 |
Previous Article | Next Article 
Volume 17, Number 17,
Issue of September 1, 1997
pp. 6685-6696
Copyright ©1997 Society for Neuroscience
Subunit Composition, Kinetic, and Permeation Properties of AMPA
Receptors in Single Neocortical Nonpyramidal Cells
María Cecilia Angulo1,
Bertrand Lambolez1,
Etienne Audinat1,
Shaul Hestrin2, and
Jean Rossier1
1 Neurobiologie et Diversité Cellulaire, Centre
National de la Recherche Scientifique Unité de Recherche
Associée 2054, Ecole Supérieure de Physique et de Chimie
Industrielles de la ville de Paris, 75231 Paris Cedex 5, France, and
2 Department of Anatomy and Neurobiology, University of
Tennessee Memphis, Memphis, Tennessee 38163
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Native AMPA receptors (AMPARs) were investigated in neocortical
fast-spiking (FS) and regular-spiking nonpyramidal (RSNP) cells. The
onset of and recovery from desensitization as well as current
rectification and single-channel conductance were studied by using fast
glutamate application to outside-out patches. The GluR1-4 subunit,
flip/flop splicing, and R/G editing expression patterns of functionally
characterized cells were determined by single-cell reverse
transcription-PCR to correlate the subunit composition of native AMPARs
with their functional properties. Our sample, mostly constituted by
RSNP neurons, predominantly expressed GluR3 flip and GluR2 flop. In
individual cells, flip/flop splicing of each subunit appeared to be
regulated independently, whereas for R/G editing all subunits were
either almost fully edited or unedited. We confirmed that the relative
GluR2 expression controls the permeation properties of native AMPARs,
whereas none of the single molecular parameters considered appeared to
be a key determinant of the kinetics. FS neurons displayed AMPARs with relatively homogeneous functional properties characterized by fast
desensitization, slow recovery from desensitization, marked inward
rectification, and large single-channel conductance. In contrast, these
parameters varied over a wide range in RSNP neurons, and their
combination resulted in various AMPAR functional patterns. Indeed, in
different cells, fast or slow desensitization was found to be
associated with either slow or fast recovery from desensitization. Similarly, fast or slow kinetics was associated with either strong or
weak rectification. Our results suggest that kinetic and permeation properties of native AMPARs can be regulated independently in cortical
neurons and probably do not have the same molecular determinants.
Key words:
AMPA receptor;
neocortex;
interneuron;
single-cell RT-PCR;
fast
glutamate application;
subunit;
splicing;
editing
INTRODUCTION
The fast excitatory synaptic
transmission in the CNS is mediated mainly by AMPA receptor channels
(AMPARs). These receptors are multimeric assemblies of four different
subunits GluR1-4 (for review, see Wisden and Seeburg, 1993 ; Hollmann
and Heinemann, 1994 ). Further diversity is generated by alternative
splicing (Sommer et al., 1990 ) and mRNA editing (Sommer et al., 1991 ;
Lomeli et al., 1994 ). In heterologous expression systems recombinant AMPAR permeation properties are controlled by the relative abundance of
GluR2 (for review on voltage dependence and calcium permeability, see
Hollmann and Heinemann, 1994 ; Jonas and Burnashev, 1995 ) [see also
Swanson et al. (1997) for single channel conductance]. In contrast,
their kinetic properties are affected by multiple factors, including
subunit composition, flip/flop alternative splicing, and mRNA edition
at the R/G site (Sommer et al., 1990 ; Lomeli et al., 1994 ; Mosbacher et
al., 1994 ; Partin et al., 1994 ).
Studies of native AMPARs by patch-clamp recordings combined with
single-cell reverse transcription-PCR (single-cell RT-PCR; Lambolez et
al., 1992 ) have confirmed the role played by the GluR2 subunit in their
permeation (Bochet et al., 1994 ; Jonas et al., 1994 ; Geiger et al.,
1995 ), but the identity of the molecular determinants controlling their
kinetics is still controversial. Indeed, slow and fast desensitizations
were correlated with either GluR2 flip and GluR4 (Geiger et al., 1995 ),
respectively, or to flip and flop splice variants (Lambolez et al.,
1996 ). The correlation found by Geiger et al. (1995) suggests that
permeation and kinetic properties of native AMPARs may not be regulated
independently and would range from fast desensitizing-calcium
permeable (as found in interneurons) to slow desensitizing-calcium
impermeable (as found in pyramidal cells). This is indeed the case for
most neural cell types studied so far.
In the present work the kinetic and permeation properties of AMPARs
were studied in neocortical nonpyramidal cells and the GluR1-4,
flip/flop splicing, and R/G editing expression patterns of
electrophysiologically characterized cells were determined by
single-cell RT-PCR. Neocortical nonpyramidal neurons comprise the
fast-spiking (FS) cells that show relative homogeneity in their
morphology, action potential firing, biochemical markers expression,
and AMPAR properties and the highly heterogeneous regular-spiking
nonpyramidal (RSNP) cells for which the AMPARs have not been studied
(McCormick et al., 1985 ; Hestrin, 1993 ; Kawaguchi and Kubota, 1993 ;
Jonas et al., 1994 ; Kawaguchi, 1995 ; Lambolez et al., 1996 ; Cauli et
al., 1997 ).
Nonpyramidal cells showed a large diversity of AMPAR functional
patterns in which permeation and kinetic properties varied independently. We confirmed that permeation properties of native AMPARs
are determined by GluR2. In contrast, none of the single molecular
parameters considered appeared to be a key determinant of kinetic
properties. Our results suggest that the functional diversity of native
AMPARs derives from the combination of independent molecular variables
and that specific combinations of these variables vary on a cell type
basis.
MATERIALS AND METHODS
Brain slices preparation and patch-clamp recordings.
Young Wistar rats (13-17 postnatal days old) were anesthetized
with ketamine (65 mg/kg) and xylazine (14 mg/kg) and decapitated.
Brains were removed quickly, and 300-µm-thick parasagittal slices
were prepared from cerebral frontal cortex with a vibratome (DSK
microslicer DTK-1000, Dosaka, Japan), following the procedure of
Edwards et al. (1989) . For recordings, slices were transferred to a
chamber perfused at 2-3 ml/min with a physiological extracellular
saline solution containing (in mM): 121 NaCl, 2.5 KCl, 1.25 NaH2PO4, 2 CaCl2, 1 MgCl2, 5 Na-pyruvate, and 15 glucose, bubbled with a
mixture of 95% O2/5% CO2. Patch
pipettes were pulled from borosilicate glass tubing and had a
resistance of 5-10 M when filled with an internal solution
containing (in mM): 144 K-gluconate, 3 MgCl2, 0.2 EGTA, 10 HEPES, 2 ATP, 0.2 GTP, and 100 µM spermine, pH 7.2-7.4, 300 mOsm. Spermine was included
because it maintains the voltage dependence of AMPARs in excised
patches (Bowie et al., 1995 ; Kamboj et al., 1995 ; Koh et al., 1995 ).
All potentials were corrected for junction potential ( 12 mV) (Neher,
1992 ). Whole-cell recordings were performed from layers IV/VI
nonpyramidal cells at room temperature. Only neurons with resting
membrane potential more negative than 62 mV were considered
further.
Cells were identified initially by videomicroscopy with Nomarski optics
under infrared illumination (Stuart et al., 1993 ). Neurons with
characteristic pyramidal shapes were excluded from the sample.
Furthermore, the kinetics of the action potential firing of recorded
cells was analyzed to discard those with electrophysiological patterns
of pyramidal cells (see Data Collection and Analysis; McCormick et al.,
1985 ; Connors and Gutnick, 1990 ; Kawaguchi, 1995 ; Lambolez et al.,
1996 ).
After intracellular recordings outside-out membrane patches were
excised from nonpyramidal cells to study native AMPARs. Fast application experiments on outside-out patches were performed by a
method originally developed by Franke et al. (1987) . A double-barreled application pipette (100-200 µm tip diameter) was operated by a
piezoelectrical device (PZ-150 M, Burleigh Instruments,
Fishers, NY). Two solutions were used for rapid perfusion: a control
solution containing (in mM) 135 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl, and 10 HEPES (315 mOsm) and a test
solution containing, additionally, 10 mM glutamate and 50 mM sucrose. To adjust the osmolarity, we diluted the test
solution 1:10 with water before the addition of the glutamate (final
concentration 10 mM). Isolated patches were positioned in
the control solution near the interface of the agonist-containing
stream. The rate of the solution exchange was estimated at the end of
each recording by measuring the current resulting from the junction
potential between the two solutions with the open patch pipette. The
exchange time (20-80%) of considered patches was 0.26 ± 0.1 msec (mean ± SD; n = 57), and the mean rise time
(20%-80%) of glutamate-induced currents was 0.35 ± 0.16 msec
(n = 66).
Data collection and analysis. Intracellular current-clamp
(mode I-Clamp fast) and outside-out voltage-clamp recordings were obtained by a patch-clamp amplifier (Axopatch 200A, Axon Instruments, Foster City, CA) and filtered at 5 and 2 kHz, respectively. Digitized data were acquired and analyzed with Acquis1 software (Gérard Sadoc, Centre National de la Recherche Scientifique, Gif-sur-Yvette, France).
