 |
Previous Article | Next Article 
Volume 17, Number 20,
Issue of October 15, 1997
pp. 7881-7889
Copyright ©1997 Society for Neuroscience
Pattern Deformities and Cell Loss in Engrailed-2
Mutant Mice Suggest Two Separate Patterning Events during
Cerebellar Development
Barbara Kuemerle1,
Hadi Zanjani2, 4,
Alexandra Joyner3, and
Karl Herrup1
1 Alzheimer Research Laboratory, Case Western Reserve
Medical School, Cleveland, Ohio 44106, 2 Laboratoire de
Neurobiologie du Developpement, Institut des Neuroscience (Centre
National de la Recherche Scientifique Unité de Recherche
Associée 1488), Université Pierre & Marie Curie, 75005 Paris, France, 3 Skirball Institute of Biomolecular
Medicine, New York University Medical Center, New York, New York 10016, and 4 Physiological Science Department, University of
California at Los Angeles, Los Angeles, California 90095-1527
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Null alleles of the mouse Engrailed-2 gene, a
molecular homolog of the fly gene engrailed, have
demonstrable effects on the anteroposterior (A/P) patterning of
cerebellum as reflected in the disruption of the normal process of
foliation of the cerebellar cortex and the alteration of transgene
expression boundaries in the adult. Engrailed-2 also
affects the transient mediolateral (M/L) pattern of En-1
and Wnt-7b expression seen in late embryogenesis. We
have examined three markers of cerebellar compartmentation in
En-2 mutant mice: the Zebrin II and Ppath monoclonal
antibodies and the transgene L7lacZ. In
En-2 mutants, the normal temporal pattern of expression
is preserved for all three markers, although the size and spatial
location of various bands differ from those of the wild type. Unlike
the foliation abnormalities, the M/L pattern disturbances we have found
occur in nearly all cerebellar regions. Cell counts reveal that all
major cell types of the olivocerebellar circuit are reduced by
30-40%. We propose that these results are best explained by a model
in which the Engrailed-2 gene is involved in the early
specification of the cerebellar field including the number of
progenitors. Because each of these progenitors gives rise to a clone of
defined size, Engrailed-2 helps specify adult cell
number. We further postulate that the configuration of the seven Zebrin
bands as well as the shapes and locations of the cerebellar lobules are
set up by a second patterning event that occurs after neurogenesis is
complete.
Key words:
Purkinje cell;
deep cerebellar nuclei;
inferior olive;
L7;
Zebrin;
compartments
INTRODUCTION
A fundamental characteristic of the
cerebellum in all vertebrates is its regionalization into zones with
distinct biochemical, genetic, and physiological traits (Wassef et al.,
1985 , 1987 , 1992 ; Hawkes and Leclerc, 1987 ; Oberdick et al., 1990 ,
1993 ; Hawkes and Gravel, 1991 ; Millen et al., 1995 ; Hawkes and Herrup,
1996 ) The properties of these zones meet many of the criteria necessary to define them as compartments: sharp boundaries, restricted gene expression, and barriers to cell movement (for a complete discussion, see Herrup and Kuemerle, 1997 ). In the present study we explore the
distortion of the murine cerebellar compartments in the
Engrailed-2 mutant mouse.
Two homologs of the Drosophila engrailed gene exist in the
mouse. Engrailed expression is found in a strong transverse
band at the early midbrain-hindbrain junction with decreasing levels toward the rostral midbrain. Consistent with the En gene
being essential for brain development, a null allele of mouse
Engrailed-1 has been shown to lead to the absence of most of
the cerebellum and midbrain (Wurst et al., 1994 ). The second
engrailed homolog, Engrailed-2 (En-2),
is also expressed in the presumptive midbrain-hindbrain region.
Although En-1 expression initiates at the one-somite stage (McMahon et al., 1992 ), En-2 expression is not detected
until the five-somite stage (Davis and Joyner, 1988 ; Davis et al.,
1988 ). Unlike En-1, null alleles of Engrailed-2
have only a subtle neurological phenotype (Gerlai et al., 1995 ), and a
modest yet reproducible disruption in the anteroposterior (A/P) pattern
of cerebellar foliation and transgene expression (Joyner et al., 1991 ;
Millen et al., 1994 ). In addition, mediolateral (M/L) pattern changes have also been noted. There is a subtle change in the banded
organization of spinal cord mossy fiber afferents (Vogel et al., 1996 )
and in the transient pattern of banded expression of En-2,
En-1, Pax-2, and Wnt-7B seen during
late gestation (Millen et al., 1995 ).
In the present study we have used three M/L markers: Zebrin II, Ppath,
and the expression of an L7lacZ fusion gene. The Zebrin II
monoclonal antibody defines subsets of adult Purkinje cells that are
arranged in a series of evolutionarily conserved, antigen-positive, sagittal stripes (Hawkes and Gravel, 1991 ; Hawkes and Herrup, 1996 ;
Hawkes and Eisenman, 1997 ). There are three Zebrin bands per
hemicerebellum in the vermis, a fourth one at the margin of the vermis
and hemispheres, and three more in each hemisphere. The pattern is
mirror symmetric around the midline and can be recognized in a broad
range of adult vertebrates. The borders of the bands have been shown to
be congruent with the segregation of some cerebellar afferent terminal
fields (Gravel and Hawkes, 1987 , 1990 ), emphasizing the functional
significance of the banding pattern. A second marker, the Ppath
antigen, reveals a nearly complementary pattern (Leclerc et al., 1992 ).
These reagents are only useful in the adult, however, because before
postnatal day 6 (P6) there is no Zebrin staining at all, and it is not
until P25 that the mature banding pattern is fully developed (Leclerc et al., 1988 ). In the neonate, M/L organization can be visualized using
the L7lacZ transgene of Oberdick et al. (1990 , 1993) . With this marker, a transient pattern of bands first appears at the midline
around embryonic day 18 (E18), with additional bands added laterally
throughout postnatal development until about P11, when all Purkinje
cells turn positive for transgene expression.
The present study is a comparison of the Zebrin II, Ppath, and
L7lacZ bands in the wild-type and
En-2hd/hd cerebellum. Although distinct patterning
changes are observed with all three markers, the basic neonatal and
adult banding structure is well preserved. In addition to these
qualitative studies, we have performed cell counts of four cell
populations in the olivocerebellar circuit. We find that the numbers of
Purkinje, granule, deep nuclear, and inferior olivary neurons are
reduced in the En-2 mutant, each by the same amount. The
results are incorporated into a new model of cerebellar development in
which cerebellar space undergoes two separate patterning events during
ontogeny.
