Previous Article | Next Article 
Volume 17, Number 22,
Issue of November 15, 1997
Defective Learning in Mutants of the Drosophila Gene
for a Regulatory Subunit of cAMP-Dependent Protein Kinase
Stephen F. Goodwin1,
Maria Del Vecchio2,
Klara Velinzon2,
Catherine Hogel2,
Steven R. H. Russell3,
Tim Tully2, and
Kim Kaiser1
1 Institute of Genetics, University of Glasgow, Glasgow
G11 5JS, Scotland, 2 Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York 11724, and 3 Department of
Genetics, University of Cambridge, Cambridge CB2 3EH, England
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Disruptions of a Drosophila gene encoding a
regulatory subunit of cAMP-dependent protein kinase homologous to
mammalian RI
(dPKA-RI) were targeted to the first (noncoding) exon
of dPKA-RI via site-selected P element mutagenesis. Flies homozygous
for either of two mutant alleles showed specific defects in olfactory learning but not in subsequent memory decay. In contrast, olfactory acuity and shock reactivity, component behaviors required for normal
odor avoidance learning, were normal in these mutants. Northern and
Western blot analyses of mRNA and protein extracted from adult heads
have revealed a complex lesion of the PKA-RI locus,
including expression of a novel product and over- or underexpression of
wild-type products in mutants. Western blot analysis revealed reductions in RI protein in mutants. PKA activity in the absence of
exogenous cAMP also was significantly higher than normal in homogenates
from mutant adult heads. These two mutant alleles failed to complement
each other for each of these phenotypic defects, eliminating
second-site mutations as a possible explanation. These results
establish a role for an RI regulatory subunit of PKA in Pavlovian
olfactory conditioning.
Key words:
learning;
memory;
reverse genetics;
PKA;
insertional
mutagenesis;
RI regulatory subunit
INTRODUCTION
Forward and reverse genetic
strategies in Drosophila have established a role for cAMP
signaling in olfactory associative learning. Disruptions of a G-protein
subunit (Gs), an adenylyl cyclase (rutabaga), a phosphodiesterase (dunce), a
catalytic subunit of cAMP-dependent protein kinase (DC0),
and a cAMP-responsive transcription factor (dCREB2) all
produce deficits in learning and/or memory formation thereafter,
without affecting basic sensorimotor responses to the odors or
electroshock stimuli used for conditioning (for review, see Tully et
al., 1996
). Three of these genes (rutabaga, dunce, and DC0) are expressed preferentially in
mushroom bodies (for review, see Davis, 1993
), characteristic
anatomical structures in the insect brain (cf. Hammer and Menzel,
1995
). Preferential expression of a constitutively active
Gs transgene in mushroom bodies, in fact, is
sufficient to abolish olfactory learning completely (Connolly et al.,
1996
).
Several observations in mammals suggest that modulations and
subcellular distributions of cAMP-dependent protein kinase (PKA) regulatory subunits may play a pivotal role during learning and memory
formation. Type I and type II PKA holoenzymes are composed of the
regulatory subunit isoforms RI
or RI
and RII
or RII
, respectively (Taylor et al., 1990
). Moreover, these regulatory subunit
homodimers can combine with at least three catalytic (C) subunit
isoforms, C
, C
, or C
(Scott and Soderling, 1992
). The various
PKA isoforms are expressed from different genes in a tissue-specific manner with the
-isoforms of each subunit enriched in neuronal tissue (Cadd and McKnight, 1989
; McKnight, 1991
). RII, but not RI,
subunits are phosphorylated by activated PKA. RII also undergoes proteolytic modification (Greenberg et al., 1987
; Müller and Spatz, 1989
). Because both processes act to slow reassociation of the
holoenzyme and thereby to prolong kinase activity, they have been
suggested as molecular correlates of memory (Kandel and Schwartz, 1982
;
Schwartz and Greenberg, 1987
; Müller and Spatz, 1989
). RII, but
not RI, subunits also appear to contain an anchoring domain that
tethers them at specific locations within the cell, possibly adjacent
to substrates for kinase activity (Bregman et al., 1989
, 1991
). Type I
and type II PKA also may be coupled to different cell-surface
receptors within the same cell (Scott, 1991
). Notably, a different
affinity for cAMP may result, so that neuronal responses to cAMP may
vary in accordance with the specific isoform of PKA in the neuron (Cadd
et al., 1990
).
Type I and type II PKA activities also have been characterized in
Drosophila (Foster et al., 1984
). Several catalytic subunit genes and one regulatory subunit gene have been cloned by homology with
mammalian counterparts (Foster et al., 1984
, 1988
; Kalderon and Rubin,
1988
). The latter PKA-RI gene most closely resembles mammalian RI
. Access to its DNA sequence allowed us to apply a
relatively new technique in Drosophila to target disruptions of PKA-RI. We present molecular, genetic, biochemical, and
behavioral data that establish a role for PKA-RI in fruit
fly associative learning.
MATERIALS AND METHODS
Drosophila strains and culture. Birm-2;
ry506 and w; Sb
P[ry+
2-3]99B/TM6
(Lindsley and Zimm, 1992
) were the sources of defective P elements and
P element transposase, respectively.
RI7I5 and
RI11D4 were separately
"Cantonized" by at least six rounds of backcrossing to wild-type
Canton-S flies (see below). Heterozygous females, rather than males,
were bred in each generation to allow free recombination around the P
element insertions on the third chromosome. P element-bearing third
chromosomes then were made homozygous using the double balancer strain
w; TM3 Sb Ser e/TM6B Tb Hu e. For general
purposes, flies were propagated at 18°C on cornmeal, molasses, and
agar medium supplemented with fresh yeast. Flies to be tested for
olfactory learning were raised on a 16:8 hr light/dark cycle at 25°C
on a sugar-based medium (Tully and Quinn, 1985
). Basic information on
strains and Drosophila methods is given by Lindsley and Zimm
(1992)
and Ashburner (1989)
.
In situ hybridization to tissue sections. Single-stranded
antisense and sense DNAs labeled with digoxygenin were generated by the
method of Patel and Goodman (1992)
. The template was pcD6BO (see Fig.
2; gift from D. Kalderon, Department of Biology, Columbia University,
New York, NY) linearized with either EcoRI or
XbaI. In situ hybridization to tissue sections
was performed as described by Han et al. (1992)
.
Fig. 2.
Structure of PKA-RI gene and its
relation to the P element insertional mutations. A,
Structure of the PKA-RI gene (after Kalderon and Rubin,
1988
).
gS8 is a DNA clone recovered from an EMBL3 genomic library, which was used to characterize mutants of
PKA-RI. pcD6BO is a plasmid recovered
from a cDNA library, which corresponds to a class Ia transcript and
which was used as a probe to recognize all known transcripts of
PKA-RI (see text). Locus depicts the intron and exon (black boxes) structure of the
PKA-RI locus. Arrows above exons I, II,
and IV indicate alternative transcription start sites for class I, II,
and IV messages. The start site for the class III message has not yet
been determined. Ia, Ib,
Ic, II, III, and
IV represent exon maps of the six known
PKA-RI transcripts. AUG indicates the
presumed translation start sites for each. B, Detail of
first exon of PKA-RI. Two identical P elements
(triangle) inserted independently near the 5
end of
exon I (black box) in a region of heterogeneous
transcription start sites (stippled box) upstream of the
presumed translation start site for class I RI isoforms.
77F3, PL,
PR, 77F1, and
77F2 represent PCR primers used to identify and
characterize the PKA-RI mutants (see Materials and
Methods). 77F1/77F3 represents a PCR product used as a
probe for class I-specific transcripts (see Fig.
4A).
[View Larger Version of this Image (15K GIF file)]
Site-selected mutagenesis. P element mutagenesis and
screening was performed by a modification of the method of Kaiser and Goodwin (1990)
(see also Finbow et al., 1994
). Birm-2;
ry506 males were mated en masse at 16°C with
virgin w; Sb
P[ry+
2-3]99B/TM6
females. F1 Sb male progeny were mated, also en
masse, with Canton-S virgin females at 18°C. Groups of 10 Sb+ F2 virgin females were
placed in single vials together with several wild-type males and were
allowed to lay for several days. F2 females from 10 vials
were then pooled and used for the preparation of genomic DNA. PCR
between two gene-specific primers (77F1 and 77F2; see Fig. 2) and two P
element primers (PL and PR) was
performed on the pooled DNA preparations (Kaiser and Goodwin, 1990
).
Amplified DNA was separated in 1.5% agarose gels, blotted, and probed
with
gS8 DNA. The presence of a discrete band of hybridization was taken to indicate a pool of F2 females in which at least
one individual contained a P element insertion within range of a
gene-specific primer. Two such pools were identified out of 120 pools
(12,000 F2 females) tested. Progeny eclosing in the 10 vials relevant to any pool of DNA were screened by the sib-selection
procedure of Kaiser and Goodwin (1990)
to isolate individual flies that bred true for the insertion. Sequencing of double-stranded DNA was
performed using the Sequenase version 2.0 protocol (United States
Biochemicals, Cleveland, OH). Direct sequencing of PCR products
recovered from agarose gels was by the modification of Winship (1989)
.
