 |
Previous Article | Next Article 
Volume 17, Number 20,
Issue of October 15, 1997
pp. 7736-7745
Copyright ©1997 Society for Neuroscience
Aggregated Amyloid- Protein Induces Cortical Neuronal
Apoptosis and Concomitant "Apoptotic" Pattern of Gene Induction
Steven Estus1,
H.
Michael Tucker1,
Corlia van
Rooyen1,
Sarah Wright2,
Elizabeth F. Brigham2,
Mark Wogulis2, and
Russell E. Rydel2
1 Department of Physiology, Sanders-Brown Center on
Aging, University of Kentucky, Lexington, Kentucky 40536, and
2 Athena Neurosciences, South San Francisco, California
94080
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
To gain a molecular understanding of neuronal responses to
amyloid- peptide (A ), we have analyzed the effects of A
treatment on neuronal gene expression in vitro by
quantitative reverse transcription-PCR and in situ
hybridization. Treatment of cultured rat cortical neurons with
A 1-40 results in a widespread apoptotic neuronal death.
Associated with death is an induction of several members of the
immediate early gene family. Specifically, we (1) report the
time-dependent and robust induction of c-jun,
junB, c-fos, and fosB, as
well as transin, which is induced by c-Jun/c-Fos heterodimers and encodes an extracellular matrix protease; these gene
inductions appear to be selective because other Jun and Fos family
members, i.e., junD and fra-1, are
induced only marginally; (2) show that the c-jun
induction is widespread, whereas c-fos expression is
restricted to a subset of neurons, typically those with condensed
chromatin, which is a hallmark of apoptosis; (3) correlate gene
induction and neuronal death by showing that each has a similar
dose-response to A ; and (4) demonstrate that both cell death and
immediate early gene induction are dependent on A aggregation state.
This overall gene expression pattern during this "physiologically
inappropriate" apoptotic stimulus is markedly similar to the pattern
we previously identified after a "physiologically appropriate"
stimulus, i.e., the NGF deprivation-induced death of sympathetic
neurons. Hence, the parallels identified here further our understanding
of the genetic alterations that may lead neurons to apoptosis in
response to markedly different insults.
Key words:
amyloid;
apoptosis;
immediate early genes;
Alzheimer's
disease;
programmed cell death
INTRODUCTION
During normal nervous system
maturation, physiologically appropriate neuronal loss contributes to a
sculpting process that removes approximately one-half of all
neurons born during neurogenesis (Oppenheim, 1991 ). Neuronal loss
subsequent to this developmental window is physiologically
inappropriate for most systems and can contribute to neurological
deficits, e.g., neurodegenerative diseases such as Alzheimer's disease
(AD) and conditions such as stroke. Elucidating the molecular
mechanisms underlying neuronal death hence will contribute to our
understanding of basic developmental biology and to human
neuropathology.
Apoptosis is a type of cell death that represents the culmination of
the naturally occurring, or programmed, cell death (PCD) pathway during
normal development. Apoptosis is defined on the basis of accompanying
cellular morphology, which includes cellular shrinkage as well as
chromatin condensation and nucleosomal fragmentation (Wyllie et al.,
1980 ; Clarke, 1990 ). Apoptosis also has been associated with the
pathophysiology of AD (Su et al., 1994 ; Dragunow et al., 1995 ; Lassmann
et al., 1995 ; Smale et al., 1995 ), Huntington's disease (Dragunow et
al., 1995 ; Portera-Calliau et al., 1995 ), and stroke (Goto et al.,
1990 ; Shigeno, 1990 ; Linnik et al., 1993 ; MacManus et al., 1993 ,
1994 ).
Elucidating patterns of gene expression during neuronal death may be
critical to our understanding of underlying mechanisms. Indeed, studies
with RNA and protein synthesis inhibitors have demonstrated that
neuronal PCD in vitro (Martin et al., 1988 ) and in
vivo (Oppenheim et al., 1990 ), as well as in certain other models
(for review, see Freeman et al., 1993 ; Bredesen, 1995 ), is dependent on
macromolecular synthesis. This has led to the hypothesis that PCD
results from the activation of a genetic program. Recently, we
identified a temporal cascade of gene expression in sympathetic neurons
undergoing NGF deprivation-induced PCD (Estus et al., 1994 ; Freeman et
al., 1994 ). Moreover, by microinjecting neutralizing antibodies, we
implicated the protein product of one of the induced genes, c-Jun, as
necessary for death (Estus et al., 1994 ), results that were confirmed
by others (Ham et al., 1995 ). Hence, a genetic cascade appears to be
necessary for NGF deprivation-induced neuronal PCD.
To evaluate whether neurons undergoing physiologically inappropriate
neuronal cell death manifest a similar genetic cascade, we have
analyzed rat cortical neurons undergoing amyloid- (A )-induced cell death. As will be discussed later, the relevance of this work
includes the observations that A aggregates accumulate in AD brain,
induce neuronal apoptosis in vitro, and have been implicated as contributory to AD by a series of genetic and protein processing studies (for review, see Selkoe, 1997 ). Because neuronal apoptosis may
be facilitated by altered gene expression and because genes induced by
A may be integral to neuropathological changes observed in AD brain,
we have quantified A -induced changes in neuronal gene
expression.
Much of this work has been reported in abstract form (Estus et al.,
1995 , 1996 ).
MATERIALS AND METHODS
Primary rat cortical neurons
Primary rat cortical neuron cultures were established from
embryonic day 18 rat fetuses. Cortical tissue was dissociated by incubation in trypsin/EDTA (0.05% trypsin plus 0.53 mM
EDTA in HBSS; Life Technologies, Gaithersburg, MD) for 20 min at
37°C. Then trypsin was inactivated by resuspending the cells in
serum-containing medium (DMEM/fetal bovine serum, Life Technologies):
DMEM which contains 4.5 gm/l glucose, 1 mM sodium pyruvate,
1 mM glutamine, 100 U/ml penicillin, and 100 µg/ml
streptomycin and supplemented with 10% heat-inactivated fetal bovine
serum (JRH Biologicals, Lenexa, KA). Then cells were pelleted by
centrifugation and resuspended in a chemically defined medium
(DMEM/B27): DMEM containing B27 (Life Technologies) supplement in place
of fetal bovine serum. Polyethyleneimine-coated 6.4 mm (96-well) dishes
were rinsed with PBS, coated with DMEM/fetal bovine serum, and then
seeded at 0.75-1.25 × 105 cells per well in
100 µl of DMEM/B27. Cultures were maintained in a humidified
incubator with an atmosphere of 90% air/10% CO2 at
37°C. Serum replacement with B27 supplement yields nearly pure neuronal cultures, as judged by immunocytochemistry for glial fibrillary acidic protein (GFAP) and neuron-specific enolase (NSE) (Brewer et al., 1993 ).
Treatment with A peptides
Aggregated A 1-40. Aggregated
A 1-40 stock solutions were prepared as 1 mM
stocks in sterile double-distilled water immediately before their
addition to cultures. A concentrations in all stock solutions were
determined by amino acid analysis. Cultured rat cortical neurons were
exposed to A by removing the culture medium and replacing it
with DMEM/N2 (Life Technologies; Bachem lots ZK840 and ZM482) or
DMEM/B27 (Bachem lot ZM605) containing 5-40 µM
A 1-40. Qualitatively similar results were obtained with
all three lots of A 1-40. Neuronal cultures were
maintained for 2-4 d before neuronal survival was assessed
visually by phase-contrast microscopy and quantified by measuring
(1) the reduction of alamarBlue (Accumed/Alamar Biosciences,
Sacramento, CA); (2) the reduction of the tetrazolium salt, 2,3-bis
(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT); and (3) the release of the cytoplasmic enzyme, lactate dehydrogenase (LDH).
Nonaggregated A . Stock nonaggregated
A 1-40 solutions were prepared by dissolving
A 1-40 (Bachem lot ZM605) to 7.5 mM in
dimethylsulfoxide (DMSO, Aldrich, Milwaukee, WI), sonicating for 30 min
in a bath sonicator, and filtering through a 3 mm Teflon membrane
filter (pore size 0.2 µm). A concentration in the stock solution
was determined by amino acid analysis. Aliquots were snap-frozen on dry
ice and ethanol and stored at 80°C. Cultures were exposed to
nonaggregated A by removing the culture medium and replacing it with
DMEM/B27 containing 40 µM A 1-40. For
these experiments an equal volume of DMSO was added to control wells
and to wells treated with aggregated A 1-40.