The characteristics of the action potential discharges induced by
depolarizing current pulses were analyzed following the procedure
described by Cauli et al. (1997) . Briefly, the instantaneous discharge
frequency was determined all along the discharge and plotted as a
function of time at the highest intensity tested (400-600 pA). The
instantaneous discharge frequencies between the first two spikes
(finitial) and at the end of the
stimulation (ffinal) were used to
calculate the accommodation of the firing frequency during the
discharges according to (finitial ffinal)/finitial. Two physiological groups of nonpyramidal cells were defined according to their action potential firing behavior, as defined by Cauli et al.
(1997) . Neurons of the first group corresponded to fast-spiking cells,
which fired fast action potentials at a high constant rate. Cells of
the second group were unable to sustain high frequencies of repetitive
discharges and corresponded to RSNP cells (Kawaguchi, 1995 ). Uncertain
cases were distinguished by measuring the input resistance, the spike
amplitude and duration, and the after-hyperpolarization amplitude of
the first and second action potentials of the discharges as previously
described (for details, see Cauli et al., 1997 ). Pyramidal cells were
discriminated from these two populations of nonpyramidal cells
according to their smaller after-hyperpolarization (less than 7 mV),
longer spike duration (>1.5 msec), and stronger accommodation of the
firing frequency (>80%) (for details, see Cauli et al., 1997 ).
Different characteristics of AMPARs were studied simultaneously in a
single isolated patch. To study the kinetics of desensitization of
these receptors, we applied 10 mM glutamate steps of 100 msec at 72 mV (step frequency 0.2 Hz). The desensitization time
constant was obtained by fitting the decay of the averaged current
(10-50 traces) by a single exponential function. A nonstationary noise analysis was made from glutamate-induced responses (22-50 traces) that
did not show any rundown to determine the weighted mean single-channel conductance, as previously described (Sigworth, 1980 ; Cull-Candy et
al., 1988 ; Hestrin, 1993 ; Silver et al., 1996 ). For this purpose the
variance-amplitude ( 2-I)
relationship was plotted. The shape of the 2-I
relationship was either linear (n = 22) or parabolic
(n = 6), and the plot was fit with a linear regression
function ( of the points) or with a parabolic function (all
points), respectively. The fact that the shape of the
2-I relationship was often linear suggests
that the open probability of AMPARs is low in our experimental
conditions (see Silver et al., 1996 ). The slope of the
variance-amplitude relationship was considered as a weighted mean
single-channel current and divided by the driving force. We assumed
that the driving force was 70 mV, determined from the reversal
potential (Erev = 2 mV) calculated from ion
concentrations of the external and internal solutions.
Furthermore, a rectification index (RI) was
calculated from current-voltage (I-V) curves with
the following expression (Ozawa et al., 1991 ; Bochet et al., 1994 ):
|
(1)
|
where I28 and
I 72 correspond to the normalized current at 28 and 72 mV, respectively, and Erev corresponds
to the experimental reversal potential. Currents were normalized with respect to the I 72 for comparison among
cells.
Finally, the recovery from desensitization was studied by applying
pairs of 1 msec pulses of glutamate (Hestrin, 1993 ; Lomeli et al.,
1994 ). The two application pulses were separated by increasing time
intervals (from 5 to 350 msec). For each pulse pair we measured the
amplitude of the first current (current 1) and the amplitude of second
current (current 2); the ratio of current 2/current 1 was plotted
against time intervals. The time required for 50% recovery from
desensitization (t50%) was estimated by
interpolation.
Statistical data are given as mean ± SD. Correlations between
functional and molecular parameters (see below) were tested with the
nonparametrical Spearman test. We computed the Spearman rank linear
correlation coefficient (rs), and we
calculated U = (n 1)
rs, which follows the distribution of
Laplace-Gauss (Lebart et al., 1982 ).
Molecular analysis by single-cell RT-PCR. A second
whole-cell recording was performed on functionally characterized cells. The patch pipette (3-5 M ) used to harvest the cytoplasm was filled with 8 µl of autoclaved RT-PCR internal solution containing (in mM): 144 K-gluconate, 3 MgCl2, 0.2 EGTA,
and 10 HEPES, pH 7.4, 300 mOsm. The cell content was aspirated under
visual control by application of a gentle negative pressure into the
pipette. The harvesting was interrupted as soon as the seal was lost.
Then the content of the pipette was expelled into a test tube and RT performed in a final volume of 10 µl, as described (Lambolez et al.,
1992 ).
GluR1-4 cDNAs amplification. The RT products were amplified
with the common GluR1-4 primers (sense primer,
CCTTTGGCCTATGAGATCTGGATGTG; antisense primer, TCGTACCACCATTTGTTTTTCA)
with 40 PCR cycles, as described (Lambolez et al., 1992 ). In 50% of
the harvested cells the RT-PCR yielded amplified GluR1-4 cDNAs, as
seen by agarose gel electrophoresis of 10 µl of the reaction. The
product of positive samples was purified on a 1.5% low-melting-point
agarose gel and saved for further analysis.
Quantification of the GluR1-4 relative proportions. The
procedure was performed essentially as described by Lambolez et al. (1996) , except that quantification was based on fluorescence instead of
radioactivity. Aliquots of the purified product from the first PCR were
reamplified with the same set of primers, the antisense primer being
carboxyfluorescein (FAM) fluorescently labeled at the 5 end. In all,
25 cycles (94°C, 30 sec; 49°C, 30 sec; 72°C, 45 sec) were
performed. The product of the second PCR was cut by BglI,
Bsp1286I, Eco47III, or EcoRI, which
selectively cut the GluR1, 2, 3, or 4 PCR fragment, respectively (for
details, see Lambolez et al., 1992 , 1996 ). The restriction reactions
were performed on 1 µl aliquots of the PCR product in a 5 µl volume
and, after the addition of 30 µl of H2O, were run by
capillary electrophoresis [2.3% fragment analysis reagent (FAR),
nondenaturing conditions] in an ABI 310 Genetic Analyzer
(Perkin-Elmer, Foster City, CA) and analyzed with the GeneScan software
(Perkin-Elmer). Because only the antisense primer was labeled, each
restriction cut generated only one labeled restriction fragment. For
each run, corresponding to a subunit-specific cut, the total
fluorescence present in both the cut and the uncut peaks was normalized
to 100%. The percentage of fluorescence present in the cut peak thus
represented the percentage of the corresponding subunit in the GluR1-4
amplified products.
Quantification of the flip/flop proportions of GluR1-4.
Aliquots of the purified product of the first amplification were
submitted to a second amplification with the following sets of primers: the sense primers were specific for GluR1 (R1, GGACGAGACCAGACAACCAG at
position 1717; position 1 is the first nucleotide of the initiation codon), GluR2 (R2, TGAAGATGGAAGAGAAACACAAAG at position 1731), GluR3 (R3, ACCCACAAAGCCCTCCTG at position 1757), or GluR4 (R4, GAAGGACCCAGTGACCAGCC at position 1747), the common antisense primer was
that used for the first amplification, but FAM 5 end-labeled. Then 25 cycles (94°C, 30 sec; 49°C, 30 sec; 72°C, 45 sec) were performed.
The products of these second amplifications (632, 639, 628, and 630 bp
for GluR1, 2, 3, and 4, respectively) were digested with enzymes
specific of either the flip or the flop form, yielding fragments of the
following size: 568 and 64 for GluR1 flip cut by BfaI, 571 and 68 for GluR2 flop cut by HpaI, 560 and 68 for GluR3 flop
cut by HpaI, and 562 and 68 for GluR4 flop cut by
HpaI (Bochet et al., 1994 ; Lambolez et al., 1996 ).
The restriction reactions were performed on 1 µl aliquots of the PCR
product in a 5 µl volume and, after addition of 30 µl H2O, were run by capillary electrophoresis (2.3% FAR,
nondenaturing conditions) in an ABI 310 Genetic Analyzer and analyzed
with the GeneScan software. For each run, corresponding to a
variant-specific cut, the total fluorescence present in both the cut
and the uncut peaks was normalized to 100%. The percentage of
fluorescence present in the cut band thus represented the percentage of
the corresponding flip or flop variant for each subunit. The percentage
of the complementary variant was calculated assuming that flip plus
flop variants represent 100%. For each cell these relative values were
multiplied by the relative amounts of the GluR1 to four subunits
previously determined (see above) to obtain the relative proportions of
the GluR1-4 flip or flop expressed.
Quantification of the R/G edited proportions of GluR2-4.