32P probes were prepared by random priming (Feinberg and
Vogelstein, 1983
) of gel-purified DNA fragments, linearized plasmids,
or phage DNA. Specific activities were in the range
108-109 cpm/µg. For other
methods, see Sambrook et al. (1989)
.
Gene-specific primers (co-ordinates with respect to EMBL accession
number X16970; for approximate locations, see Fig. 2): 77F1,
5
GATGCAGTCCTTGAGGACTCGC, 1584-1605 (PCR primer); 77F2, 5
AGAATCCCGTGCAGTTCCTGCG, 1631-1652 (PCR primer); 77F3,
5
ACCCACCTCCGTTGATTGGCTC, 713-734 (PCR primer). P-element primers
(co-ordinates with respect to EMBL accession no. V01520):
PL, 5
GTGTATACTTCGGTAAGCTTCGG, 36-58 (PCR primer);
PR, 5
AGCATACGTTAAGTGGATGTCTC, 2850-2872 (PCR primer); P31Inv, 5
CATGATGAAATAACATAAGGTGGTCCCGTCG,
1-31 (PCR primer); P233-247, 5
ATTGTGGGAGCAGAG, 233-247
(sequencing primer); P2397-2412, 5
GACATTTACATACGTC,
2397-2412 (sequencing primer). P233-247 and
P2397-2412 were a gift of K. O'Hare (O'Hare et al.,
1992
). P31Inv is oriented such that amplification proceeds
into the P element from the inverted terminal 31 bp repeats.
Outcrossing. Because no phenotypic markers had been
introduced onto the RI7I5 and
RI11D4 third chromosomes, and
because the P element itself is unmarked, the RI insertions
were followed through this process by PCR. Virgin females were mated
each generation with Canton-S males and allowed to lay eggs for several
days, after which their DNA was amplified in the presence of 77F1 and
PR. If a female tested positive for the P element, virgin
females were collected from among her progeny, and the above process
was repeated. After six such generations, the Cantonized third
chromosomes were made homozygous. Individual mating pairs of candidate
heterozygous males and virgin females were allowed to generate progeny
before being tested for amplification in the presence of 77F1 and
PR. If both parents tested positive for the P element,
mating pairs of their progeny were established and later tested for
amplification in the presence of 77F1 and 77F3. Lines were retained
only when both parents tested negative for the wild-type allele.
Although somewhat laborious, this procedure allowed genuinely free
recombination and the establishment of homozygosity without
contribution from any other genetic background.
Associative learning. Pavlovian (classical) conditioning of
odor avoidance responses and controls for olfactory acuity and shock
reactivity were performed essentially as described by Dura et al.
(1993)
(for a description of the training and testing apparatus, see
Tully and Quinn, 1985
). Groups of ~100 individuals (1- to 4-d-old)
were trained inside a tube with an electrifiable grid over 90% of its
inner surface. The flies were exposed sequentially to two odors,
3-octanol (OCT; ICN-K & K Labs) and 4-methylcyclohexanol (MCH; ICN-K
& K Labs), carried through the tube on a current of air (750 ml/min).
During 60 sec in the presence of the first odor (CS+; OCT or MCH), they received 12 1.25 sec pulses
of 60 V DC at 5 sec intervals (the unconditioned stimulus). The tube
was flushed with air for 45 sec, and the flies were exposed to the
second odor (CS
; MCH or OCT) for 60 sec without
electric shock. The chamber was again flushed with air for 45 sec. For
testing, the flies were transferred to the choice point of a T maze,
the opposite arms of which provided converging currents of OCT and MCH
(1500 ml/min at the choice point). After 120 sec, the numbers of flies
in the two arms were counted. Flies remaining at the choice point were ignored (<5%). Flies representing the 0 time point were transferred to the T maze within 90 sec after the end of training. Flies
representing the other time points (15, 30, 60, and 180 min) were
removed from the training chamber and kept in standard food vials (in
the dark). They were transferred to the choice point of the T maze 90 sec before testing began. All of the above were performed at 25°C and
70% relative humidity in dim red light. Relative concentrations of OCT
and MCH were adjusted such that naive flies distributed themselves
50:50 in the T maze. Each round of training and testing involved two
groups of flies, differing only in the order of presentation of the two
odors (CS+, OCT, and CS
, MCH,
for one group; vice versa for the second). For each reciprocal group,
the fraction of flies making the "correct" decision (COR) was
determined as the number of flies avoiding the CS+
divided by the total number of flies in the T-maze arms. Finally, a
performance index (PI) was calculated by averaging the COR values of
the two reciprocal groups of flies. PIs can range from 0 (no learning)
to 100 (perfect learning). Because each PI is an average of two
percentages, the Central Limit Theorem predicts that they should be
distributed normally (see Sokal and Rohlf, 1981
). This expectation was
determined to be true empirically with data from Tully and Quinn (1985)
and Tully and Gold (1993)
and also applies to PIs calculated from
experiments on olfactory acuity or shock reactivity (see below).
Consequently, untransformed (raw) data were analyzed parametrically
with JMP3.1 statistical software (SAS Institute Inc., Cary, NC). All
pairwise comparisons were planned. To maintain an experimentwise error
rate of
= 0.05, we adjusted the critical p values for
these individual comparisons accordingly (Sokal and Rohlf, 1981
). Three
separate experiments were done for Pavlovian learning. In the first,
conditioned odor avoidance responses in wild-type (Canton-S) flies and
homozygous 7I5 and 11D4 mutants were quantified
at 0, 15, 30, 60, and 180 min after one training session. In the
second, conditioned odor avoidance responses in wild-type (Canton-S)
and heteroallelic 7I5/11D4 mutants were quantified at 0, 15, 30, 60, 180, and 360 min after one training session. In the third,
conditioned odor avoidance responses in control
[w(isoCJ1)] and heterozygous 7I5/+ or
11D4/+ flies were quantified immediately after one training session. All three experiments were designed in a balanced manner with
two PIs per group collected per day for a total of 6 PIs per group per
experiment. Mean scores for wild-type flies did not differ at any time
point between the first two experiments, so the data were combined (see
Fig. 3A) to yield a total of 6 PIs per group (genotype and
retention time), except for Canton-S flies at 0, 15, 30, 60, and 180 min for which n = 12 PIs. PIs from these four strains
(Canton-S 7I5, 11D4, and 7I5/11D4) and five retention intervals (0, 15, 30, 60, and 180 min; the 360 min time
point was not included in the analyses because it was not done for all
strains) were subjected to a two-way ANOVA with genotype (GENO)
[F(3,130) = 86.31; p < 0.001]
and retention time (TIME) [F(4,130) = 86.70;
p < 0.001] as main effects and GENO × TIME
[F(12,130) = 0.56; p = 0.87]
as an interaction term. Values of p from subsequent planned
comparisons are summarized (see Fig. 3A). The fifteen
planned comparisons were judged significant if p
0.003. PIs from the three strains [w(isoCJ1),
7I5/+, and 11D4/+] of the third experiment were
subjected to a one-way ANOVA with GENO as the main effect. Subsequent
unplanned comparisons of each heterozygote to control flies (with
Dunnett's method) revealed significant pairwise differences
(p < 0.05).
Fig. 3.
A, Learning and memory retention of
a conditioned odor avoidance response in wild-type flies, homozygous
7I5 or 11D4 mutants, and heteroallelic
7I5/11D4 mutants. The PI is a function of the percentage
of flies that avoided the shock-associated odor versus a control odor
in a T maze. A PI of 0 represents a 50:50 distribution (no learning); a
PI of 100 represents a 0:100 distribution (strong learning). Planned
comparisons between group means at each retention time after a two-way
ANOVA (see Materials and Methods) revealed significant differences
between mutant (11D4, 7I5, and
7I5/11D4) versus wild-type (Can-S)
flies (all p values < 0.001) but no
differences among the mutants (all p values > 0.04). For each group, n = 6 PIs, except
n = 12 PIs for Can-S at 0, 15, 30, 60, and 180 min retention. Error bars indicate SEM. B,
Olfactory acuity in untrained wild-type flies and in homozygous
7I5 or 11D4 mutants. The ability of flies
to smell the odors used during conditioning experiments was assayed by
giving naive flies a choice between each odor (OCT or
MCH) versus air in the T maze. A PI was
calculated in a manner similar to that described above.
Planned comparisons between group means for each odor after a two-way
ANOVA (see Materials and Methods) revealed no significant differences
between mutant (11D4 or 7I5) versus
wild-type (Can-S) flies (all p
values > 0.15). For each group, n = 16 PIs.
Error bars indicate SEM. C, Shock reactivity in
untrained wild-type flies and in homozygous 7I5 or
11D4 mutants. The ability of flies to sense the
electroshock used during conditioning experiments and to escape from it
was assayed by giving naive flies a choice between an electrified arm
versus an unelectrified arm in the T maze. A PI was calculated in a
manner similar to that described above. Planned comparisons between
group means for each odor after a one-way ANOVA (see Materials and
Methods) revealed no significant differences between mutant
(11D4 or 7I5) versus wild-type
(Can-S) flies (both p values > 0.43). For each group, n = 8 PIs. Error bars
indicate SEM.