Measurement of A aggregation in solution. The detection
of A aggregation in solution was based on the method of LeVine
(LeVine, 1993 ). Thioflavin-T (ThT, Aldrich) stocks were made at 2.5 mM in DMSO, frozen on dry ice, and stored at 30°C. ThT
stocks were diluted to 125 µM in DMEM/B27, and 11 µl of
this solution was added to 100 µl/well of A in DMEM/B27. ThT
binding to aggregated A 1-40 was measured
spectrofluorometrically, using a Millipore Cytofluor 2350 Scanner
(excitation 440 nm, emission 485 nm) and CytoCalc software (Millipore,
Bedford, MA), and normalized to ThT in DMEM/B27 without added
A 1-40.
Neurotoxicity/apoptosis assays
AlamarBlue assay. The alamarBlue assay incorporates a
proprietary fluorometric/colorimetric metabolic indicator. Viable cells convert alamarBlue from an oxidized (nonfluorescent, blue) form to a
reduced (fluorescent, red) form. Assays were performed by replacing the
culture media with a 10% alamarBlue solution in DMEM. Reduction of
alamarBlue was determined spectrofluorometrically after 2 hr, using a
Millipore Cytofluor 2350 Scanner (excitation, 560 nm; emission, 590 nm)
and CytoCalc software. AlamarBlue reduction was directly proportional
to neuronal cell number and was linear over 3 hr.
XTT colorimetric assay. The reduction of the XTT was
determined by the Cell Proliferation Kit II (XTT) (Boehringer Mannheim, Indianapolis, IN). XTT is a substrate for intracellular and plasma membrane oxidoreductases, and its reduction is an indication of cellular metabolic activity. Assays were performed by replacing the
culture medium with 150 µl of XTT reagent. The 96-well culture plate
was read after 2 hr with a microplate reader (UVmax, Molecular Devices,
Palo Alto, CA) and "SOFTmax" version 2.32 software. Absorbance at
450 nm minus absorbance at 650 nm was used to quantify the amount of
soluble formazan dye formed from the XTT tetrazolium salt. The
absorbance was directly proportional to neuronal cell number and was
linear over this time period.
LDH kinetic assay. The release of the cytoplasmic enzyme LDH
into the culture medium was used to quantify cell membrane integrity. Twenty microliters of culture supernatant were assayed with 200 µl of
reconstituted LD-L 10 reagent (Sigma, St. Louis, MO). Samples were read
every 30 sec over a 5 min time period with a kinetic microplate reader
(UVmax, Molecular Devices) and "SOFTmax" version 2.32 software.
Absorbance at 340 nm minus absorbance at 650 nm was used to determine
the rate of formation of reduced nicotinamide adenine dinucleotide. The
reaction rate was linear over this time period. The rate of reduced
nicotinamide adenine dinucleotide formation is directly proportional to
LDH activity in the sample. Fluorescent values were converted to units
per milliliter by the inclusion of an LDH standard curve on each assay
plate by using LDH controls (Sigma).
In situ labeling of nuclear DNA fragments. DNA
fragmentation was assessed by using a fluorescent TUNEL technique
(TdT-mediated dUTP-X nick end labeling; In Situ Cell Death
Detection Kit, Boehringer Mannheim). Briefly, neurons were fixed with
4% paraformaldehyde, rinsed with PBS, and incubated with terminal
deoxy-terminal transferase and digoxigenin-dUTP. Incorporated
digoxigenin was detected with a fluorescein-labeled anti-digoxigenin
antibody.
Nuclear staining. Chromatin integrity was examined by
staining neurons with
2 -(4-hydroxyphenyl)-5-(4-methyl-1-piperazinyl)2,5 -bi-1H-benzimidazole trihydrochloride (bisbenzimide, Hoechst 33258; Sigma) at a
concentration of 1 µg/ml in PBS for 10 min. After being rinsed with
PBS, cultures prepared by the TUNEL method and costained with Hoechst
33258 were examined for DNA fragmentation and chromatin condensation by
fluorescence microscopy.
Gene expression assays
cDNA preparation. Total RNA was prepared by using
RNAeasy kits as directed by the manufacturer (Qiagen, Hilden, Germany), subjected to DNase treatment, and then repurified either by using the
RNAeasy kit or by ethanol precipitation. RNA was reverse-transcribed by
using random hexamers to prime Maloney murine leukemia virus reverse
transcriptase (Superscript). In the initial time course experiments, 1 µg of total RNA was used in each reaction, whereas in later studies
the RNA isolated from 300,000 initially plated cells was used;
essentially identical results were obtained with each approach. For the
reverse transcription, the RNA was mixed with 500 pmol of random
hexamers (Boehringer Mannheim) in a volume of 20 µl, incubated at
95°C for 2 min, and then placed on ice. Then a stock solution was
added such that the final reaction volume of 30 µl contained 200 U of
Superscript, 500 µM dNTPs, 40 U of RNAsin, and 1×
reaction buffer (Life Technologies). The solution was incubated at
20°C for 10 min and at 42°C for 50 min, and the Superscript was
inactivated by heating to 95°C for 2 min. Sufficient cDNA was
synthesized in each reaction for 30 separate PCR analyses.
PCR amplification. Stock PCR reaction mixtures (50 µl)
were prepared on ice and contained 50 µM dCTP, 100 µM each of dGTP, dATP, and dTTP, 10 µCi of dCTP (3000 Ci/mmol), 1.5 mM MgCl2, 1× reaction
buffer (Life Technologies), 1 µM each primer, 1 U of Taq polymerase (Life Technologies), and 1/30th of the cDNA
synthesized in the reverse transcription. Then the stock solutions were
separated into three 14 µl aliquots that were covered with a drop of
mineral oil and subjected to various numbers of cycles of PCR. The use of multiple cycles allowed us to determine the minimum number of cycles
necessary to detect PCR product and thereby stay within the linear
region of PCR amplification. Typical reaction conditions were 1 min at
94°C, 1 min at 55°C, and 2 min at 72°C. After
amplification, the cDNAs were separated by polyacrylamide gel
electrophoresis and visualized by autoradiography of the dried gels or
by PhosphorImager technology (Molecular Dynamics, Sunnyvale,
CA).
The sequences of the primers used in this study included the following:
cyclophilin sense primer, 5 ATG GTC AAC CCC ACC GTG TT 3
and cyclophilin antisense primer, 5 CGT GTG AAG TCA CCA CCC
T 3 (204 bp product); neurofilament M
(NFM) sense primer, 5 ACG CTG GAC TCG CTG GGC AA 3
and NFM antisense primer, 5 GCG AGC GCG CTG CGC TTG TA 3
(156 bp product); NSE sense primer, 5 ATC TTG GAC TCC CGT
GGG AA 3 and NSE antisense primer, 5 TTT GGC AGT ATG GAG
ATC CA 3 (54 bp product); GFAP sense primer, 5 GCG CTC AAT
GCC GGC TTC AA 3 and GFAP antisense primer, 5 TTC TCG ATG
TAG CTA GCA AA 3 (88 bp product); c-jun sense primer, 5
ACT CAG TTC TTG TGC CCC AA 3 and c-jun antisense primer, 5 CGC ACG AAG CCT TCG GCG AA 3 (64 bp product); junB sense
primer, 5 GGG AAT TCA AAC CCA CCT TGG CGC TCA A 3 and junB
antisense primer, 5 GCG GAT CCG GAC CCT TGA GAC CCC GAT A 3 (69 bp
product); junD sense primer, 5 GGG AAT TCA GGC TGA TCA TCC
AGT CCA A and junD antisense primer, 5 GGG GAT CCG CCA CCT
TCG GGT AGA GGA A 3 (128 bp product); c-fos sense primer,
5 AAT AAG ATG GCT GCA GCC AA and c-fos antisense primer, 5
TTG GCA ATC TCG GTC TGC AA 3 (116 bp product); fosB sense
primer, 5 GAG ATC GCC GAG CTG CAA AA 3 and fosB antisense
primer, 5 TTG TGG GCC ACC AGG ACA AA 3 (58 bp product);
fra1 sense primer, 5 GCC TTG AGC TGG TGC TGG AA 3 and
fra1 antisense primer, 5 ATG CAG TGC TTC CGG TTC AA 3 (175 bp product); transin sense primer, 5 GGG AAT TCC TTT CCA
GGT TCA CCC AA 3 and transin antisense primer, 5 GCG GAT
CCT TCA GAG ATC CTG GAG AA 3 (172 bp product); amyloid- protein precursor (APP) sense primer, 5 CACCACAGAGTCTGTGGAAG and APP antisense primer, 5
AGGTGTCTCGAGATACTTGT (these primers flank an alternative splice site
such that APP695 produces an 87 bp product,
APP751 produces a 255 bp fragment, and
APP770 produces a 312 bp product) (Golde et al.,
1990 ). The identity of the amplified cDNAs was confirmed typically
either by subcloning and then sequencing from the vector (some of the
oligos contain restriction sites to facilitate subcloning) or, more
recently, by direct sequencing, which was facilitated by purifying the
cDNA by using a purification kit (Qiagen). We validated this RT-PCR
assay in initial studies by showing that the PCR product yields were
linear with respect to input RNA (Estus, 1997 ) and that the technique
could be used to detect gene inductions in neuronal cultures, i.e.,
HSP70 in a heat-shock paradigm (Estus, 1997 ) and immediate early and
delayed early gene inductions in NGF-treated PC12 cells (data not
shown). Where shown, differences in gene expression were analyzed
statistically by ANOVA comparison of treated versus control samples
with a post hoc Fisher Protected Least Significant
Difference (PLSD) Test for significance (StatView version 4.5, Abacus
Concepts, Calabasas, CA).
