 |
 Previous Article | Next Article 
Volume 17, Number 17,
Issue of September 1, 1997
pp. 6522-6528
Copyright ©1997 Society for Neuroscience
Murine Astrocytes Express a Functional Chemokine Receptor
Shigeyuki Tanabe,
Michael Heesen,
Michael A. Berman,
Michael B. Fischer,
Izumi Yoshizawa,
Yi Luo, and
Martin
E. Dorf
Department of Pathology, Harvard Medical School, Boston,
Massachusetts 02115
 ABSTRACT
- INTRODUCTION
- MATERIALS AND METHODS
- RESULTS
- DISCUSSION
- FOOTNOTES
- REFERENCES
ABSTRACT 
Elevated levels of chemokines have been observed in various
diseases of the CNS. Little is known, however, about how these chemokines affect parenchymal cells of the CNS. The current studies examine astrocyte chemotaxis to the mouse chemokine macrophage inflammatory protein-1 (MIP-1). Murine astrocytes demonstrate directed migration along a chemical gradient in response to
10 10-108 M
MIP-1. Peak chemotactic responses are noted at
109 M. MIP-1-induced astrocyte
migration is specifically inhibitable with pertussis toxin, suggesting
a role for Gi proteins in the signaling process.
RT-PCR and in situ hybridization were used to identify
expression of the murine CCR1 MIP-1 receptor on astrocytes.
Astrocytes contain mRNA for CCR1, but messages for CCR4 and the orphan
chemokine receptor MIP-1R-like#1 were not detected. The combined
results suggest that a functional chemokine receptor is expressed on
resident cells of the CNS. We speculate that the interactions of
chemokines with astrocytes are involved in inflammatory reactions of
the CNS.
Key words:
astrocytes;
chemokines;
chemokine receptors;
chemotaxis;
inflammation;
macrophage inflammatory protein-1;
neuroimmunology
INTRODUCTION
Chemokines are a family of
chemoattractant cytokines that have been implicated in the pathogenesis
of infectious and inflammatory diseases. Chemokine molecules are 8-10
kDa heparin-binding proteins; they have been classified into three
subfamilies (,  , and  chemokines), defined by the spacing of
cysteines in a highly conserved motif (Baggiolini et al., 1994 ). The
-chemokine, macrophage inflammatory protein-1 (MIP-1) induces
the directed migration of monocytes, T lymphocytes, and eosinophils
(Taub et al., 1993; Baggiolini et al., 1994). In addition, MIP-1 can
activate neutrophils, basophils, and mast cells (Wolpe et al., 1988;
Alam et al., 1992; Rot et al., 1992; McColl et al., 1993). Gene
targeting of MIP-1 resulted in reduced responses to influenza and
coxackie viral infections, demonstrating the role of this chemokine in
viral inflammation (Cook et al., 1995).
Chemokines are generally produced by hematopoetic cells after
activation with proinflammatory agents (Baggiolini et al., 1994). Nonhematopoetic cells, however, including parenchymal cells of the CNS,
also express various chemokines, especially during disease states,
e.g., MIP-1 levels are elevated in focal cerebral ischemia, human
immunodeficiency virus type-1 (HIV-1) infection, and experimental autoimmune encephalomyelitis (EAE) (Glabinski et al., 1995; Kim et al.,
1995; Schmidtmayerova et al., 1996).
EAE is an animal model of multiple sclerosis. MIP-1 has been shown
to play a critical role in the pathogenesis of EAE. Injection of
anti-MIP-1 antibody prevents recruitment of inflammatory cells into
the CNS and progression of EAE development (Karpus et al., 1995).
Moreover, myelin-specific T cells that induce EAE can express MIP-1
(Kuchroo et al., 1993). Although MIP-1 seems to play a critical role
in EAE and other diseases of the CNS (Glabinski et al., 1995; Godiska
et al., 1995; Kim et al., 1995), the nonhematopoetic targets of this
chemokine are not yet completely understood. In this report we examine
the ability of mouse astrocytes to migrate in response to MIP-1.
Chemokines act through specific receptors on the cell membrane. These
chemokine receptors belong to the family of G-protein-coupled, seven
transmembrane-spanning receptors. CCR1 and related chemokine receptors
bind MIP-1 (Gao and Murphy, 1995; Post et al., 1995; Hoogewerf et
al., 1996; Meyer et al., 1996). This report also examines astrocytes
for expression of MIP-1 receptors.
MATERIALS AND METHODS
Mice. BALB/cHa mice of either sex were
purchased from Harlan Bioproducts for Science (Indianapolis, IN) and
bred in our animal facilities. Mice were maintained in accordance with
the guidelines of the Committee on Animals of the Harvard Medical
School and the Society for Neuroscience, and those prepared by the
Committee on Care and Use of Laboratory Animals of the Institute of
Laboratory Resources, National Research Council (Department of Health
and Human Services, National Institutes of Health Publication 85-23, revised 1985, Bethesda, MD).
Reagents. The mouse chemokines MIP-1 and MIP-1 were
purchased from R & D Systems (Minneapolis, MN). Human recombinant
PDGF-BB was purchased from Life Technologies (Gaithersburg, MD). These reagents were treated with Detoxi-Gel (Pierce, Rockford, IL) to eliminate endotoxin before use in chemotaxis assays.
