 |
Previous Article | Next Article 
Volume 17, Number 23,
Issue of December 1, 1997
Mutation Causing Autosomal Dominant Nocturnal Frontal Lobe
Epilepsy Alters Ca2+ Permeability, Conductance, and Gating
of Human 4 2 Nicotinic Acetylcholine Receptors
Alexander Kuryatov,
Volodymyr Gerzanich,
Mark Nelson,
Felix Olale, and
Jon Lindstrom
Department of Neuroscience, Medical School, University of
Pennsylvania, Philadelphia, Pennsylvania 19104-6074
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
A mutation (S247F) in the channel-lining domain (M2) of the 4
nicotinic acetylcholine receptor (AChR) subunit has previously been
linked genetically to autosomal dominant nocturnal frontal lobe
epilepsy (ADNFLE).
To better understand the functional significance of this mutation, we
characterized the properties of mutant and wild-type human 4 2
AChRs expressed in Xenopus oocytes. Both had similar expression levels and EC50 values for ACh and nicotine.
Substantial use-dependent functional upregulation was found for mutant
4 2 AChRs, but not for wild type. Mutant AChR responses showed
faster desensitization, slower recovery from desensitization, less
inward rectification, and virtually no Ca2+
permeability as compared with wild-type 4 2 AChRs. Addition of the
5 subunit restored Ca2+ permeability to the
mutant 4 2 5 AChRs. At 80 mV, wild-type 4 2 AChR single
channel currents exhibited two conductances, each with two mean open
times ( 1 = 17 pS, 1 = 3.7 msec, and 2 = 23.4 msec; 2 = 28 pS,
1 = 1.9 msec, and 2 = 8.1 msec). In
contrast, mutant AChRs exhibited only one conductance of 11 pS, with
1 = 1.9 msec and 2 = 4.1 msec.
The net effect of the mutation is to reduce AChR function. This could
result in the hyperexcitability characteristic of epilepsy if the
mutant AChRs were part of an inhibitory circuit, e.g., presynaptically
regulating the release of GABA. In the minority of AChRs containing the
5 subunit, the overall functionality of these AChRs could be
maintained despite the mutation in the 4 subunit.
Key words:
autosomal dominant nocturnal frontal lobe epilepsy;
nicotinic acetylcholine receptors;
calcium permeability;
desensitization;
epilepsy;
single channel
INTRODUCTION
Autosomal dominant nocturnal frontal
lobe epilepsy (ADNFLE) is a recently recognized form of epilepsy in
which brief partial seizures occur during light sleep and often are
misdiagnosed as nightmares (Scheffer et al., 1994 ). ADNFLE is the first
inherited epilepsy in which a specific mutation has been identified
(Phillips et al., 1995 ; Scheffer et al., 1994 , 1995 ; Steinlein et al.,
1995 ). ADNFLE patients exhibit a missense mutation in 4 subunits of neuronal nicotinic acetylcholine receptors (AChRs), causing serine to
be replaced with phenylalanine at position 247 (Steinlein et al.,
1995 ). This replaces a highly conserved small hydrophilic amino acid
with a large hydrophobic amino acid at a region of the M2 transmembrane
domain thought to line the AChR cation channel near the channel gate at
the cytoplasmic surface (Akabas et al., 1994 ). Recently, a second
mutation involving insertion of a leucine near the extracellular end of
M2 also has been found to cause ADNFLE (Steinlein et al., 1997 ).
4 subunits form neuronal AChRs that have the subunit composition
( 4)2( 2)3 (Anand et al., 1991 ; Cooper et
al., 1991 ). In mammalian brains, 4 AChRs comprise the major AChR
subtype, with high affinity for nicotine (Whiting and Lindstrom, 1988 ).
A small fraction of these AChRs may have 5 subunits associated with
them (Ramirez-Latorre et al., 1996 ). 4 AChRs are expressed in many brain regions (Wada et al., 1989 ; Lindstrom et al., 1995 ), yet the
functional roles of 4 AChRs are not clearly defined. Many neuronal
AChRs are thought to be located presynaptically where they can modulate
neurotransmitter release (Role and Berg, 1996 ; Wonnacott, 1997 ). Post-
and perisynaptic roles for AChRs in peripheral ganglionic synaptic
transmission are well known; however, it has been difficult to
demonstrate similar involvement of AChRs in central synaptic
transmission except at brain stem vagal motor neurons (Zhang et al.,
1993 ). Nicotine has been reported to improve concentration, alertness,
and memory, and it is supposed that these effects would be mediated via
4 2 AChRs and other subtypes of neuronal AChRs (Riedel and Jolles,
1996 ; Vidal and Changeux, 1996 ).
Recent studies on recombinant 4 2 AChRs containing the 4
subunit S247F mutation showed that these AChRs exhibit significantly faster desensitization and slower recovery from the desensitized state
as compared with wild type (Weiland et al., 1996 ). Thus, it was
proposed that this reduction in 4 2 activity might disturb the
balance between inhibitory and excitatory synaptic transmission, thereby lowering the seizure threshold.
Serine 247 of 4 subunits is thought to contribute to the hydrophilic
lining of the cation-selective channel through the center of the AChR
molecule. In all AChR subunits there are small hydrophilic amino acids
(either serine or threonine) at this position, so changing this residue
to a larger hydrophobic phenylalanine might be expected to alter
channel conductance. It has been shown that this mutation in muscle
1 AChR subunits decreases channel conductance by 25% but increases
sensitivity to ACh by eightfold (Forman et al., 1996 ). Changes in
potency of agonists because of mutations in the AChR channel lining are
thought to result from changes in channel gating (Bertrand et al.,
1993 ; Filatov and White, 1995 ).
To understand the pathological mechanisms resulting from the 4 S247F
mutation, we compared in detail the expression, kinetics, pharmacology,
and channel properties of mutant and wild-type 4 2 AChRs.