In situ hybridization. Cells were maintained on
polyethyleneimine-coated 16-well chamber slides, treated with A for
24 or 48 hr, fixed with 4% paraformaldehyde in PBS for 30 min at room temperature, and processed for in situ hybridization (Wanaka
et al., 1990 ), except that proteinase K treatment was omitted. Slides were hybridized at 55°C for 16-18 hr with 33P-labeled
RNA probes (500,000 cpm/slide) corresponding to rat c-jun or
c-fos (Estus et al., 1994 ). Antisense and sense riboprobes were synthesized by using T7 and T3 RNA polymerases (Stratagene, La
Jolla, CA) and ( -33P)UTP. Sense probes served as
specificity controls. After treatment with ribonuclease and
high-stringency washes, slides were processed for emulsion
autoradiography for 11-14 d. After development of the emulsion, the
cells were stained for 10 min with Hoechst 33258 (1 µg/ml) (Molecular
Probes, Eugene, OR) in water, followed by a 10 min water rinse. Slides
were viewed with phase-contrast, dark-field, and fluorescence
microscopy.
RESULTS
Time course of A toxicity
To define the time course of A toxicity, we quantified cell
viability by three criteria. These assays were performed on neuronal cultures treated in parallel with A or vehicle only, i.e., medium addition. Viability assays included measures of metabolic and membrane
integrity. Metabolic integrity was assessed by both alamarBlue and XTT
reduction, which quantify cellular reducing potential; by these
measures, neuronal viability began to decline at 24 hr of treatment and
approached a minimum by 48 hr. Membrane integrity was assessed by LDH
release, which was lost after metabolic integrity, approaching only
30% of maximal by 48 hr (Fig. 1). We
interpret these data as indicating that A treatment induces a
delayed neuronal cell death wherein a decline in metabolic activity
occurs before disruption of plasma membrane integrity. This temporal
pattern of loss of metabolic and membrane integrity is consistent with the majority of cell death occurring by an apoptotic mechanism.
Fig. 1.
Time course of A neurotoxicity. Cultured rat
cortical neurons were treated with A 1-40 (20 µM, Lot ZK840) for the indicated intervals, and cell
viability was assayed by metabolic integrity (XTT reduction and
alamarBlue reduction) and plasma membrane integrity (LDH release).
Metabolic parameters decrease well before the loss of membrane
integrity. Data are mean ± SD (error bars) values from triplicate
wells and represent typical results obtained with these cells on a
routine basis.
[View Larger Version of this Image (25K GIF file)]
A toxicity manifests the hallmarks of apoptosis
To assess whether the delayed A -mediated neuronal death
manifested other hallmarks of apoptosis, we compared A -treated and control neurons for two characteristic changes in chromatin integrity, i.e., DNA fragmentation and chromatin condensation. These indices were
colocalized by in situ DNA end labeling (Gavrieli et al., 1992 ) and with Hoechst 33258 staining, respectively. After A treatment, large numbers of neurons manifested punctate and fragmented chromatin, changes that were not seen in control samples (Fig. 2A-D). Hence, our
results agree with those of others (Forloni et al., 1993 ; Loo et al.,
1993 ; Gschwind and Huber, 1995 ), in that the A -induced neuronal
death as described here manifests apoptotic characteristics.
Fig. 2.
A toxicity manifests the hallmarks of
apoptosis. Cortical neuron preparations were treated with medium change
alone (A, B) or A 1-40 (40 µM, lot ZM482) for 24 hr (C, D) and then
assessed for chromatin integrity as discerned by Hoechst 33258 staining (A, C) and by DNA end labeling (B, D).
The incidence of neurons manifesting punctate and fragmented chromatin
is much higher in A -treated neurons; note that neurons that manifest
punctate chromatin also display an increased amount of fragmented DNA,
as assessed by DNA end labeling.
[View Larger Version of this Image (135K GIF file)]
Time-dependent changes in gene expression during
A treatment
To begin the analysis of A -induced changes in gene expression
over time, we established a baseline by quantifying changes in the
expression of cellular markers: cyclophilin, expressed constitutively
in all cell types; MAP-2, NSE, NFM, and PGP9.5, mRNAs unique to
neurons; and GFAP, a marker for astrocytes, one of the non-neuronal
cell types in the cultures. The resultant PCR data indicate that,
although the neuronal mRNAs decreased with A treatment, the levels
of GFAP showed a modest increase (Fig.
3A) consistent with the notion
that, as the neurons died, a greater proportion of the RNA was derived
from non-neuronal cells in the culture.
Fig. 3.
Time course of mRNA expression
in rat cortical cultures undergoing A -mediated neuronal apoptosis.
A, Cellular marker genes. B, Jun and Fos
family members and related genes. C, Quantification of
changes in NSE, c-jun,
c-fos, and transin expression. To assess changes in mRNA levels, we maintained primary rat cortical cultures (~125,000 neurons/well) for 3-4 d and then treated them with
A 1-40 (40 µM, lot ZM482), as described in
Materials and Methods. After various times of A treatment, total RNA
was isolated, aliquots were converted to cDNA, and then 3% of the
resultant cDNA was analyzed in each PCR sample. The data presented are
from a single preparation of neuronal cultures, which were maintained
and treated in parallel with those described in Figure 1. Each gene
induction was confirmed in at least two independent neuronal culture
preparations.
[View Larger Version of this Image (37K GIF file)]
We have identified previously a cascade of gene induction in rat
sympathetic neurons undergoing apoptosis after trophic factor deprivation (Estus et al., 1994 ). To evaluate the expression of these
genes during A treatment, we compared their patterns of expression
with those of the baseline marker genes. In marked contrast to the
baseline genes, the prototype immediate early genes c-jun
and c-fos were induced markedly after A treatment, beginning at 12 and 24 hr, respectively (Fig. 3B,C). Among
other Jun and Fos family members, junB and fosB
also were induced markedly, whereas junD and
fra-1 were induced only modestly, each after the
c-jun induction. The c-jun results per se confirm
those of Anderson et al. (1995) . The results overall are strikingly
similar to the changes we observed in NGF-deprived sympathetic neurons in that the inductions of these "immediate early genes" occur many
hours after A treatment, and the induction of c-jun
precedes that of the other genes.
To assess indirectly whether these induced genes produce functional
protein, we quantified the expression of a prototype target gene of
c-Jun/c-Fos heterodimers, i.e., transin (Angel and Karin, 1991 ; Cochran, 1993 ), which encodes an extracellular matrix protease (McDonnell et al., 1990 ). Indeed, transin was induced,
beginning after c-fos (Fig. 3B,C) and peaking at
48 hr. We also quantified the expression of the three primary mRNAs
encoding the APP (APP695, APP751, and APP770). Because the APP promotor
has been reported to be activated by c-Jun (Trejo et al., 1994 ), this
raises the possibility that A exposure leads to increased APP mRNA
and protein and thereby more A , in a feed-forward cycle. However,
this possibility was not supported by the data, because no increase was
detected in the levels of any of the APP transcripts (Fig.
3B). These results indicate that A treatment leads to an
increase in several transcription factors and a selective increase in a
known target gene of these transcription factors. When these data are
quantified, three waves of gene induction are observed, beginning with
c-jun, followed by a group of genes that are nearly
simultaneous with c-fos, and then transin (Fig.
3C). Comparison of the temporal pattern of A -mediated
gene induction relative to the time course of neurotoxicity (Fig. 1)
reveals that the first two waves precede dramatic changes in neuronal
viability. The third wave, represented by transin, begins
during the decline in metabolic parameters and peaks as cells begin to
lose membrane integrity. These results are consistent with the
possibility that these gene inductions are involved with the neuronal
"decision" to die.