Aliquots of the products of the subunit-specific second
amplification (see above) were submitted to an additional amplification
with the following primers common to GluR2, 3, and 4: the sense primer (TGGATTCCAAAGGCTA, positions 2243, 2258, and 2246 on GluR2, 3, and 4, respectively) was FAM 5 end-labeled and the antisense primer was that
used for the previous amplifications. In all, 18 cycles (94°C, 30 sec; 49°C, 30 sec; 72°C, 15 sec) were performed. The product of
this amplification (127 bp) was digested by the editing
variant-specific enzyme MseI yielding fragments of the following sizes: 127* bp for GluR2-4 flip edited (G form), 82 and 45*
bp for GluR2-4 flip unedited (R form), 69 and 58* bp for GluR2-4 flop
edited, and 69, 45*, and 13 bp for GluR2-4 flop unedited (* indicates
the fragment bearing the FAM fluorophore).
The restriction reactions were performed on 2 µl aliquots of the PCR
product in a 5 µl volume and, after addition of 30 µl of
H2O, were run by capillary electrophoresis (2.5% FAR,
nondenaturing conditions) in an ABI 310 Genetic Analyzer and analyzed
with the GeneScan software. In the cases in which only one of the flip or flop forms was present for a given subunit, the percentage of
fluorescence present in the 45 bp band thus represented the percentage
of the unedited variant for this subunit. When a mix of flip and flop
forms was present for a given subunit, both of their unedited variants
contributed to the fluorescence of the 45 bp band. The amount of
fluorescence contributed by the unedited flop form
(oR) was calculated according to the
following equation:
|
(2)
|
where iG (edited flip) is the
fluorescence amount in the 127 bp peak, oG
(edited flop) is the fluorescence amount in the 58 bp peak,
A is the flip/flop ratio (previously determined), and
B is the fluorescence amount in the 45 bp peak. Then the
percentage of unedited flop
[oR/(oR + oG)] and of unedited flip
[(B oR)/(B (oR + iG))] were
calculated. For each cell these relative values were multiplied by the
relative amounts of the GluR2-4 flip or flop subunits previously
determined (see above) to obtain the relative proportions of the
GluR2-4/flip-flop/R-G expressed.
RESULTS
Native AMPARs were studied from layer IV/VI nonpyramidal cells in
the sensory motor cortex of 13- to 17-d-old rats. The functional and
molecular properties of these receptors were analyzed by combining fast
glutamate application to outside-out patches and single-cell RT-PCR.
Outside-out patches from 66 nonpyramidal neurons were recorded, and in
27 cells a successful combined analysis was made.
The FS cells and the RSNP cells were discriminated by the frequency
accommodation of the action potential trains induced by depolarizing
current injections. The average firing accommodation of FS neurons was
33 ± 11% (n = 16), significantly different from that of RSNP neurons (60 ± 12%; n = 47;
Student's t test, p < 0.001) (see
Materials and Methods). The proportion of FS neurons (24%) was smaller
than that of RSNP neurons (76%).
Analysis of the AMPAR properties in an RSNP neuron
Four functional parameters were measured on glutamate-induced
responses: the desensitization time constant of the current ( ), the
recovery from desensitization (t50%),
the rectification of the I-V curves (RI),
and the weighted mean single-channel conductance (g) (see Materials and Methods).
Figure 1 illustrates an analysis of the
AMPAR properties in a neuron identified as an RSNP cell by its firing
properties (data not shown). The desensitization time constant was
determined from the decay of AMPAR currents elicited by glutamate steps
of 100 msec ( = 5.95 msec; Fig. 1A). Recovery from
desensitization was determined by applying two pulses of 1 msec at
increasing time intervals (from 5 to 350 msec). For short time
intervals the current elicited by the second pulse (current 2) was
smaller than the current elicited by the first pulse (current 1) (data
not shown). The first pulse thus was sufficient to desensitize the
glutamate-induced currents. As shown for the RSNP cell of Figure 1, the
ratio of current 2/current 1 was plotted against the time between the
two pulses. The recovery from desensitization
(t50%), interpolated from the plot, was
estimated by the time needed for current 2 to reach 50% of current 1 (t50% = 35 msec; Fig.
1B).
Fig. 1.
Functional and molecular analysis of AMPARs on a
single RSNP neuron. Functional properties were investigated on an
excised patch. Subsequently, a second whole-cell recording was obtained on the same cell, and the cellular content was harvested to investigate the GluR1-4 combination expressed. A, Averaged response
(bottom trace) to 100 msec step applications (top
trace) of 10 mM glutamate (holding potential, 72
mV). The current decay was fit by a single exponential function ( = 5.95 msec) superimposed to the averaged current; average of 39 responses. B, Recovery from desensitization between
currents induced by pairs of 1 msec pulses of glutamate separated by
increasing time intervals (from 5 to 350 msec). The ratio of current
2/current 1 was plotted against time intervals. The time required for
50% recovery from desensitization was determined by interpolation
(t50% = 35 msec). C,
I-V curve of glutamate-induced responses. The averaged
amplitudes of peak currents (averages of five responses) were measured
at different potentials (from 72 to 48 mV) and normalized with
respect to the peak current at 72 mV. Note the linear shape of the
curve (RI = 0.83 and
Erev = 6 mV). The points
were fit by a fourth-order polynomial function. D,
Variance-amplitude plot obtained by nonstationary noise analysis of
glutamate-induced responses (holding potential, 72 mV). Two-thirds of
the plot was fit with a linear regression. The estimated single-channel current is obtained from the slope of the variance-amplitude
relationship (i = 0.57 pA). The weighted mean
single-channel conductance for AMPARs on this patch was 8.1 pS.
E, Quantification of GluR1-4, flip/flop, and R/G
edition proportions. GluR1-4 cDNA fragments were amplified with a fluorescent primer, cut with restriction enzymes, and submitted to capillary electrophoresis. The fluorescence profiles obtained are displayed with subunit-specific colors: green, GluR1; red, GluR2;
blue, GluR3; black, GluR4. Time of
migration is represented horizontally (fragment size
increasing from left to right), and
fluorescence intensity is represented vertically. Unincorporated primers peaks (p) are indicated.
Left, GluR1-4 proportions. GluR1-4 cDNA fragments were
coamplified and cut with subunit-specific enzymes. Positions of uncut
(u; GluR1-4 cDNAs resistant to the specific enzyme) and
cut cDNA fragments are indicated. No GluR4 was found in this cell. The
small peak present on all profiles at the same position
(left of R2 peak) is attributable to a
PCR artifact uncut by the enzymes. Top right panel,
Flip/flop proportions of GluR1-4 subunits expressed. Subunit-specific
amplifications were performed, followed by restriction with splice
variant-specific enzymes. GluR1 and GluR3 were uncut (flop and flip,
respectively), whereas GluR2 was cut (flop). Bottom right
panel, R/G edition proportions. After subunit-specific
amplification, products were cut with an editing variant-specific
enzyme. Positions of edited flip (R3iG), edited flop
(R2oG), and unedited (asterisk; not
present but found in other analyzed cells) peaks are indicated. In this cell GluR3 flip and GluR2 flop were edited.
[View Larger Version of this Image (25K GIF file)]
The RSNP neuron analyzed in Figure 1 displayed AMPAR responses
with an I-V curve almost linear (RI = 0.83;
Fig. 1C). Nonstationary noise analyses were performed on
glutamate-induced responses to determine the weighted mean
single-channel conductance of AMPARs. For the RSNP neuron illustrated
in Figure 1, the estimated single-channel current obtained from the
slope of the variance-amplitude relationship was i = 0.57 pA (Fig. 1D). Assuming a driving force of 70
mV, the mean single-channel conductance of AMPARs on this patch was 8.1 pS.
After characterizing the functional properties of AMPARs, we obtained a
second whole-cell recording on the same cell, and the cellular content
was harvested. Then an RT-PCR was performed on the mRNAs harvested to
investigate the GluR1-4 combination expressed in the cell (see
Materials and Methods).
Figure 1E shows the molecular analysis performed on
the RSNP cell for which the glutamate-induced responses are described above (Fig. 1A-D). The relative proportions of
GluR1-4 were quantified after a second PCR, using the first PCR
product as a template and the primer pair common to all subunits (the
antisense primer was fluorescently labeled; see Materials and Methods).
The GluR1-4 subunits were cut with subunit-specific restriction
enzymes. Then the restriction reactions were run by capillary
electrophoresis, and the obtained fluorescence profiles were used to
quantify the GluR1-4 proportions (Fig. 1E, left).
For this RSNP cell the proportions of the different subunits in the
amplified products were 38.9% GluR1, 48.7% GluR2, and 12.4%
GluR3.
The flip/flop proportions for subunits expressed in individual cells
were analyzed in a second step. After second PCRs that used the first
PCR product as a template and subunit-specific primers (the antisense
primer was fluorescently labeled), each of the resulting products was
cut by a splice variant-specific enzyme and run by
capillary electrophoresis. The fluorescence profiles of
Figure 1E, upper right panel, showed that the RSNP cell expressed GluR1 flop, GluR2 flop, and GluR3 flip. The flip/flop percentages obtained for each subunit were expressed as percentages of
the total of all subunits found in the cell.