MATERIALS AND METHODS
Mouse strains. Mice carrying the
En-2hd allele (Joyner et al., 1991 ) were maintained
on a 129/Sv inbred background by breeding homozygotes to either
heterozygous or homozygous animals. Offspring were genotyped via PCR
with the following primers: (1) TTGAGAAGAGAGGCCCTGTA, a sequence common
to both +/+ and En-2hd/En-2hd
animals; (2) CTCGAACAAAAGGCCAGTGT, a sequence specific for the +/+
En-2 homeobox; and (3) TCTCATGCTGGAGTTCTTCG, a sequence in the neomycin gene in the En-2hd mutation.
In wild-type animals, these primers amplify a 500-bp band; in
homozygous mutants they amplify a 300-bp band; in heterozygotes they
amplify one band of each size. Because we could detect no cytoarchitectural differences in their cerebellums, wild-type and
heterozygous (En-2hd/+) mice were used
interchangeably as normal controls in all studies except for the cell
counts, in which +/+ controls were used exclusively. Mice bearing the
L7lacZ transgene were a generous gift from Drs. Richard
Smeyne, (St. Jude Research Hospital, Memphis, TN), John Oberdick (Ohio
State University, Columbus, OH), and James Morgan, (St. Jude Research
Hospital, Memphis, TN). This line derives from a chimeric gene in which
the bacterial lacZ ( -galactosidase) histological marker
is driven by 4 kb of promoter sequence from the Purkinje cell-specific
L7 gene. Originally developed in mice of the B6SJL genetic
background, our colony was maintained by brother-sister mating before
being bred onto the 129/Sv-En-2hd background. All
animals were maintained in the American Association for the
Accreditation of Laboratory Animal Care-accredited Case Western Reserve
University animal facility, where they were maintained on a 14/10 hr
light/dark cycle. Food and water were available ad
libitum.
Histology. Adult mice were anesthetized with Avertin (0.025 ml/gm body weight) and transcardially perfused with PBS for 2 min,
followed by 10 min of 4% paraformaldehyde in 0.1 M
phosphate buffer. Dissected brains were placed in fixative for 6 hr at
4°C and then rinsed with 18% sucrose in PBS for 30 min two times
before being placed in fresh sucrose solution overnight. Brains used for Zebrin II and Ppath analysis were sectioned either horizontally or
coronally at 40 µm using a vibratome or sectioned at 10 µm using a
cryostat. Postnatal animals were anesthetized with ether before
perfusion and brain dissection.
Detection of -galactosidase activity. Whole brains and
cryostat sections of animals carrying the L7lacZ transgene
were stained for -galactosidase activity using standard methods.
Samples were kept in
5-bromo-4-chloro-3-indolyl- -D-galactoside (X-gal) mix: 35 mM K3Fe(CN)6, 35 mM K4Fe(CN)6·3H2O, 2 mM MgCl2, 0.01% sodium desoxycholate,
0.02% NP-40, and 1 mg/ml X-gal, for 8-12 hr at 37°C and then rinsed
in PBS and stored in a 0.2 M EDTA-PBS solution at 4°C.
The data shown are representative of three animals at each age.
Intermediate ages (e.g., P3, P5, and P12) were also examined but are
not shown.
Immunohistochemistry. Floating sections (40 µm) were
treated in standard 24 well tissue culture plates. Sections were washed three times in Tris-buffered saline (TBS) for 5 min each and then incubated in blocking solution (TBS containing 10% goat serum and
0.1% Triton X-100) to prevent nonspecific antibody binding. After 30 min the sections were reacted simultaneously with the monoclonal
antibodies Zebrin II (a gift from Dr. Richard Hawkes, University of
Calgary, Calgary, Alberta, Canada) and Ppath (a gift from Drs. Gerald
Schwarting and Miyuki Yamamoto, E.K. Shriver Center, Waltham, MA)
diluted 1:8 in blocking solution overnight at 4°C. Sections were then
washed four times for 5 min each in TBS and placed in 10% goat
serum/0.2% Triton X-100 in TBS for 30 min. Secondary antibodies were
then applied for 2 hr at room temperature. For the Zebrin II antibody,
FITC-conjugated goat anti-mouse IgG was used (1:200 in blocking
solution). For Ppath, the secondary was Texas Red-conjugated goat
anti-mouse IgM (1:400 in blocking solution). Both secondary antibodies
were purchased from Jackson ImmunoResearch (West Grove, PA). Secondary
antibodies were then removed by rinsing the sections for 20 min total
in TBS, after which the sections were mounted on gelatinized slides and
coverslipped in 1:1 TBS-glycerol. In some experiments, Zebrin II was
revealed using HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) diluted 1:50 in blocking solution. After the normal rinse, the presence of the HRP was revealed by a 5 min incubation with
diaminobenzidine in TBS (0.25 mg/ml). The observations presented are
based on data obtained from at least three animals of each genotype.
Cell counts. Purkinje, granule, inferior olive, deep
cerebellar nucleus, and facial nucleus neurons were counted by
previously described methods (Herrup and Sunter, 1987 ; Maricich et al.,
1997 ). For each cell type, a complete set of sagittal or coronal
sections (10 µm) were identified, and 10-15 well spaced sections
were selected. Two animals of each genotype were used, and all counts
were done with cresyl violet-stained material. The nucleus of the cell
was used as a criterion for scoring a cell as present. The total
numbers of counted cells for the Purkinje cell, olive, deep nuclear,
and facial nucleus populations were then determined by graphing the total counts per section as a function of distance from the first cell
(or, for Purkinje cells, distance from the midline). The area under
this curve was computed to give the uncorrected counts.
For cerebellar granule cells, six fields, 50 µm on a side, were
selected (at low magnification to reduce bias). Two fields each, chosen
from the tops, sides, and bottoms of folia, were counted in each of six
sections from across the mediolateral extent of the cerebellum. The
average number of cells in these 36 fields was used as the average
density of granule cells in a 50 × 50 × 10 µm region of
the counted cerebellum. This density figure was then multiplied by the
total volume of the internal granule cell layer (IGL), determined by
measuring the area of the IGL in each of 15 well spaced sections. A
graph of granule cell layer area as a function of distance from the
midline was made, and the area under the curve was computed to give the
volume of the IGL. All neuronal counts were corrected for the
split-cell error by the method of Hendry (1976) .
RESULTS
Sagittal compartmentation is disrupted in specific regions of the
adult cerebellum
The mice used in this study were maintained on an inbred 129/Sv
genetic background (unless otherwise noted). The effects of the
En-2hd/hd genotype on cerebellar size and the
pattern of foliation are reviewed in the sagittal sections shown in
Figure 1 (also see (Joyner et al., 1991 ;
Millen et al., 1994 ). In both vermis and hemisphere, the
cross-sectional area of the mutant (Fig. 1B,D) is
much reduced from that of the wild type (Fig. 1A,C).