[View Larger Version of this Image (21K GIF file)]
Olfactory acuity. Absolute odor avoidance was quantified by
exposing groups of ~100 flies to converging currents of one of the
odors versus air at the choice point of the T maze. Numbers of flies in
each arm of the T maze were counted at the end of a 2 min exposure, and
a PI was calculated as described in Boynton and Tully (1992)
. Each data
point (see Fig. 3B) is a mean of 16 PIs. PIs from these
three genotypes (Can-S, 7I5, and 11D4) and two odors (OCT and MCH) were subjected to a two-way ANOVA with GENO
[F(2,90) = 2.77; p = 0.07] and
odor (ODOR) [F(1,90) = 1.14; p = 0.29] as main effects and GENO × ODOR
[F(2,90) = 0.13; p = 0.88] as
the interaction term. Values of p from subsequent planned comparisons are summarized (see Fig. 3B). The four planned
comparisons were judged significant if p
0.01.
Shock reactivity. Ability to sense and escape from electric
shock was quantified in a T maze modified by insertion of an
electrifiable grid into each arm (tubes of the same dimensions as the
training tube). This procedure was performed as described in Dura et
al. (1993)
. Each data point (see Fig. 3C) is a mean of eight
PIs. PIs from these three genotypes (Can-S, 7I5, and
11D4) were subjected to a one-way ANOVA with GENO
[F(2,21) = 0.39; p = 0.68] as
the main effect. Values of p from subsequent planned
comparisons are summarized (see Fig. 3C). The two planned
comparisons were judged significant if p
0.03.
Northern blot analysis. Total RNA from adults was isolated
using TRIzol reagent (GIBCO BRL). Adult heads were separated from bodies and appendages by sieving in liquid nitrogen (Levy and Manning,
1981
). Poly(A+) RNA was purified by the PolyATtract
system (Promega, Madison, WI). Five micrograms of
poly(A+) RNA were separated in each lane of a 1%
agarose/formaldehyde gel (Sambrook et al., 1989
) and blotted onto a
Hybond-N+ membrane as described by the manufacturer
(Amersham, Arlington Heights, IL). Hybridization was performed at
65°C in 5× saline-sodium phosphate-EDTA buffer (SSPE), 10% dextran
sulfate, 0.04% bovine serum albumin (BSA), 0.04%
polyvinylpyrrolidone, 0.04% Ficoll, 0.1% SDS, and 100 µg/ml
sonicated salmon sperm DNA. The blots were washed in 0.2× SSC and
0.1% SDS at 65°C. Blots from two separate RNA extractions were
probed with a class I-specific PCR product produced by amplification
between 77FI and 77F3 (see Fig. 2). These blots then were reprobed with
a DNA fragment from the ribosomal protein gene rp49
(O'Connell and Rosbash, 1984
). PKA-RI transcript levels
were normalized against rp49 levels on each blot and then averaged for the two blots to yield quantitative estimates (see Results). A third blot also was probed with pBL
25.7wc (Voth and Lee,
1989
), a P element-specific probe. Transcript sizes were deduced by
comparison with an RNA size ladder (BRL).
Western blot analysis. Total protein from adult heads was
extracted from ~200 flies of each genotype as described in Edery et
al. (1994)
, with modifications to the extraction buffer (100 mM KCl, 20 mM HEPES, pH 7.5, 5% glycerol, 20 mM
-glycerophosphate, 100 µM sodium
orthovanadate, 10 mM EDTA, 0.1% Triton X-100, 1 mM DTT, 0.5 mM PMSF, 20 µg/ml aprotinin, 5 µg/ml leupeptin, and 5 µg/ml pepstatin A). Equal amounts of each
extract (~100 µg) were separated on 7.5% SDS-PAGE gels and
electroblotted to nitrocellulose membranes. After blocking with 1% BSA
in Tris-buffered saline with Tween (TBST; 140 mM NaCl, 10 mM Tris-HCl, pH 7.5, and 0.05% Tween 20), membranes were
incubated with a polyclonal rabbit anti-PKA-RI antibody
(kindly provided by D. Kalderon), diluted 1:2000 in 5% nonfat dry
milk, in TBST for 2 hr. Filters were washed once for 15 min and 3 times
for 5 min each in TBST and incubated for 30 min with a secondary,
horseradish peroxidase (HRP)-coupled anti-rabbit antibody (Amersham;
1:5000 dilution). After washing (see above), proteins were visualized
using the Amersham ECL system, according to the manufacturer's
instructions. After a membrane was stained with the
anti-PKA-RI antibody, the same membrane was stripped (in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM
Tris-HCl, pH 6.7, for 30 min at 50°C), blocked, and incubated with a
polyclonal mouse anti-
-tubulin antibody (Sigma, St. Louis, MO;
1:200,000 dilution) as described above. The secondary antibody was
HRP-coupled anti-mouse (Amersham; 1:5000 dilution).
PKA assay. Kinase assays were performed essentially as
described by Lane and Kalderon (1993)
. Ten to 20 heads were homogenized in 200 µl of buffer A (in mM: 10 sodium phosphate, pH
6.8, 1 EDTA, 0.5 EGTA, 2.5 2-mercaptoethanol, 25 benzamidine, and 1 PMSF) and centrifuged at 10,000 × g for 10 min at
4°C. Thirty-five microliters of extract were assayed in a total
volume of 50 µl containing 50 mM
3-[N-morpholino]propanesulfonic acid (MOPS), pH 7.0, 10 mM MgCl2, 0.25 mg/ml BSA, 0.1 mM Kemptide, and 0.1 mM
[
-32P]ATP (5 Ci/mmol) at 30°C for 45 sec, with or
without 5 mM cAMP. Incorporation of label into the Kemptide
substrate was measured by spotting onto Whatman P-81 paper and washing
(three times for 2 min each) in 75 mM phosphoric acid.
Protein concentrations of extracts were determined using the Bio-Rad
reagent (Bradford, 1976
). Two replicate assays were run per extract,
and extracts from the four genotypes (Canton-S, 7I5 and
11D4 homozygotes, and 7I5/11D4 heteroallelics)
were treated in parallel with the experimenter (C.H.) blind to
genotype. This entire experiment then was repeated to yield an
n = 4 for each group. Specific activities were
calculated for each reaction tube and were determined to be normally
distributed, thereby justifying parametric statistical analyses (see
above). Of the 32 total values, one value for Can-S flies at [cAMP]
of 0 was deemed an "outlier," because it lay more than three SDs below the mean value (and clearly indicated a failed reaction). This
value was removed from the data set. Specific activity values from four
genotypes (Can-S, 7I5, 11D4, and
7I5/11D4) and two extracts (first and second) were
subjected to two separate two-way ANOVAs, one for the 0 µM cAMP group and one for the 5 µM cAMP
group with GENO [F(3,7) = 5.88 and
p = 0.025 for 0 µM cAMP;
F(3,8) = 0.69 and p = 0.58 for 5 µM cAMP] and extract (EX)
[F(1,7) = 0.02 and p = 0.902 for 0 µM cAMP; F(1,8) = 0.01 and
p = 0.951 for 5 µM cAMP] as the main
effects and GENO × EX [F(3,7) = 3.40 and
p = 0.082 for 0 µM cAMP;
F(3,8) = 0.63 and p = 0.62 for 5 µM cAMP] as the interaction term. Three planned
(orthogonal) comparisons for each [cAMP] group are summarized (Table
1). The planned comparisons were judged
significant if p
0.05 (corrections for
experimentwise error are not necessary for orthogonal comparisons).
Table 1.
Mutations in PKA-RI disrupt PKA activity
(picomoles per minute per microgram) in the absence of, but not at
saturating concentrations of, exogenous cAMP
| [cAMP] (µM)
|
Strain |
Specific activity ± SEM
(pmol·min 1·µg 1
|
|
|
Can-S |
13.7 ± 1.1
|
|
11D4/715 |
17.7 ± 0.8
|
| 0a
|
|
11D4 |
16.1
± 0.8 |
|
715 |
17.0 ± 0.9
|
|
Can-S |
80.1 ± 5.4
|
|
11D4/715 |
67.3 ± 6.4
|
| 5b
|
|
11D4 |
74.8
± 6.8 |
|
715 |
75.2
± 4.2 |
|
|
a
Specific PKA activity was quantified in
normal and mutant flies in the absence of any exogenous cAMP
([cAMP = 0]). Planned comparisons between group means after a
one-way ANOVA (see Materials and Methods) revealed no significant
differences between each homozygous mutant (11D4 or
715) and the heteroallelic mutant (715/11D4) (p = 0.13 and p = 0.49, respectively)
but a significant difference between the average of these three mutant
groups and that of wild-type (Can-S) flies (p < 0.006). n = 4 reactions per group, two from each of two
replicate tissue homogenates.
b
Specific PKA activity was quantified in normal
and mutant flies at a saturating concentration of exogenous cAMP
([cAMP = 5]). Planned comparisons between group means after a
one-way ANOVA (see Materials and Methods) revealed no significant
differences between each homozygous mutant (11D4 or
715) and the heteroallelic mutant (715/11D4)
(p = 0.43 and p = 0.41, respectively) or between the average of these three mutant groups and
that of wild-type (Can-S) flies (p = 0.33).
n = 4 reactions per group, two from each of two
replicate tissue homogenates.
|
|
RESULTS
The PKA-RI gene is expressed throughout the brain and
at high levels in mushroom bodies
The PKA-RI gene is alternatively spliced into at least
six different transcripts (classes Ia, Ib, Ic, and II-IV), all of
which contain four "common" 3
exons and each of which contains a
different 5
exon (see Fig. 2; Kalderon and Rubin, 1988
). Class I
transcripts are expressed at all developmental stages, whereas class
II-IV transcripts are detected only in adults. Class I-IV transcripts are enriched in adult heads, suggesting that a predominant component of
PKA-RI gene expression may be within the nervous system. We examined the spatial distribution of these PKA-RI
transcripts in the adult brain by RNA in situ hybridization.