Astrocyte isolation. Astrocytes were prepared from neonatal
(<24 hr) mouse brains, as described earlier (Hayashi et al., 1993). Briefly, after removal of the meninges, the brains were separated into
single-cell suspensions by passage through nylon mesh (112 µm; Tetko,
Briarcliff Manor, NY). The primary glial cell cultures were maintained
in MEM (Sigma, St. Louis, MO) supplemented with 10% FCS (Sigma), 2 mM glutamine, 2 mg/ml glucose, 5 µg/ml bovine pancreas
insulin (Sigma), 2.2 mg/ml NaHCO3, 50 U/ml
penicillin, and 50 µg/ml streptomycin (referred to as complete
medium) in 10% CO2 at 37°C. After 10 d, the flasks
were agitated on an orbital shaker (Lab-Line Orbit-Shaker, Lab Line
Instruments) for 2 hr at 250 rpm at 37°C, and the nonadherent
oligodendrocyte and microglial cells were removed. After 13 d, the
astrocytes were trypsinized and expanded at a 1:6 ratio in complete
medium. One day after expansion, the flasks were agitated as described
above, and the medium was changed. The purity of astrocytes was >95%,
as determined by indirect immunofluorescence assay with anti-Mac-1 to
detect microglial cells, anti-galactocerebroside to detect
oligodendrocyte contamination, and anti-glial fibrillary acidic protein
(GFAP) antibodies to identify astrocytes (Smith et al., 1983).
Astrocytes used for chemotaxis assays and preparation of RNA were
cultured for 20-26 d. To remove any residual oligodendrocytes and
microglial cells, the flasks were agitated for 1 hr, as described above, before harvest. Thereafter the cells were trypsinized for 10 min
at 37°C and washed three times. The cells were allowed to recover
from trypsinization by incubation in complete medium for 90 min at
37°C.
Pertussis toxin (PTx) treatment. After incubation of the
cells in complete medium, the cells were washed three times and
resuspended in serum-free complete medium. The cells were treated with
1 ng/ml PTx (Sigma) for 60 min at 37°C. After treatment, astrocytes
were washed twice and suspended in endotoxin-depleted MEM containing 1% BSA and 2.2 mg/ml NaHCO3 (referred to as chemotaxis
medium). The viability of the cells with or without PTx was >95%.
Chemotaxis assay. Cell migration was evaluated in 48-well
Boyden microchambers (Neuroprobe, Cabin John, MD) as described earlier (Luo and Dorf, 1996). Mouse peritoneal macrophages, prepared as detailed elsewhere (Devi et al., 1995), were used as controls for
chemotaxis assays. Astrocytes or macrophages were washed and resuspended in the chemotaxis medium (4 × 106
cells/ml). Fifty microliters of cells were added to the upper well of
the Boyden chamber. Thirty microliters, containing the indicated
concentration of endotoxin-depleted chemokine, were placed in the lower
microchamber; the wells were separated by a 14 µm (astrocyte) or 5 µm (macrophage) pore size polycarbonate filter (Poretics, Livermore,
CA). All responses were assayed in triplicate. The chambers were
incubated for 90 min (macrophage) or 3-4 hr (astrocyte) at 37°C in a
moist 5% CO2 atmosphere. After incubation, the upper
surface of the filters was scraped to remove nonmigrating cells.
Filters were subsequently fixed in methanol and stained with Diff-Quik
(Baxter, McGaw Park, IL). The number of migrating cells per
high-powered field were counted at 400× magnification. At least five
high-powered fields were examined in each well.
Statistics. Data are given as the mean ± SD.
Statistical analysis was performed with Student's t test;
p values <0.05 were considered significant.
Screening of astrocyte cDNA for expression of MIP-1 receptor
genes. Total RNA and cDNA were prepared from 8 × 107 astrocytes, casein-elicited peritoneal exudate
(PE) cells, or L929 mouse fibroblasts using methods described elsewhere
(Post et al., 1995; Heesen et al., 1996). Briefly, total RNA was
isolated by the method of Chomczynski and Sacchi (1987). Before cDNA
synthesis, the RNA was treated with 1 U DNase-1 (bovine pancreas;
Sigma) for 15 min at room temperature in 10 µl 20 mM Tris
HCl, pH 8.4, 2 mM MgCl2, and 50 mM KCl, which was then inactivated by incubation at 65°C
for 10 min with 2.5 mM EDTA. Single-stranded cDNA was synthesized from 1.5 µg total RNA incubated in a 20 µl reaction containing 50 ng random hexamers, 2.5 mM
MgCl2, 0.5 mM dNTPs, 10 mM
1,4-dithiotreitol, 50 mM KCl, 20 mM Tris-HCl,
pH 8.4, and 200 U reverse transcriptase (Superscript Preamplification
System for First Strand cDNA Synthesis, Life Technologies) for 10 min at 25°C followed by 50 min at 42°C. The reaction was terminated by
heating at 70°C for 15 min. The sample was then incubated with 1 µl
of RNase H for 20 min at 37°C. To control for the possibility of
contaminating genomic DNA, RNA samples were included that were not
subjected to reverse transcriptase. Gene-specific primers for selected
mouse MIP-1 receptors were designed as listed in Table
1. PCR was performed in a reaction
mixture containing 2 mM MgCl2, 0.5 µM primers, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 4 U/70 µl Amplitaq DNA Polymerase
(Perkin-Elmer, Modesto, CA). With the exception of CCR4, the PCR
program was as follows: preincubation at 94°C for 1 min and then
85°C while enzyme was added, 27 cycles of PCR at 94°C for 45 sec
plus 45 sec annealing and 1 min 72°C extension. The annealing
temperatures used were 52°C for CCR1 and MIP-1R-like#1, 55°C for
-glucuronidase. For CCR4 the modifications included 30 cycles of PCR
at an annealing temperature of 60°C. Six microliters of the PCR
mixtures were visualized on a 1.5% agarose gel, except for the orphan
receptor termed MIP-1R-like#1 PCR from which 70 µl was
precipitated and resuspended in 6 µl and then run on a 1.5% agarose
gel.