In the vermis of the mutant (Fig. 1B), the foliation
has a relatively normal appearance in anterior cerebellum (lobules
I-V) compared with wild type (Fig. 1A). In posterior
cerebellum (lobules VI-IX), however, there is a subtle distortion of
the foliation pattern; nodulus (lobule X) seems unaffected. In the
hemispheres, the anterior lobules of the mutant are well preserved
(Fig. 1D) compared with wild type (Fig.
1C), but there is a fusion of Crus II and the paramedian
lobule (pml).
Fig. 1.
Sagittal view of wild-type and
En-2 mutant cerebella cresyl violet-stained midline
(A, B) and lateral (C, D) sections from wild-type (A, C) and En-2hd/hd
(B, D) animals. Note the posterior folial abnormalities
in lobules 8 and 9 at the midline
(compare B with A) and the fusion of the Crus II and pml lobules in the hemisphere
(compare D with C). Scale bar, 500 µm.
pml, Paramedian lobule; simp, simplex.
[View Larger Version of this Image (155K GIF file)]
We have reconstructed the pattern of Zebrin II and Ppath bands in adult
animals using both coronal and horizontal serial sections. The analysis
was performed both at low magnification to score the overall pattern of
bands and at high magnification to score the phenotype of individual
Purkinje cells more accurately. We based our comparisons on the
nomenclature established previously (Hawkes and Leclerc, 1987 ; Millen
et al., 1994 ) The pattern of Zebrin II and Ppath expression is
basically intact in the adult En-2hd/hd mouse, yet
there are significant and reproducible differences between mutant and
wild-type Zebrin II staining.
In the cerebellum as a whole, we have identified four regions in which
the Zebrin II M/L pattern is affected by the En-2hd
mutation. In each of these regions there is a localized loss or
fragmentation of bands (Fig. 2). The
discrete nature of the disruptions is highlighted by the fact that a
normal banding pattern is often observed in regions immediately
adjacent to the disrupted area on a single section. Two of the affected
areas are in the vermis: the area that includes the misshapen lobules
VIII and IX (Fig. 2A,B) and the more anterior region
encompassing lobule V (culmen; Fig. 2C,D). Each of these
shows a fragmentation of bands (see the regions highlighted by
brackets). In the third region, lobule IV (centralis), the
pattern disruption is evidenced by band loss (Fig.
2E,F). In this more anterior region, the P2 band (nomenclature of Hawkes and Leclerc, 1987 ) is specifically affected, whereas the midline, P1, band is always recognizable and
largely unaltered. Likewise, in both the mutant and wild type, the P4
Zebrin II band, which occurs at the junction between the vermis and the
hemispheres, is always intact. These last two observations suggest that
the attenuations noted in the other bands are not simply attributable
to a reduced number of Purkinje cells in the cerebellum as a whole. The
fourth disruption occurs in the hemisphere in the region of fusion
between the Crus II and pml lobules, as well as in the more anterior
Crus I lobule (Fig. 3). In these locations, the Zebrin and Ppath patterns are not maintained, and although the exact nature of the disruption is varied, there appears to
be a consistent loss of the Ppath-positive interband between the Zebrin
II-positive bands, P5 and P6. The result is a continuous Zebrin
II-positive band along the crown of the fused folia. Additionally, in
some animals, Ppath-positive cells are apparent but misplaced.
Fig. 2.
Lack of En-2 function results in
the fragmentation or loss of Zebrin II bands in the adult. Zebrin II
bands in wild-type (A, C, E) and
En-2hd/hd (B, D, F)
cerebellar cortex are identified according to the nomenclature of
Hawkes and Gravel, 1991 . Sections are from posterior lobules VIII and
IX (A, B), dorsal lobule V (C, D), and
anterior lobule III (E, F). Note the shortening
of the mutant P2 and P3 bands in the posterior lobules on the
left (up-facing brackets in A, B) and the fragmentation of the same bands on the right
(down-facing bracket). In lobule V (C, D)
there is a similar shortening of the P2 bands bilaterally, whereas in
lobule III (E, F) the P2 band is missing in the
mutant. Scale bar, 200 µm.
[View Larger Version of this Image (183K GIF file)]
Fig. 3.
Reconstruction of coronal sections of Zebrin II-
and Ppath-stained cerebellar cortex. The relative locations of the
Zebrin II bands (filled lines) and Ppath
interbands (stippled lines), as well as the folial
differences between wild type (A) and the En-2hd/hd mutant (B) are
illustrated in a representative coronal section. The hatched
region in the mutant Crus I (C I) folium
represents Purkinje cells reactive to both Zebrin II and Ppath. The
Ppath-positive interband between Zebrin II bands P5 and P6 is either
missing or the cells present in this region have switched from Ppath to Zebrin II expression. CII, Crus II.
[View Larger Version of this Image (26K GIF file)]
In the remaining regions of the cerebellum, there are at most only
minor alterations in the Zebrin II and Ppath staining. The banding in
the structurally unaffected hemispheric folia of the mutants is
generally indistinguishable from that of the wild type, although it
appears as if the patterns may not always be bilaterally symmetric.
This is most noticeable at the junctions between folia; the base of a
specific fissure may be positive for Zebrin II on one side but positive
for Ppath (and negative for Zebrin II) on the other side. Furthermore,
in the structurally "normal" lobules (i.e., simplex and pyramis),
bands 5-7 are appropriately positioned.
Patterning revealed by the L7lacZ transgene is
disrupted in perinatal En-2 mutants
The results from the En-2hd/hd cerebellum led
us to consider whether we could establish a link between this adult
pattern and the disruption in the embryonic M/L pattern observed by
Millen et al. (1995) . Oberdick et al. (1993) have shown that a
-galactosidase transgene, driven by the promoter of a Purkinje
cell-specific protein L7, is expressed in a transient pattern of
sagittally oriented bands (interleaved with unstained interbands).
Expression begins on approximately E17. We have bred the
L7lacZ transgene onto the En-2hd
background and have analyzed expression patterns in perinatal +/+,
En-2hd/+, and
En-2hd/hd littermates to determine the effect, if
any, of the En-2 mutation on the early M/L organization. No
differences could be detected between the patterns of wild-type and
heterozygous mice, so the findings from these two types of animals are
pooled.
At E18, the staining patterns of En-2hd/hd mice
(Fig. 4B) are
essentially identical to those of normal mice (Fig.