The strongest signal from an antisense PKA-RI probe was to
the region of the Kenyon cell bodies (Fig.
1A). A weaker signal
was apparent throughout the cell-body layer, however, and also within
optic lobes (Fig. 1B-C). No signal was observed from
a sense probe (Fig. 1D). Because our probe recognized
all PKA-RI transcripts (Fig. 2; Materials and Methods),
isoform-specific patterns of expression could not be determined.
Nevertheless, the preferential expression of one or more of the
PKA-RI transcripts in mushroom bodies (see introductory remarks) supported the hypothesis that olfactory learning might be
defective in mutants of the PKA-RI gene.
Fig. 1.
In situ hybridization to
PKA-RI transcripts in the adult brain (200×
magnification). Twelve micrometer cryostat frontal sections of
wild-type (Canton-S) adult heads (male and females; no differences were
observed) probed with pcD6BO (see Fig. 2). A-C,
Antisense probe showing PKA-RI expression in three
serial sections of dorsal brain via mushroom bodies (c,
calyx of mushroom body, which is surrounded by Kenyon cell bodies;
OL, optic lobe; CB, central brain).
D, Sense probe showing no nonspecific signal.
[View Larger Version of this Image (106K GIF file)]
Targeted disruption of the PKA-RI gene via
site-selected P element mutagenesis
The Drosophila PKA-RI locus is located at 77F on the
third chromosome (Kalderon and Rubin, 1988
). It comprises at least five exons spanning >16 kb of genomic DNA, giving rise to six (known) alternative transcripts (Fig. 2). The
three class I transcripts (Ia, Ib, and Ic) differ from each other via
alternative splicing (and perhaps alternative transcription starts)
within the first exon. This exon encodes the N-terminal dimerization
domain of RI. Class I, II, III, and IV transcripts differ from each
other via alternative transcription starts and 5
-most exons. All six transcripts contain the four 3
-most common exons, which encode the
cAMP- and C subunit-binding domains (Kalderon and Rubin, 1988
). Conceptually, these alternatively spliced transcripts can yield three
RI protein isoforms of 41.5, 35, or 32.6 kDa.
A site-directed P element mutagenesis was performed as described in
Materials and Methods to generate mutations in the PKA-RI gene. From ~12,000 F2 females, two independent P element
insertional mutations, RI7I5 and
RI11D4, were isolated from distinct
DNA pools (70 and 110) >1 month apart. The two resulting mutant stocks
then were maintained separately (and in multiple sublines). This
mutagenesis strategy results in ~10 new insertions per F2
individual and possibly in a residuum of P elements on the
Birm-2 chromosome. Hence, to eliminate any extraneous P
elements, we outcrossed repeatedly these two mutant lines to a
wild-type (Can-S) strain, which itself is free of P elements. Southern
blots of genomic DNA from outcrossed
RI7I5 or
RI11D4 homozygotes each yielded a
single 2.6 kb BamHI fragment when probed with a P element
sequence (pBL
25.7wc; Voth and Lee, 1989
), confirming the presence of
only one P element insertion in each outcrossed mutant line. This
procedure also ensured that most of the "mutant" third chromosome
to within ± 5 map units of the P element insertion and that
>95% of the first, second, and fourth chromosomes in the outcrossed
population were of wild-type Can-S origin, thereby equilibrating the
genetic backgrounds of the mutant stocks with that of wild-type flies
(see below; Gailey et al., 1991
; Boynton and Tully, 1992
; Dura et al.,
1993
; Tully, 1996
).
The exact location of the two insertions was determined by direct
sequencing of PCR products. Both P element insertions were at the same
position, 9 bp from the 5
end of exon 1, within a 26 bp region that
contains heterogeneous start sites for class I transcripts (Fig.
2B; Kalderon and Rubin, 1988
). Both P element insertions were in the same orientation and of the same length and seem
to have been derived from a full-length P element (2.9 kb; O'Hare and
Rubin, 1983
) by an internal deletion of 1848 bp between nucleotides
394-2241 (data not shown). Given that these two P element insertions
in RI7I5 and
RI11D4 are identical in sequence,
orientation, and insertion site, they may be considered functionally
equivalent with respect to any ensuing phenotypic effects.
Reduced associative learning in PKA-RI mutants
Learning and memory in outcrossed, homozygous
RI7I5 and
RI11D4 mutants, in heteroallelic
RI7I5/RI11D4
mutants, and in wild-type flies were assayed after one training session
of the Pavlovian olfactory conditioning procedure (Tully and Quinn,
1985
; Tully et al., 1994
). This task quantifies conditioned odor
avoidance responses that result from the temporal pairing of one odor
stimulus with electroshock. A resulting PI of 0 indicates a failure to
learn, and a PI of 100 indicates that 100% of the flies learned to
avoid the shock-associated odor (see Materials and Methods).
Learning scores among the three mutant genotypes were similar, and each
was at least 25% lower than that of wild-type flies (Fig.
3A). In contrast, the learning
scores of heterozygous flies were only 8% lower than that of wild-type
flies. [PIs for 11D4/+ (79 ± 2) and 7I5/+
(79 ± 2) nevertheless were significantly lower than that for
wild-type controls (86 ± 2); p = 0.013 and 0.039 for 11D4/+ and 7I5/+, respectively;
n = 6 for each group; see Discussion]. Failure of the
7I5 and 11D4 mutations to complement in mutant
RI7I5/RI11D4
flies provides strong genetic evidence that the learning deficits of
homozygous mutants derive from disruptions of the PKA-RI
gene rather than from (unknown) second-site mutations. In contrast to
the effects on learning, memory decay rates in mutant flies seemed
normal over the first 6 hr after training (Fig. 3A; the GENO × TIME interaction term from the ANOVA was not significant; see Materials and Methods). These observations suggest that newly acquired information, although less than normal, was processed normally
via short-term memory (STM), middle-term memory (MTM), and
anesthesia-resistant memory (ARM) (cf. Tully et al., 1990
, 1994
,
1996
).
The learning deficits observed in homozygous
RI7I5 and
RI11D4 mutants did not result from
abnormalities in their abilities to sense, or react to, the odors, or
electroshock, used during conditioning. Odor avoidance responses to OCT
versus air or to MCH versus air (at concentrations used during
conditioning; see Materials and Methods) did not differ among untrained
mutant and wild-type lines (Fig. 3B). Likewise, shock
avoidance responses to 60 V did not differ among untrained mutant and
wild-type lines (Fig. 3C). These results strengthen the
conclusion that the performance deficits in mutant flies observed
during conditioning experiments resulted from subnormal associative
learning processes.
Aberrant RNA and protein processing in
PKA-RI mutants
We sought corroborative evidence of molecular abnormalities
underlying this disruption of associative learning in mutants of the
PKA-RI gene. As discussed above, the PKA-RI locus
gives rise to several distinct mRNA classes transcribed from different promoters and spliced to a common body (Fig. 2A). Our
site-selected mutagenesis yielded two P element insertions into a
region of heterogeneous transcription start sites 5
to the first exon
(Fig. 2B; see above). Northern and Western blot
analyses on RNA or protein extracts from adult heads were done to
evaluate the molecular effects of these mutations.
Poly(A+) RNA was extracted from homozygous
RI7I5 or
RI11D4 mutants, heteroallelic
RI7I5/RI11D4
mutants, and wild-type (Can-S) flies (Fig.
4), blotted, and probed with a PCR
product (between primers 77F1 and 77F3) derived from the first exon
(Fig. 4A). This probe revealed class I transcripts (Ia, Ib, and Ic were all ~3.8 kb) in both wild-type and mutant extracts, along with a novel 4.8 kb RNA species in mutant extracts (Fig. 4A). To quantify differences between the
wild-type and mutant 3.8 kb transcripts, we prepared a second
independent extract and blotted and probed it again. Concentrations of
the 3.8 kb band then were normalized against rp49 (see Fig.
4A) and averaged, indicating 152 ± 4%,
153 ± 7%, and 178 ± 2% of normal levels of the 3.8 kb
transcripts in mutant
RI7I5/RI7I5,
RI11D4/RI11D4,
and
RI7I5/RI11D4
extracts, respectively. [These quantitative increases reflect only a
net effect among the three class I transcripts (Ia, Ib, and Ic).
Conceivably, expression of one or more might be lower than normal and
obscured by overexpression of the others. In addition, these
quantitative changes might reflect differences in spatial patterns of
expression.] Another Northern blot, probed with a cDNA (pcD6BO) that
hybridizes with all known PKA-RI transcripts, indicated that
all class I-IV transcripts were present in mutant RNA extracts (data
not shown).