Additionally, we investigated the influence of the 5 AChR subunit,
which can associate with 4 and 2 subunits to form functional AChRs (Ramirez-Latorre et al., 1996 ).
MATERIALS AND METHODS
Cloning and mutation of the human 4 AChR subunit.
The cDNA encoding the human neuronal AChR 4 subunit was
obtained by PCR amplification of cDNA synthesized from human brain
poly(A+) RNA (Clontech, Palo Alto, CA) with
StrataScript RNase H Reverse Transcriptase
(Stratagene, La Jolla, CA), using two sets of primers (forward
GCCAGCAGCCATGTGGAG, reverse GCCATCTTATGCATGGACTCGATG; forward
TGGGTACGCAGGGTCTTC, reverse AGCAGGCTCCCGGTCCCTTCCTAG). For subsequent
recloning into a vector, these PCR products were digested enzymatically
with BsaI, NsiI, and NsiI
endonucleases. The 5 end of this subunit was amplified from
5 -RACE-Ready cDNA (Clontech), using the Anchor Primer supplied with
the kit (CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) and a specific 5
reverse primer (GCCACGGGTCGGGACCAC). The 5 end PCR fragment was
digested with ClaI and BsaI restriction enzymes. All PCR fragments were purified by agarose gel electrophoresis with the
Geneclean II kit (BIO 101, Vista, CA). The PCR products were ligated
together via BsaI and NsiI sites and cloned into the ClaI and EcoRV blunt end sites of the
pBluescript II SK( ) phagemid. To add a poly(A+)
tail, we recloned this construct into SalI and
BamHI sites of a modified pSP64 poly(A+)
plasmid, where an AseI site can be used for linearization
instead of EcoRI. The construct was sequenced according to
the Sanger method (Sequenase Version 2.0 DNA Sequencing Kit; United
States Biochemical, Cleveland, OH) to verify the published sequence of the human 4 AChR subunit (Gopalakrishnan et al., 1996 ).
For introduction of the mutation S247 to F247 into the human 4
subunit, a 316 bp fragment was amplified by PCR, using the primer
AGATCACGCTGTGCATCT CGTGCTG (in which the nucleotide
responsible for this mutation is underlined) and the primer sequence
GCCATCTTATGCATGGACTCGATG from the cloned subunit. This fragment was
recloned into the 4 subunit by using the DraIII and
NsiI restriction sites. The fragment was sequenced according
to the Sanger method (Sequenase Version 2.0 DNA Sequencing Kit, United
States Biochemical) to verify that only the desired mutation was
present.
cDNAs encoding the human 4 and S247F 4 subunits were cloned into
a modified pSP64 poly(A+) (Promega, Madison, WI)
expression vector with a unique EcoRI site and digested;
sticky ends were filled in with Klenow enzyme (Boehringer Mannheim,
Indianapolis, IN) and religated with T4 DNA polymerase (New England
Biolabs, Beverly, MA). 5 and 2 were cloned in the pSP64
poly(A+) vector, using standard DNA cloning
procedures (Melton et al., 1984 ). cRNA was synthesized in
vitro with the Megascript kit (Ambion, Austin, TX).
The oocytes were removed surgically from Xenopus laevis
(Xenopus I, Ann Arbor, MI) and placed in oocyte physiological saline (ND-96) containing (in mM) 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 10 HEPES, pH
7.5, to which 50 U/ml of penicillin and 50 µg/ml of streptomycin were
added. Oocytes were dispersed in this buffer minus
Ca2+ containing 2 mg/ml collagenase A (Sigma, St.
Louis, MO) for 2 hr.
Stage V-VI oocytes were selected and injected with combinations of
4 2, 4 2 5, 4S247F 2, and 4S247 2 5 subunit
cRNAs (equal amounts of 5-12 ng of each subunit in a total volume of
55 nl). After injections, oocytes were maintained semisterile at 18°C in Liebovitz L-15 medium (Life Technologies, Grand Island, NY) diluted
by one-half in 10 mM HEPES buffer, pH 7.5.
Electrophysiology and perfusion solutions; whole-cell recordings.
Currents were measured with a standard two-microelectrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument, Hamden, CT) as previously described (Gerzanich et al., 1994 ). All
recordings were digitized at 200 Hz with MacLab software and hardware
(AD Instruments, Castle Hill, Australia) and stored on an Apple
Macintosh IIcx computer (Cupertino, CA). Data were analyzed by using
KALEIDAGRAPH (Synergy Software, Reading, PA).
The recording chamber was perfused at a flow rate of 10 ml/min with
ND-96 solution. All perfusion solutions contained 0.5 µM
atropine. Agonists were applied, using a set of eight glass tubes as
previously described (Gerzanich et al., 1994 ). For experiments measuring the effect of extracellular Ca2+ on the
reversal potentials, intracellular electrodes were filled with 2.5 M potassium aspartate. To prevent activation of the
endogenous Ca2+-dependent Cl
channels, we used Cl -free solutions for oocyte
preincubation (6-12 hr) and for the perfusion during recordings
(Francis and Papke, 1996 ). "Normal" Ca2+
solution included (in mM) 90 NaMeSO3,
2.5 KOH, 10 HEPES, and 1.8 Ca(OH)2. Additionally, 48 mM dextrose was supplemented in the normal solution to
yield osmolarity equal to the "high" Ca2+
solution, which contained 18 mM Ca(OH)2 and the
same concentration of the other ions as "normal"
Ca2+ solution. Both solutions were buffered with
methanesulfonic acid to pH 7.3. Reversal potentials of the currents
were determined either by 6 sec agonist applications at different
holding potentials or by 2 sec ramps of the holding potential from 50
to +50 mV during agonist application after the current reached a steady state. Both protocols gave similar estimates for the reversal potential. Control ramp currents obtained before agonist applications were subtracted from the ramp currents during AChR activation. In one
set of experiments current carried by Ca2+ ions only
was measured by using solutions containing only 1.8 mM
Ca(OH)2 buffered to pH 7.3 by HEPES. Dextrose (at 200 mM) was added to the solutions to preserve osmolarity.