4A). Two stained patches are observed on either side
of the midline on the dorsal surface of the newly developing
cerebellum, the region that will give rise to lobules 5-7. On the day
of birth (E19 = P0), these patches persist dorsally, but
differences become apparent on the ventromedial surface where lobules 8 and 9 are developing. In control animals (Fig. 4C), one
broad band and one thin band are noticeable on either side of the
midline. Although -galactosidase activity is visible in the
corresponding region in the mutants (Fig. 4D,
asterisk) it is diffuse, and no discrete bands comparable to wild
type (Fig. 4C, 1-4) are visible. This difference is
more readily recognizable at later stages (Fig. 4G,H)
at which the control animals have four bands total, and the mutant
animals have two thin bands at the midline, accompanied by a thick band and a thin band on either side. At P2, the cerebellar midline of
control mice is clearly demarcated by a band of unstained tissue (Fig.
4E, asterisk, G). This is in contrast to the
En-2-deficient littermates, in which no such "interband"
exists (Fig. 4F,H, asterisks). There is also a
precocious appearance of a band in the region of the Crus I lobule of
the hemispheres. This band, which is located on the right under the
I in Figure 4F (and on the
left, to the left of the 6), is
not found in control animals of this age. Mutants also exhibit
irregularly shaped broad bands in lobule VII (Fig. 4F) and lack a patch of staining localized to either
side of these bands (Fig. 4E,F). The eighth
folium has a rather uniform appearance from the midline laterally (Fig.
4H), whereas the wild type has two clear bands (Fig.
4G, a,b). Caudally, in the ninth folium, the mutant harbors
bilateral curved stripes medially (Fig. 4H, band
a), not found in controls (Fig. 4G), plus two
stripes lateral to this (Fig. 4H, b,c), in contrast
to the uniform appearance of the control (Fig. 4G). In both
genotypes, -galactosidase staining is strongest in the developing
parafloccular regions and in posterior lobules 9 and 10.
Fig. 4.
Developmental compartments are disrupted
early in the En-2hd/hd mutant. Whole-mount
cerebella from En-2hd/hd, L7lacZ
(B, D, F, H) stained with -galactosidase are
compared with wild-type mice (A, C, E, G) at different
perinatal ages: E18 (A, B), P0 (C, D),
and P2 (E, F). At E18, two medial bands are
present in both control (A) and mutant
(B) animals. By P0, the first disruptions are
apparent. In wild-type (C), four bands are
located in the region of the eighth and ninth folia, compared with the
highly diffuse staining (asterisk) found in
Engrailed-2 mutants (D). At P2
(E-H) many differences are noticeable. There is
a loss of a midline interband (F, asterisk), the
precocious appearance of a stained band in Crus I (F,
located under I in the mutant), and the addition of two
medial bands in lobule IX (G, compare bands
a, b in wild type with the pattern in the
En-2hd/hd lobules 8, 9,
H). S, Simplex.
[View Larger Version of this Image (179K GIF file)]
By P4 the Purkinje cell banding patterns expand laterally in both
normal and mutant cerebella. In addition to the dissimilarities observed in the P2 brains, there is a clear lack of striping in anterior lobules 3 and 4 in the mutant (Fig.
5B, asterisk) compared with
controls (Fig. 5A, asterisk). At P7 striping in the
hemispheric lobules is easily recognizable. Bands in the mutant are
attenuated in the hemisphere, in the precise region where previous
studies have shown a foliation abnormality is developing: a failure of formation of the fissure separating Crus II and the pml (Fig. 5C,D, asterisks). Control P30 mice have at least four
distinct stripes in vermal lobules 4-6 (Fig. 5E). In
En-2-deficient mice at this age, there are only two broad
bands (Fig. 5F), instead of four thin bands (Fig.
5E), in lobules 4-6. The pattern of transgene expression in
P12 and P17 mice is similar to that found in P30 mice (data not shown).
In contrast to the originally reported behavior of the transgene, a
striped appearance of the cerebellar staining persists in both controls
and mutants even at P30. Because of this, the differences in the
striping pattern of the L7lacZ transgene in normal and
mutant animals remain apparent. The reason for the persistence of the
striped pattern is unknown; it may be attributable to quantitative
variations in expression (all Purkinje cells express, but some much
less than others); it may reflect an alteration in the transgene
structure with continued germ line transmission; or it may be the
effects of the 129/Sv genetic background.
Fig. 5.
L7lacZ band loss persists into
adulthood. Whole-mount cerebella from En-2hd/hd,
L7lacZ (B, D, F) stained with
-galactosidase are compared with wild-type mice (A, C,
E) at different postnatal ages: P4 (A, B), P7
(C, D), and P30 (E, F). P4 mutants
lack lateral bands of transgene activity in vermal lobules III and IV,
and staining is generally diffuse (A, B, asterisks). By
P7 staining in the Crus II- and pml-fused folia reveals that band width
is significantly reduced in the mutant (compare the region identified
by the asterisk in C, lobule
8, with that in D). Severe band loss is
recognizable in the adult mutant (F), most
noticeably in the vermis compared with wild type
(E). In general, there appears to be less overall reaction product in En-2 mutants at this time.
S, Simplex; I, Crus I; II,
Crus II.
[View Larger Version of this Image (146K GIF file)]
Purkinje cell identity may be affected by the
En-2hd mutation
LeClerc et al. (1990) established the existence of a binary Zebrin
and Ppath code that partitions adult Purkinje cells into one of three
phenotypes. Most Purkinje cells fall into two major classes: Zebrin
II-positive, Ppath-negative and vice versa. A third, minor class is
found in the P3 band in lobule IX, in which the Purkinje cells are
positive for both markers. LeClerc et al. (1992) also noted that
Purkinje cells at the interface of Zebrin II and Ppath bands were often
double-labeled. In the Engrailed-2 mutant, most regions
retained the standard code; Purkinje cells were either Zebrin II- or
Ppath-positive, with double-labeled cells found primarily in the P3
band in the rostral portion of posterior lobe IX. This situation
persisted, even in regions where the bands were lost or fragmented.
However, in many mutant animals, double-stained cells replaced the
usual Ppath-positive interband located at the crown of Crus I (between
Zebrin-positive bands 4 and 5; Fig. 3A,B). Thus, it appears
as if the identities of individual Purkinje cells were altered at this
one location. One possibility is that the Purkinje cells in this
double-labeled band were transformed into cells resembling those in the
P3 band in lobule IX; a second possibility is that this region
represents an expanded or ambiguous "boundary" between a Zebrin and
Ppath band. In neither the mutant nor the wild type could we identify any double-negative cells.