The R/G proportions of individual subunits were analyzed in a third
step (the GluR1 subunit was not analyzed because it is not edited). A
PCR using the subunit-specific PCR products as a template and a nested
fluorescently labeled sense primer was performed. Each of the resulting
products was cut by an editing variant-specific enzyme and run by
capillary electrophoresis. Figure 1E, lower right
panel, shows the profiles obtained for the RSNP cell used as an
example. The profile corresponding to GluR2 (red) showed
that this subunit was edited (the cut peak was at the position
corresponding to the G form of flop subunits, 58 bp; see Materials and
Methods). The profile corresponding to GluR3 (blue) showed
that this subunit was edited (this peak was uncut, at the position
corresponding to the G form of flip subunits, 127 bp; see Materials and
Methods).
Functional diversity of AMPARs in nonpyramidal cells
Figure 2 shows the distribution of
the desensitization time constant and the recovery from desensitization
as well as that of the RI and the mean single-channel
conductance of AMPARs in our sample of nonpyramidal cells. Mean values
of these functional properties are summarized in Table
1. In our sample and
t50% presented a wide distribution with values
ranging from 1.56 to 18.4 msec (n = 66; Fig.
2A) and from 5 to 181 msec (n = 32;
Fig. 2B), respectively. As observed for the kinetic
properties, RI widely varied in our sample
(n = 65) with values ranging from 0.12 to 1.32 (Fig.
2C). Single-channel conductances ranged from 5.3 to 36.3 pS,
but relatively high values were predominant (n = 28;
Fig. 2D).
Fig. 2.
Functional properties of AMPARs in FS and RSNP
neurons. Open and filled bars correspond
to FS and RSNP cells, respectively. A, Desensitization
time constants ( ; n = 66 cells).
B, Recovery from desensitization
(t50%; n = 32).
C, Rectification index values calculated from
I-V curves (RI; n = 65). D, Weighted mean single-channel conductances
(g; n = 28). Note that RSNP
cells show wide distributions of the four functional parameters in
comparison to FS cells.
[View Larger Version of this Image (40K GIF file)]
Table 1.
Mean values of four functional properties of AMPARs in
nonpyramidal cells
|
FS cells |
RSNP cells |
Sample |
|
(msec) |
2.88 ± 0.68 |
6.70
± 3.34 |
5.89 ± 3.38 |
|
(n = 16) |
(n = 50) |
(n = 66)
|
| t50% (msec) |
97.2 ± 44.6 |
44.4
± 35.6 |
57.6 ± 43.9 |
|
(n = 8) |
(n = 24) |
(n = 32)
|
| RI |
0.23 ± 0.07 |
0.66 ± 0.29 |
0.55
± 0.31 |
|
(n = 16) |
(n = 49) |
(n = 65) |
| g
(pS) |
26.1 ± 6.6 |
19.6 ± 8.7 |
21.9 ± 8.9
|
|
(n = 10) |
(n = 18) |
(n = 28) |
|
The desensitization time constant ( ), the recovery from
desensitization (t50%), the rectification index
(RI), and the single-channel conductance (g) were
measured from glutamate-induced responses of FS and RSNP cells. Mean
values were calculated from data of individual cells for all of the
samples and separately for these two groups of neurons.
|
|
The FS and RSNP cell subgroups displayed AMPARs with different
functional properties (Table 1). Indeed, the mean and
t50% of FS were significantly different from
those of RSNP cells (Student's t test; p < 0.01 and p < 0.001 respectively; Table 1). Similarly, the mean RI of FS was significantly different from that of
RSNP cells (p < 0.001; Table 1). In contrast,
the average of the weighted mean single-channel conductance of FS cells
was not significantly different from that of RSNP cells (significance
level 0.05; Table 1).
The functional diversity of AMPARs appeared more restricted when only
FS cells were considered. For instance, the scattering of the and
RI values was attributable mostly to the AMPAR responses of
RSNP neurons. Indeed, in these cells, AMPAR currents presented desensitization time constants between 2.61 and 18.4 msec and RI between 0.19 and 1.32 (Fig. 2A,C, filled
bars). In contrast, FS cells always showed AMPARs with fast
kinetics of desensitization (between 1.56 and 3.87 msec) and pronounced
inward rectification of the I-V curves (between 0.12 and
0.35) (Fig. 2A,C, open bars). The distribution of
g values also was more restricted for FS cells (Fig.
2D), but large variations of
t50% values were observed in both the RSNP and
FS cell samples (Fig. 2B).
Correlations between permeation properties or between kinetic
properties of AMPARs were searched by analyzing data obtained from
individual cells (Spearman test; see Materials and Methods).
The two permeation properties of these receptors, RI and the
mean single-channel conductance, were negatively correlated
(p < 0.01; Table
2), single-channel conductances
decreasing as a function of increasing RI.
Statistical analyses of kinetic properties of AMPARs showed that the
and t50% were negatively correlated
(p < 0.01; Table 2). This correlation indicated
that slow desensitization time constants were associated with fast
recoveries from desensitization and vice versa. Typical examples are
shown in Figure 3, A and B. The FS cell of Figure 3A had fast
desensitizing ( = 1.56 msec) and slow resensitizing AMPAR currents
(t50% = 89 msec). Conversely, the RSNP cell of
Figure 3B had slow desensitizing ( = 6.24 msec) and fast
resensitizing AMPAR currents (t50% = 20 msec).
However, in 5 of 24 RSNP neurons, we observed the opposite
-t50% relationships. Figure 3C
shows one of the three RSNP neurons with fast kinetics of
desensitization ( = 2.66 msec) and fast kinetics of recovery from
desensitization (t50% = 37 msec). In contrast,
Figure 3D illustrates one of the two RSNP neurons that
presented a slow desensitization ( = 7.32 msec) and a slow recovery
from desensitization (t50% = 92 msec). Indeed,
when data obtained from FS cells, which constitute a relatively
homogeneous population of cells as compared with RSNP cells, were
removed from the statistical analysis, the
-t50% correlation disappeared (Spearman
test; p < 0.11). In contrast, the
RI-g (two permeation properties) correlation was
little affected by the same operation (from U = 2.81,
p < 0.01 to U = 2.16, p < 0.02; Table 2). These data indicate that
desensitization and recovery from desensitization of native AMPARs can
be controlled independently.
Fig. 3.
Desensitization and recovery from desensitization
of AMPARs in individual cells. Left, Averaged responses
of excised patches elicited by step glutamate application. The current
decay was fit by a single exponential function shown superimposed to
the averaged current. Right, Plot of the ratio of
current 2/current 1 against time, obtained by applying pairs of 1 msec
pulses of glutamate separated by increasing time intervals (from 5 to
350 msec). A, Patch excised from an FS neuron. Note the
fast desensitization ( = 1.56 msec; average of six responses) and
the slow recovery from desensitization
(t50% = 89 msec). B, Patch
excised from an RSNP neuron with a slow desensitization ( = 6.24 msec; average of 11 responses) and a fast recovery from desensitization (t50% = 20 msec). C, Patch
excised from an RSNP neuron with fast desensitization ( = 2.66 msec;
average of 10 responses) and fast recovery from desensitization
(t50% = 37 msec). D, Patch
excised from an RSNP neuron. Note the slow desensitization ( = 7.32 msec; average of 25 responses) and the slow recovery from
desensitization (t50% = 92 msec).
[View Larger Version of this Image (18K GIF file)]
Molecular diversity of AMPARs in nonpyramidal cells
Because in our sample of nonpyramidal cells 23 of 27 molecularly
analyzed cells corresponded to RSNP neurons, we did not differentiate the data of FS and RSNP cells. Quantification of the different GluR
subunits mRNAs indicated that GluR3 and GluR2 were expressed predominantly, whereas GluR4 was observed rarely (GluR1, 24%; GluR2,
36%; GluR3, 39%; GluR4, 1%; see Fig.
4). In our sample the overall abundance
of flop variants (47%) was equivalent to that of flip variants (53%;
right bars in Fig. 4). However, GluR1 and GluR2 were
predominantly flop (73 and 63%, respectively; filled bars
in Fig. 4), whereas GluR3 was mostly flip (82%; hatched bar in Fig. 4). Moreover, the flip/flop proportion widely varied from one
cell to another: among the 27 cells analyzed, 11 expressed >80% of
the flop form and 12 expressed >80% of the flip form. In addition,
splicing for each subunit appeared to be regulated independently in
single cells (for instance, in the cell of Fig. 1, GluR1 and GluR2 were
flop, whereas GluR3 was flip; in another cell, GluR1 was flop, whereas
GluR2 and GluR3 were flip). In our sample the mean number of GluR1-4
flip/flop subunits expressed per cell was 2.7 ± 1.4.
Fig. 4.
Relative abundance of GluR1-4 flip/flop in
nonpyramidal neurons. Shown are mean proportions of GluR1-4 subunits
found in 27 nonpyramidal neurons (23 RSNP cells and 4 FS cells). GluR2
and GluR3 mRNAs were expressed predominantly (GluR1, 24 ± 28%;
GluR2, 36 ± 36%; GluR3, 39 ± 39%; GluR4, 1 ± 4%).