Single channel recordings. Xenopus oocytes were
manually stripped of the vitelline membrane after osmotic shrinking
with a 200 mM potassium aspartate solution. Outside-out
configuration patches were formed from stripped oocytes expressing
recombinant AChRs 5-10 d after cRNA injections. Single channel
currents were activated by the application of ACh flowing continuously
from one barrel of a two-barrel fused glass capillary tubing that was attached to as many as 10 different reservoirs among which selections were made by two six-way valves (Rheodyne, Cotati, CA) in series. Before application of agonist, the patch was isolated in a continuously flowing control solution from the other barrel of the fused glass tubing. The change to the agonist-containing solution was achieved by
manually repositioning the perfusion tubing in a lateral direction. The
recording solutions were an ND-96 bath solution and a pipette solution
consisting of (in mM) 80 CsF, 20 CsCl, 10 Cs-EGTA, 10 HEPES, and 3 MgATP, pH-adjusted to 7.2 with CsOH. Electrodes were formed from borosilicate glass tubing and had resistances of 7-15 m . Recordings were obtained with an Axopatch 1-D amplifier (Axon Instruments, Foster City, CA) and sampled with an VR-10A digital data
recorder (Instrutech, Great Neck, NY) onto video medium (VHS model
VC-A206C, Sharp, Osaka, Japan) for later analysis. Signals were sampled
off-line at 10 kHz (Axotape 2.0, Axon Instruments) and filtered at 2 kHz (Model 902; eight-pole Bessel, 3 dB; Frequency Devices,
Haverhill, MA) for analysis, except for some mutant 4 2 AChR
recordings that were filtered at 1.5 kHz because of the low signal-to-noise ratios. All single channel analysis and fitting were
performed with pClamp 6.0.3 (Axon Instruments). Events list files were
formed by visual inspection of the data and manually accepting or
rejecting putative events while ignoring events <0.2 or 0.3 msec in
duration (depending on filter bandwidth). Then the data in the events
list files were log-binned into histograms, using seven to eight bins
per decade, and fit with single- or double-exponential functions, using
maximum likelihood optimization of a Simplex algorithm (Sigworth and
Sine, 1987 ). The number of components in the "best" fit were
evaluated visually and also by comparing the likelihood ratios of the
fits. For figures, histograms with fits were exported to Origin
(Microcal Software, Northampton, MA). Representative single channel
traces were constructed by opening data files in Axograph 3.55 (Axon
Instruments) for the Power Macintosh 7100 (Apple Computer) and
exporting data segments to Canvas 5.0 (Daneba Software, Miami, FL).
Monoclonal antibodies (mAbs) used, oocyte surface AChRs binding,
and solid phase radioimmunoassay (RIA). Immulon 4 (Dynatech, Chantilly, VA) microtiter wells were coated with mAbs 290, 299, or 210 (Wang et al., 1996 ) as described previously (Anand et al., 1993 ).
Oocytes were homogenized by repetitive pipetting in buffer [containing
(in mM) 50 Na2HPO4-NaH2PO4,
pH 7.5, 50 NaCl, 5 EDTA, 5 EGTA, 5 benzamidine, 15 iodoacetamide, and 2 phenylmethylsulfonyl fluoride]. The membrane fractions were collected
by centrifugation (15 min at 15,000 × g). AChRs were
solubilized by incubating the membrane fractions in the same buffer
containing 2% Triton X-100 at 4°C for 1 hr. Nonsolubilized fractions
were removed by centrifugation for 15 min at 15,000 × g. Solubilized AChRs from oocytes were used directly for all
assays. mAb-coated microtiter wells were incubated with
Triton-solubilized AChRs and 5 nM
3H-epibatidine (DuPont NEN, Boston, MA) at 4°C for 16 hr.
Then the wells were washed three times with ice-cold PBS and 0.05% Tween-20 buffer; the amount of radioactivity bound was determined by
liquid scintillation counting. The nonspecific binding was determined
by processing the RIAs with extracts of noninjected oocytes.
Surface binding. Surface expression was determined by
incubating oocytes in ND-96 solution containing normal adult bovine serum and 10 nM 125I-mAb (0.5-2 × 1018 cpm/mol for 1 hr at 25°C) with stirring,
followed by three washes with ND-96 to remove nonspecific binding.
Nonspecific binding was determined by incubating noninjected oocytes
under the same conditions.
RESULTS
Expression and time course of the responses of wild-type and S247F
human 4 2 AChRs
Levels of surface expression and ACh-induced currents of 4 2
and 4 2 5 AChRs incorporating wild-type and mutated 4
subunits were determined 3-6 d after cytoplasmic injection of the
subunit cRNAs into Xenopus oocytes. Surface binding of
125I-mAb290 specific for 2 subunits indicated high
efficiency of expression, with levels of binding ranging from 1 to 7 fmol/oocyte. Maximum ACh-induced currents were correspondingly large,
reaching 20 µA at 50 mV. Mutant 4 2 AChRs, both without and
with 5 subunit incorporated, showed equivalent levels of surface
expression similar to wild-type 4 2 AChRs (Fig.
1). When 4, 2, and 5 cRNAs were injected in a 1:1:1 ratio, surface levels of 125I-mAb290
binding to 2 subunits were lower by 15-30% (Fig. 1) as compared
with 4 2 AChRs. Functionality of the expressed AChRs was tested by
measuring net charge carried during responses induced by a saturating
concentration of ACh (100 µM) before surface labeling with 125I-mAb210 (Fig. 1). Mutant 4 2 AChRs carried
60% less charge per AChR than did wild type. Native 4 2 5 AChRs
carried 25% less charge per AChR than did native 4 2 AChRs, and
mutant 4 2 5 AChRs carried 30% less charge than did this
wild-type combination of subunits.