Fig. 4.
Aberrant gene expression in PKA-RI
mutants. A, Northern blot analysis of
poly(A+) RNA extracted from heads of Canton-S
(Can-S) flies, homozygous RI7I5 and
RI11D4 mutants, and heteroallelic
RI7I5/RI11D4
mutants and probed with a PCR product specific to class I transcripts (see Fig. 2). Signals of rp49 were used for
normalization; PKA-RI band intensities were quantified
by phosphorimage analysis, indicating a 150% net increase in class I
transcripts in mutants (see text). A novel 4.8 kb RNA species also was
detected in mutant extracts. B, P element-specific probe
hybridized only to the novel 4.8 kb transcript in mutants on a Northern
blot similar to that described in A, indicating
transcription of an aberrant PKA-RI message from within
the P element. C, Western blot analysis of total protein extracted from heads of Canton-S (Can-S) flies,
homozygous RI7I5 and
RI11D4 mutants, and heteroallelic
RI7I5/RI11D4
mutants and probed with a rabbit polyclonal antibody to bacterially expressed class I RI protein. Although cross-reacting with several proteins, this anti-RI recognized three proteins at 50, 48, and ~40
kDa, which were expressed at lower-than-normal levels in mutants. In
contrast, a fourth protein was recognized near 84 kDa, which was
expressed at a higher-than-normal level in mutants. Also apparent were
several other cross-reacting proteins, which were expressed at similar
levels among wild-type and mutant flies. Anti-
-tubulin (
-tub) was used as a loading control for this
experiment.
[View Larger Version of this Image (55K GIF file)]
One of these Northern blots also was reprobed with a P element probe.
This probe hybridized with the novel 4.8 kb transcript in mutant RNA
extracts. Thus, this RNA species is likely derived from transcription
initiation within the P element, which then extended into the
PKA-RI transcription unit.
This result also suggested that an aberrant protein may be produced
from the novel RNA species in mutant flies. To pursue this notion, we
extracted total protein from homozygous
RI7I5 or
RI11D4 mutants, heteroallelic
RI7I5/RI11D4
mutants, and wild-type (Can-S) adult head and blotted and probed the
protein with a polyclonal antibody raised against in vitro translated RI protein from a class I cDNA (kindly provided by D. Kalderon). This antibody recognized four proteins that showed differences between mutant and wild-type flies, although several cross-reacting bands, which did not differ in intensity among wild-type
and mutant extracts, also were apparent (Fig. 4C). (This level of cross-reactivity also precluded an analysis of RI
immunochemistry in situ; see Discussion). As a loading
control, the blot was reprobed with an antibody raised against
-tubulin (see Fig. 4C, bottom). Three bands,
near 50, 48, and ~40 kDa, were less intense in each of the mutant
extracts than in that from wild-type flies. In contrast, one band near
84 kDa was more intense in mutant extracts than in that from wild-type
flies. The 50 kDa band is of a size similar to that observed for
bacterially expressed class I RI protein (D. Kalderon, personal
communication). The 48 and ~40 kDa bands likely correspond to RI
isoforms derived from class II and class III/IV transcripts,
respectively, or they may be degradation products of the class I
isoform. The origin of the 84 kDa band is uncertain but may represent
an antimorphic protein derived from the aberrant RNA transcript in
mutant flies (Fig. 4A,B). Its
overabundance in mutant flies nevertheless suggested a potential
dominant-negative role for this mutant protein (see Discussion). In any
case, the RI7I5 and
RI11D4 mutations seem to have
yielded aberrant levels of expression of these proteins, and they
failed to complement each other (in RI7I5/RI11D4
flies) for all of these molecular defects.
Defective PKA biochemistry in PKA-RI mutants
A subtle but significant defect in PKA activity also was detected
in mutant genotypes. cAMP-dependent kinase activity was assayed in
adult head homogenates using Kemptide as a specific substrate (Lane and
Kalderon, 1993
; see Materials and Methods). In the absence of any
exogenous cAMP, PKA activity in heteroallelic RI7I5/RI11D4
mutants did not differ from homozygous
RI7I5 (p = 0.49) or RI11D4
(p = 0.13) mutants. Mutant PKA activity was
significantly higher than that of wild-type flies, however
(p = 0.006; Table 1. Failure to complement the
mutant phenotypes of homozygous 7I5 and 11D4 flies by heteroallelic
RI7I5/RI11D4
flies, indicates that disruption of the PKA-RI gene is
responsible for the biochemical abnormality (also the case for learning
defects; Fig. 3A). At a saturating concentration of cAMP (5 µM), PKA activity levels were similar among mutant and
wild-type flies (Table 1).
These results indicate that less RI protein is available in mutants
flies to bind to PKA catalytic subunits. This effect is most apparent
at lower cAMP concentrations when more regulatory subunits are
available to bind with PKA catalytic subunits, thereby inhibiting its
activity. In contrast, fewer regulatory subunits are available to bind
to catalytic subunits at higher cAMP concentrations, thereby
diminishing functional differences between mutant and wild-type tissue.
The difference in PKA activity between mutant and wild-type tissue at
low cAMP concentration was not detected in whole-fly homogenates (data
not shown), which is consistent with the observation that
PKA-RI is preferentially expressed in mushroom bodies of
adult heads (Fig. 1). Additionally, the similarity in PKA activity
between mutant and wild-type tissue at high cAMP concentration suggests
the absence of any developmental or biochemical compensation in PKA
catalytic activity.
DISCUSSION
Although the studies by Drain et al. (1991)
, Skoulakis et al.
(1993)
, and Li et al. (1996)
all provide evidence of the involvement of
cAMP-dependent protein kinase in Drosophila olfactory
learning, they did not reveal which endogenous regulatory subunit of
PKA is involved in vivo. In particular, Drain et al. (1991)
induced the expression of a murine type II transgene throughout the
nervous system. Consequently, ectopic expression of the RII subunit in inappropriate cells may have disrupted learning indirectly, or alternatively, PKA activity normally modulated by RI subunits may have
been disrupted artificially by overexpression of murine RII in the same
neurons.
These issues raised a legitimate question about which type of
endogenous regulatory subunit (RI, RII, or both) might be involved in
associative learning. Because the wild-type PKA-RI gene in Drosophila was cloned and because we observed one or more
PKA-RI transcripts to be expressed at high levels in the
adult mushroom bodies (Fig. 1), we targeted disruptions of the gene via
site-selected P element mutagenesis (Fig. 2; Kaiser and Goodwin, 1990
).
The resulting homozygous mutants (1) seem viable and fertile with no
obvious morphological defects, (2) show reduced olfactory learning (Fig. 3A) without affecting sensory acuities for odor (Fig.
3B) or electroshock (Fig. 3C), (3) overexpress
wild-type transcript(s) and express a novel 4.8 kb transcript (Fig.
4A,B), (4) underexpress three putative RI proteins
and overexpress a novel protein (Fig. 4C), and (5) show
increased levels of baseline PKA activity in adult head homogenates in
the absence of exogenous cAMP but normal PKA activity levels in the
presence of saturating concentrations of cAMP (Table 1). These
phenotypic aberrations clearly are produced by disruption of the
PKA-RI gene, because the original
RI7I5 and
RI11D4 mutants were outcrossed to
wild-type flies to remove any second-site mutations, and subsequently,
the outcrossed mutant alleles still failed to complement each other at
each phenotypic level of analysis. Thus, these data argue that
PKA-RI is involved with olfactory associative learning.
Molecularly, an exact mechanistic explanation of how these mutations of
PKA-RI lead to a reduction in PKA activity and associative learning is not yet clear. The P element insertions into
PKA-RI produce a complex effect on RI expression in adult
heads. First, levels of (class I) wild-type transcripts are increased.
Second, a novel transcript is initiated from within the P element
sequence. Third, levels of (putative) wild-type RI isoforms are
decreased. And fourth, levels of an unknown protein are increased. The
net effects, however, are reduced PKA activity and olfactory learning. One plausible interpretation of these molecular observations is that
the mutant 4.8 kb transcript encodes a mutant 84 kDa protein (Fig.
4B), which is capable of binding with wild-type RI
but which then interferes with normal interactions between the +/
hybrid regulatory subunit dimers and PKA catalytic subunit dimers.
Abnormal interaction with catalytic subunits then may result in a
shorter half-life for wild-type RI protein(s) (Fig. 4C). One
implication from this interpretation is that the PKA-RI
mutation might have a dominant-negative (antimorphic) effect on
wild-type RI. Heterozygous RI7I5/+
or RI11D4/+ flies show only an 8%
(but significant) reduction in learning compared with wild-type
controls (see above), however, indicating a weak semidominant effect at
best. Possibly, this dominant-negative effect might become more
pronounced in homozygous mutants in which the ratio of mutant to
wild-type RI protein would increase multiplicatively.