Preparation of riboprobes. A fragment of mouse CCR1
including nucleotides 62-461 of the coding region was amplified by PCR using the PE cell cDNA library (Bozic et al., 1994) as template. The
100 µl PCR mixture contained 5 µl of the PE cDNA library, 5 mM dNTPs, 5 µl of dimethylsulfoxide, 10 µl of 10 × PCR buffer, 2.5 U of cloned PFU DNA polymerase (Stratagene, La
Jolla, CA), and 0.5 µM each primer. The 5 -primer
(ATCTCGAGCCACTCCATGCCAAAAGACTG) and the 3-primer
(ATGCGGCCGCTGGTGATGATGCCAAGAG) contained a XhoI and a
NotI restriction site, respectively. PCR was performed at 94°C for 1 min, 42°C for 1 min, and 72°C for 1 min over 26 cycles.
The PCR product was precipitated, ligated into the pCR-Script 228 Amp
SK (+) cloning vector, and transformed into Epicurian Coli XL1-Blue
MRF' Kan supercompetent cells using the pCR-Script 228 Amp SK (+)
cloning kit (Stratagene). The cloning vector contains a T3 promoter
upstream from the cloning site. The transformation reaction was plated
on agar plates containing ampicillin, X-gal, and
isopropylthio--D-galactoside and incubated overnight.
White colonies were selected and grown overnight in a liquid culture. Plasmids were purified using the Wizard Plus Minipreps DNA Purification Systems (Promega, Madison, WI). The purified plasmids were digested with XhoI and HindIII as well as with
NotI and HindIII (New England Biolabs, Beverly,
MA). A HindIII restriction site is present at position 319 of the nucleotide sequence of mouse CCR1. Plasmids containing the
cloned mouse CCR1 fragment in an antisense orientation were used for
RNA transcription. To prepare the antisense riboprobe, the plasmid was
digested with BamHI; this restriction site is located
downstream from the cloning site of the vector. A digest with
SacI was performed to prepare the sense riboprobe. The
SacI restriction site is located upstream from the cloning
site.
Fractions of the linearized plasmid were visualized on a gel. After
precipitation and resuspension, RNA transcription and labeling with
digoxigenin (DIG)-UTP was performed using the DIG RNA Labeling Kit
(Boehringer Mannheim, Indianapolis, IN). Briefly, 1 µg of template
was incubated with 2 µl of T3 RNA polymerase for the antisense
riboprobe or T7 RNA polymerase for the sense riboprobe in a final
volume of 20 µl. Two microliters of DNase were added, and after an
additional 15 min at 37°C the reactions were stopped by adding 2 µl
of 0.2 M EDTA. The reaction mixtures were diluted 1:2 with
DEPC-treated water and stored at  80°C.
In situ hybridization. Astrocytes or control mesangial
cells, prepared as detailed elsewhere (Hayashi et al., 1993; Luo and Dorf, 1996), were cyto-centrifuged onto baked RNase-free slides. Slides
were air-dried for 15 min and fixed in 3% paraformaldehyde in PBS for
1 hr. The slides were incubated in 0.1 M triethanolamine, pH 8.0, for 5 min (Sigma). The cell samples were acetylated by incubation in 0.1 M triethanolamine, pH 8.0, with 0.25%
acetic anhydride (Sigma) for 15 min and rinsed twice in 2× SSC (0.3 M sodium chloride, 0.03 M sodium citrate).