Average percentages of flip (53 ± 43%) and flop (47 ± 43%) variants are indicated by hatched and
filled bars, respectively. The two bars
on the right represent the total percentages of flip and
flop variants calculated from flip and flop proportions of each
subunit.
[View Larger Version of this Image (58K GIF file)]
Because the edition at the R/G site predominantly affects the recovery
from desensitization of AMPARs (Lomeli et al., 1994 ), the R/G
quantification was performed only on cells for which we could measure
this electrophysiological parameter (n = 14). We observed that 11 of 14 neurons presented GluR2-4 subunits mRNAs edited
at 100%. In two other cells the proportion of the GluR2-4 edited
subunits was also high, with values of 91 and 83%. The remaining cell
showed a low proportion of edition (7%; data not shown).
Statistical analyses showed that the expression of GluR3 was negatively
correlated with those of GluR2 and GluR1 (p < 0.001 and p < 0.04, respectively; Table 2). In other
words, high levels of GluR3 were found in cells with low GluR2 (or low
GluR1) and vice versa. No correlation was found between GluR2 and GluR1
(Table 2).
Correlation between molecular and functional properties of AMPARs
in nonpyramidal cells
We found a positive correlation between the RI and the
relative abundance of GluR2 (p < 0.01; Table
2). The RI was negatively correlated with the relative
abundance of GluR3 mRNAs (p < 0.03; Table 2).
Thus, high levels of GluR2 (or low GluR3) were correlated with linear
I-V curves and low levels of GluR2 (or high GluR3) with
inwardly rectifying I-V curves. It must be noted that, in our sample, the expression of GluR3 was negatively correlated with that
of GluR2 (see above). No correlation was found between RI
and GluR1 (the correlation with GluR4 was not examined because this
subunit was found only in two cells).
We also found a positive correlation between and the relative
abundance of GluR2 (p < 0.04; Table 2), slower
kinetics of desensitization usually being found in cells with high
GluR2. This correlation was even better with GluR2 flip
(p < 0.025; Table 2). In contrast with
RI, no correlation was found between and GluR3 (Table
2).
No other significant correlation could be found between functional
properties and mRNA subunit expression. In particular, the
desensitization time constants and the flip/flop ratio or the R/G
editing were not correlated (Table 2). For instance, two cells (data
not shown) having desensitization time constants in the same range
( , 5.95 and 7.81 msec) and similar GluR1-4 composition (R1, 38.9 and 49.1%; R2, 48.7 and 38.6%; R3, 12.4 and 12.3%) had opposite flop
percentages (87.6 and 0%). On the other hand, two other cells (data
not shown) having similar flop percentages (96.1 and 84.5%) and
similar GluR1-4 composition (R1, 27.1 and 20.7%; R2, 68.2 and 69.4%;
R3, 4.7 and 9.9%) had very different desensitization time constants
( , 2.85 and 12.2 msec). These two examples suggest that, in addition
to the subunit composition, other factors such as protein
phosphorylation may regulate the AMPAR kinetics.
Similarly, recovery from desensitization and AMPAR subunits edition was
not correlated (Table 2).
We did not estimate the correlation between the single-channel
conductance of AMPARs and subunit composition, because this electrophysiological parameter was determined in only 7 of the 27 cells
for which the AMPAR mRNAs were studied.
Permeation and kinetics are independent properties in
native AMPARs
The correlation of one molecular parameter (GluR2) to both
RI and in our sample of neurons suggested that
permeation and kinetic properties of AMPARs could be correlated.
Indeed, when we statistically analyzed and RI from
individual patches, we observed a positive correlation between these
two parameters (p < 0.001; Table 2). Similarly,
we found that and g on one hand and RI and
t50% on the other hand were negatively
correlated (p < 0.02 and p < 0.01, respectively; Table 2). These results indicated that permeation
and kinetic properties of AMPARs usually are coupled in our cell sample
in a range going from fast desensitization-strong rectification to
slow desensitization-linear I-V curve. It further suggested that they might be controlled by the same molecular determinant, GluR2.
However, the plot of versus RI (Fig.
5) showed a large diversity of relations
between the permeation and the kinetic properties of native AMPARs. For
example, the data included in the rectangle show the variations of the
RI (between 0.23 and 1.19) for desensitization time
constants between 6 and 7 msec. Similarly, a large variability of (between 3.46 and 18.4 msec) is found for RI between 0.85 and 1.05. Furthermore, when data obtained from FS cells, which constitute a relatively homogeneous population of cells as compared with RSNP cells (open and filled circles,
respectively, in Fig. 5), were removed from the statistical analysis,
the -RI correlation dramatically decreased (from
U = 4.53, p < 0.001 to U = 1.86, p < 0.04; Table 2). A similar decrease in the
coefficient of correlation was exhibited by the -g and
RI-t50% correlations (Table 2). In
contrast, as observed above, the RI-g (two
permeation properties) correlation was affected little by the same
operation. The statistical correlation between permeation and kinetic
AMPAR properties obtained in our sample therefore seemed to reflect a
cell type-dependent rather than a structure-function-dependent coupling.
Fig. 5.
Desensitization and rectification properties of
AMPARs in FS and RSNP neurons. Desensitization time constants and
RI were plotted for each cell. Open
circles, FS neurons; filled circles, RSNP
neurons. The points located inside the
rectangle show the large variability of
RI found for desensitization time constants of 6-7
msec.
[View Larger Version of this Image (19K GIF file)]
In support of this view, analysis of individual cases revealed that
permeation and kinetic properties can be controlled independently. The
-RI correlation found in our sample predicts functional
behaviors exemplified in Figure 6,
A and B, showing an FS cell that displayed fast
desensitizing ( = 3.41 msec) and strongly rectifying
(RI = 0.12) currents and an RSNP cell that displayed
slowly desensitizing ( = 10.1 msec) and nonrectifying
(RI = 1.00) currents, respectively. However, AMPAR
responses from 11 of 49 RSNP neurons showed the opposite behaviors. The
cell of Figure 6C displayed slowly desensitizing ( = 9.69 msec) and strongly rectifying (RI = 0.36) currents. This type of AMPAR response was found in seven cells (mean = 8.26 ± 2.71 msec; mean RI = 0.32 ± 0.08).
In contrast, the cell of Figure 6D displayed fast
desensitizing ( = 2.66 msec) and weakly rectifying
(RI = 0.59) currents. This type of AMPAR response was
found in four cells (mean = 3.21 ± 0.56 msec; mean
RI = 0.84 ± 0.31). These results indicate that
desensitization and rectification of AMPARs can be controlled
independently and thus do not have the same molecular determinants.
Fig. 6.
Desensitization and rectification properties of
AMPARs in individual cells. Left, Averaged responses of
excised patches elicited by step glutamate application. The current
decay was fit by a single exponential function shown superimposed to
the averaged current. Right, I-V curves
of glutamate-induced responses. The points were fit by
third- or fourth-order polynomials. A, Patch excised
from an FS neuron. Note the fast desensitization ( = 3.41 msec;
average of 35 responses) and the inward rectification of the
I-V curve (RI = 0.12 and
Erev = 2 mV). B, Patch
excised from an RSNP neuron. Note the slow desensitization ( = 10.1 msec; average of 25 responses) and the linear I-V curve
(RI = 1.00 and Erev = 6 mV). C, Patch excised from an RSNP neuron. Note the slow desensitization ( = 9.69 msec; average of 11 responses) and the
inward rectification of the I-V curve
(RI = 0.36 and Erev = 5 mV). D, Patch excised from an RSNP neuron. Note the
fast desensitization ( = 2.66 msec; average of 10 responses) and the approximately linear I-V curve (RI = 0.59 and Erev = 5 mV).
[View Larger Version of this Image (17K GIF file)]
DISCUSSION
The present study of neocortical nonpyramidal cells confirms that
the permeation properties of native AMPARs (i.e., voltage dependence
and single-channel conductance) are regulated by the relative
expression of the GluR2 subunit. In contrast, the regulation of kinetic
properties could not be attributed to any of the single molecular
determinants considered, suggesting more complex structure-function relationships. Native AMPARs showed functional behaviors in which kinetic properties or kinetic and permeation properties varied independently. The diversity of native AMPARs supports the view that
their permeation and kinetic properties are coupled in a cell
type-dependent manner but do not have the same molecular determinant.
Molecular properties of AMPARs in nonpyramidal cells
All of the GluR1-4 subunits, except GluR4 flop, were found to be
expressed in our sample of molecularly analyzed nonpyramidal cells,
mostly constituted by RSNP neurons. The mean number of subunits
expressed per cell was 2.7, intermediate between those reported for FS
and pyramidal cells in the neocortex (3.3 and 2.3, respectively;
Lambolez et al., 1996 ). Similarly, the proportion of GluR2 was
intermediate between those reported for FS and pyramidal cells (Jonas
et al., 1994 ; Lambolez et al., 1996 ). However, the predominant
expression of GluR3 indicates that RSNP cells expressed AMPARs
different from those of FS or pyramidal cells. Indeed, FS neurons are
characterized by a high relative abundance of GluR1 mRNAs (Jonas et
al., 1994 ; Lambolez et al., 1996 ) [see also Kondo et al. (1997) , where
GluR1 is found colocalized with parvalbumin, an FS cell marker],
whereas pyramidal neurons express a high proportion of GluR2 (Jonas et
al., 1994 ; Lambolez et al., 1996 ).