Dose-response relationship of gene induction and neuronal
cell death
To begin to evaluate whether A -induced apoptosis and immediate
early gene induction may be separable events, we examined whether they
displayed a similar dependence on A concentration and aggregation;
after neurons were treated with 5, 10, 20, or 40 µM A
for varying intervals, we quantified A aggregation state, neuronal
death, and mRNA levels. A neurotoxicity was concentration-dependent; although little toxicity was observed in preparations treated with 5 µM A for up to 72 hr, neuronal viability decreased
earlier and more completely with increasing A concentrations (Fig.
4A). This difference in
neurotoxicity correlated with A aggregation state because the rate
and extent of A aggregation were also concentration-dependent (Fig.
4B); aggregation continued through the time course of
the experiment. Changes in gene expression were quantified in neurons
treated in parallel. The magnitude of the inductions of the
Jun and Fos family members showed a strong correlation with A
concentration (Fig. 4C-E). For c-fos,
fosB, and junB, the timing of the
induction was also concentration-dependent, beginning earlier with
increasing A concentration and correlating approximately with
declining neuronal viability (Fig. 4A,C,E). In
contrast, whereas the magnitude of c-jun
induction was also concentration-dependent, the trend of the
timing of c-jun induction was less
concentration-dependent, because c-jun levels began to increase significantly beginning 12 hr after treatment with A at
concentrations >5 µM. In summary, because the gene
inductions and neuronal toxicity were overall similarly dependent on
A concentration, we interpret these data as consistent with the
possibility that these gene inductions may be causally involved with
neuronal death.
Fig. 4.
Gene induction and death are dependent on A
concentration. Cortical neuronal cultures were treated with
A 1-40 (lot ZM605) for the indicated concentrations and
times. Viability was determined by measuring alamarBlue reduction
(A) and A aggregation assessed by changes in
ThT fluorescence (B). Changes in gene expression were assessed by RT-PCR (C), with quantification
for c-jun (D) and
c-fos (E). Values for the
alamarBlue and ThT assays are expressed as mean ± SD (error bars)
from triplicate wells, whereas those for c-jun and
c-fos inductions are the mean ± SE (error bars) from triplicate determinations. The induction of c-jun,
junB, c-fos, fosB,
transin, and death shows a strong dependence on A concentration and aggregation. The induction of c-jun
was significant (p < 0.05) for 5 µM A at the 48 and 72 hr time points and at every time
point after 6 hr for the higher A concentrations. The induction of
c-fos was significant at 72 hr for 5 µM
A , at 48 and 72 hr for 10 and 20 µM A , and at 24, 48, and 72 hr for 40 µM A [ANOVA comparison of
A -treated vs control samples (n = 3), with
post hoc Fisher PLSD test].
[View Larger Version of this Image (46K GIF file)]
Neuronal death and gene induction are dependent on
A aggregation
A second means to test the association between A toxicity and
altered gene expression was to examine directly whether they were both
dependent on A aggregation. Neurons were treated with A that was
dissolved initially in water (which promotes subsequent aggregation) or
DMSO (which delays subsequent aggregation). After this initial
solvation, the A was diluted to 40 µM in medium as per
our usual protocol; to control for possible effects of trace amounts of
DMSO, we added DMSO back to the water-solvated samples such that the
final concentration of DMSO was equal to that of samples treated with
DMSO-solvated A . We then quantified neuronal death, A
aggregation, and mRNA levels. This paradigm confirmed a previous
observation that A neurotoxicity was dependent on A aggregation
(Fig. 5A) (Pike et al., 1991 ;
Simmons et al., 1994 ). Changes in gene expression were examined in RNA
isolated from neurons treated in parallel. This analysis revealed that c-jun, c-fos, junB, fosB,
and transin were induced only in samples treated with
aggregated A and not in samples treated with nonaggregated A
(Fig. 5B,C). Although a transient rise in c-jun
and c-fos was observed 3 hr after replacement of the tissue
culture medium, the sustained induction of the immediate early genes
was observed only after treatment with aggregated A (Fig.
5C).
Fig. 5.
mRNA induction correlates with A aggregation
and A neurotoxicity. Changes in neuronal viability and A
aggregation (A) and gene expression (B,
C) were assessed in neurons treated with A 1-40 (40 µM, lot ZM605) solvated initially in either water or
DMSO. Values for the alamarBlue and ThT assays are expressed as
mean ± SD (error bars) from triplicate wells. Similar results
were observed in at least two independent neuronal culture
preparations.
[View Larger Version of this Image (29K GIF file)]
Immediate early gene induction is attributable to
enhanced transcription
Because inhibition of protein synthesis, which might occur in
dying neurons, increases immediate early gene mRNA levels by mRNA
stabilization (Greenberg et al., 1986 ), we evaluated whether increases
in the mRNA for c-fos, a prototype immediate early gene, were attributable to increases in transcription or stabilization. Because increased transcription, but not mRNA stabilization, leads to
an increase in heteronuclear RNA (hnRNA), we compared the induction patterns of c-fos hnRNA and c-fos mRNA; RT-PCR
was performed by using a pair of c-fos oligos designed such
that the PCR product spanned an intron in hnRNA (Fig.
6). We found that c-fos hnRNA and c-fos mRNA were enhanced in a parallel manner, strongly
suggesting that the increase in immediate early gene mRNA levels is
attributable, at least partially, to increased transcription.
Fig. 6.
Enhanced immediate early gene levels appear to be
derived from increased transcription. To assess whether induction of a
prototype immediate early gene, c-fos, resulted from
increased transcription or mRNA stabilization, we designed
c-fos oligos such that the PCR product spanned an intron
in hnRNA (A). After A 1-40 treatment (40 µM, lot ZM605), c-fos
heteronuclear RNA (hnRNA) and c-fos
mature mRNA were induced in parallel, as revealed by the autoradiograms
(B) and PhosphorImager quantitation
(C). That the hnRNA-associated PCR product was
not a result of contaminating genomic DNA was demonstrated by showing
that no product was detected in the absence of reverse transcription
(data not shown). The parallel nature of the hnRNA and mRNA inductions
indicates that enhanced transcription likely contributes to
c-fos induction.
[View Larger Version of this Image (17K GIF file)]
In situ analyses of gene expression and
chromatin condensation
Although the cortical preparations are nearly pure neuronal
cultures, we used in situ hybridization to verify that two
representative genes, i.e., c-jun and c-fos, were
expressed in neurons and not in the small number of astrocytes and,
potentially, microglia, contaminating the cultures. This approach also
allowed us to assess the heterogeneity of neuronal expression. To
visualize chromatin, we stained neuronal cultures with Hoechst 33258. A treatment led to a widespread induction of c-jun (Fig.
7A,B). In contrast, the
A -induced increase in c-fos was restricted to a subset of neurons (Fig. 7C,D). Closer examination (Fig.
7E-H) revealed that the chromatin of
c-fos-positive neurons was not distributed uniformly, i.e.,
chromatin condensation was observed in 79 ± 1% of
c-fos-positive cells (mean ± range, two separate
experiments, 230 cells scored in total). However, many cells with
abnormal chromatin were not positive for c-fos expression,
suggesting that c-fos expression was not an obligate step in
chromatin condensation (Fig. 7E-H). Thus,
c-jun mRNA was expressed for extended periods in neurons undergoing A treatment, whereas c-fos mRNA was induced
transiently in a subset of neurons, frequently those with chromatin
condensation.
Fig. 7.
Patterns of c-jun and
c-fos induction in situ. Cultures were
analyzed for c-jun (A, B) or
c-fos (C-H) expression by
performing in situ hybridization and for chromatin
integrity by staining with Hoechst 33258. Cultures were treated with
A 1-40 (40 µM, lot ZM605) for 48 hr
(A, C, E-H) or treated with medium change only (B, D). The depicted images represent
dark-field-and-fluorescence (A-E, G) or fluorescence
(F, H) microscopy. The neurons depicted in
E and G are shown again in
F and H, respectively; the
arrows indicate c-fos-positive neurons
and their associated chromatin. A-D originally were
magnified 200×, whereas E and F were
magnified 400×. Sense cRNA probes did not label above background.
These results were replicated in at least two separate neuronal
preparations. These genes also were induced at 24 hr after A
treatment (data not shown).
[View Larger Version of this Image (85K GIF file)]
DISCUSSION
In the studies reported here, we have established a strong
correlation among A aggregation, altered gene expression, and A -induced neuronal apoptosis. As such, these results constitute the
second stage in ongoing efforts aimed at elucidating patterns of gene
expression in neurons undergoing apoptosis that may be regarded as
physiologically appropriate, e.g., induced by trophic factor
deprivation (Estus et al., 1994 ), or physiologically inappropriate, e.g., induced by neurotoxic insult (this study). We anticipate that
elucidating these genetic patterns will contribute to our understanding
of basic developmental processes as well as potential mechanisms
leading to neurodegenerative disease.