Cell numbers in the En-2hd/hd
olivocerebellar circuit
The reduced size of the cerebellum in En-2hd/hd
mutant animals has been described previously, but the implied deficit
of cells has only been documented in a preliminary manner (Herrup et
al., 1991 ). Two adult En-2hd/hd animals and two +/+
controls were serially sectioned in the sagittal or coronal plane, and
the numbers of Purkinje, granule, deep nuclear, and inferior olive
cells were counted as described in Materials and Methods. These counts
are illustrated graphically in Figure 6A. Note that each of
the cell types involved in the olivocerebellar circuit is reduced in
number by 30-40%. Without a careful quantitative study during
development, we cannot determine whether the deficit is caused by cell
death or agenesis. However, a reduction in cerebellar size in
En-2-deficient animals is apparent as early as E15
(Avarado-Mallart et al., 1990 ), and no obvious period of cell death has
been observed in our studies. To ensure that the cell number deficit
was not a property of the entire CNS of the mutant, we counted the
motor neurons of the facial nucleus in both mutant and wild-type
animals. Although the cells of this nucleus are located in the ventral brainstem, 750 µm rostral to the inferior olive, the cell counts in
mutant and wild-type animals are identical.
Fig. 6.
A, Effect of
Engrailed-2 on neuronal cell number. The percentage of
each cell type in wild-type (shaded bar, 100%) and
affected (solid bar) animals is shown. All of the
principal neurons of the olivocerebellar circuit are affected to about
the same extent. Counts of the motor neurons of the facial nucleus
serve as a control, indicating that the deficit is specific for the
cell types shown. B, Uniform reduction of Purkinje cell
number. The raw counts from hemicerebella of mutant and control animals
are shown graphically ( , wild-type; , En-2hd/hd).
That the overall shapes of the curves are nearly identical indicates
the lack of regional variation in the Purkinje cell loss observed in
the mutant. C, Purkinje cell loss in the
En-2 mutant cerebellum. In this diagram, Purkinje cell
counts are displayed folium by folium. Each box is
proportional in area to the number of Purkinje cells in the
corresponding folium. The shaded region represents the
the number of Purkinje cells found in each folium in the
En-2 mutant. In each case, about two-thirds of the box is shaded, indicating an approximate one-third loss of cells. This loss
appears uniform, because it is not greater or lesser in any given
folium.
[View Larger Version of this Image (46K GIF file)]
The Purkinje cell counts were analyzed in greater detail for evidence
of regional variation in either the M/L or A/P axis. Figure
6B is a display of the raw counts of hemicerebella of
two En-2hd/hd and two wild-type animals. The reduced
width of the mutant structure is reflected in the smaller
x-intercept, but the overall shapes of the curves are nearly
identical. This suggests that there is little or no regional variation
in the M/L axis. A similar conclusion derives from Figure
6C, in which the Purkinje cell counts are displayed folium
by folium. Each box in the figure is proportional in area to
the number of Purkinje cell counts in that folium. Within each box, the
shaded area represents the En-2hd/hd
counts for that region. From this analysis it would appear that there
is a nearly uniform reduction in Purkinje cell number in all A/P and
M/L regions.
DISCUSSION
The initial goal of this study was to determine whether the
alterations in cerebellar size and A/P patterning that have been described for the En-2hd/hd mouse were accompanied
by any effect on the organization of the cerebellar cortex in the M/L
dimension after birth. This question is of interest because during late
embryogenesis, the cells expressing En-2 form a pattern of
sagittal bands that divides the E17.5 cerebellum into M/L compartments,
presaging the strong orientation of the adult modules of cerebellar
function.
We have used three markers to assess the M/L patterning of the
cerebellum in the En-2 mutants: Zebrin II, Ppath, and the
L7lacZ transgene. We find that most of the M/L patterning is
maintained, but there are subtle, consistent changes, which are a part
of the phenotype of this mutation. Significantly, the disturbances we
have found are not exclusively in those regions where the mutation has
obvious structural (i.e., folial) abnormalities. Lobules VIII and IX in
the posterior vermis are affected in their structure; here there is a
correlated disruption of both the L7lacZ and Zebrin II
patterns (Figs. 2A,B, 4G,H). By
contrast, the more anterior lobules, III and IV, appear normal in their
lobular structure but show significant alterations in the pattern of
both the L7 and Zebrin markers (Figs. 2E,F,
5A,B). These data suggest that the consequences of the
En-2 mutation for adult cerebellar structure cover a much
broader area than previously appreciated. Curiously, there does not
appear to be a discernible correlation between the postnatal pattern of
En-2 expression and the location of the L7 or Zebrin
changes. For example, at birth En-2 is expressed in a broad
band of cells at the midline. The L7 transgene is appropriately expressed dorsally at this time, but in ventral regions, transgene expression is disrupted in mutants. Also, in the early postnatal animal, disruptions revealed by the L7 marker do not always correlate with the disturbances in the adult, as revealed by the Zebrin II and
Ppath bands. For example, in the En-2hd/hd neonate,
there is no clear demarcation of a well defined
L7lacZ-negative band at the midline (Fig.
4E,F), whereas the P1 Zebrin band, which is
located precisely at the midline, always remains intact in the adult
(Fig. 2).
The embryonic (E17.5) pattern of En-2 expression correlates
somewhat better with the L7lacZ changes, but even here there
is not perfect congruence. The precocious appearance of the
L7lacZ bands in Crus I (at P2) and the ectopic expression of
L7lacZ at the midline both correlate with the loss of
En-2 expression in the similar regions of the E17.5 embryos.
On the other hand, there are regions where the loss of En-2
function at E17 appears to have no comparable gain in L7lacZ
expression. Apart from the two abnormalities cited above, it is
difficult to attribute any other change in L7lacZ expression
specifically to a loss of En-2 function. The same applies to
the Zebrin II and Ppath pattern. Thus although the M/L pattern of
cerebellar compartmentation is clearly disrupted, the nature of this
disruption, in and of itself, does not inform us about the link between
the loss of En-2 expression and the observed structural and
biochemical consequences.