Prehybridization was performed at room temperature for 20 min in a
buffer with 50% formamide, 4× SSC, 0.4× Denhardt's solution, 10%
dextran sulfate, 250 µg/ml of yeast tRNA, and 500 µg/ml of salmon
testes DNA. The buffer was boiled for 10 min and incubated on ice for 5 min before use. Four microliters of the riboprobe were diluted in 50 µl of prehybridization buffer, boiled for 5 min, and placed in the
center of a coverslip. The coverslip was inverted onto the slide, which then was sealed with nail polish and hybridized at 52°C for 16-18 hr. The coverslip was then removed with a razor blade, and the slides
were rinsed twice with 2× SSC over 5 min followed by a rinse in STE
buffer (500 mM NaCl, 1 mM EDTA, pH 8.0, 20 mM Tris-HCl). An incubation was performed in STE buffer
containing RNase A (50 µg/ml) for 45 min at 37°C. After this,
slides were incubated in 2× SSC/50% formamide for 10 min at 50°C,
rinsed one time in 1× SSC and three times in 0.5× SSC for 5 min each
time. A final rinse over 5 min was performed in buffer 1 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl) containing
0.2% BSA. The slides were preincubated in 2% normal rabbit serum in
buffer 1 for 20 min before incubating with sheep anti-DIG-AP F(ab)
(Boehringer Mannheim), diluted 1:500 in buffer 1, for 60 min. The
slides were rinsed one time in buffer 1 and incubated for 10 min in
buffer 2 (100 mM Tris-HCl, pH 7.5, 100 mM NaCl,
50 mM MgCl2). The substrate solution
consisting of 450 µg/ml of 4-nitro blue tetrazolium chloride
(Boehringer Mannheim), 175 µg/ml of 5-bromo-4-chloro-3-indolyl
phosphate toludium salt (Boehringer Mannheim), and 1.25 mM
levamisole (Sigma) in buffer 2 was added for a 16-18 hr incubation at
4°C in a light-protected room. This reaction was stopped by rinsing
with buffer 3 (10 mM Tris-HCl, pH 8.0, 1 mM
EDTA). Slides were mounted with Mount 60 228 (Baxter, Deerfield, IL).
RESULTS
MIP-1 induces chemotactic migration of astrocytes
The ability of the mouse chemokines MIP-1 and MIP-1 to
stimulate migration of cultured mouse astrocytes was examined. Various
concentrations (1011-108
M) of the chemokines were placed in the lower well of a
Boyden microchamber. Cells were separated from the lower well by a
porous polycarbonate filter. Preliminary experiments indicated that
astrocyte migration to MIP-1 occurred after 3-4 hr incubation at
37°C (data not shown). All cells that migrated to the bottom surface
of the membrane stained with anti-GFAP antibody, confirming that
astrocytes are responsive to MIP-1 (data not shown). The total level
of migration was proportional to the nonspecific background migration with control medium. Because the level of background migration varied
among different batches of astrocytes (16-127 cells/well), the results
from different experiments were normalized and presented as a migration
index (experimental response/control response with medium only).
MIP-1 consistently stimulated astrocyte migration at
1010-108 M
(p < 0.01). At higher (107
M) concentrations, MIP-1 migratory activity decreased
(data not shown). Peak astrocyte migratory responses were noted at
109 M; similar MIP-1 dose-response
patterns were noted with the control macrophage population (Fig.
1). In contrast, MIP-1 only demonstrated weak (nonsignificant, p > 0.05) activity
at the highest concentration tested (108
M) (Fig. 1). The biological activity of this preparation of
MIP-1 was confirmed because
1010-108 M
MIP-1 stimulated migration of mouse macrophages, demonstrating peak
migration index of 2.8 at 109 M (Fig.
1). Thus, these experiments demonstrate that astrocytes can respond to
subnanomolar concentrations of MIP-1 but are not sensitive to
MIP-1.
Fig. 1.
Mouse astrocyte (left panel)
or macrophage (right panel) migration across a
membrane in response to various doses of the mouse -chemokines
MIP-1 (square) and MIP-1 (diamond).
The average number of migrating cells per high-powered field were
divided by the background migration in the medium control for
presentation as the migration index. The medium control migration
index ± SD was 1.0 ± 0.2. The data represent a pool of two
or three independent experiments.
[View Larger Version of this Image (13K GIF file)]
Although MIP-1 consistently induces astrocyte locomotion, the
magnitude of the migratory responses are generally lower than the
fivefold stimulation indices noted with macrophages (Fig. 1).
Therefore, we compared the levels of astrocyte migration between MIP-1 and the established astrocyte attractant PDGF (Bressler et
al., 1985; Heesen et al., 1996). MIP-1 and PDGF were equally effective at inducing chemotaxis under these experimental conditions (Fig. 2).
Fig. 2.
Inhibition of astrocyte migration by boiling
MIP-1 or PTx treatment of astrocytes. Astrocytes were allowed to
migrate toward 10 ng/ml native or denatured (boiled for 30 min)
MIP-1. Astrocytes were pretreated in serum-free MEM with or without
PTx (1 ng/ml) for 1 hr at 37°C. Stimulants of chemotaxis included
PDGF-BB (10 ng/ml) and MIP-1 (10 ng/ml). The results are a composite
of two representative experiments with triplicate wells. The data are expressed as migration index ± SD. An asterisk
indicates significant levels of inhibition
(p < 0.05) versus cells treated with
chemoattractant alone.
[View Larger Version of this Image (32K GIF file)]
To determine whether the observed migration of astrocytes was
attributable to chemotaxis (directed movements along a chemical gradient) rather than random cell movement (chemokinesis), various concentrations (1-100 ng/ml) of MIP-1 were placed in the upper and
lower wells of the Boyden microchamber. Astrocytes only migrated toward
the lower chamber when a concentration gradient existed in that
direction (Table 2). These results
established that MIP-1 induced directed migration of astrocytes.