Indeed, the import of the work described here rests partially on the
relevance of A aggregates to AD, which is indicated by several
observations, including (1) A has been reported to induce apoptosis
(Forloni et al., 1993 ; Loo et al., 1993 ; Gschwind and Huber, 1995 ) and
necrosis (Behl et al., 1994a ) in neurons in vitro, and this
A neurotoxicity depends on A aggregation (Pike et al., 1991 ;
Simmons et al., 1994 ); (2) A aggregates accumulate in senile plaques
found throughout the neocortex in AD; (3) that A aggregation may
actually be causal in AD is suggested by findings that the known
mutations associated with familial Alzheimer's disease all lead to an
increased production of the more amyloidogenic A 1-42
(Citron et al., 1992 ; Cai et al., 1993 ; Suzuki et al., 1994 ; Scheuner
et al., 1996 ). Further support for a role of aggregated A in AD-like
pathology comes from the findings that transgenic mice that express
high levels of mutant human A precursor protein (APP with valine at
residue 717 substituted by phenylalanine) manifest a phenotype that
includes senile plaques and neuropathology markedly similar to that
observed in AD (Games et al., 1995 ), and transgenic mice
overexpressing the 695-amino acid isoform of human APP containing
a Lys670 Asn, Met671 Leu
familial AD mutation manifest a phenotype that includes senile plaques
and memory deficits (Hsiao et al., 1996 ). Considered together, these
data implicate aggregated A as critical to AD in that aggregated A accumulates in AD brain in vivo, aggregated A
induces neuronal cell death in vitro, and production of A
with a propensity to aggregate cosegregates with susceptibility to AD
in humans or AD-like pathology in vivo. Hence, elucidating
the patterns of altered gene expression induced during A
neurotoxicity may contribute to our understanding of AD.
A -treated neuronal preparations manifest several trends in gene
expression patterns that are markedly similar to those observed in
NGF-deprived sympathetic neurons. The first general trend is the
delayed but widespread induction of immediate early gene transcription factors. For NGF-deprived neurons, death begins at ~24 hr, as quantified by crystal violet staining. The induction of
c-jun begins within 5 hr and is followed by
c-fos, fosB, and junB and other genes
at 15 hr (Deckwerth and Johnson, 1993 ; Estus et al., 1994 ). After A
treatment, death begins at ~36-48 hr, as determined by LDH release,
the induction of c-jun begins within 12 hr, and that is
followed by c-fos, fosB, and junB
beginning at 24 hr (Figs. 1, 3). A further similarity between both
models, and an indication that these mRNAs are translated into
functional protein, was the induction after c-fos of a
target gene of c-Jun/c-Fos heterodimers, i.e., transin,
which encodes an extracellular matrix protease (McDonnell et al.,
1990 ). Because we previously implicated c-Jun as well as the Fos family
as necessary for neuronal apoptosis by using microinjected,
neutralizing antibodies (Estus et al., 1994 ), and Ham and coworkers
confirmed our results regarding c-Jun (Ham et al., 1995 ), these results
are suggestive that these gene inductions may be relevant to neuronal
death.
The second trend identified by two separate lines of evidence was that
the c-jun induction correlated with initial neuronal responses to A , whereas the c-fos induction, as well as
genes coinduced with c-fos temporally, correlated with later
stage(s) of apoptosis. First, whereas the c-jun induction
began 12-24 hr after A treatment, the timing, as well as the
magnitude, of the induction of c-fos, fosB, and
junB showed a much greater dependence on A concentration;
the induction of these later genes coincided more closely with
declining neuronal viability. Second, the in situ
hybridization studies showed that c-jun is induced in most neurons and that this induction is independent of overt signs of
toxicity, i.e., chromatin changes. In contrast, the induction of
c-fos, and presumably genes coinduced temporally, was
restricted mainly to neurons with condensed chromatin, a hallmark of
apoptosis. Hence, c-jun generally was induced in a
widespread manner and well before overt signs of neuronal toxicity.
This suggests that c-jun expression may be more predictive
of impending apoptosis than of apoptosis itself; alternatively, if
c-Jun proves necessary for A -induced death, c-Jun may act by
accumulating over time, eventually reaching a threshold level that
leads to the induction of later genes and concomitant loss of
viability. This possibility is consistent with the observations of
others regarding c-Jun reaching a critical level sufficient to act as a
transcription factor (Trejo et al., 1992 ). Overall, c-jun is
induced in most neurons before changes in viability, whereas
c-fos is induced concomitant with an end stage of neuronal
apoptosis.
The third trend discerned from these data is that A aggregation per
se is critical to changes in neuronal gene expression and resulting
death; gene induction and neuronal cell death were not observed in
cultures treated with nonaggregated A . Hydrogen peroxide and free
radical production have been implicated in mediating A neurotoxicity
in cultured neurons (Behl et al., 1994b ; Hensley et al., 1994 ; Schubert
et al., 1995 ), although quite recent studies indicate metabolic stress
rather than oxidative stress as more likely to contribute to the cell
death after exposure of neurons to A (Zhang et al., 1996 ). Cellular
stress is known to activate the Jun kinase (JNK) pathway (Kyriakis et
al., 1994 ), and JNK activation has been reported to mediate neuronal
apoptosis (Xia et al., 1995 ). We hypothesize that stress mediated by
aggregated A leads to JNK activation, which in turn phosphorylates
cytoplasmic c-Jun, causing its activation and nuclear translocation,
and subsequent activation of c-jun transcription. Current
studies are addressing the role of JNK in A -mediated neuronal
apoptosis and identifying additional genes that may be involved more
directly in neuronal cell death.
The temporal pattern of the immediate early gene response associated
with A -mediated neuronal apoptosis is remarkably similar to the
immediate early gene response associated with neuronal apoptosis after
NGF withdrawal. These findings demonstrate that similar genetic
alterations are associated with markedly different apoptotic insults
(toxic insult to cortical neurons and trophic factor deprivation of
sympathetic neurons). Indeed, the results reported here lend further
support that A neurotoxicity in vitro is relevant to AD
pathology in vivo; the induction of c-jun and c-fos by A in vitro is consistent with the
observation that c-Jun and c-Fos expression are induced in
tangle-bearing neurons in AD (Anderson et al., 1994 ). Hence, the
elucidation of molecular mechanisms underlying neuronal cell death in
these model systems will likely contribute to our understanding of PCD
and the development of therapeutic strategies for the treatment of
neurodegenerative diseases such as AD.
FOOTNOTES
Received June 19, 1997; accepted July 29, 1997.
This work was supported by grants (to S.E.) from the Alzheimer's
Association (Mr. Darrell Phillippi Pilot Research Grant), National
Institutes of Health (NS35607), and the University of Kentucky. We
thank F. Bard and G. Basi for helpful discussions and for assistance
with the apoptotic characterization of neuronal cell death; we also
thank F. Bard, E. M. Johnson, I. Lieberburg, P. A. K. Osborne, D. Schenk, and D. Selkoe for critically reviewing this
manuscript.
Correspondence should be addressed to Dr. Steven Estus, Department of
Physiology, Sanders-Brown Center on Aging, University of Kentucky, 800 South Limestone, Lexington, KY 40536-0230, or to Dr. Russell E. Rydel,
Athena Neurosciences, 800 Gateway Boulevard, South San Francisco, CA
94080.
REFERENCES
-
Anderson AJ,
Cummings BJ,
Cotman CW
(1994)
Increased immunoreactivity for Jun- and Fos-related proteins in Alzheimer's disease: association with pathology.
Exp Neurol
125:286-295[Web of Science][Medline].
-
Anderson AJ,
Pike CJ,
Cotman CW
(1995)
Differential induction of immediate early gene proteins in cultured neurons by
-amyloid (A ): association of c-jun with A -induced apoptosis.
J Neurochem
65:1487-1498[Web of Science][Medline]. -
Angel P,
Karin M
(1991)
The role of Jun, Fos, and the Ap-1 complex in cell proliferation and transformation.
Biochim Biophys Acta
1072:129-157[Medline].
-
Behl C,
Davis JB,
Klier FG,
Schubert D
(1994a)
Amyloid beta peptide induces necrosis rather than apoptosis.
Brain Res
645:254-264.
-
Behl C,
Davis JB,
Lesley R,
Schubert D
(1994b)
Hydrogen peroxide mediates amyloid beta protein toxicity.
Cell
77:817-827[Web of Science][Medline].
-
Bredesen DE
(1995)
Neural apoptosis.
Ann Neurol
38:839-851[Web of Science][Medline].
-
Brewer GJ,
Torricelli JR,
Evege EK,
Price PJ
(1993)
Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination.