The other informative phenotype of the En-2 mutant is the
absence of neurons in the olivocerebellar circuit. We find that each of
the four major cell populations is reduced in En-2 mutant mice, and all four are reduced by a similar amount: 30-40%. To our
knowledge, this is the first reported instance of a uniform decrease in
these four cell types. The deep nuclei, in particular, have been
reported to show cell number deficits in only three other mutations:
weaver (Maricich et al., 1997 ), vibrator (Weimer et al., 1982 ), and purkinje cell degeneration (Triarhou et
al., 1987 ). Although reductions in olive cell number are known to occur in a number of mutants, they are rarely if ever as large as those found
in their cortical targets. For example, the weaver mutant is
missing 35% of its cerebellar Purkinje cells, yet it contains a full
complement of olive neurons (Blatt and Eisenman, 1985 ; Herrup and
Trenkner, 1987 ); lurcher loses 100% of its Purkinje cells
but only 80% of its olive neurons (Caddy and Biscoe, 1979 ). As with
the biochemical markers discussed previously, there is no obvious
correlation between the known expression patterns of the normal
Engrailed-2 gene and the location of the missing cells. There is not an augmented loss of Purkinje cells in the vermis, as
might be expected from the L7lacZ misexpression patterns
found in the mutant, and there is no banded organization to the
Purkinje cell loss, as is found in the nervous (Edwards et
al., 1994 ) and leaner (Heckroth and Abbott, 1994 ) mutations.
Rather, if the Purkinje cell distribution may be taken as example (Fig.
6C), there is a near uniform loss of cells from all
regions.
A double-patterning hypothesis
We believe that our data are best explained by a model in which
cerebellar space is patterned twice. The first patterning event occurs
at E8-E10 when the overlapping but noncongruent bands of
En-1 and En-2 expression appear at early neural
tube stages. This event establishes the cerebellar field and specifies
the precursors that will give rise to the various cells of the
cerebellum. We also propose that subdivisions of the cerebellar field
are established in this first patterning event. A simple model would be
that there are three major subdivisions: En-1-only,
En-2-only, and En-1 plus -2. Note that
this event occurs at a time before the bulk of neurogenesis has
occurred. This view is consistent with earlier observations that the
population of adult Purkinje cells descends from a small number of
precursors established early in CNS development. Exact estimates of the
initial number of precursors vary from 8 to 11 (Herrup and Sunter,
1986 ) to 64 (Baader et al., 1996 ) per half-cerebellum, but there is
agreement that the event(s) that selects these cells occurs during the
early neural tube stage, embryonic days 8-9, the same period of
development when Engrailed-1 and Engrailed-2
expression are first observed by in situ hybridization. Based on an analysis of Purkinje cell clone size in several different inbred strains of mouse, the early Purkinje cell precursors are hypothesized to produce clones of cells with a size (measured as the
number of Purkinje cells per clone) that is intrinsic to the precursor
(Herrup and Sunter, 1986 ). Thus the initial establishment of the
precursors is a central event in the establishment of cell number in
the cerebellar system. We propose that in the
En-2hd/hd mouse, the early establishment of the
cerebellar neuronal precursors is blocked (either by death or
agenesis). Following with the simple example of three
Engrailed compartments, we might predict that the cerebellum
of the En-2hd/hd mouse is missing the
En-2-only and En-1 plus -2 cell
lineages.
After these early events, we propose that the spatial coherence of the
initial subdivisions is lost. Several independent lines of evidence
demonstrate that there is extensive spatial mixing of the neuronal cell
lineages in the mouse. Direct observation of mixing in the ventricular
zone has been reported by Fishell et al. (1993) and in the postmitotic
populations by O'Rourke et al. (1995 , 1997) . Cell lineage studies in
aggregation chimeras (Herrup, 1987 ), X-inactivation mosaics (Baader et
al., 1996 ), and retroviral mosaics (Gray et al., 1988 ; Walsh and Cepko,
1992 , 1993 ; Reid et al., 1997 ) have provided abundant evidence that descendants of the early nerve cell precursors intersperse widely with
each other within the growing brain. The expectation, therefore, is
that the first subdivisions should not stay as spatially defined patches; rather, they should intermingle and spread throughout the
adult cerebellum.
Our findings in En-2hd/hd mice are consistent with
this model. We find that the various cell populations of the cerebellar
field are reduced by a nearly identical percentage, even the cells of the inferior olive that migrate to a distant position in the ventral medulla. Furthermore, as predicted by the model, the spatial
distribution of the remaining Purkinje cells is nearly uniform across
the entire A/P and M/L expanse of the cerebellum. This is likely to be
the result of extensive mixing of the lineages during the development of cerebellar cortex. A similar picture of uniform cell loss is observed in aggregation chimeras of either staggerer or
lurcher mutants (Herrup and Sunter, 1987 ; Vogel and Herrup,
1993 ) or purkinje cell degeneration (Mullen, 1977 ).
What then is the explanation for the observed pattern of the Zebrin II,
Ppath, and L7 bands in the Engrailed-2 mutant? Our study has
documented significant and reproducible differences between the
En-2hd/hd and wild-type patterns, but in view of the
fact that the mutant cerebellum contains one-third fewer cells, the
fidelity of the pattern to that of the wild type is impressive. We
propose that the similarities are the predicted result of a process in
which there is a second cerebellar patterning event that occurs after neurogenesis is complete. It is this second event that determines the
size and shape of both the folia and the sagittal bands. The exact
timing of the second event is not known, but it is noteworthy that the
first appearance of M/L or A/P differentiation in the cerebellar anlage
occurs at around E14.5, just after the birth of the large cerebellar
neurons (E10-E13.5).
It has been argued that the M/L and A/P divisions of cerebellar cortex,
revealed by the Zebrin bands and the folia, reflect a true
developmental compartmentalization (Herrup and Kuemerle, 1997 ). We
would suggest, however, that these spatial compartments are analogs
rather than true homologs of the developmental compartments described
in the fruit fly. One important reason for this interpretation is our
prediction that the formative events that establish them are likely to
occur after cell division (and cell mixing) is completed. The
relatively normal appearance of the bands and folia in
En-2hd/hd mice raises the question of what role the
Engrailed genes have in directing the second patterning
event. Our dual-patterning hypothesis is neutral on the question of
whether the descendants of the original En-2-only or the
En-1+2 precursors are the same ones that express
En-2 during late embryogenesis. It is plausible that
En-2 is not part of the patterning mechanism at all but
merely part of the "realization" program within the individual cell
types. For the present, however, this important question must remain unanswered.
FOOTNOTES
Received May 2, 1997; revised July 31, 1997; accepted Aug. 6, 1997.
This work was supported by National Institutes of Health Grant NS 18381 to K.H. We express our thanks to Drs. John Oberdick, Richard Smeyne,
and James Morgan for the transgenic mice used as part of this
study.
Correspondence should be addressed to Karl Herrup, Alzheimer Research
Laboratory, Case Western Reserve Medical School, 10900 Euclid Avenue,
Cleveland, OH 44106.
REFERENCES
-
Avarado-Mallart R-M,
Martinez S,
Lance-Jones C
(1990)
Pluripotentiality of the 2 day old avian germinative neuroepithelium.