To evaluate the thermal stability of MIP-1, the chemokine was boiled
for 30 min before introduction into the Boyden chamber. As shown in
Figure 2, boiling completely destroyed chemotactic activity
(p < 0.01). These results suggest that the vast
majority of chemotactic activity was not attributable to endotoxin,
which is stable under these experimental conditions.
MIP-1 responses are sensitive to PTx
Chemokine receptors belong to the family of seven
transmembrane-spanning molecules that couple to heterotrimetric
G-proteins. Most chemokine receptors for MIP-1 appear to couple to
G-protein i subunits, because PTx pretreatment inhibits
MIP-1-induced calcium mobilization (Spiegel et al., 1992; Ben-Baruch
et al., 1995). To determine whether MIP-1-induced astrocyte
migration is mediated by a PTx-sensitive intracellular signaling
pathway, astrocytes were pretreated with PTx before analysis in the
chemotaxis assay. As shown in Figure 2, MIP-1-induced astrocyte
migration was completely inhibited by treatment with 1 ng/ml of PTx for 1 hr at 37°C (p < 0.05). In contrast, PTx did
not inhibit astrocyte migration in response to PDGF-BB, because the
PDGF receptor uses a different intracellular signaling pathway
(Pfeilschifter et al., 1991).
Expression of chemokine receptor genes
To determine whether mouse astrocytes express CCR1, CCR4, or the
orphan MIP-1R-like#1 receptor, astrocyte and control PE cell RNAs
were reverse-transcribed and subjected to PCR amplification. Because
most chemokine receptors lack introns, we used three approaches to
minimize artifacts attributable to potential genomic contamination. First, the RNAs were treated with DNase I before RT. Second, RT-PCR reactions were also run in the absence of reverse transcriptase, and
finally a parallel PCR was run using primers surrounding a 90 bp intron
of the housekeeping gene -glucuronidase. No PCR products were
detected when reverse transcriptase was omitted (Fig.
3). The -glucuronidase PCR products
found in both astrocytes and PE cells had a size of 301 bp, consistent
with the predicted size of the spliced cDNA (Table 1, Fig. 3). Mouse
CCR1 PCR products were detected in astrocytes (Fig. 3). Because primary
astrocyte cultures may be contaminated with fibroblasts, L929
fibroblasts were also tested for expression of CCR1, but no PCR
products were detectable (Fig. 3). In contrast, the CCR4 and orphan
MIP-1R-like#1 PCR products were not detected in astrocytes but were
identified in RNA from control PE cells. The failure to detect CCR4
message in astrocytes was confirmed using four primer combinations
(Fig. 3).
Fig. 3.
Representative RT-PCR results using murine CCR1
(546 bp), CCR4 (1090-1180 bp), the orphan MIP-1-like#1 receptor
(411 bp), and -glucuronidase (301 bp) primers. PCR products were run
with RNA from either A (astrocytes), NA
[astrocytes with no reverse transcriptase (RT) added],
P (PE cells), NP (PE cells with no RT
added), or F, L929 fibroblasts.
[View Larger Version of this Image (62K GIF file)]
In situ hybridization
A cloned fragment of mouse CCR1 was DIG-labeled and in
vitro RNA transcribed. The probe was visualized on a nylon
membrane (GeneScreen, New England Nuclear, Boston, MA) by incubating
with anti-DIG-AP F(ab) and the substrate solution to confirm successful RNA transcription (data not shown). The CCR1 antisense probe
specifically hybridized to the astrocyte preparation (Fig.
4). In contrast, hybridization to a
negative control population of mesangial cells did not show a signal.
No signal was detected when astrocytes or mesangial cells were
hybridized with the control CCR1 sense probe (Fig. 4).
Fig. 4.
In situ hybridization of CCR1
antisense (A, B) and sense (C, D)
riboprobes to cultured astrocytes (left panels).
Hybridization of the same probes to cultured mouse mesangial cells
(right panels) were included as negative controls. Cells
were viewed at a magnification of 50×.
[View Larger Version of this Image (64K GIF file)]
DISCUSSION
MIP-1 is produced by various cell types, including astrocytes
and microglia, after stimulation with proinflammatory agents (Hayashi
et al., 1995). In addition to astrocytes, MIP-1 can recruit
monocytes and microglia. The combined data suggest that there may be an
autocrine loop in which MIP-1 attracts and activates astrocytes at
sites of inflammation. Murine MIP-1 is an effective chemoattractant
of GFAP-positive astrocytes at subnanomolar concentrations. Peak
chemotactic responses were noted at 109
M (Fig. 1). These results are consistent with the finding
that RNA for the MIP-1 binding receptor CCR1 was detected in
astrocytes by both RT-PCR (Fig. 3) and in situ hybridization
(Fig. 4).
Mouse CCR1 and CCR4 have high affinity for murine MIP-1 with
affinities of 1-10 × 109 M
[(Gao and Murphy, 1995; Post et al., 1995; Hoogewerf et al., 1996).