J Neurosci Res
35:567-576[Web of Science][Medline].
-
Cai XD,
Golde TE,
Younkin SG
(1993)
Release of excess amyloid beta protein from a mutant amyloid beta protein precursor.
Science
259:514-516[Abstract/Free Full Text].
-
Citron M,
Oltersdorf T,
Haass C,
McConlogue L,
Hung AY,
Seubert P,
Vigo-Pelfrey C,
Lieberburg I,
Selkoe DJ
(1992)
Mutation of the beta-amyloid precursor protein in familial Alzheimer's disease increases beta-protein production.
Nature
360:672-674[Medline].
-
Clarke PG
(1990)
Developmental cell death: morphological diversity and multiple mechanisms.
Anat Embryol (Berl)
181:195-213[Medline].
-
Cochran BH
(1993)
Regulation of immediate early gene expression.
NIDA Res Monogr
125:3-24[Medline].
-
Deckwerth TL,
Johnson Jr EM
(1993)
Temporal analysis of events associated with programmed cell death (apoptosis) of sympathetic neurons deprived of nerve growth factor (NGF).
J Cell Biol
123:1207-1222[Abstract/Free Full Text].
-
Dragunow M,
Faull RLM,
Lawlor P,
Beilharz EJ,
Singleton K,
Walker EB,
Mee E
(1995)
In situ evidence for DNA fragmentation in Huntington's disease striatum and Alzheimer's disease.
NeuroReport
6:1053-1057[Web of Science][Medline].
-
Estus S
(1997)
Optimization and validation of RT-PCR as a tool to analyze apoptotic gene expression.
In: NeuroMethods 29: apoptosis techniques and protocols (Poirier J,
ed), pp 67-84. Totowa, NJ: Humana.
-
Estus S,
Zaks W,
Freeman R,
Gruda M,
Bravo R,
Johnson E
(1994)
Altered gene expression in neurons during programmed cell death: identification of c-jun as necessary for neuronal apoptosis.
J Cell Biol
127:1717-1727[Abstract/Free Full Text].
-
Estus S,
van Rooyen C,
Mattson M,
Brigham EF,
Rydel RE
(1995)
Comparison of altered gene expression during neuronal death induced by NGF withdrawal, amyloid
-protein treatment, or glucose deprivation.
Soc Neurosci Abstr
21:1721. -
Estus S,
van Rooyen C,
Tucker HM,
Wright S,
Brigham EF,
Rydel RE
(1996)
Altered gene expression during neuronal death induced by amyloid
-protein treatment.
Soc Neurosci Abstr
22:2114. -
Forloni G,
Chiesa R,
Smiroldo S,
Verga L,
Salmona M,
Tagliavini F,
Angeretti N
(1993)
Apoptosis-mediated neurotoxicity induced by chronic application of
amyloid fragment 25-35.
NeuroReport
4:523-526[Web of Science][Medline]. -
Freeman RS,
Estus S,
Horigome K,
Johnson Jr EM
(1993)
Cell death genes in invertebrates and (maybe) vertebrates.
Curr Opin Neurobiol
3:25-31[Medline].
-
Freeman RS,
Estus S,
Johnson Jr EM
(1994)
Analysis of cell cycle-related gene expression in postmitotic neurons: selective induction of cyclin D1 during programmed cell death.
Neuron
12:343-355[Web of Science][Medline].
-
Games D,
Adams D,
Alessandrini R,
Barbour R,
Berthelette P,
Blackwell C,
Carr T,
Clemens J,
Donaldson T,
Gillespie F
(1995)
Alzheimer-type neuropathology in transgenic mice overexpressing V717F beta-amyloid precursor protein.
Nature
373:523-527[Medline].
-
Gavrieli Y,
Sherman Y,
Ben-Sasson SA
(1992)
Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation.
J Cell Biol
119:493-501[Abstract/Free Full Text].
-
Golde TE,
Estus S,
Usiak M,
Younkin LH,
Younkin SG
(1990)
Expression of beta amyloid protein precursor mRNAs: recognition of a novel alternatively spliced form and quantitation in Alzheimer's disease using PCR.
Neuron
4:253-267[Web of Science][Medline].
-
Goto K,
Ishige A,
Sekiguchi K,
Iizuka S,
Sugimoto A,
Yuzurihara M
(1990)
Effects of cycloheximide on delayed neuronal death in rat hippocampus.
Brain Res
534:299-302[Web of Science][Medline].
-
Greenberg ME,
Hermanowski AL,
Ziff EB
(1986)
Effect of protein synthesis inhibitors on growth factor activation of c-fos, c-myc, and actin gene transcription.
Mol Cell Biol
6:1050-1057[Abstract/Free Full Text].
-
Gschwind M,
Huber G
(1995)
Apoptotic cell death induced by
-amyloid 1-42 peptide is cell type-dependent.
J Neurochem
65:292-300[Web of Science][Medline]. -
Ham J,
Babij C,
Whitfield J,
Pfarr CM,
Lallemand D,
Yaniv M,
Rubin LL
(1995)
A c-Jun dominant negative mutant protects sympathetic neurons against programmed cell death.
Neuron
14:927-939[Web of Science][Medline].
-
Hensley K,
Carney JM,
Mattson MP,
Aksenova M,
Harris M,
Wu JF,
Floyd RA,
Butterfield DA
(1994)
A model for beta-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease.
Proc Natl Acad Sci USA
91:3270-3274[Abstract/Free Full Text].
-
Hsiao K,
Chapman P,
Nilsen S,
Eckman C,
Harigaya Y,
Younkin S,
Yang F,
Coel G
(1996)
Correlative memory deficits, A
elevation, and amyloid plaques in transgenic mice.
Science
274:99-102[Abstract/Free Full Text]. -
Kyriakis JM,
Banerjee P,
Nikolakaki E,
Dai T,
Rubie EA,
Ahmad MF,
Avruch J,
Woodgett JR
(1994)
The stress-activated protein kinase subfamily of c-Jun kinases.
Nature
369:156-160[Medline].
-
Lassmann H,
Bancher C,
Breitschopf H,
Wegiel J,
Bobinski M,
Jellinger K,
Wisniewski HM
(1995)
Cell death in Alzheimer's disease evaluated by DNA fragmentation in situ.
Acta Neuropathol (Berl)
89:35-41[Medline].
-
LeVine H
(1993)
Thioflavine T interaction with synthetic Alzheimer's disease beta-amyloid peptides: detection of amyloid aggregation in solution.
Protein Sci
2:404-410[Web of Science][Medline].
-
Linnik MD,
Zobrist RH,
Hatfield MD
(1993)
Evidence supporting a role for programmed cell death in focal cerebral ischemia in rats.
Stroke
24:2002-2009[Abstract/Free Full Text].
-
Loo DT,
Copani A,
Pike CJ,
Whittemore ER,
Walencewicz AJ,
Cotman CW
(1993)
Apoptosis is induced by
-amyloid in cultured central nervous system neurons.
Proc Natl Acad Sci USA
90:7951-7955[Abstract/Free Full Text]. -
MacManus JP,
Buchan AM,
Hill IE,
Rasquinha I,
Preston E
(1993)
Global ischemia can cause DNA fragmentation indicative of apoptosis in rat brain.
Neurosci Lett
164:89-92[Web of Science][Medline].
-
MacManus JP,
Hill IE,
Huang ZG,
Rasquinha I,
Xue D,
Buchan AM
(1994)
DNA damage consistent with apoptosis in transient ischaemic neocortex.
NeuroReport
5:493-496[Web of Science][Medline].
-
Martin DP,
Schmidt RE,
DiStefano PS,
Lowry OH,
Carter JG,
Johnson Jr EM
(1988)
Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation.
J Cell Biol
106:829-844[Abstract/Free Full Text].
-
McDonnell SE,
Kerr LD,
Matrisian LM
(1990)
Epidermal growth factor stimulation of stromelysin mRNA in rat fibroblasts requires induction of proto-oncogenes c-fos and c-jun and activation of protein kinase C.
Mol Cell Biol
10:4284-4293[Abstract/Free Full Text].
-
Oppenheim RW
(1991)
Cell death during development of the nervous system.
Annu Rev Neurosci
14:453-501[Web of Science][Medline].
-
Oppenheim RW,
Prevette D,
Tytell M,
Homma S
(1990)
Naturally occurring and induced neuronal death in the chick embryo in vivo requires protein and RNA synthesis: evidence for the role of cell death genes.
Dev Biol
138:104-113[Web of Science][Medline].
-
Pike C,
Walencewicz A,
Glabe C,
Cotman C
(1991)
In vitro aging of
-amyloid protein causes peptide aggregation and neurotoxicity.