Dev Biol
139:75-88[Web of Science][Medline].
-
Baader S,
Schilling M,
Rosengarten B,
Pretsch W,
Teutsch H,
Oberdick J,
Schilling K
(1996)
Purkinje cell lineage and the topographic organization of the cerebellar cortex: a view from X inactivation mosaics.
Dev Biol
174:393-406[Web of Science][Medline].
-
Blatt G,
Eisenman L
(1985)
A qualitative and quantitative light microscopic study of the inferior olivary complex of normal, reeler and weaver mutant mice.
J Comp Neurol
232:117-128[Web of Science][Medline].
-
Caddy K,
Biscoe T
(1979)
Structural and quantitative studies on the normal C3H and Lurcher mutant mouse.
Philos Trans R Soc Lond [Biol]
287:167-201[Abstract/Free Full Text].
-
Davis C,
Joyner A
(1988)
Expression patterns of the homeobox-containing genes En-1 and En-2 and the protooncogene int-1 diverge during mouse development.
Genes Dev
2:1736-1744[Abstract/Free Full Text].
-
Davis C,
Noble-Topham S,
Rossant J,
Joyner A
(1988)
Expression of the homeo box-containing gene En-2 delineates a specific region of developing mouse brain.
Genes Dev
2:361-371[Abstract/Free Full Text].
-
Edwards MA,
Crandall JE,
Leclerc N,
Yamamoto M
(1994)
Effects of nervous mutation on Purkinje cell compartments defined by Zebrin II and 9-O-acetylated gangliosides expression.
Neurosci Res
19:167-174[Web of Science][Medline].
-
Fishell G,
Mason C,
Hatten M
(1993)
Dispersion of neural progenitors within the germinal zones of the forebrain.
Nature
362:636-638[Medline].
-
Gerlai R,
Millen K,
Fabien K,
Herrup K,
Joyner A,
Roder J
(1995)
Impaired motor learning performance in cerebellar en-2 mutant mice.
Behav Neurosci
110:126-133.
-
Gravel C,
Hawkes R
(1987)
Neuronal maturation in the normal and hypothyroid rat cerebellar cortex studied with monoclonal antibody MIT-23.
J Comp Neurol
258:447-462[Web of Science][Medline].
-
Gravel C,
Hawkes R
(1990)
Parasagittal organization of the rat cerebellar cortex: direct comparison of Purkinje cell compartments and the organization of the spinocerebellar projection.
J Comp Neurol
291:79-102[Web of Science][Medline].
-
Gray G,
Glover J,
Majors J,
Sanes J
(1988)
Radial arrangement of clonally related cells in the chicken optic tectum: lineage analysis with a recombinant retrovirus.
Proc Natl Acad Sci USA
85:7356-7360[Abstract/Free Full Text].
-
Hawkes R, Eisenman L (1997) Stripes and zones: the origins of
regionalization of the adult cerebellum. Perspect Dev Neurobiol, in
press.
-
Hawkes R,
Gravel C
(1991)
The modular cerebellum.
Prog Neurobiol
36:309-327[Web of Science][Medline].
-
Hawkes R,
Herrup K
(1996)
Aldolase C/Zebrin II and the regionalization of the cerebellum.
J Mol Neurosci
6:147-158.
-
Hawkes R,
Leclerc N
(1987)
Antigenic map of the rat cerebellar cortex: the distribution of parasagittal bands as revealed by monoclonal anti-Purkinje cell antibody mabQ113.
J Comp Neurol
256:29-41[Web of Science][Medline].
-
Heckroth JA,
Abbott LC
(1994)
Purkinje cell loss from alternating sagittal zones in the cerebellum of leaner mutant mice.
Brain Res
658:93-104[Web of Science][Medline].
-
Hendry I
(1976)
A method to correct adequately for the change in neuronal size when estimating neuroanl numbers after nerve growth factor treatment.
J Neurocytol
5:337-349[Web of Science][Medline].
-
Herrup K
(1987)
Roles of cell lineage in the developing mammalian brain.
In: Neural development, current topics in developmental biology (Hunt RK,
ed), pp 65-97. New York: Academic.
-
Herrup K,
Kuemerle B
(1997)
The compartmentalization of the cerebellum.
Annu Rev Neurosci
20:61-90[Web of Science][Medline].
-
Herrup K,
Sunter K
(1986)
Lineage dependent and independent control of Purkinje cell number in the mammalian CNS: further quantitative studies of lurcher chimeric mice.
Dev Biol
117:417-427[Web of Science][Medline].
-
Herrup K,
Sunter K
(1987)
Numerical matching during cerebellar development: quantitative analysis of granule cell death in staggerer mouse chimeras.
J Neurosci
7:829-836[Abstract].
-
Herrup K,
Trenkner E
(1987)
Regional differences in cytoarchitecture of the weaver cerebellum suggest a new model for weaver gene action.
Neuroscience
23:871-85[Web of Science][Medline].
-
Herrup K,
Zanjani H,
Millen K,
Rossant J,
Joyner A
(1991)
Analysis of cerebellar circuits in Engrailed-2 deficient transgenic mice.
Soc Neurosci Abstr
17:634.
-
Joyner A,
Herrup K,
Auerbach B,
Davis C,
Rossant J
(1991)
Subtle cerebellar phenotype in mice homozygous for a targeted deletion of the En-2 homeobox.
Science
251:1239-1243[Abstract/Free Full Text].
-
Leclerc N,
Gravel C,
Hawkes R
(1988)
Development of parasagittal zonation in the rat cerebellar cortex: MabQ113 antigenic bands are created postnatally by the suppression of antigen expression in a subset of Purkinje cells.
J Comp Neurol
273:399-420[Web of Science][Medline].
-
Leclerc N,
Schwarting G,
Herrup K,
Hawkes R,
Yamamoto M
(1992)
Compartmentation in mammalian cerebellum: Zebrin II and P-path antibodies define three classes of sagittally organized bands of Purkinje cells.
Proc Natl Acad Sci USA
89:5006-5010[Abstract/Free Full Text].
-
Maricich SM,
Soha J,
Trenkner E,
Herrup K
(1997)
Failed cell migration and death of cerebellar Purkinje can deep nuclear neurons in the weaver cerebellum.
J Neurosci
17:3675-3683[Abstract/Free Full Text].
-
McMahon A,
Joyner A,
Bradley A,
McMahon J
(1992)
The midbrain-hindbrain phenotype of Wnt-1-/Wnt-1- mice results from stepwise deletion of engrailed-expressing cells by 9.5 days post coitum.
Cell
69:581-595[Web of Science][Medline].