Expression of RNA for CCR4 in mouse brain or astrocytes was not
examined previously; however, two independent reports noted that CCR1
was not detectable in normal brain tissue by Northern blot (Gao and
Murphy, 1995; Post et al., 1995). In the present studies, the more
sensitive RT-PCR technique was used to identify CCR1 in mRNA from
cultured astrocyte populations. This finding was confirmed
independently by in situ hybridization.
Very few studies have monitored the expression of chemokine receptors
on astrocytes. Tada et al. (1994) first screened for the expression of
the type B IL-8 receptor (CXCR2) on human glioblastoma cell lines and
tissue samples; they detected CXCR2 mRNA in some samples but not in
cultured human astrocyte samples. Lacy et al. (1995) also reported
variable expression of CXCR2 on human astrocytes. The function of
chemokine receptors in cells of the CNS was not explored in either of
the previous studies. The present studies combine RT-PCR with
functional studies and represent the first evidence that functional
chemokine receptors are expressed on astrocytes. Expression of these
receptors may be important in the pathogenesis of reactive
astrogliosis.
Chemokine receptors are seven transmembrane-spanning molecules that
couple to G-proteins (Spiegel et al., 1992; Ben-Baruch et al., 1995).
In leukocytes, chemokine-mediated biological activities such as
chemotaxis, arachidonic acid release, and Ca2+
influx are partially or completely inhibited by PTx (Locati et al.,
1994; Sozzani et al., 1994; Bacon et al., 1995; Bizzarri et al., 1995;
Myers et al., 1995). PTx ADP-ribosylates C-terminal i
subunits of the heterotrimeric G-proteins, resulting in functional uncoupling with the seven transmembrane-spanning receptors (Spiegel et
al., 1992). In the present study, MIP-1-induced astrocyte migration
was also sensitive to PTx treatment (Fig. 2), further supporting the
functional role of chemokine receptor proteins in astrocyte chemotaxis.
The combined data suggest that astrocyte chemokine receptors may use
the same family of G-proteins used by leukocyte chemokine
receptors.
Treatment of mice with anti-MIP-1 prevents recruitment of
inflammatory cells into the CNS (Karpus et al., 1995). MIP-1 may contribute to inflammation within the CNS by altering the integrity of
the blood-brain barrier. Astrocyte processes form the endfeet surrounding the CNS microvessels. The astrocyte interactions with capillary and venule endothelial cells appear to be responsible for
formation of the characteristic tight junctions of the blood-brain barrier (Mucke and Eddleston, 1993). Breakdown of the blood-brain barrier and leakage of blood-borne substances into the CNS have been
implicated in the astrogliosis observed in EAE (Eng et al., 1996). Thus
chemokines such as MIP-1 may facilitate entry of inflammatory cells
into the CNS and contribute to the pathogenesis of autoimmune and
infectious diseases.
FOOTNOTES
Received April 15, 1997; revised June 9, 1997; accepted June 11, 1997.
This work was partially supported by National Institutes of Health
Grants NS-31152 and CA67416 and a gift from the Multiple Sclerosis
Foundation. M.H. is the recipient of a fellowship from the Deutsche
Forschungsgemeinschaft.
S.T. and M.H. contributed equally to this work.
Correspondence should be addressed to Dr. Martin E. Dorf, Department of
Pathology, Harvard Medical School, 200 Longwood Avenue, Boston, MA
02115-5701.
REFERENCES
-
Alam R,
Forsythe PA,
Stafford S,
Lett-Brown MA,
Grant JA
(1992)
Macrophage inflammatory protein-1 activates basophils and mast cells.
J Exp Med
176:781-786[Abstract/Free Full Text].
-
Bacon KB,
Premack BA,
Gardner P,
Schall T
(1995)
Activation of dual T cell signaling pathways by the chemokine RANTES.
Science
269:1727-1730[Abstract/Free Full Text].
-
Baggiolini M,
Dewald B,
Moser B
(1994)
Interleukin-8 and related chemotactic cytokines
 CXC and CC chemokines.
Adv Immunol
55:97-179[Web of Science][Medline]. -
Ben-Baruch A,
Michiel DF,
Oppenheim JJ
(1995)
Signals and receptors involved in recruitment of inflammatory cells.
J Biol Chem
270:11703-11706[Free Full Text].
-
Bizzarri C,
Bertini R,
Bossu P,
Sozzani S,
Montovani A,
Damme JV,
Tagliabue A,
Boraschi D
(1995)
Single-cell analysis of macrophage chemotactic protein-1-regulated cytosolic Ca2+ increase in human adherent monocytes.
Blood
86:2388-2394[Abstract/Free Full Text].
-
Bozic CR,
Gerard NP,
von Uexkull-Guldenband C,
Kolakowski Jr LF,
Conklyn MJ,
Breslow R,
Showell HJ,
Gerard C
(1994)
The murine interleukin 8 type B receptor homologue and its ligands.
J Biol Chem
169:29355-29358.
-
Bressler JP,
Grotendorst GR,
Leitov C,
Hjelmeland LM
(1985)
Chemotaxis of rat brain astrocytes to platelet derived growth factor.
Brain Res
344:249-254[Web of Science][Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Cook DN,
Beck MA,
Coffman TM,
Kirby SL,
Sheridan JF,
Pragnell IB,
Smithies O
(1995)
Requirement of MIP-1 for an inflammatory response to viral infection.