Fig. 1.
Expression levels are not impaired by the S247F
mutation. Top, Comparison of surface expression of AChRs
per oocyte detected by binding of 125I-mAb290 to 2
subunits on the surface of intact oocytes. Middle, Average amounts of net charge carried per femtomole of surface AChRs.
Inward currents induced by an initial 30 sec exposure to 100 µM ACh at 30 mV in Cl -free medium
were integrated. Bottom, Total AChRs immunoisolated from
detergent extracts of oocytes, using mAbs specific for either 3 and
5 subunits (mAb210), 2 subunits (mAb290), or 4 subunits (mAb299). Data were obtained from 7 to 10 oocytes for each measurement. The mean value and SE are shown.
[View Larger Version of this Image (31K GIF file)]
5 subunits assembled very efficiently with both wild-type and mutant
4 2 AChRs. After coinjection of the cRNAs for 5, 2, and 4
wild-type or mutant subunits in a 1:1:1 ratio, AChRs were immunoisolated, using mAbs specific for each subunit; the amount of
AChR isolated by each antibody was determined by binding of 3H-epibatidine (Fig. 1). Each of the mAbs tested isolated
the same amount of AChR, suggesting that all three types of subunits
were incorporated in virtually all AChRs. mAb210 binds to the main immunogenic region epitope expressed on the extracellular surface of
1, 3, and 5 subunits (Wang et al., 1996 ) but does not bind to
4 subunits (data not shown). mAb290 and mAb299 (Whiting and Lindstrom, 1988 ) bind to the extracellular surfaces of 2 and 4
subunits, respectively, and previously have been used to quantitate 4 2 AChRs expressed in oocytes (Peng et al., 1994 ).
Mutant 4 2 AChRs exhibited a peculiar facilitation response to
agonists. In oocytes expressing mutant 4 2 AChRs, responses induced by the initial agonist application augmented with consecutive applications, reaching a plateau after five to six activations (Fig.
2). Thus, the first application of ACh
induced a rather small current, which increased more than threefold, on
average, before plateauing at the new level. The time course of the
responses did not change significantly during this process. When the
same oocytes were tested 24 hr later, they exhibited no additional increase of response with consecutive applications of agonist. The
response increase was observed only for naive oocytes not previously
exposed to agonist. This phenomenon of initial activation-dependent functional upregulation was not observed in oocytes expressing wild-type 4 2 AChRs, in which the amplitude of the response
remained virtually the same during consecutive applications of the
agonist (Fig. 2). These results suggest that exposure to agonists can cause a long-lived or permanent change in the conformation of mutant
4 2 AChRs to a more activatable conformation. To test whether this
use-dependent upregulation of function might be caused by displacing
from the mutant channel antibiotics or other components of the L-15
medium in which injected oocytes were incubated routinely, we incubated
oocytes in ND-96 solution instead. After incubation of injected oocytes
in ND-96, mutant 4 2 AChRs still exhibited use-dependent
upregulation. Thus, this phenomenon cannot be attributable to
displacement from mutant channels of antibiotics or other organic compounds in L-15 medium, but it cannot be excluded that an inorganic ion was displaced from mutant channels.
Fig. 2.
Functional differences between wild-type and
mutant 4 2 AChRs. Top, Use-dependent functional
upregulation of the responses mediated by mutant 4 2 AChRs.
Left, Currents induced by the first and fifth
application of 3 µM ACh are shown for oocytes expressing wild-type and mutant 4 2 AChRs. Oocytes that did not have previous exposure to the agonists were held at 50 mV. ACh was applied at 2 min
intervals. Right, Plot of the response peak amplitude on
the initial five consecutive applications of 3 µM ACh on
the oocytes expressing wild-type (open circles) or
mutant 4 2 AChRs (filled circles). Currents
were normalized to the peak amplitude of the first response.
Bottom, S247F mutation causes significant changes in the
desensitization of the 4 2 and 4 2 5 AChRs.
Left, Comparison of the time course of the superimposed
normalized averaged currents mediated by the wild-type (thin
trace) and mutant (thick trace) 4 2 AChRs.
Right, Comparison of time course for the wild-type and
mutant 4 2 5 AChRs. Averaged currents were obtained from 15 to
22 oocytes by normalizing to the same current amplitude. Oocytes were
held at 50 mV. Both perfusion and agonist solution contained no
Cl ions to prevent contamination with endogenous
Ca2+-dependent Cl current.
Oocytes were preincubated in Cl -free media for
4-16 hr.
[View Larger Version of this Image (21K GIF file)]
To exclude the possible influence of the endogenous
Ca2+-dependent Cl current in
Xenopus oocytes, which can distort the time course of the
responses mediated via neuronal nicotinic AChRs (Leonard and Kelso,
1990 ; Vernino et al., 1992 ; Gerzanich et al., 1994 ), we recorded
responses in Cl -free media. Moreover, oocytes were
preincubated in the Cl -free media for 4-16 hr
before recordings, and recordings were performed with electrodes filled
with Cl -free solution (potassium aspartate).
Concentration of Ca2+ ions in the extracellular
solution was maintained at 1.8 mM to correspond to the
Ca2+ concentration in normal recording conditions.
These conditions were preferable to those applied in the previous study
of S247F 4 2 AChRs (Weiland et al., 1996 ), where, to prevent
activation of Ca2+-dependent Cl
currents, recordings were performed in media in which
Mg2+ ions were substituted for
Ca2+ ions. Extracellular Ca2+ is
known to modulate such properties of nicotinic AChRs as conductance, open probability, and desensitization (Vernino et al., 1992 ). Furthermore, increase of extracellular Mg2+
potentially could cause channel block that could be altered by the
S247F mutation.