Null mutations in DC0 are developmentally lethal (Lane and
Kalderon, 1993
). Consequently, we do not rule out the possibility that
more severe mutations in PKA-RI may promote maldevelopment, if not lethality. Our extant PKA-RI mutations, however,
produce only a slight effect on PKA biochemistry: no defect is detected in whole-fly homogenates or in adult head homogenates at saturating concentrations of cAMP, and a 25% increase is detected in
adult head homogenates in the absence of cAMP. This subtle biochemical defect nevertheless yields a 30% reduction in learning with no abnormalities in sensorimotor responses. The magnitude of this learning
defect is similar to that produced after induced overexpression of a
PKA catalytic subunit in adults (Drain et al., 1991
). Taken together,
these data argue that the primary effect of the PKA-RI mutations is functional rather than developmental. This issue cannot be
resolved fully, however, until future experiments use more
sophisticated genetic tools to induce a disruption of PKA-RI only in adults (cf. Drain et al., 1991
; Yin et al., 1994
).
Our study and others have shown in Drosophila that
disruptions of both a regulatory and a catalytic subunit gene, which
either decrease or increase PKA activity, all yield reductions in
olfactory learning (Drain et al., 1991
; Skoulakis et al., 1993
; Li et
al., 1996
). Similarly, disruptions of rutabaga adenylyl
cyclase or dunce phosphodiesterase, which either increase or
decrease cAMP levels, respectively, also yield reductions in olfactory
learning (for review, see Tully, 1991
). Together, these results suggest an optimal range of cAMP signaling for normal adult plasticity (cf.
Zhong and Wu, 1991
). An interesting behavioral difference exists,
however, between the cAMP mutants (dunce and
rutabaga) and the PKA activity mutants (PKA-RI,
DC0, and transgenic flies overexpressing inhibitor peptide,
truncated mammalian RII, or catalytic subunit). The latter seem to
disrupt conditioned behavior immediately after training with no effect
on memory decay rates, although the former disrupt both initial
learning levels and memory decay rates. At face value, this observation
suggests the direct involvement of cAMP in (short-term) memory
processing. Importantly, the chronic (developmental) effects of these
disruptions will have to be distinguished from their acute effects
during adult learning and memory formation before more specific
functions can be assigned to each component of the cAMP signaling
pathway. To this end, study of a temperature-sensitive mutation of
DC0 has revealed a temperature shift-specific effect of PKA
on middle-term memory (MTM) during adult olfactory learning (Li et al.,
1996
).
Our results neither preclude an additional role for RII regulatory
subunits (see above) nor identify specific cells in the brain wherein
disruption of PKA-RI is required to produce the observed
effect on behavioral plasticity. Future studies, using gene disruptions
of Drosophila RII (which has not yet been identified genetically or cloned) or using enhancer-trap technology to restrict RI
disruption or mutant RI "rescue" to specific regions of the brain
(cf. Connolly et al., 1996
), likely will delineate these functional
subtleties. Chemical ablation of adult mushroom body neurons, however,
has demonstrated a role for this brain region in olfactory associative
learning (de Belle and Heisenberg, 1994
; cf. Heisenberg et al., 1985
).
Spatially restricted disruption of G-protein function also has
indicated a role for cAMP signaling in mushroom bodies during olfactory
associative learning (Connolly et al., 1996
). Consistent with these
interventionist experiments, the dunce, rutabaga,
DC0, and PKA-RI genes all seem to be expressed preferentially in mushroom bodies (Fig. 1) (Nighorn et al., 1991
; Han
et al., 1992
; Skoulakis et al., 1993
; cf. P.-L. Han et al., 1996
).
These observations, taken together with more general cellular considerations from work on Aplysia (Byrne and Kandel,
1996
), suggest a neuronal model of olfactory associative learning in Drosophila (Fig. 5) (cf.
K. A. Han et al., 1996
).
Fig. 5.
A neuronal model for olfactory associative
learning in Drosophila, involving the cAMP signal
transduction pathway. Sensory input from olfactory cues produces neural
activity in mushroom body neurons (MBNs), producing an
increase in intracellular calcium. Sensory input from footshock also
activates MBNs via a modulatory neuron, which releases
dopamine (DA) or serotonin (5HT)
synthesized by the Dopa decarboxylase
(Ddc) gene. This monoamine neurotransmitter binds to its
postsynaptic receptor (R?) on the MBNs
and activates a rutabaga (rut)-encoded
adenylyl cyclase (AC) via a stimulatory subunit of
G-protein (Gs), which itself is encoded by the
Drosophila Gs
(dGs
) gene.
Coincident activation of AC by calcium and G-protein leads to a synergistic increase in intracellular cAMP, which is hydrolyzed by dunce (dnc)-encoded
phosphodiesterase (PDE). Increased cAMP levels may be
involved in several intracellular effects (?), but nevertheless cAMP binds to an RI regulatory subunit of PKA (RI), encoded by the Drosophila
PKA-RI (dPKA-RI) gene. cAMP binding causes RI dimers to disassociate from dimers of the PKA catalytic subunit (PKA), encoded by DC0. Free
PKA then is able to phosphorylate many cytoplasmic
targets (?), one of which is a potassium channel (K+ channel)
composed of Shaker subunits. Free PKA
also is translocated to the nuclei of MBNs, where it
phosphorylates the CREB transcription factor (CREB)
encoded by dCREB2. Phosphorylated CREB
then initiates a cascade of gene expression that produces gene products
(?) involved with long-term functional and
structural changes at MBN synapses. The neuronal effect
of these biochemical changes is to increase transmitter efficacy
between MBNs and their follower neurons, which mediate
the motor output responsible for conditioned odor avoidance responses.
This model assumes MBNs to be sights of associative learning because
chemical ablation of MBNs or molecular disruption of G-protein function
in MBNs completely abolishes olfactory associative learning. Protein
components of the signal transduction pathway are labeled only after
disruptions of identified genes are shown to produce defects in
olfactory associative learning that cannot be attributed to nonspecific
effects on the sensory or motor responses required to perform this
task. Other neural substrates or signal transduction pathways will be
added to this working model as they are revealed in future studies (see
text for more details).
[View Larger Version of this Image (22K GIF file)]
In this model, mushroom body neurons (MBNs) serve to integrate sensory
input from olfactory cues and footshock (electroshock). Olfactory cues
lead to activity in MBNs, which produces a rise in intracellular
calcium. Footshock leads to activity in modulatory neurons, which then
stimulates adenylyl cyclase (AC) in MBNs via release of a monoamine
neurotransmitter. A stimulatory G-protein (Gs) mediates communication
between the ligand-bound neurotransmitter receptor (R?) and AC.
Coincident activation of these two input paths during associative
learning produces a synergistic effect on AC activation in MBNs,
thereby producing relatively large increases in cAMP. Excess cAMP may
interact with several targets, including cyclic nucleotide ion channels
(Delgado et al., 1991
). Binding to RI regulatory subunit (RI) causes
disassociation of RI dimers from dimers of the PKA catalytic subunit
(PKA). Activated PKA then potentially phosphorylates many integral
membrane proteins (?), one of which may be a potassium channel (Drain
et al., 1994
; Wright and Zhong, 1995
). Activated PKA also is
translocated into the nucleus where it may phosphorylate the CREB
transcription factor (Yin et al., 1994
, 1995a
,b
), which initiates a
cascade of gene expression that ultimately produces structural and
functional changes at the synapse between MBNs and follower neurons
mediating conditioned odor avoidance responses (cf. Davis et al.,
1996
).
We have included in this model only those genes for which disruptions
have yielded functional effects on olfactory associative learning (Fig.
5 legend). Thus, many mechanistic aspects of this model remain to be
elucidated. To this end, a novel dopamine D1 receptor, which is
expressed preferentially in MBNs, recently has been cloned in
Drosophila (K.-A. Han et al., 1996
). Disruptions of this
candidate receptor may yet reveal whether it participates in olfactory
associative learning. Similarly, no CREB-dependent "downstream"
genes yet are known, but they likely will reveal structural and
functional components of long-term memory formation. Importantly, this
model does not exclude (1) the involvement of other "associative
centers" in the Drosophila brain during olfactory learning
or during other types of learning (cf. Menzel et al., 1991
), (2) the
involvement of other signal transduction pathways (cf. Griffith et al.,
1993
; Kane et al., 1997
), or (3) any further anatomical distinction
between learning and memory storage or retrieval. Further
identification of genes involved with behavioral plasticity and
cellular localization of their corresponding gene products likely will
discover such complexity to exist in Drosophila, as it does
in other species.
FOOTNOTES
Received April 9, 1997; revised Aug. 27, 1997; accepted Aug. 29, 1997.
S.F.G was supported by a postgraduate studentship from the Department
of Education for Northern Ireland. Additional support came from Medical
Research Council Grants to K.K. and National Institutes of Health Grant
HD32245, a McKnight Scholars Award, and a John Merck Scholarship Grant
to T.T. We thank Audrey Duncanson, Jeff C. Hall, John W. Sentry, Joshua
Dubnau, Gert Bolwig, John Connolly, and Marcia Belvin for helpful
discussions and critical reading of this manuscript, Dan Kalderon for
plasmids and the RI antibody, Kevin O'Hare for sequencing primers,
Ming Yao Yang for cryostat sections, and Ed Dougherty and Brigitte
Frisch for photographic assistance.
Correspondence should be addressed to Dr. Stephen F. Goodwin,
Department of Biology, 235 Bassine Building, Brandeis University, 415 South Street, Waltham, MA 02254-9110.