Although in our sample of neurons we found equivalent amounts of flip
and flop forms, predominant expression of one form was observed in most
individual cells. Because at the developmental stage used in the
present work (13- to 17-d-old rats) the flip/flop variants ratio has
reached its adult level (Monyer et al., 1991 ), our data confirm that
the expression of flip/flop subunit proportions is cell type-dependent
(Lambolez et al., 1992 , 1996 ; Bochet et al., 1994 ; Jonas et al., 1994 ;
Geiger et al., 1995 ). Moreover, the comparison between the flip/flop
expression of the different subunits at the single-cell level confirms
that splicing is regulated independently for each subunit (Lambolez et
al., 1992 ).
Consistent with developmental studies of the GluR2-4 subunits R/G
edition (Lomeli et al., 1994 ), we found that, in our sample, GluR2-4
subunits were predominantly edited. In individual cells all subunits
were either almost fully edited or unedited. This may indicate that, in
contrast with the flip/flop splicing, the R/G editing is not regulated
independently for each subunit.
Permeation properties of AMPARs
The wide range of RI values observed is reminiscent of
similar results obtained on hippocampal nonpyramidal neurons (Isa et al., 1996 ). The mean RI value obtained in our sample (0.55)
was intermediate between that of our FS cells (0.23) and the
RI values reported for hippocampal pyramidal neurons (mostly
above 1; see Isa et al., 1996 ). Similarly, g values varied
from those reported for FS cells to those reported for pyramidal cells
(Hestrin, 1993 ). The average of g in our population of FS
neurons (26 pS) is similar to that previously reported for this cell
type (27 pS, Hestrin, 1993 ). For both permeation properties the FS
cells appeared to form a homogeneous population, as compared with RSNP
cells.
A negative correlation was found between RI and
g, suggesting that these permeation properties are both
controlled by the same molecular determinant. Consistent with numerous
reports, the positive correlation we found between RI and
the relative abundance of GluR2 indicates that this subunit regulates
both of these permeation properties. Indeed, the role played by the GluR2 subunit in the rectification of AMPAR currents is well
established in heterologous expression systems (for review, see
Hollmann and Heinemann, 1994 ; Jonas and Burnashev, 1995 ) and for native
receptors (Bochet et al., 1994 ). Similarly, the mean single-channel
conductance of recombinant AMPARs is determined by the relative
abundance of the GluR2 subunit (Swanson et al., 1997 ). The negative
correlation between RI and the predominantly expressed GluR3
subunit observed in our sample of cells also confirms that permeation
properties are regulated by the ratio GluR2/GluR1, 3, 4.
The relative abundance of GluR2 also determines another permeation
property of AMPARs, their calcium permeability (for review, see
Hollmann and Heinemann, 1994 ; Jonas and Burnashev, 1995 ) [see also
Jonas et al. (1994) and Geiger et al. (1995) for native receptors]. From the present study and previous reports it can be inferred that the
relative abundance of GluR2 in the neural cell types analyzed so far
determines AMPARs for which the permeation properties vary from high
g-high calcium permeability-low RI (neocortical FS cell type) to low g-low calcium permeability-high
RI (pyramidal cell type).
Kinetic properties of AMPARs
In our sample desensitization values ranged from the fastest
reported (medial nucleus of the trapezoid body cells) to the slowest
reported (Hilar mossy cells), using 1 mM glutamate
applications (1.7 and 16.3 msec, respectively; Geiger et al., 1995 ).
Most of this variability was attributable to RSNP neurons, FS neurons always showing fast desensitization. In a previous study neocortical pyramidal and FS neurons displayed AMPARs with slow and fast recovery from desensitization, respectively (Hestrin, 1993 ). Here we observed that, in both FS and RSNP cells, t50% values
widely varied between these two extremes.
The negative correlation observed between and
t50% (fast desensitization generally being
associated with slow recovery and vice versa) dramatically decreased
when data of FS neurons were removed from statistical analyses. Indeed,
we found individual RSNP cells with either fast desensitization-fast
recovery or slow desensitization-slow recovery, as previously reported
for other cell types (Colquhoun et al., 1992 ; Raman and Trussell,
1995 ). Together, these observations suggest that these two kinetic
properties of AMPARs can be controlled independently and probably do
not have the same molecular determinants.
In heterologous expression systems the flip/flop splicing affects the
kinetic properties of recombinant AMPARs (Sommer et al., 1990 ; Lomeli
et al., 1994 ; Mosbacher et al., 1994 ; Partin et al., 1994 ). Comparison
between neocortical FS and pyramidal cells also suggested that native
AMPARs kinetics similarly are affected by the flip/flop splicing
(Lambolez et al., 1996 ). However, as observed in a similar study
comparing native AMPARs of a broad cell types sample (Geiger et al.,
1995 ), we did not find any correlation between these molecular and
functional properties. In agreement with Geiger et al. (1995) , we
therefore propose that the flip/flop splicing is not the principal
molecular determinant controlling the kinetic properties of native
AMPARs.
Recombinant studies have suggested that recovery from desensitization
of AMPARs is controlled by the R/G site edition (Lomeli et al., 1994 ).
Although the number of cells analyzed for that molecular property in
the present study (n = 14) does not allow us to reject
this hypothesis, the absence of correlation between t50% and editing suggests that recovery from
desensitization of native AMPARs is not controlled primarily at that
site.
As also found in a previous work (Geiger et al., 1995 ), we observed a
positive correlation between desensitization time constants and the
relative abundance of GluR2, suggesting a correlation between kinetic
and permeation properties. Consistent with this hypothesis we also
found a positive correlation between and RI. From this
correlation native AMPAR properties are expected to range from fast
desensitization-strong rectification to slow desensitization-linear
I-V curve. However, when data from the homogeneous
population of FS neurons were removed from statistical analyses, the
significance of this correlation dramatically decreased. Moreover,
analyses of individual RSNP cells showed that, in 11 of 49 neurons, the
-RI relationship was opposite to that expected from the
correlation found on our whole nonpyramidal cell sample. Indeed, seven
cells displayed AMPAR currents with slow desensitization and marked
inward rectification, and four cells displayed AMPAR currents with fast
desensitization and weak rectification, as also reported for nigral
GABAergic neurons (Götz et al., 1997 ). Overall, these data
indicate that the permeation and the kinetic properties of native
AMPARs can be controlled independently and thus do not have the same
molecular determinant. GluR2 therefore does not appear to determine
dominantly the native AMPAR kinetics.
In heterologous expression systems many molecular determinants have
been shown to affect AMPAR kinetics: the subunit composition, the
alternative flip/flop variants, and the mRNA edited at the R/G site of
subunits GluR2-4 (Sommer et al., 1990 ; Lomeli et al., 1994 ; Mosbacher
et al., 1994 ; Partin et al., 1994 ). Our data, together with these
studies, are consistent with the view that multiple determinants
regulate the desensitization of AMPARs. Comparisons between individual
cells even suggest that additional molecular determinants, such as
protein phosphorylation, also might regulate AMPAR kinetics. This,
indeed, would explain the absence of correlation between kinetics and
individual molecular parameters in native AMPARs.
Cell type-dependent regulations of AMPAR kinetic and
permeation properties
Heterologous expression studies have demonstrated that the fine
tuning of AMPAR properties can result in a large variability of
functional patterns. Despite cell to cell variations in their GluR1-4
expression, cell types express distinct mean GluR1-4 combinations and
display AMPARs with relatively homogeneous functional properties. Among
neocortical neurons FS cells express AMPARs with fast desensitization, inwardly rectifying I-V curves, high calcium permeability,
and large mean single-channel conductances, whereas pyramidal cells exhibit AMPARs with opposite properties. In contrast, RSNP cells form a
highly heterogeneous population (Kawaguchi and Kubota, 1993 ; Kawaguchi,
1995 ; Cauli et al., 1997 ) and display wide variations of AMPAR kinetic
and permeation properties, resulting in various functional patterns. In
most of neuronal populations investigated in previous studies, kinetic
and permeation properties of native AMPARs were found to vary in a
range going from fast desensitization-inward rectification to slow
desensitization-no rectification. In RSNP neurons we observed two
other types of native AMPARs characterized by fast desensitization-no
rectification or slow desensitization-inward rectification. Overall,
the studies of native AMPARs suggest that their properties are
regulated independently according to cell type-specific functions.
FOOTNOTES
Received May 8, 1997; revised June 20, 1997; accepted June 23, 1997.
This study was supported by Centre National de Recherche Scientifique
(France) and by European Union Biotec Grants 960382 and 960589. S.H.
was supported by National Eye Institute Grant EY09120. M.C.A. was
supported by a fellowship from Instituto Colombiano de Ciencia y
Tecnología (Colciencias; Colombia). We thank Nathalie Gibelin,
Bruno Cauli, and Gérard Sadoc for help.