The S247F mutation in 4 subunits caused changes in the rates of
desensitization of both 4 2 and 4 2 5 AChRs. Normalized current traces obtained from oocytes expressing mutant and wild-type 4 2 and 4 2 5 AChRs are superimposed for comparison in
Figure 2. Each trace shown represents the
average of normalized currents from 15 to 22 oocytes induced by a
saturating concentration of ACh. Wild-type 4 2 AChRs did not show
significant desensitization over 30 sec. In contrast, current through
the mutant AChRs fell rapidly by ~50% and then continued to decay
slowly in the presence of ACh. The time constant for the initial fast
component of the desensitization was 1.8 sec, and the time constant for
the secondary component was 45 sec. When the 5 subunit was
coexpressed with wild-type 4 2 AChRs, responses exhibited notable
desensitization as compared with 4 2 AChRs without 5 (Fig. 2,
bottom right). The currents decayed with a time constant of
6.4 sec to a plateau level of ~65%. For mutant 4 2 5 AChRs,
the initial component of desensitization was somewhat faster as
compared with the wild type, with a time constant of 4.5 sec. The
current decay continued in the presence of ACh after the initial peak
with a time constant of ~40 sec, resembling the slow component of
desensitization of mutant 4 2 AChRs (Fig. 2, bottom).
Recovery from desensitization of mutant 4 2 and 4 2 5 AChRs
also was much slower as compared with wild-type 4 2 5 AChRs
(data not shown).
Comparison of some pharmacological properties of wild-type and
S247F 4 2 AChRs
Wild-type and mutant 4 2 AChRs showed subtle differences in
sensitivity to ACh and nicotine (Fig. 3,
top). ACh activated wild-type AChRs with an EC50
of 2.2 ± 0.1 µM [Hill coefficient of the
concentration/response curve (nH) was 2.1]. The ACh
concentration/response curve for mutant AChRs had a Hill coefficient of
0.9 and an EC50 value of 11.6 ± 1.2 µM.
Similarly, the mutant AChRs had lower sensitivity to nicotine
(EC50 = 1.8 ± 0.6 µM) as compared with wild-type 4 2 AChRs (EC50 = 0.3 ± 0.04 µM), although Hill coefficients for both were >1 (1.8 and 1.4, respectively). The efficacy of nicotine for both wild-type and
mutant 4 2 AChRs was slightly lower (~90%) as compared with ACh
(Fig. 3, top).
Fig. 3.
Comparison of pharmacological properties of human
wild-type and mutant 4 2 AChRs. Top,
Concentration/response curves for ACh and nicotine for wild-type and
mutant 4 2 AChRs. Middle, Inhibition of mutant
4 2 AChR-mediated currents by DH E, quinine, and amantadine.
Equivalent inhibition of wild-type 4 2 AChRs was produced at these
concentrations of DH E and quinine. Control responses superimposed
with responses induced by coapplication of ACh and antagonists, and
responses induced after 5 min washout, are shown. Bottom
left, Comparison of the voltage dependence of the inhibition of
the mutant 4 2 AChRs by quinine (thin line) and
amantadine (thick line) are shown. Voltage dependence is
represented by plotting the amount of the inhibition
(Ic Ia)/Ic · 100% against holding potential, where Ic is
the current in the presence of the ACh (100 µM), and
Ia is the current induced by coapplication of the ACh (100 µM) and quinine (10 µM) or
amantadine (100 µM). Currents were measured by the
application of 2 sec voltage ramps from 100 to +50 mV to the oocytes
before and during application of the agonist or coapplication of the
agonist and antagonist. Passive currents induced before application of
the agonist were subtracted. Bottom right,
Concentration/response curves built for amantadine inhibition of
wild-type (open circles) and the mutant
(filled circles) 4 2 AChRs. Data obtained
from four to six oocytes held at 50 mV were normalized to the control
responses induced by 100 µM ACh, averaged, and fit by
using the Hill equation (EC50 and IC50 = values, and nH values are listed in the
text).
[View Larger Version of this Image (32K GIF file)]
Inhibition by a competitive ACh binding site antagonist and by
quinine was equivalent for both wild-type and mutant 4 2 AChRs, whereas inhibition by the noncompetitive ion channel blocker amantadine was less potent on mutant 4 2 AChRs. Both wild-type and mutant 4 2 AChRs were inhibited effectively and reversibly by the
competitive antagonist dihydro- -erythroidine (DH E) (Harvey et
al., 1996 ) (Fig. 3, left). Additionally, amantadine
(Matsubayashi et al., 1997 ) and quinine blocked both wild-type and
mutant AChRs, although at concentrations much higher than did DH E
(Fig. 3, middle and bottom). Block by amantadine
was notably voltage-dependent, with robust inhibition at more negative
potentials, and almost none at membrane potentials more positive than
35 mV (Fig. 3, bottom left). In contrast, inhibition by
quinine showed no voltage dependence (Fig. 3, bottom left).
Voltage dependence of the amantadine block, as well as the reduced peak
current amplitude with faster decay kinetics during coapplication with
agonist (Fig. 3, middle right), suggests that amantadine
acts as a channel blocker. Amantadine was fourfold less potent as a
blocker of mutant (IC50 = 207 ± 30 µM)
than wild-type (IC50 = 51 ± 10 µM)
4 2 AChRs (Fig. 3, bottom right). This reduction of
potency in blocking mutant AChRs could be explained by reduced affinity
of amantadine for its channel binding site caused by the S247F mutation
in the ion channel lumen (Charnet et al., 1990 ; Leonard et al.,
1991 ).
The S247F mutation in the M2 transmembrane domain of the 4 2
AChR decreases Ca2+ permeability of the channel
Currents through both mutant and wild-type 4 2 AChRs showed
strong inward rectification characteristic of neuronal AChRs, with
outward currents at +50 mV being <5% of the current at 50 mV. The
reversal potentials for both AChR subtypes were estimated by using ramp
protocols applied during application of the agonist in
Cl -free media to prevent contamination with the
endogenous Ca2+-dependent Cl
current. Currents mediated via wild-type AChRs reversed at 11.4 ± 1.4 mV (n = 15) under these conditions; for mutant
AChRs the reversal occurred at 10.3 ± 1.2 mV (n = 11). Reversal of the wild-type 4 2 AChR currents depended on the
concentration of Ca2+ ions in the extracellular
solution. When the concentration of Ca2+ was
increased 10-fold from 1.8 to 18 mM, the reversal potential shifted in the positive direction by 4.4 ± 0.8 mV (Fig.