REFERENCES
-
Ashburner M
(1989)
In: Drosophila. A laboratory manual, Ed 1. Plainview, NY: Cold Spring Harbor Laboratory.
-
Boynton S,
Tully T
(1992)
Latheo, a new gene involved in associative learning and memory in Drosophila melanogaster identified from P element mutagenesis.
Genetics
131:655-672[Abstract].
-
Bradford MM
(1976)
A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:248-254[Web of Science][Medline].
-
Bregman DB,
Bhattacharyya N,
Rubin CS
(1989)
High affinity binding protein for the regulatory subunit of cAMP-dependent protein kinase II
: cloning, characterization, and expression of cDNAs for rat brain P150.
J Biol Chem
264:4648-4656[Abstract/Free Full Text]. -
Bregman DB,
Hirsch AH,
Rubin CS
(1991)
Molecular characterization of bovine brain P75, a high affinity binding protein for the regulatory subunit of cAMP-dependent protein kinase II beta.
J Biol Chem
266:7207-7213[Abstract/Free Full Text].
-
Byrne JH,
Kandel ER
(1996)
Presynaptic facilitation revisited: state and time dependence.
J Neurosci
16:425-435[Abstract/Free Full Text].
-
Cadd G,
McKnight GS
(1989)
Distinct patterns of cAMP-dependent protein kinase gene expression in mouse brain.
Neuron
3:71-79[Web of Science][Medline].
-
Cadd G,
Uhler MD,
McKnight GS
(1990)
Holoenzymes of cAMP-dependent protein kinase containing the neural form of type I regulatory subunit have an increased sensitivity to cyclic nucleotides.
J Biol Chem
265:19502-19506[Abstract/Free Full Text].
-
Connolly JB,
Roberts IJH,
Armstrong D,
Kaiser K,
Forte M,
Tully T,
O'Kane CJ
(1996)
Associative learning disrupted by impaired Gs signaling in Drosophila mushroom bodies.
Science
274:2104-2106[Abstract/Free Full Text].
-
Davis GW,
Schuster CM,
Goodman CS
(1996)
Genetic dissection of structural and functional components of synaptic plasticity. III. CREB is necessary for presynaptic functional plasticity.
Neuron
17:669-679[Web of Science][Medline].
-
Davis RL
(1993)
Mushroom bodies and Drosophila learning.
Neuron
11:1-14[Web of Science][Medline].
-
de Belle JS,
Heisenberg M
(1994)
Associative odor learning in Drosophila abolished by chemical ablation of mushroom bodies.
Science
263:692-695[Abstract/Free Full Text].
-
Delgado R,
Hidalgo P,
Diaz F,
Latorre R,
Labarca P
(1991)
A cyclic AMP-activated K+ channel in Drosophila larval muscle is persistently activated in dunce.
Proc Natl Acad Sci USA
88:557-560[Abstract/Free Full Text].
-
Drain P,
Folkers E,
Quinn WG
(1991)
cAMP-dependent protein kinase and the disruption of learning in transgenic flies.
Neuron
6:71-82[Web of Science][Medline].
-
Drain P,
Dubin AE,
Aldrich RW
(1994)
Regulation of Shaker potassium channel inactivations gating by the cAMP-dependent protein kinase.
Neuron
12:1097-1109[Web of Science][Medline].
-
Dura JM,
Preat T,
Tully T
(1993)
Identification of linotte, a new gene affecting learning and memory in Drosophila melanogaster.
J Neurogenet
9:1-14[Web of Science][Medline].
-
Edery I,
Zwiebel LJ,
Dembinska ME,
Rosbash M
(1994)
Temporal phosphorylation of the Drosophila period protein.
Proc Natl Acad Sci USA
91:2260-2264[Abstract/Free Full Text].
-
Feinberg AP,
Vogelstein B
(1983)
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
132:6-13[Web of Science][Medline].
-
Finbow ME,
Goodwin SF,
Meagher L,
Lane NJ,
Keen JN,
Findlay JBC,
Kaiser K
(1994)
Evidence that the 16 kDa proteolipid (subunit c) of the vacuolar H+-ATPase and ductin from gap junctions are the same polypeptide in Drosophila and Manduca: molecular cloning of the Vha 16k gene from Drosophila.
J Cell Sci
107:1817-1824[Abstract].
-
Foster JL,
Guttman JJ,
Rosen OM
(1984)
Drosophila cAMP-dependent protein kinase.
J Biol Chem
259:13049-13055[Abstract/Free Full Text].
-
Foster JL,
Higgins GC,
Jackson FR
(1988)
Cloning, sequence, and expression of the Drosophila cAMP-dependent protein kinase catalytic subunit gene.
J Biol Chem
263:1676-1681[Abstract/Free Full Text].
-
Gailey DA,
Villella A,
Tully T
(1991)
Reassessment of the effect of biological rhythm mutations on learning in Drosophila melanogaster.
J Comp Physiol [A]
169:685-697[Medline].
-
Greenberg SM,
Castellucci VF,
Bayley H,
Schwartz JH
(1987)
A molecular mechanism for long-term sensitization in Aplysia.
Nature
329:62-65[Medline].
-
Griffith LC,
Verselis LM,
Aitken KM,
Kyriacou CP,
Danho W,
Greenspan RJ
(1993)
Inhibition of calcium/calmodulin dependent protein kinase in Drosophila disrupts plasticity.
Neuron
10:501-509[Web of Science][Medline].
-
Hammer M,
Menzel R
(1995)
Learning and memory in the honeybee.
J Neurosci
15:1617-1630[Abstract].
-
Han K-A,
Millar NS,
Grotewiel MS,
Davis RL
(1996)
DAMB, a novel dopamine receptor expressed specifically in Drosophila mushroom bodies.
Neuron
16:1127-1135[Web of Science][Medline].
-
Han P-L,
Levin LR,
Reed RR,
Davis RL
(1992)
Preferential expression of the Drosophila rutabaga gene in mushroom bodies, neural centres for learning in insects.
Neuron
9:619-627[Web of Science][Medline].
-
Han P-L,
Meller V,
Davis RL
(1996)
The Drosophila brain revisited by enhancer detection.
J Neurobiol
31:88-102[Web of Science][Medline].
-
Heisenberg M,
Borst A,
Wagner S,
Byers D
(1985)
Drosophila mushroom body mutants are deficient in olfactory learning.
J Neurogenet
2:1-30[Web of Science][Medline].
-
Kaiser K,
Goodwin SF
(1990)
"Site-selected" transposon mutagenesis of Drosophila.
Proc Natl Acad Sci USA
87:1686-1690[Abstract/Free Full Text].
-
Kalderon D,
Rubin GM
(1988)
Isolation and characterization of Drosophila cAMP-dependent protein kinase genes.
Genes Dev
2:1539-1556[Abstract/Free Full Text].
-
Kandel ER,
Schwartz JH
(1982)
Molecular biology of learning: modulation of transmitter release.
Science
218:433-443[Abstract/Free Full Text].
-
Kane NS,
Robichon A,
Dickinson JA,
Greenspan RJ
(1997)
Learning without performance in PKC-deficient Drosophila.
Neuron
18:307-314[Web of Science][Medline].
-
Lane ME,
Kalderon D
(1993)
Genetic investigation of cAMP-dependent protein kinase function in Drosophila development.
Genes Dev
7:1229-1243[Abstract/Free Full Text].
-
Levy LS,
Manning JE
(1981)
Messenger RNA sequence complexity and homology in developmental stages of Drosophila.
Dev Biol
85:141-149[Web of Science][Medline].
-
Li W,
Tully T,
Kalderon D
(1996)
Effects of a conditional Drosophila PKA mutant on learning and memory.
Learn Mem
2:320-333.[Abstract/Free Full Text]
-
Lindsley DL,
Zimm GG
(1992)
In: The genome of Drosophila melanogaster. San Diego: Academic.
-
McKnight GS
(1991)
Cyclic AMP second messenger systems.
Curr Opin Cell Biol
3:213-217[Medline].
-
Menzel R,
Hammer M,
Braun G,
Mauelshagen J,
Sugawa M
(1991)
Neurobiology of learning and memory in honeybees.
In: The behavior and physiology of bees (Goodman LJ,
Fisher RC,
eds), pp 323-353. London: CAB International.
-
Müller U,
Spatz H
(1989)
Ca2+-dependent proteolytic modification of the cAMP-dependent protein-kinase in Drosophila wild-type and dunce memory mutants.
J Neurogenet
6:95-114[Web of Science][Medline].
-
Nighorn A,
Healy MJ,
Davis RL
(1991)
The cyclic AMP phosphodiesterase encoded by the Drosophila dunce gene is concentrated in the mushroom body neuropil.
Neuron
6:455-467[Web of Science][Medline].
-
O'Connell P,
Rosbash M
(1984)
Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene.
Nucleic Acids Res
12:5495-5513[Abstract/Free Full Text].
-
O'Hare K,
Rubin GM
(1983)
Structure of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome.
Cell
34:25-35[Web of Science][Medline].
-
O'Hare K,
Driver A,
McGrath S,
Johnson-Schiltz DM
(1992)
Distribution of cloned P elements from the Drosophila melanogaster P strain
2.