Correspondence should be addressed to Dr. Bertrand Lambolez,
Neurobiologie et Diversité Cellulaire, Centre National de la Recherche Scientifique Unité de Recherche Associée 2054, Ecole Supérieure de Physique et de Chimie Industrielles de la
ville de Paris, 10 Rue Vauquelin, 75231 Paris Cedex 5, France.
REFERENCES
-
Bochet P,
Audinat E,
Lambolez B,
Crépel F,
Rossier J,
Lino M,
Tsuzuki K,
Ozawa S
(1994)
Subunit composition at the single-cell level explains functional properties of a glutamate-gated channel.
Neuron
12:383-388[Web of Science][Medline].
-
Bowie D,
Mayer ML
(1995)
Inward rectification of both AMPA and kainate subtype glutamate receptors generated by polyamine-mediated ion channel block.
Neuron
15:453-462[Web of Science][Medline].
-
Cauli B,
Audinat E,
Lambolez B,
Angulo MC,
Ropert N,
Tsuzuki K,
Hestrin S,
Rossier J
(1997)
Molecular and physiological diversity of cortical nonpyramidal cells.
J Neurosci
17:3894-3906[Abstract/Free Full Text].
-
Colquhoun D,
Jonas P,
Sakmann B
(1992)
Action of brief pulses of glutamate on AMPA/kainate receptors in patches from different neurones of rat hippocampal slices.
J Physiol (Lond)
458:261-287[Abstract/Free Full Text].
-
Connors BW,
Gutnick MJ
(1990)
Intrinsic firing patterns of diverse neocortical neurons.
Trends Neurosci
13:99-104[Web of Science][Medline].
-
Cull-Candy SG,
Howe JR,
Ogden DC
(1988)
Noise and single channels activated by excitatory amino acids in rat cerebellar granule neurones.
J Physiol (Lond)
400:189-222[Abstract/Free Full Text].
-
Edwards FA,
Konnerth A,
Sakmann B,
Takahashi T
(1989)
A thin slice preparation for patch-clamp recordings from neurons of the mammalian central nervous system.
Pflügers Arch
414:600-612[Web of Science][Medline].
-
Franke C,
Hatt H,
Dudel J
(1987)
Liquid filament switch for ultra-fast exchanges of solutions at excised patches of synaptic membrane of crayfish muscle.
Neurosci Lett
77:199-204[Web of Science][Medline].
-
Geiger JR,
Melcher T,
Koh DS,
Sakmann B,
Seeburg PH,
Jonas P,
Monyer H
(1995)
Relative abundance of subunit mRNAs determines gating and Ca2+ permeability of AMPA receptors in principal neurons and interneurons in rat CNS.
Neuron
15:193-204[Web of Science][Medline].
-
Götz T,
Kraushaar U,
Geiger J,
Lübke J,
Berger T,
Jonas P
(1997)
Functional properties of AMPA and NMDA receptors expressed in identified types of basal ganglia neurons.
J Neurosci
17:204-215[Abstract/Free Full Text].
-
Hestrin S
(1993)
Different glutamate receptor channels mediate fast excitatory synaptic currents in inhibitory and excitatory cortical neurons.
Neuron
11:1083-1091[Web of Science][Medline].
-
Hollmann M,
Heinemann S
(1994)
Cloned glutamate receptors.
Annu Rev Neurosci
17:31-108[Web of Science][Medline].
-
Isa T,
Itazawa S,
Iino M,
Tsuzuki K,
Ozawa S
(1996)
Distribution of neurons expressing inwardly rectifying and Ca2+-permeable AMPA receptors in rat hippocampal slices.
J Physiol (Lond)
491:719-733[Abstract/Free Full Text].
-
Jonas P,
Burnashev N
(1995)
Molecular mechanisms controlling calcium entry through AMPA-type glutamate receptor channels.
Neuron
15:987-990[Web of Science][Medline].
-
Jonas P,
Racca C,
Sakmann B,
Seeburg PH,
Monyer H
(1994)
Differences in Ca2+ permeability of AMPA-type glutamate receptor channels in neocortical neurons caused by differential GluR-B subunit expression.
Neuron
12:1281-1289[Web of Science][Medline].
-
Kamboj SK,
Swanson GT,
Cull-Candy SG
(1995)
Intracellular spermine confers rectification on rat calcium-permeable AMPA and kainate receptors.
J Physiol (Lond)
486:297-303[Abstract/Free Full Text].
-
Kawaguchi Y
(1995)
Physiological subgroups of nonpyramidal cells with specific morphological characteristics in layer II/III of rat frontal cortex.
J Neurosci
15:2638-2655[Abstract].
-
Kawaguchi Y,
Kubota Y
(1993)
Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindin D28k-immunoreactive neurons in layer V of rat frontal cortex.
J Neurophysiol
70:387-396[Abstract/Free Full Text].
-
Koh DS,
Burnashev N,
Jonas P
(1995)
Block of native Ca2+-permeable AMPA receptors in rat brain by intracellular polyamines generates double rectification.
J Physiol (Lond)
486:305-312[Abstract/Free Full Text].
-
Kondo M,
Sumino R,
Okado H
(1997)
Combinations of AMPA receptor subunit expression in individual cortical neurons correlate with expression of specific calcium-binding proteins.
J Neurosci
17:1570-1581[Abstract/Free Full Text].
-
Lambolez B,
Audinat E,
Bochet P,
Crépel F,
Rossier J
(1992)
AMPA receptor subunits expressed by single Purkinje cells.
Neuron
9:247-258[Web of Science][Medline].
-
Lambolez B,
Ropert N,
Perrais D,
Rossier J,
Hestrin S
(1996)
Correlation between kinetics and RNA splicing of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors in neocortical neurons.
Proc Natl Acad Sci USA
93:1797-1802[Abstract/Free Full Text].
-
Lebart L,
Morineau A,
Fénelon J-P
(1982)
Méthodes non paramétriques.
In: Traitement des données statistiques: méthodes et programmes, pp 109-183. Paris: Bordas Dunod.
-
Lomeli H,
Mosbacher J,
Melcher T,
Hoger T,
Geiger JR,
Kuner T,
Monyer H,
Higuchi M,
Bach A,
Seeburg PH
(1994)
Control of kinetic properties of AMPA receptor channels by nuclear RNA editing.
Science
266:1709-1713[Abstract/Free Full Text].
-
McCormick DA,
Connors BW,
Lighthall JW,
Prince DA
(1985)
Comparative electrophysiology of pyramidal and sparsely spiny stellate neurons of the neocortex.
J Neurophysiol
54:782-806[Abstract/Free Full Text].
-
Monyer H,
Seeburg PH,
Wisden W
(1991)
Glutamate-operated channels: developmentally early and mature forms arise by alternative splicing.
Neuron
6:799-810[Web of Science][Medline].
-
Mosbacher J,
Schoepfer R,
Monyer H,
Burnashev N,
Seeburg PH,
Ruppersberg JP
(1994)
A molecular determinant for submillisecond desensitization in glutamate receptors.
Science
266:1059-1062[Abstract/Free Full Text].
-
Neher E
(1992)
Correction for liquid junction potentials in patch-clamp experiments.
Methods Enzymol
207:123-131[Web of Science][Medline].
-
Ozawa S,
Lino M,
Tsuzuki K
(1991)
Two types of kainate response in cultured rat hippocampal neurons.
J Neurophysiol
66:2-11[Abstract/Free Full Text].
-
Partin KM,
Patneau DK,
Mayer ML
(1994)
Cyclothiazide differentially modulates desensitization of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor splice variants.
Mol Pharmacol
46:129-138[Abstract].
-
Raman IM,
Trussell LO
(1995)
The mechanism of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor desensitization after removal of glutamate.
Biophys J
68:137-146[Web of Science][Medline].
-
Sigworth FJ
(1980)
The variance of sodium current fluctuations at the node of Ranvier.
J Physiol (Lond)
307:97-129[Abstract/Free Full Text].
-
Silver RA,
Cull-Candy SG,
Takahashi T
(1996)
Non-NMDA glutamate receptor occupancy and open probability at a rat cerebellar synapse with single and multiple release sites.
J Physiol (Lond)
494:231-250[Abstract/Free Full Text].
-
Sommer B,
Keinanen K,
Verdoorn TA,
Wisden W,
Burnashev N,
Herb A,
Kohler M,
Takagi T,
Sakmann B,
Seeburg PH
(1990)
Flip and flop: a cell-specific functional switch in glutamate-operated channels of the CNS.
Science
249:1580-1585[Abstract/Free Full Text].
-
Sommer B,
Kohler M,
Sprengel R,
Seeburg PH
(1991)
RNA editing in brain controls a determinant of ion flow in glutamate-gated channels.
Cell
67:11-19[Web of Science][Medline].
-
Stuart GJ,
Dodt HU,
Sakmann B
(1993)
Patch-clamp recordings from the soma and dendrites of neurons in brain slices using infrared video microscopy.