4, top left
and middle). The same change of extracellular medium did not
cause significant changes in the reversal potential of mutant 4 2
AChRs, although some tendency for a subtle shift to more negative
potentials was observed ( 0.7 ± 0.9 mV) (Fig. 4, top right and middle). Changes of the reversal potentials
obtained by voltage ramps were virtually the same when current/voltage relationships were obtained from the peak current measurements from the
oocytes voltage-clamped at different holding potentials (data not
shown). From these data it appears that mutant 4 2 AChRs are
significantly less permeable to Ca2+ than are
wild-type AChRs.
Fig. 4.
S247F mutation of the 4 subunit eliminates
Ca2+ permeability of the 4 2 AChRs, which was
restored by coexpression of 5 subunits. Top, Shift of
the reversal potential of wild-type (left) and mutant (right) 4 2 AChRs induced by a 10-fold increase of
Ca2+ concentration from 1.8 to 18 mM.
Representative currents induced by the application of voltage ramps on
oocytes perfused by 100 µM ACh with 1.8 mM
(dashed trace) or 18 mM
Ca2+ (solid trace) in the solution
are plotted against membrane potential. Currents induced by the ramps
in agonist-free solutions are subtracted. Recordings were performed in
Cl -free solutions on the oocytes preincubated in
the Cl -free media. Middle, Plot of
the reversal potential shifts induced by a 10-fold increase of the
extracellular Ca2+ concentration (from 1.8 to 18 mM) for wild-type (open bars) and mutant
(filled bars) 4 2 and 4 2 5 AChRs.
Averaged data obtained from 7 to 14 oocytes as described on the
top panel represent mean value ± SE.
Bottom, Currents conducted only by
Ca2+ ions through wild-type and mutant 4 2
AChRs. Left, Currents induced in normal ND-96 media and
an equiosmotic solution containing 1.8 mM
Ca2+ as the only permanent ion were compared for
both wild-type and mutant 4 2 AChRs. Currents were induced by 100 µM ACh in Cl -free media.
Right, Plot of the percentage of the inward current induced in the "Ca2+-only" (1.8 mM)
solution as compared with the current in the normal ND-96 solution for
wild-type (open bar) and mutant (shaded
bar) 4 2 AChRs. Bar in the negative
direction for the mutant indicates that in some experiments currents
were outward in the "Ca2+-only" conditions. Data
were obtained from seven oocytes preincubated in the
Cl -free media for each AChR; mean values and SE
are plotted.
[View Larger Version of this Image (26K GIF file)]
Coexpression of the 5 subunit changed the permeability of mutant
4 2 AChRs. In 1.8 mM Ca2+ currents
mediated via wild-type 4 2 5 AChRs reversed at 14.1 ± 0.7 mV (n = 8). Increasing the Ca2+
concentration to 18 mM shifted the reversal potential
7.0 ± 1.1 mV more positive. In 1.8 mM
Ca2+ mutant 4 2 5 AChRs had a reversal
potential at 5.3 ± 1.8 mV (n = 7). Increasing
the Ca2+ concentration 10-fold caused a 6.8 ± 0.9 mV more positive shift of the reversal potential. Thus,
incorporation of the 5 subunit into the mutant 4 2 AChR channel
not only reversed but, in fact, somewhat enhanced the
Ca2+ permeability as compared with the wild-type
4 2 AChR.
Differences in the Ca2+ permeability of wild-type
and mutant 4 2 AChRs also were confirmed by an alternative method.
When all cations but Ca2+ in the extracellular
solution were replaced by an equiosmotic concentration of dextrose,
wild-type 4 2 AChRs still conducted detectable inward current
(Fig. 4, bottom left). The amplitude of this current was
only 6 ± 1.0% of the current induced at the same membrane
potential by the same concentration of agonist in the normal
extracellular solution (ND-96). As expected, virtually no residual
inward current was observed when similar replacement of the
extracellular cations was performed on oocytes expressing mutant
4 2 AChRs (Fig. 4, bottom middle). These experiments
confirmed that the S247F mutation of the 4 subunit dramatically
decreased the ability of 4 2 AChRs to conduct
Ca2+ ions. This impairment of the
Ca2+ permeability of the mutant 4 2 AChR could
be compensated for effectively by the introduction of the 5
subunit.
Comparison of single channel properties of wild-type and S247F
4 2 AChRs
Single channel currents were activated in outside-out patches for
both wild-type and mutant 4 2 AChRs expressed in
Xenopus oocytes (Figs. 5,
6). For both types of AChRs the
sensitivity for channel activation was extremely high, so 50 nM ACh was used for steady-state recording. Recording at
this concentration allowed for sufficient channel activity to be
obtained for amplitude and kinetic analysis. Even at this low
concentration, desensitization was evident, particularly for the mutant
AChRs. For example, channel activity for the wild-type AChR was
sustained for 3-5 min of continuous application of 50 nM
ACh, whereas mutant AChR channels usually persisted for only 2-3 min
before desensitizing. Moreover, channels could be reactivated by
additional applications of agonist for the wild-type channels after a
period of recovery, whereas the mutant channel activity was greatly
diminished or completely inactivated.
Fig. 5.