Science
269:1583-1585[Abstract/Free Full Text].
-
Devi S,
Laning J,
Luo Y,
Dorf ME
(1995)
Biologic activities of the -chemokine TCA3 on neutrophils and macrophages.
J Immunol
154:5376-5383[Abstract].
-
Eng LF,
Ghirnikar RS,
Lee YL
(1996)
Inflammation in EAE: role of chemokine/cytokine expression by resident and infiltrating cells.
Neurochem Res
21:511-525[Web of Science][Medline].
-
Gao J-L,
Murphy PM
(1995)
Cloning and differential tissue-specific expression of three mouse chemokine receptor-like genes, including the gene for a functional macrophage inflammatory protein-1 receptor.
J Biol Chem
270:17494-17501[Abstract/Free Full Text].
-
Glabinski AR,
Tani M,
Aras S,
Stoler MH,
Tuohy VK,
Ransohoff RM
(1995)
Regulation and function of central nervous system chemokines.
Int J Dev Neurosci
13:153-165[Web of Science][Medline].
-
Godiska R,
Chantry D,
Dietsch GN,
Gray PW
(1995)
Chemokine expression in murine experimental allergic encephalomyelitis.
J Neuroimmunol
58:167-176[Web of Science][Medline].
-
Hayashi M,
Dorf ME,
Abromson-Leeman S
(1993)
Granulocyte-macrophage colony stimulating factor inhibits class II major histocompatibility complex expression and antigen presentation by microglia.
J Neuroimmunol
48:23-32[Web of Science][Medline].
-
Hayashi M,
Luo Y,
Laning J,
Strieter RM,
Dorf ME
(1995)
Production and function of monocyte chemoattractant protein-1 and other -chemokines in murine glial cells.
J Neuroimmunol
60:143-150[Web of Science][Medline].
-
Heesen M,
Tanabe S,
Berman MA,
Yoshizawa I,
Luo Y,
Kim RJ,
Post WT,
Gerard C,
Dorf ME
(1996)
Mouse astrocytes respond to the chemokines MCP-1 and KC but RT-PCR does not detect mRNA for the KC or new MCP-1 receptor.
J Neurosci Res
45:382-391[Web of Science][Medline].
-
Hoogewerf AJ,
Black D,
Proudfoot AEI,
Wells TNC,
Power CA
(1996)
Molecular cloning of murine CC CKR-4 and high affinity binding of chemokines to murine and human CC CKR-4.
Biochem Biophys Res Commun
218:337-343[Web of Science][Medline].
-
Karpus WJ,
Lukacs NW,
McRae BL,
Strieter RM,
Kunkel SL,
Miller SD
(1995)
An important role for the chemokine macrophage inflammatory protein-1 in the pathogenesis of the T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis.
J Immunol
155:5003-5010[Abstract].
-
Kim JS,
Gautam SC,
Chopp M,
Zaloga C,
Jones ML,
Ward PA,
Welch KMA
(1995)
Expression of monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 after focal cerebral ischemia in the rat.
J Neuroimmunol
56:127-134[Web of Science][Medline].
-
Kuchroo VK,
Martin CA,
Greer JM,
Ju S-T,
Sobel RA,
Dorf ME
(1993)
Cytokines and adhesion molecules contribute to the ability of myelin proteolipid protein-specific T cell clones to mediate experimental allergic encephalomyelitis.
J Immunol
151:4371-4382[Abstract].
-
Lacy M,
Jones J,
Whittemore SR,
Haviland DL,
Wetsel RA,
Barnum SR
(1995)
Expression of the receptors for the C5a anaphylatoxin, interleukin-8 and FMLP by human astrocytes and microglia.
J Neuroimmunol
61:71-78[Web of Science][Medline].
-
Locati M,
Zhou D,
Luini W,
Evangelista V,
Mantovani A,
Sozzani S
(1994)
Rapid induction of arachidonic acid release by monocyte chemotactic protein-1 and related chemokines. Role of Ca2+ influx: synergism with platelet-activating factor and significance for chemotaxis.
J Biol Chem
269:4746-4753[Abstract/Free Full Text].
-
Luo Y,
Dorf ME
(1996)
-Chemokine TCA3 binds to mesangial cells and induces adhesion, chemotaxis, and proliferation.
J Immunol
156:742-748[Abstract].
-
McColl SR,
Hachicha M,
Levasseur S,
Neote K,
Schall TJ
(1993)
Uncoupling of early signal transduction events from effector function in human peripheral blood neutrophils in response to recombinant macrophage inflammatory protein-1 and -1.
J Immunol
150:4550-4560[Abstract].
-
Meyer A,
Coyle AJ,
Proudfoot AEI,
Wells TNC,
Power CA
(1996)
Cloning and characterization of a novel murine macrophage inflammatory protein-1 receptor.
J Biol Chem
271:14445-14451[Abstract/Free Full Text].
-
Mucke L,
Eddleston M
(1993)
Astrocytes in infectious and immune-mediated diseases of the central nervous system.
FASEB J
7:1226-1232[Abstract].
-
Myers SJ,
Wong LM,
Charo IF
(1995)
Signal transduction and ligand specificity of the human monocyte chemoattractant protein-1 receptor in transfected embryonic kidney cells.