-
Millen KJ,
Wurst W,
Herrup K,
Joyner AL
(1994)
Abnormal embryonic cerebellar development and patterning of postnatal foliation in two mouse Engrailed-2 mutants.
Development
120:695-706[Abstract].
-
Millen KJ,
Hui CC,
Joyner AL
(1995)
A role for En-2 and other murine homologues of Drosophila segment polarity genes in regulating positional information in the developing cerebellum.
Development
121:3935-3945[Abstract].
-
Mullen RJ
(1977)
Site of pcd gene action and Purkinje cell mosaicism in cerebella of chimeric mice.
Nature
270:245-247[Medline].
-
O'Rourke N,
Sullivan D,
Kaznowski C,
Jacobs A,
McConnell S
(1995)
Tangential migration of neurons in the developing cerebral cortex.
Development
121:2165-2176[Abstract].
-
O'Rourke N,
Chenn A,
McConnell S
(1997)
Postmitotic neurons migrate tangentially in the cortical ventricular zone.
Development
124:997-1005[Abstract].
-
Oberdick J,
Smeyne R,
Corbin J,
Wurzburger R,
Morgan J
(1990)
Subsets of Purkinje cells and bipolar neurons identified by the L7 promoter.
Soc Neurosci Abstr
16:644.
-
Oberdick J,
Schilling K,
Smeyne RJ,
Corbin JG,
Bocchiaro C,
Morgan JI
(1993)
Control of segment-like patterns of gene expression in the mouse cerebellum.
Neuron
10:1007-1018[Web of Science][Medline].
-
Reid C,
Tavazoie S,
Walsh C
(1997)
Clonal dispersion and evidence for asymmetric cell division in ferret cortex.
Development
124:2441-2461[Abstract].
-
Triarhou LC,
Norton J,
Ghetti B
(1987)
Anterograde transsynaptic degeneration in the deep cerebellar nuclei of Purkinje cell degeneration (pcd) mutant mice.
Exp Brain Res
66:577-588[Web of Science][Medline].
-
Vogel M,
Herrup K
(1993)
A theoretical and experimental examination of cell lineage relationships among cerebellar Purkinje cells in the mouse.
Dev Biol
156:49-68[Web of Science][Medline].
-
Vogel MW,
Ji Z,
Millen K,
Joyner AL
(1996)
The Engrailed-2 homeobox gene and patterning of spinocerebellar mossy fiber afferents.
Dev Brain Res
96:210-218[Medline].
-
Walsh C,
Cepko C
(1992)
Widespread dispersion of neuronal clones across functional regions of the cerebral cortex.
Science
255:434-440[Abstract/Free Full Text].
-
Walsh C,
Cepko C
(1993)
Widespread dispersion in proliferative layers of cerebral cortex.
Nature
362:632-635[Medline].
-
Wassef M,
Zanetta J,
Brehier A,
Sotelo C
(1985)
Transient biochemical compartmentalization of Purkinje cells during early cerebellar development.
Dev Biol
111:129-137[Web of Science][Medline].
-
Wassef M,
Sotelo C,
Cholley B,
Brehier A,
Thomasset M
(1987)
Cerebellar mutations affecting the postnatal survival of Purkinje cells in the mouse disclose a longitudinal pattern of differentially sensitive cells.
Dev Biol
124:379-389[Web of Science][Medline].
-
Wassef M,
Angaut P,
Arsenio-Nunes L,
Bourrat F,
Sotelo C
(1992)
Purkinje cell heterogeneity: its role in organizing the topography of the cerebellar cortex connections.
In: The cerebellum revisited (Llinas R,
Sotelo C,
eds), pp 5-21. New York: Springer.
-
Weimer WR,
Lane PW,
Sidman RL
(1982)
Vibrator (vb): a spinocerebellar system degeneration with autosomal recessive inheritance in mice.
Brain Res
1982:357-364.
-
Wurst W,
Auerbach AB,
Joyner AL
(1994)
Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum.
Development
120:2065-2075[Abstract].
This article has been cited by other articles:

|
 |

|
 |
 
R. V. Sillitoe, D. Stephen, Z. Lao, and A. L. Joyner
Engrailed Homeobox Genes Determine the Organization of Purkinje Cell Sagittal Stripe Gene Expression in the Adult Cerebellum
J. Neurosci.,
November 19, 2008;
28(47):
12150 - 12162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Barak, M. A. Lazzaro, N. S. Cooch, D. J. Picketts, and R. Shiekhattar
A Tissue-specific, Naturally Occurring Human SNF2L Variant Inactivates Chromatin Remodeling
J. Biol. Chem.,
October 22, 2004;
279(43):
45130 - 45138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Bilovocky, R. R. Romito-DiGiacomo, C. L. Murcia, S. M. Maricich, and K. Herrup
Factors in the Genetic Background Suppress the Engrailed-1 Cerebellar Phenotype
J. Neurosci.,
June 15, 2003;
23(12):
5105 - 5112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Marie, L. Cruz-Orengo, and J. M. Blagburn
Persistent engrailed Expression Is Required to Determine Sensory Axon Trajectory, Branching, and Target Choice
J. Neurosci.,
February 1, 2002;
22(3):
832 - 841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Airey, L. Lu, and R. W. Williams
Genetic Control of the Mouse Cerebellum: Identification of Quantitative Trait Loci Modulating Size and Architecture
J. Neurosci.,
July 15, 2001;
21(14):
5099 - 5109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. B. Sarnat
Molecular Genetic Classification of Central Nervous System Malformations
J Child Neurol,
October 1, 2000;
15(10):
675 - 687.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
H. B. Samat and J. H. Menkes
How to Construct a Neural Tube
J Child Neurol,
February 1, 2000;
15(2):
110 - 124.
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Baader, M. W. Vogel, S. Sanlioglu, X. Zhang, and J. Oberdick
Selective Disruption of "Late Onset" Sagittal Banding Patterns by Ectopic Expression of Engrailed-2 in Cerebellar Purkinje Cells
J. Neurosci.,
July 1, 1999;
19(13):
5370 - 5379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H Shamim, R Mahmood, C Logan, P Doherty, A Lumsden, and I Mason
Sequential roles for Fgf4, En1 and Fgf8 in specification and regionalisation of the midbrain
Development,
January 2, 1999;
126(5):
945 - 959.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Baader, S. Sanlioglu, A. S. Berrebi, J. Parker-Thornburg, and J. Oberdick
Ectopic Overexpression of Engrailed-2 in Cerebellar Purkinje Cells Causes Restricted Cell Loss and Retarded External Germinal Layer Development at Lobule Junctions
J. Neurosci.,
March 1, 1998;
18(5):
1763 - 1773.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|