Single channel currents of the human wild-type and
mutant 4 2 AChRs. Top, Records are from outside-out
patches taken from oocytes that were injected with either human
4 2 or human S247F mutant 4 2 AChRs. Currents were
recorded at 80 mV by steady-state application of 50 nM
ACh, with the patch isolated in a continuously flowing stream of
agonist diluted from stock into ND-96 solution. Channel activity was
initiated by lateral displacement of the perfusion tube across the face
of the recording electrode. Wild-type AChRs exhibited two conductance
levels, as indicated by the dashed lines, whereas mutant
AChRs exhibited predominantly a single conductance level. For display,
records were sampled at 10 kHz and filtered at 2 kHz (eight-pole
Bessel, 3 dB). Bottom, Both wild-type and mutant AChR
single channel currents were blocked by 1 µM DH E. Currents were activated originally by 50 nM ACh by rapid
movement of the perfusion tube across the tip of the recording
electrode. High levels of expression allowed robust inward currents to
be observed because of massive simultaneous channel activations. After
~1 min of wash, agonist was reapplied along with 1 µM
DH E. The initial channel activity was significantly lower as
compared with the level in the absence of antagonist. After the first
3-5 sec, the channel activity was essentially gone because of
inhibition by DH E. The inhibition was reversible within 60 sec (time
for solution change).
[View Larger Version of this Image (33K GIF file)]
Fig. 6.
Single channel properties of wild-type and mutant
4 2 AChRs. Left, Representative unitary conductance
histograms. All-point amplitude histograms were generated from sections
of data files that did not contain simultaneous channel openings. The
data are presented as the square root of samples to emphasize the
channel open amplitudes. Fitting of the histograms was done by a
Levenburg-Marquardt least-squares algorithm of either three
(wild-type) or two (mutant) gaussian components. Right,
Channel open time histograms were generated from events list files. In
all cases, the fits shown represent a Simplex maximum likelihood
estimate of a two-component exponential function. The mean values for
the time constants of the fits can be found in Table 1.
[View Larger Version of this Image (28K GIF file)]
Sensitivity to DH E
The nicotinic character of single channel activity observed in
outside-out patches from oocytes was confirmed by demonstrating sensitivity to DH E. We found that coapplication of 1 µM DH E could effectively antagonize the channels
activated in outside-out patches by 50 nM ACh. Furthermore,
the antagonism appeared to be competitive because, at the initial
coapplication of ACh with DH E, channel openings occurred that had
the same amplitude and duration as the channels recorded in the absence
of the antagonist. Additionally, when the number of channels in the
patch was high, periodic openings of channels were observed that also
resembled the channels in the absence of antagonist. The antagonism by
DH E was also readily reversible, because reapplication of ACh within 60 sec after removing DH E resulted in a level of channel activity resembling the activity level seen before the application of the antagonist. In the case of the mutant, the relatively rapid
inactivation of the channel never allowed for a dramatic recovery of
channel activity after removal of the DH E, but the level of channel
activity observed on washout was significantly higher than that seen in the presence of the antagonist.
Channel amplitudes
At a holding potential of 80 mV, wild-type 4 2 AChRs had
two amplitudes of 1.4 ± 0.1 and 2.3 ± 0.1 pA (assuming a 0 mV reversal potential yields chord conductance estimates of 17 and 28 pS). The proportions of channel openings to each of the conductance levels were 67.4 and 32.6%, respectively. Mutant 4 2 AChR
channels, on the other hand, had a single conductance channel type with an amplitude of 0.90 ± 0.01 pA (or 11 pS with the zero reversal potential assumption). In some patches a few openings to a higher level
were observed. Only in one such patch were enough openings observed to
perform a reasonable fit to the amplitude distribution, with the
amplitude being 1.5 pA.
Mean channel open times
In every patch for the wild-type AChRs, both conductances
exhibited gating behavior that required two components to fit the channel open time distributions. The mean channel open times for the 17 pS channel were 3.65 ± 0.51 msec (51.1% of the distribution) and
23.4 ± 4.76 msec (48.8%), whereas for the 28 pS channel the open
times were 1.90 ± 0.21 msec (67.8%) and 8.05 ± 0.58 msec (32.2%). For the mutant AChR, the predominant conductance observed required two components for the fitting of the open time distributions in one-half of the patches recorded, whereas the remaining patches could be fit by a single-component function. The time constants derived
for the patches that required only a single component corresponded to
one of the components of the patches that required two component fits.
The mean open times were 1.93 ± 0.37 msec (69.3%) and 4.05 ± 0.24 msec (30.7%).
DISCUSSION
In the present study we show that the S247F mutation in 4
subunits causes significant acceleration of desensitization and slows
recovery from desensitization. Similar observations were made by
Weiland et al. (1996) and Figl et al. (1997) . Additionally, we
characterized expression levels, functionality, pharmacological properties, Ca2+ permeability, channel conductance,
and gating of the mutant in comparison with the wild-type 4 2
AChRs. All of these characteristics of the mutant 4 2 AChRs are
important, both from the perspective of gaining a better understanding
of the structure and function of AChRs and for better understanding
possible mechanisms of seizures in ADNFLE patients.
The S247F mutation in human 4 subunits did not cause notable
changes, at least in oocytes, in the expression efficiency of either
4 2 or 4 2 5 AChRs. Similar results were reported for rat
S247F mutant 4 2 AChRs expressed in oocytes (Figl et al., 1997 ).
These results suggest that changes in the amount of 4 2 AChRs are
not responsible for pathological changes in ADNFLE.
Potentiation of the responses to agonist on successive exposures in the
case of the S247F mutant is an interesting phenomenon that may have
implications for the pathological mechanisms of ADNFLE. This disease is
characterized by seizures during light sleep (Scheffer et al., 1994 ,
1995 ). If 4 2 AChRs were associated with a generalized cholinergic
activation mechanism regulating sleep and wakefulness, as has been
suggested (Szymusiak, 1995 ; Everitt and Robbins, 1997 ), then mutant
4 2 AChRs might be susceptible to failure at the beginning of this
transition, but after sustained activation during wakefulness (or
sleep), the potentiated function of these mutant 4 2 AChRs into
the normal range of function would prevent seizures during sustained
wakefulness (or sleep).