J Biol Chem
270:5786-5792[Abstract/Free Full Text].
-
Pfeilschifter J,
Hosang M
(1991)
Effects of homo- and heterodimeric isoforms of PDGF on signaling events in rat renal mesangial cells.
Cell Signal
3:413-424[Web of Science][Medline].
-
Post TW,
Bozic CR,
Rothenberg ME,
Luster AD,
Gerard N,
Gerard C
(1995)
Molecular characterization of two murine eosinophil chemokine receptors.
J Immunol
155:5299-5305[Abstract].
-
Rot A,
Krieger M,
Brunner T,
Bischoff SC,
Schall TJ,
Dahinden CA
(1992)
RANTES and human macrophage inflammatory protein (MIP)-1 induce the migration and activation of normal human eosinophil granulocytes.
J Exp Med
176:1489-1495[Abstract/Free Full Text].
-
Schmidtmayerova H,
Nottet HSM,
Nuovo G,
Raabe T,
Flanagan CR,
Duborovsky L,
Gendelman HE,
Cerami A,
Bukrinsky M,
Sherry B
(1996)
Human immunodeficiency virus type 1 infection alters chemokine peptide expression in human monocytes: implications for recruitment of leukocytes into brain and lymph nodes.
Proc Natl Acad Sci USA
93:700-704[Abstract/Free Full Text].
-
Smith ME,
Somera FP,
Eng L
(1983)
Immunocytochemical staining for glial fibrillary acidic protein and the metabolism of cytoskeletal proteins in experimental allergic encephalomyelitis.
Brain Res
264:241-253[Web of Science][Medline].
-
Sozzani S,
Zhou D,
Locati M,
Rieppi M,
Proost P,
Magazin M,
Vita N,
Damme JV,
Mantovani A
(1994)
Receptors and transduction pathways for monocyte chemotactic protein-2 and monocyte chemotactic protein-3. Similarities and differences with MCP-1.
J Immunol
152:3615-3622[Abstract].
-
Spiegel AM,
Schenker A,
Weinstein LS
(1992)
Receptor-effector coupling by G proteins: implications for normal and abnormal signal transduction.
Endocr Rev
13:536-565[Abstract/Free Full Text].
-
Tada M,
Diserens AC,
Desbaillets I,
de Tribolet N
(1994)
Analysis of cytokine receptor messenger RNA expression in human glioblastoma cells and normal astrocytes by reverse-transcription polymerase chain reaction.
J Neurosurg
80:1063-1073[Web of Science][Medline].
-
Taub DD,
Conlon K,
Lloyd AR,
Oppenheim JJ,
Kelvin DJ
(1993)
Preferential migration of activated CD4+ and CD8+ T cells in response to MIP-1 and MIP-1.
Science
260:355-358[Abstract/Free Full Text].
-
Wolpe SD,
Davatelis G,
Sherry B,
Beutler B,
Hesse DG,
Nguyen HT,
Moldawer LL,
Nathan CF,
Lowry SF,
Cerami A
(1988)
Macrophages secrete a novel heparin-binding protein with inflammatory and neutrophil chemokinetic properties.
J Exp Med
167:570-581[Abstract/Free Full Text].
This article has been cited by other articles:
|
|
|
|
 
G. Cheung, O. Kann, S. Kohsaka, K. Faerber, and H. Kettenmann
GABAergic activities enhance macrophage inflammatory protein-1{alpha} release from microglia (brain macrophages) in postnatal mouse brain
J. Physiol.,
February 15, 2009;
587(4):
753 - 768.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Zhang, Q. Zhai, Y. Luo, and M. E. Dorf
RANTES-mediated Chemokine Transcription in Astrocytes Involves Activation and Translocation of p90 Ribosomal S6 Protein Kinase (RSK)
J. Biol. Chem.,
May 17, 2002;
277(21):
19042 - 19048.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. J. McMahon, D. N. Cook, K. Suzuki, and G. K. Matsushima
Absence of Macrophage-Inflammatory Protein-1{alpha} Delays Central Nervous System Demyelination in the Presence of an Intact Blood-Brain Barrier
J. Immunol.,
September 1, 2001;
167(5):
2964 - 2971.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. C. Asensio, J. Maier, R. Milner, K. Boztug, C. Kincaid, M. Moulard, C. Phillipson, K. Lindsley, T. Krucker, H. S. Fox, et al.
Interferon-Independent, Human Immunodeficiency Virus Type 1 gp120-Mediated Induction of CXCL10/IP-10 Gene Expression by Astrocytes In Vivo and In Vitro
J. Virol.,
August 1, 2001;
75(15):
7067 - 7077.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. , G. , W. , and W.
CC Chemokine Receptor 2 Is Critical for Induction of Experimental Autoimmune
J. Exp. Med.,
September 18, 2000;
192(6):
899 - 906.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Meucci, A. Fatatis, A. A. Simen, T. J. Bushell, P. W. Gray, and R. J. Miller
Chemokines regulate hippocampal neuronal signaling and gp120 neurotoxicity
PNAS,
November 24, 1998;
95(24):
14500 - 14505.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