Brain Res
563:311-314[Web of Science][Medline]. -
Portera-Calliau C,
Hedreen JC,
Price DL,
Koliatsos VE
(1995)
Evidence for apoptotic cell death in Huntington disease and excitotoxic animal models.
J Neurosci
15:3775-3787[Abstract].
-
Scheuner D,
Eckman C,
Jensen M,
Song X,
Citron M,
Suzuki N,
Bird TD,
Hardy J,
Hutton M,
Kukull W,
Larson E,
Levy-Lahad E,
Viitanen M,
Peskind E,
Poorkaj P,
Schellenberg G,
Tanzi R,
Wasco W,
Lannfelt L,
Selkoe D,
Younkin SG
(1996)
Secreted amyloid
-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease.
Nat Med
2:864-870[Web of Science][Medline]. -
Schubert D,
Behl C,
Lesley R,
Brack A,
Dargusch R,
Sagara Y,
Kimura H
(1995)
Amyloid peptides are toxic via a common oxidative mechanism.
Proc Natl Acad Sci USA
92:1989-1993[Abstract/Free Full Text].
-
Selkoe DJ
(1997)
Alzheimer's disease: genotypes, phenotype, and treatments.
Science
275:630-631[Free Full Text].
-
Shigeno T
(1990)
Reduction of delayed neuronal death by inhibition of protein synthesis.
Neurosci Lett
120:117-119[Web of Science][Medline].
-
Simmons LK,
May PC,
Tomaselli KJ,
Rydel RE,
Fuson KS,
Brigham EF,
Wright S,
Lieberburg I,
Becker GW,
Brems DN
(1994)
Secondary structure of amyloid beta peptide correlates with neurotoxic activity in vitro.
Mol Pharmacol
45:373-379[Abstract].
-
Smale G,
Nichols NR,
Brady DR,
Finch CE,
Horton WE
(1995)
Evidence for apoptotic cell death in Alzheimer's disease.
Exp Neurol
133:225-230[Web of Science][Medline].
-
Su JH,
Anderson AJ,
Cummings BJ,
Cotman CW
(1994)
Immunohistochemical evidence for apoptosis in Alzheimer's disease.
NeuroReport
5:2529-2533[Web of Science][Medline].
-
Suzuki N,
Cheung TT,
Cai XD,
Odaka A,
Otvos LJ,
Eckman C,
Golde TE,
Younkin SG
(1994)
An increased percentage of long amyloid beta protein secreted by familial amyloid beta protein precursor (beta APP717) mutants.
Science
264:1336-1340[Abstract/Free Full Text].
-
Trejo J,
Chambard J-C,
Karin M,
Brown JH
(1992)
Biphasic increase in c-jun mRNA is required for induction of AP-1-mediated gene transcription: differential effects of muscarinic and thrombin receptor activation.
Mol Cell Biol
12:4742-4750[Abstract/Free Full Text].
-
Trejo J,
Massamiri T,
Deng T,
Dewji NN,
Bayney RM,
Brown JH
(1994)
A direct role for protein kinase C and the transcription factor Jun/AP-1 in the regulation of the Alzheimer's beta-amyloid precursor protein gene.
J Biol Chem
269:21682-21690[Abstract/Free Full Text].
-
Wanaka A,
Johnson Jr EM,
Milbrandt J
(1990)
Localization of FGF receptor mRNA in the adult rat central nervous system by in situ hybridization.
Neuron
5:267-281[Web of Science][Medline].
-
Wyllie AH,
Kerr JFR,
Currie AR
(1980)
Cell death: the significance of apoptosis.
Int Rev Cytol
68:251-306[Medline].
-
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME
(1995)
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
-
Zhang Z,
Rydel RE,
Drzewiecki GJ,
Fuson K,
Wright S,
Wogulis M,
Audia JE,
May PC,
Hyslop PA
(1996)
Amyloid
-mediated oxidative and metabolic stress in rat cortical neurons: no direct evidence for a role for H2O2 generation.
J Neurochem
67:1595-1606[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
E. Sturchler, A. Galichet, M. Weibel, E. Leclerc, and C. W. Heizmann
Site-Specific Blockade of RAGE-Vd Prevents Amyloid-{beta} Oligomer Neurotoxicity
J. Neurosci.,
May 14, 2008;
28(20):
5149 - 5158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Galvan, P. G. Camoletto, F. Cristofani, P. P. Van Veldhoven, and M. D. Ledesma
Anomalous Surface Distribution of Glycosyl Phosphatidyl Inositol-anchored Proteins in Neurons Lacking Acid Sphingomyelinase
Mol. Biol. Cell,
February 1, 2008;
19(2):
509 - 522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhu, H. M. Tucker, K. E. Grear, J. F. Simpson, A. K. Manning, L. A. Cupples, and S. Estus
A common polymorphism decreases low-density lipoprotein receptor exon 12 splicing efficiency and associates with increased cholesterol
Hum. Mol. Genet.,
July 15, 2007;
16(14):
1765 - 1772.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Malm, H. Iivonen, G. Goldsteins, V. Keksa-Goldsteine, T. Ahtoniemi, K. Kanninen, A. Salminen, S. Auriola, T. Van Groen, H. Tanila, et al.
Pyrrolidine Dithiocarbamate Activates Akt and Improves Spatial Learning in APP/PS1 Mice without Affecting {beta}-Amyloid Burden
J. Neurosci.,
April 4, 2007;
27(14):
3712 - 3721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Biswas, Y. Shi, J.-P. G. Vonsattel, C. L. Leung, C. M. Troy, and L. A. Greene
Bim Is Elevated in Alzheimer's Disease Neurons and Is Required for {beta}-Amyloid-Induced Neuronal Apoptosis
J. Neurosci.,
January 24, 2007;
27(4):
893 - 900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Abad, M. Enguita, N. DeGregorio-Rocasolano, I. Ferrer, and R. Trullas
Neuronal Pentraxin 1 Contributes to the Neuronal Damage Evoked by Amyloid-{beta} and Is Overexpressed in Dystrophic Neurites in Alzheimer's Brain
J. Neurosci.,
December 6, 2006;
26(49):
12735 - 12747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Qin, C. Colin, I. Hinners, A. Gervais, C. Cheret, and M. Mallat
System Xc- and apolipoprotein E expressed by microglia have opposite effects on the neurotoxicity of amyloid-beta peptide 1-40.
J. Neurosci.,
March 22, 2006;
26(12):
3345 - 3356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-Y. Park and A. Ferreira
The Generation of a 17 kDa Neurotoxic Fragment: An Alternative Mechanism by which Tau Mediates {beta}-Amyloid-Induced Neurodegeneration
J. Neurosci.,
June 1, 2005;
25(22):
5365 - 5375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. L. Malinin, S. Wright, P. Seubert, D. Schenk, and I. Griswold-Prenner
Amyloid-{beta} neurotoxicity is mediated by FISH adapter protein and ADAM12 metalloprotease activity
PNAS,
February 22, 2005;
102(8):
3058 - 3063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wogulis, S. Wright, D. Cunningham, T. Chilcote, K. Powell, and R. E. Rydel
Nucleation-Dependent Polymerization Is an Essential Component of Amyloid-Mediated Neuronal Cell Death
J. Neurosci.,
February 2, 2005;
25(5):
1071 - 1080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yao, T.-V. V. Nguyen, and C. J. Pike
{beta}-Amyloid-Induced Neuronal Apoptosis Involves c-Jun N-Terminal Kinase-Dependent Downregulation of Bcl-w
J. Neurosci.,
February 2, 2005;
25(5):
1149 - 1158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. N. Dong, E. A. Waxman, and D. R. Lynch
Interactions of Postsynaptic Density-95 and the NMDA Receptor 2 Subunit Control Calpain-Mediated Cleavage of the NMDA Receptor
J. Neurosci.,
December 8, 2004;
24(49):
11035 - 11045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Wang, D. M. Walsh, M. J. Rowan, D. J. Selkoe, and R. Anwyl
Block of Long-Term Potentiation by Naturally Secreted and Synthetic Amyloid {beta}-Peptide in Hippocampal Slices Is Mediated via Activation of the Kinases c-Jun N-Terminal Kinase, Cyclin-Dependent Kinase 5, and p38 Mitogen-Activated Protein Kinase as well as Metabotropic Glutamate Receptor Type 5
J. Neurosci.,
March 31, 2004;
24(13):
3370 - 3378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Del Villar and C. A. Miller
Down-regulation of DENN/MADD, a TNF receptor binding protein, correlates with neuronal cell death in Alzheimer's disease brain and hippocampal neurons
PNAS,
March 23, 2004;
101(12):
4210 - 4215.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Li, L. Yang, K. Lindholm, Y. Konishi, X. Yue, H. Hampel, D. Zhang, and Y. Shen
Tumor Necrosis Factor Death Receptor Signaling Cascade Is Required for Amyloid-{beta} Protein-Induced Neuron Death
J. Neurosci.,
February 18, 2004;
24(7):
1760 - 1771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Rau, D. B. Dubal, M. Bottner, and P. M. Wise
Estradiol Differentially Regulates c-Fos after Focal Cerebral Ischemia
J. Neurosci.,
November 19, 2003;
23(33):
10487 - 10494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Minogue, A. W. Schmid, M. P. Fogarty, A. C. Moore, V. A. Campbell, C. E. Herron, and M. A. Lynch
Activation of the c-Jun N-terminal Kinase Signaling Cascade Mediates the Effect of Amyloid-{beta} on Long Term Potentiation and Cell Death in Hippocampus: A ROLE FOR INTERLEUKIN-1{beta}?