Pflügers Arch
423:511-518[Web of Science][Medline].
-
Swanson GT,
Kamboj SK,
Cull-Candy SG
(1997)
Single-channel properties of recombinant AMPA receptors depend on RNA editing, splice variation, and subunit composition.
J Neurosci
17:58-69[Abstract/Free Full Text].
-
Wisden W,
Seeburg PH
(1993)
Mammalian ionotropic glutamate receptors.
Curr Opin Neurobiol
3:291-298[Medline].
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Gainey, J. R. Hurvitz-Wolff, M. E. Lambo, and G. G. Turrigiano
Synaptic Scaling Requires the GluR2 Subunit of the AMPA Receptor
J. Neurosci.,
May 20, 2009;
29(20):
6479 - 6489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Oren, W. Nissen, D. M. Kullmann, P. Somogyi, and K. P. Lamsa
Role of Ionotropic Glutamate Receptors in Long-Term Potentiation in Rat Hippocampal CA1 Oriens-Lacunosum Moleculare Interneurons
J. Neurosci.,
January 28, 2009;
29(4):
939 - 950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-C. Chang and C.-C. Chiao
Localization and Functional Mapping of AMPA Receptor Subunits in the Developing Rabbit Retina
Invest. Ophthalmol. Vis. Sci.,
December 1, 2008;
49(12):
5619 - 5628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Ali, A. P. Bannister, and A. M. Thomson
Robust correlations between action potential duration and the properties of synaptic connections in layer 4 interneurones in neocortical slices from juvenile rats and adult rat and cat
J. Physiol.,
April 1, 2007;
580(1):
149 - 169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Coleman, T. Moykkynen, C. Cai, L. von Ossowski, E. Kuismanen, E. R. Korpi, and K. Keinanen
Isoform-Specific Early Trafficking of AMPA Receptor Flip and Flop Variants
J. Neurosci.,
October 25, 2006;
26(43):
11220 - 11229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Halabisky, F. Shen, J. R. Huguenard, and D. A. Prince
Electrophysiological Classification of Somatostatin-Positive Interneurons in Mouse Sensorimotor Cortex
J Neurophysiol,
August 1, 2006;
96(2):
834 - 845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Taschenberger, V. Scheuss, and E. Neher
Release kinetics, quantal parameters and their modulation during short-term depression at a developing synapse in the rat CNS
J. Physiol.,
October 15, 2005;
568(2):
513 - 537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Blatow, A. Caputi, and H. Monyer
Molecular diversity of neocortical GABAergic interneurones
J. Physiol.,
January 1, 2005;
562(1):
99 - 105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Ogoshi and J. H. Weiss
Heterogeneity of Ca2+-Permeable AMPA/Kainate Channel Expression in Hippocampal Pyramidal Neurons: Fluorescence Imaging and Immunocytochemical Assessment
J. Neurosci.,
November 19, 2003;
23(33):
10521 - 10530.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Beierlein, J. R. Gibson, and B. W. Connors
Two Dynamically Distinct Inhibitory Networks in Layer 4 of the Neocortex
J Neurophysiol,
November 1, 2003;
90(5):
2987 - 3000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Angulo, J. F. Staiger, J. Rossier, and E. Audinat
Distinct Local Circuits Between Neocortical Pyramidal Cells and Fast-Spiking Interneurons in Young Adult Rats
J Neurophysiol,
February 1, 2003;
89(2):
943 - 953.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gonzalez-Islas and J. J. Hablitz
Dopamine Enhances EPSCs in Layer II-III Pyramidal Neurons in Rat Prefrontal Cortex
J. Neurosci.,
February 1, 2003;
23(3):
867 - 875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kielland and P. Heggelund
AMPA and NMDA currents show different short-term depression in the dorsal lateral geniculate nucleus of the rat
J. Physiol.,
July 1, 2002;
542(1):
99 - 106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Kumar, A. Bacci, V. Kharazia, and J. R. Huguenard
A Developmental Switch of AMPA Receptor Subunits in Neocortical Pyramidal Neurons
J. Neurosci.,
April 15, 2002;
22(8):
3005 - 3015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rozov, J. Jerecic, B. Sakmann, and N. Burnashev
AMPA Receptor Channels with Long-Lasting Desensitization in Bipolar Interneurons Contribute to Synaptic Depression in a Novel Feedback Circuit in Layer 2/3 of Rat Neocortex
J. Neurosci.,
October 15, 2001;
21(20):
8062 - 8071.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Porter, C. K. Johnson, and A. Agmon
Diverse Types of Interneurons Generate Thalamus-Evoked Feedforward Inhibition in the Mouse Barrel Cortex
J. Neurosci.,
April 15, 2001;
21(8):
2699 - 2710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Fuchs, H. Doheny, H. Faulkner, A. Caputi, R. D. Traub, A. Bibbig, N. Kopell, M. A. Whittington, and H. Monyer
Genetically altered AMPA-type glutamate receptor kinetics in interneurons disrupt long-range synchrony of gamma oscillation
PNAS,
March 13, 2001;
98(6):
3571 - 3576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Gründer, K. Kohler, and E. Guenther
Distribution and Developmental Regulation of AMPA Receptor Subunit Proteins in Rat Retina
Invest. Ophthalmol. Vis. Sci.,
October 1, 2000;
41(11):
3600 - 3606.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. J. Lawrence and L. O. Trussell
Long-Term Specification of AMPA Receptor Properties after Synapse Formation
J. Neurosci.,
July 1, 2000;
20(13):
4864 - 4870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E Stern, S. Hestrin, and W. E Armstrong
Enhanced neurotransmitter release at glutamatergic synapses on oxytocin neurones during lactation in the rat
J. Physiol.,
July 1, 2000;
526(1):
109 - 114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Cauli, J. T. Porter, K. Tsuzuki, B. Lambolez, J. Rossier, B. Quenet, and E. Audinat
Classification of fusiform neocortical interneurons based on unsupervised clustering
PNAS,
May 23, 2000;
97(11):
6144 - 6149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ravindranathan, S. D Donevan, S. G Sugden, A. Greig, M. S Rao, and T. N Parks
Contrasting molecular composition and channel properties of AMPA receptors on chick auditory and brainstem motor neurons
J. Physiol.,
March 15, 2000;
523(3):
667 - 684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Durstewitz, J. K. Seamans, and T. J. Sejnowski
Dopamine-Mediated Stabilization of Delay-Period Activity in a Network Model of Prefrontal Cortex
J Neurophysiol,
March 1, 2000;
83(3):
1733 - 1750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Metin, J.-P. Denizot, and N. Ropert
Intermediate Zone Cells Express Calcium-Permeable AMPA Receptors and Establish Close Contact with Growing Axons
J. Neurosci.,
January 15, 2000;
20(2):
696 - 708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Angulo, J. Rossier, and E. Audinat
Postsynaptic Glutamate Receptors and Integrative Properties of Fast-Spiking Interneurons in the Rat Neocortex
J Neurophysiol,
September 1, 1999;
82(3):
1295 - 1302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Porter, B. Cauli, K. Tsuzuki, B. Lambolez, J. Rossier, and E. Audinat
Selective Excitation of Subtypes of Neocortical Interneurons by Nicotinic Receptors
J. Neurosci.,
July 1, 1999;
19(13):
5228 - 5235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. D. Leuschner and W. Hoch
Subtype-specific Assembly of alpha -Amino-3-hydroxy-5-methyl-4-isoxazole Propionic Acid Receptor Subunits Is Mediated by Their N-terminal Domains
J. Biol. Chem.,
June 11, 1999;
274(24):
16907 - 16916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Stern, M. Galarreta, R. C. Foehring, S. Hestrin, and W. E. Armstrong
Differences in the Properties of Ionotropic Glutamate Synaptic Currents in Oxytocin and Vasopressin Neuroendocrine Neurons
J. Neurosci.,
May 1, 1999;
19(9):
3367 - 3375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Angulo, J. F. Staiger, J. Rossier, and E. Audinat
Developmental Synaptic Changes Increase the Range of Integrative Capabilities of an Identified Excitatory Neocortical Connection
J. Neurosci.,
March 1, 1999;
19(5):
1566 - 1576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. T Swanson and S. F Heinemann
Heterogeneity of homomeric GluR5 kainate receptor desensitization expressed in HEK293 cells
J. Physiol.,
December 15, 1998;
513(3):
639 - 646.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C Bellingham, R. Lim, and B. Walmsley
Developmental changes in EPSC quantal size and quantal content at a central glutamatergic synapse in rat
J. Physiol.,
September 15, 1998;
511(3):
861 - 869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dieudonne
Submillisecond kinetics and low efficacy of parallel fibre-Golgi cell synaptic currents in the rat cerebellum
J. Physiol.,
August 1, 1998;
510(3):
845 - 866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Harada, C. Harada, M. Sekiguchi, and K. Wada
Light-Induced Retinal Degeneration Suppresses Developmental Progression of Flip-to-Flop Alternative Splicing in GluR1
J. Neurosci.,
May 1, 1998;
18(9):
3336 - 3343.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|