126(3):
555 - 566.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kohtz, D. Baker, G Corte, and G Fishell
Regionalization within the mammalian telencephalon is mediated by changes in responsiveness to Sonic Hedgehog
Development,
January 12, 1998;
125(24):
5079 - 5089.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Waid and S. McLoon
Ganglion cells influence the fate of dividing retinal cells in culture
Development,
January 3, 1998;
125(6):
1059 - 1066.
[Abstract]
[PDF]
|
 |
|