Genet Res
60:33-41[Web of Science][Medline]. -
Patel NH,
Goodman CS
(1992)
Detection of even-skipped transcripts in Drosophila embryos with PCR/DIG-labeled DNA probes.
In: Nonradioactive in situ hybridization application manual, pp 62-63. Boehringer Mannheim Biochemica.
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual. Plainview, NY: Cold Spring Harbor Laboratory.
-
Schwartz JH,
Greenberg SM
(1987)
Molecular mechanisms for memory: second-messenger induced modifications of protein kinases in nerve cells.
Annu Rev Neurosci
10:459-476[Web of Science][Medline].
-
Scott JD
(1991)
The cyclic nucleotide-dependent protein kinases.
Pharmacol Ther
14:1-24.
-
Scott JD,
Soderling TR
(1992)
Serine/threonine protein kinases.
Curr Opin Neurobiol
2:289-295[Medline].
-
Skoulakis EMC,
Kalderon D,
Davis RL
(1993)
Preferential expression in mushroom bodies of the catalytic subunit of protein kinase A and its role in learning and memory.
Neuron
11:197-208[Web of Science][Medline].
-
Sokal RR,
Rohlf FJ
(1981)
In: Biometry: the principle of statistics in biological research. New York: Freeman.
-
Taylor SS,
Buechler JA,
Yonemoto W
(1990)
cAMP-dependent protein kinase: framework for a regulatory diverse family of regulatory enzymes.
Annu Rev Biochem
59:971-1005[Web of Science][Medline].
-
Tully T
(1991)
Genetic dissection of learning and memory in Drosophila melanogaster.
In: Neurobiology of learning, emotion and affect (Madden IV J,
ed), pp 30-66. New York: Raven.
-
Tully T
(1996)
Discovery of genes involved with learning and memory: an experimental synthesis of Hirschian and Benzerian perspectives.
Proc Natl Acad Sci USA
93:13460-13467[Abstract/Free Full Text].
-
Tully T,
Gold D
(1993)
Differential effects of dunce mutations on associative learning and memory in Drosophila.
J Neurogenet
9:55-71[Web of Science][Medline].
-
Tully T,
Quinn WG
(1985)
Classical conditioning and retention in normal and mutant Drosophila melanogaster.
J Comp Physiol [A]
157:263-277[Medline].
-
Tully T,
Boynton S,
Brandes C,
Dura J-M,
Mihalek R,
Préat T,
Villella A
(1990)
Genetic dissection of memory formation in Drosophila melanogaster.
Cold Spring Harb Symp Quant Biol
55:203-211[Abstract/Free Full Text].
-
Tully T,
Préat T,
Boynton SC,
Del Vecchio M
(1994)
Genetic dissection of consolidated memory in Drosophila.
Cell
79:35-47[Web of Science][Medline].
-
Tully T,
Bolwig G,
Christensen J,
Connolly J,
Del Vecchio M,
DeZazzo J,
Dubnau J,
Pinto S,
Regulski M,
Svedberg B,
Velinzon K
(1996)
A return to genetic dissection of memory in Drosophila.
In: Cold Spring Harbor Symposium on quantitative biology: function and dysfunction of the nervous system. Cold Spring Harbor, NY: Cold Spring Harbor.
-
Voth WP,
Lee CS
(1989)
Improved yield of helper P-element by switching its vector from pBR322 to pBluescript.
Nucleic Acids Res
17:6424[Free Full Text].
-
Winship PR
(1989)
An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide.
Nucleic Acids Res
17:1266[Free Full Text].
-
Wright NJD,
Zhong Y
(1995)
Characterization of K+ currents and the cAMP-dependent modulation in cultured Drosophila mushroom body neurons identified by lacZ expression.
J Neurosci
15:1025-1034[Abstract].
-
Yin JCP,
Wallach JS,
Del Vecchio M,
Wilder EL,
Zhou H,
Quinn WG,
Tully T
(1994)
Induction of a dominant-negative CREB transgene blocks long-term memory in Drosophila.
Cell
79:49-58[Web of Science][Medline].
-
Yin JCP,
Vecchio MD,
Zhou H,
Tully T
(1995a)
CREB as a memory modulator: induced expression of a dCREB2 isoform enhances long-term memory in Drosophila.
Cell
81:107-115[Web of Science][Medline].
-
Yin JCP,
Wallach JS,
Wilder EL,
Klingensmith J,
Dang D,
Perrimon N,
Zhou H,
Tully T,
Quinn WG
(1995b)
Drosophila CREB/CREM homolog encodes multiple isoforms including a PKA-responsive transcriptional activator and antagonist.
Mol Cell Biol
15:5123-5130[Abstract].
-
Zhong Y,
Wu CF
(1991)
Altered synaptic plasticity in Drosophila memory mutants with a defective cAMP cascade.
Science
251:198-201[Abstract/Free Full Text].
This article has been cited by other articles:

|
 |

|
 |
 
J. Horiuchi, D. Yamazaki, S. Naganos, T. Aigaki, and M. Saitoe
Protein kinase A inhibits a consolidated form of memory in Drosophila
PNAS,
December 30, 2008;
105(52):
20976 - 20981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lu, Y.-S. Lu, Y. Shuai, C. Feng, T. Tully, Z. Xie, Y. Zhong, and H.-M. Zhou
The AKAP Yu is required for olfactory long-term memory formation in Drosophila
PNAS,
August 21, 2007;
104(34):
13792 - 13797.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yoshida, H-A. J. Muller, A. Wodarz, and A. Ephrussi
PKA-R1 spatially restricts Oskar expression for Drosophila embryonic patterning
Development,
March 15, 2004;
131(6):
1401 - 1410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, J.-Y. Hu, S. Schacher, and J. H. Schwartz
The Two Regulatory Subunits of Aplysia cAMP-Dependent Protein Kinase Mediate Distinct Functions in Producing Synaptic Plasticity
J. Neurosci.,
March 10, 2004;
24(10):
2465 - 2474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. T. Chang, Y.-J. Shi, and K.-T. Min
The Drosophila homolog of Down's syndrome critical region 1 gene regulates learning: Implications for mental retardation
PNAS,
December 23, 2003;
100(26):
15794 - 15799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Watanabe, M. Ichihara, M. Hashimoto, K. Shimono, Y. Shimoyama, T. Nagasaka, Y. Murakumo, H. Murakami, H. Sugiura, H. Iwata, et al.
Characterization of Gene Expression Induced by RET with MEN2A or MEN2B Mutation
Am. J. Pathol.,
July 1, 2002;
161(1):
249 - 256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-D. Yao and C.-F. Wu
Distinct Roles of CaMKII and PKA in Regulation of Firing Patterns and K+ Currents in Drosophila Neurons
J Neurophysiol,
April 1, 2001;
85(4):
1384 - 1394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H. Harum, L. Alemi, and M. V. Johnston
Cognitive impairment in Coffin-Lowry syndrome correlates with reduced RSK2 activation
Neurology,
January 23, 2001;
56(2):
207 - 214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Renger, A. Ueda, H. L. Atwood, C. K. Govind, and C.-F. Wu
Role of cAMP Cascade in Synaptic Stability and Plasticity: Ultrastructural and Physiological Analyses of Individual Synaptic Boutons in Drosophila Memory Mutants
J. Neurosci.,
June 1, 2000;
20(11):
3980 - 3992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Thiele, B. Willis, J. Stadler, J. G. Reynolds, I. L. Bernstein, and G. S. McKnight
High Ethanol Consumption and Low Sensitivity to Ethanol-Induced Sedation in Protein Kinase A-Mutant Mice
J. Neurosci.,
May 15, 2000;
20(10):
RC75 - RC75.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-D. Yao, J. Rusch, M.-m. Poo, and C.-F. Wu
Spontaneous Acetylcholine Secretion from Developing Growth Cones of Drosophila Central Neurons in Culture: Effects of cAMP-Pathway Mutations
J. Neurosci.,
April 1, 2000;
20(7):
2626 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. F. Goodwin, B. J. Taylor, A. Villella, M. Foss, L. C. Ryner, B. S. Baker, and J. C. Hall
Aberrant Splicing and Altered Spatial Expression Patterns in fruitless Mutants of Drosophila melanogaster
Genetics,
February 1, 2000;
154(2):
725 - 745.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. D. Armstrong, J. S. de Belle, Z. Wang, and K. Kaiser
Metamorphosis of the Mushroom Bodies; Large-Scale Rearrangements of the Neural Substrates for Associative Learning and Memory in Drosophila
Learn. Mem.,
May 1, 1998;
5(1):
102 - 114.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. K. Hensch, J. A. Gordon, E. P. Brandon, G. S. McKnight, R. L. Idzerda, and M. P. Stryker
Comparison of Plasticity In Vivo and In Vitro in the Developing Visual Cortex of Normal and Protein Kinase A RIbeta -Deficient Mice
J. Neurosci.,
March 15, 1998;
18(6):
2108 - 2117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Park, S. A. Sedore, C. Cronmiller, and J. Hirsh
Type II cAMP-dependent Protein Kinase-deficient Drosophila Are Viable but Show Developmental, Circadian, and Drug Response Phenotypes
J. Biol. Chem.,
June 30, 2000;
275(27):
20588 - 20596.
[Abstract]
[Full Text]
[PDF]
|
 |
|