J. Biol. Chem.,
July 18, 2003;
278(30):
27971 - 27980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Qahwash, K. L. Weiland, Y. Lu, R. W. Sarver, R. F. Kletzien, and R. Yan
Identification of a Mutant Amyloid Peptide That Predominantly Forms Neurotoxic Protofibrillar Aggregates
J. Biol. Chem.,
June 13, 2003;
278(25):
23187 - 23195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Sponne, A. Fifre, B. Drouet, C. Klein, V. Koziel, M. Pincon-Raymond, J.-L. Olivier, J. Chambaz, and T. Pillot
Apoptotic Neuronal Cell Death Induced by the Non-fibrillar Amyloid-beta Peptide Proceeds through an Early Reactive Oxygen Species-dependent Cytoskeleton Perturbation
J. Biol. Chem.,
January 24, 2003;
278(5):
3437 - 3445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Uchida
Overexpression of Full-length but Not N-terminal Truncated Isoform of Microtubule-associated Protein (MAP) 1B Accelerates Apoptosis of Cultured Cortical Neurons
J. Biol. Chem.,
January 3, 2003;
278(1):
366 - 371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fath, J. Eidenmuller, and R. Brandt
Tau-Mediated Cytotoxicity in a Pseudohyperphosphorylation Model of Alzheimer's Disease
J. Neurosci.,
November 15, 2002;
22(22):
9733 - 9741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Onuki, A. Nagasaki, H. Kawasaki, T. Baba, T. Q. P. Uyeda, and K. Taira
Confirmation by FRET in individual living cells of the absence of significant amyloid beta -mediated caspase 8 activation
PNAS,
November 12, 2002;
99(23):
14716 - 14721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Mattson, S. L. Chan, and W. Duan
Modification of Brain Aging and Neurodegenerative Disorders by Genes, Diet, and Behavior
Physiol Rev,
July 1, 2002;
82(3):
637 - 672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-S. Ji, R. D. Miranda, Y. M. Newhouse, K. H. Weisgraber, Y. Huang, and R. W. Mahley
Apolipoprotein E4 Potentiates Amyloid beta Peptide-induced Lysosomal Leakage and Apoptosis in Neuronal Cells
J. Biol. Chem.,
June 7, 2002;
277(24):
21821 - 21828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Bamberger and G. E. Landreth
Inflammation, Apoptosis, and Alzheimer's Disease
Neuroscientist,
June 1, 2002;
8(3):
276 - 283.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Spencer, H. Shao, and D. A. Andres
Induction of Neurite Extension and Survival in Pheochromocytoma Cells by the Rit GTPase
J. Biol. Chem.,
May 31, 2002;
277(23):
20160 - 20168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Spencer, H. Shao, H. M. Tucker, and D. A. Andres
Nerve Growth Factor-dependent Activation of the Small GTPase Rin
J. Biol. Chem.,
May 10, 2002;
277(20):
17605 - 17615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Okazawa and S. Estus
The JNK/c-Jun cascade and Alzheimer's disease
American Journal of Alzheimer's Disease and Other Dementias,
March 1, 2002;
17(2):
79 - 88.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Williamson, T. Scales, B. R. Clark, G. Gibb, C. H. Reynolds, S. Kellie, I. N. Bird, I. M. Varndell, P. W. Sheppard, I. Everall, et al.
Rapid Tyrosine Phosphorylation of Neuronal Proteins Including Tau and Focal Adhesion Kinase in Response to Amyloid-beta Peptide Exposure: Involvement of Src Family Protein Kinases
J. Neurosci.,
January 1, 2002;
22(1):
10 - 20.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Ermak, T. E. Morgan, and K. J. A. Davies
Chronic Overexpression of the Calcineurin Inhibitory Gene DSCR1 (Adapt78) Is Associated with Alzheimer's Disease
J. Biol. Chem.,
October 12, 2001;
276(42):
38787 - 38794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Morishima, Y. Gotoh, J. Zieg, T. Barrett, H. Takano, R. Flavell, R. J. Davis, Y. Shirasaki, and M. E. Greenberg
{beta}-Amyloid Induces Neuronal Apoptosis Via a Mechanism that Involves the c-Jun N-Terminal Kinase Pathway and the Induction of Fas Ligand
J. Neurosci.,
October 1, 2001;
21(19):
7551 - 7560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. S. De Zutter and R. J. Davis
Pro-apoptotic gene expression mediated by the p38 mitogen-activated protein kinase signal transduction pathway
PNAS,
May 3, 2001;
(2001)
111027698.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Mukherjee, E.-s. Song, M. Kihiko-Ehmann, J. P. Goodman Jr, J. St. Pyrek, S. Estus, and L. B. Hersh
Insulysin Hydrolyzes Amyloid beta Peptides to Products That Are Neither Neurotoxic Nor Deposit on Amyloid Plaques
J. Neurosci.,
December 1, 2000;
20(23):
8745 - 8749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. M. Tucker, M. Kihiko, J. N. Caldwell, S. Wright, T. Kawarabayashi, D. Price, D. Walker, S. Scheff, J. P. McGillis, R. E. Rydel, et al.
The Plasmin System Is Induced by and Degrades Amyloid-beta Aggregates
J. Neurosci.,
June 1, 2000;
20(11):
3937 - 3946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Troy, S. A. Rabacchi, W. J. Friedman, T. F. Frappier, K. Brown, and M. L. Shelanski
Caspase-2 Mediates Neuronal Cell Death Induced by beta -Amyloid
J. Neurosci.,
February 15, 2000;
20(4):
1386 - 1392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Nicholls and S. L. Budd
Mitochondria and Neuronal Survival
Physiol Rev,
January 1, 2000;
80(1):
315 - 360.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. COPANI, F. CONDORELLI, A. CARUSO, C. VANCHERI, A. SALA, A. M. GIUFFRIDA STELLA, P. L. CANONICO, F. NICOLETTI, and M. A. SORTINO
Mitotic signaling by {beta}-amyloid causes neuronal death
FASEB J,
December 1, 1999;
13(15):
2225 - 2234.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. M. Hartley, D. M. Walsh, C. P. Ye, T. Diehl, S. Vasquez, P. M. Vassilev, D. B. Teplow, and Dennis. J. Selkoe
Protofibrillar Intermediates of Amyloid beta -Protein Induce Acute Electrophysiological Changes and Progressive Neurotoxicity in Cortical Neurons
J. Neurosci.,
October 15, 1999;
19(20):
8876 - 8884.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Dubal, P. J. Shughrue, M. E. Wilson, I. Merchenthaler, and P. M. Wise
Estradiol Modulates bcl-2 in Cerebral Ischemia: A Potential Role for Estrogen Receptors
J. Neurosci.,
August 1, 1999;
19(15):
6385 - 6393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Imaizumi, T. Morihara, Y. Mori, T. Katayama, M. Tsuda, T. Furuyama, A. Wanaka, M. Takeda, and M. Tohyama
The Cell Death-promoting Gene DP5, Which Interacts with the BCL2 Family, Is Induced during Neuronal Apoptosis Following Exposure to Amyloid beta Protein
J. Biol. Chem.,
March 19, 1999;
274(12):
7975 - 7981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-N. Wang, C.-W. Chi, Y.-L. Lin, C.-F. Chen, and Y.-J. Shiao
The Neuroprotective Effects of Phytoestrogens on Amyloid beta Protein-induced Toxicity Are Mediated by Abrogating the Activation of Caspase Cascade in Rat Cortical Neurons
J. Biol. Chem.,
February 9, 2001;
276(7):
5287 - 5295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. S. De Zutter and R. J. Davis
Pro-apoptotic gene expression mediated by the p38 mitogen-activated protein kinase signal transduction pathway
PNAS,
May 22, 2001;
98(11):
6168 - 6173.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|