The S247F mutation had little effect on the EC50 of the
ACh binding site ligands ACh or nicotine but did reduce the efficacy of
the channel-blocking ligand amantadine. This is consistent with the
putative location of this mutation being in the lumen of the channel
near the gate at the cytoplasmic surface.
We observed virtually complete abolition of the permeability of
Ca2+ ions through the mutant AChRs. The S247F
mutation is located in the part of M2 thought to form the intermediate
hydrophilic ring in the channel that contributes to cation selectivity
(Imoto et al., 1988 ). Interestingly, mutant 4 2 AChRs regained
Ca2+ permeability when the 5 subunit was
incorporated in the channel. It has been proposed that 5 subunits in
neuronal AChRs occupy a position around the cation channel
corresponding to 1 subunits of muscle AChRs (i.e.,
4 2 4 2 5) to account for the observations that 5 cannot
form ACh binding sites or functional AChRs in combination with just
2 subunits but requires the presence of both 3 or 4 and 2
or 4 subunits (Ramirez-Latorre et al., 1996 ; Wang et al., 1996 ).
Further structural studies of the 5 contribution into the nicotinic
AChR channel are needed to understand the mechanism of this
Ca2+ permeability compensation. This effect of the
5 subunits indicates that in the brains of ADNFLE patients it would
be possible for 4 2 5 AChRs to function more nearly normally.
Such a subtype would comprise only a small fraction of the total,
because most brain 4 AChRs are not bound by mAbs to 5 (F. Wang,
V. Gerzanich, and J. Lindstrom, unpublished data). Reduced
Ca2+ permeability is a very important deficit in
4 2 AChR function because many of these AChRs may function
presynaptically to facilitate transmitter release by increasing the
presynaptic Ca2+ concentration.
The S247F mutation in the 4 subunit had a considerable impact on the
single channel properties of the resulting AChRs. Whereas the AChRs
containing wild-type 4 had two conductance states of the channels of
approximately equal likelihood of appearance, the mutant AChRs seemed
to prefer a lower conductance state of the channel. Considering the
size and hydrophobicity of the phenyl group of phenylalanine as
compared with the hydroxyl group of serine, it seems plausible that a
conformation shift within the channel lumen necessary for transition
into one of the conductance states is less likely in the mutant with a
phenyl group. Because the preferred conductance state of the mutant
channel has a conductance different from either of the wild-type
channel conductances, serine 247 clearly contributes to the selectivity
filter of the channel and not just to the regulation of conformational
changes controlling the switch between the two conductance states. The
fact that the main conductance state of the mutant was significantly
smaller than either of the conductance states of the wild-type AChR
seems reasonable, because the larger hydrophobic group of phenylalanine presumably would inhibit movement of ions through the channel, particularly large divalent cations like Ca2+. The
estimates of single channel conductances that we observed for wild-type
human 4 2 ACHRs expressed in oocytes (17 and 28 pS) were in the
same range as those for similarly expressed 4 2 AChRs from rats
(12, 22, and 34 pS) or chickens (20 and 24 pS), considering differences
in recording conditions (Charnet et al., 1990 , 1992 ; Cooper et al.,
1991 ; Ramirez-Latorre et al., 1996 ).
The channel open kinetics were also markedly dissimilar for the mutant
as compared with the wild-type AChR. Both conductance types of the
wild-type AChR demonstrated relatively long channel openings as
compared with the mutant, particularly the lower conductance form of
the wild-type channel, thus demonstrating the less energetically favored transition into the channel open state for the mutant form of
the AChR. In addition to the brevity of the mutant AChR channel
openings, channel desensitization for the mutant occurred much more
rapidly than for the wild-type AChR during continuous application of 50 nM ACh, and the mutant was much less likely to recover
activity after a period in control solution. Channel activity for the
wild-type AChR usually could be observed for 3-5 min of continuous
application and could be evoked by reapplication for periods of 15-20
min, whereas the mutant AChRs would inactivate during an initial 2-3
min period of continuous application. The net effect of the mutation on
the single channel properties of 4 2 AChRs is to decrease the
capacity for the AChR to pass charge both during each gating of the
channel and over a time-averaged period of continuous channel
activation.
The net functional capacity of the S247F 4 mutants thus is reduced
by four mechanisms that reduce the net flow of ions through activated
AChRs: (1) Ca2+ permeability is lost, (2)
desensitization is increased, (3) channel opening time is reduced, and
(4) channel conductance is reduced. Two compensating mechanisms were
identified: (1) incorporation of 5 subunits repairs the deficit in
Ca2+ conductance, and (2) repeated activation can
produce a conformation that is more activatable for at least 24 hr.
However, the net effect of this mutation is to reduce AChR function.
This effect is so potent that even in the heterozygous state the
disease occurs. High doses of nicotinic agonists can produce seizures
(Miner and Collins, 1988 ; Singer and Janz, 1990 ; Woolf et al., 1996 ),
but loss of 4 2 AChRs such as occurs in 2 knock-out mice
(Picciotto et al., 1995 ) is not associated with the occurrence of
seizures. Epilepsy is caused by excessive neuronal activation. How
might a mutation that causes a net decrease in AChR function cause the excessive excitation characteristic of epilepsy? Neuronal AChRs are
effective at promoting the release of many transmitters from synaptosomes (Role and Berg, 1996 ; Wonnacott, 1997 ). It seems likely
that 4 2 AChRs controlling the release of the inhibitory transmitters GABA or glycine either presynaptically or postsynaptically could be responsible for triggering seizures in ADNFLE. There are
numerous studies describing nicotine-induced GABA release either from
isolated synaptosomes or shown directly in electrophysiological studies
(Lena et al., 1993 ; Kayadjanian et al., 1994 ; McMahon et al., 1994 ;
Role and Berg, 1996 ; Wonnacott, 1997 ). Nicotine was shown to cause or
potentiate release of other inhibitory neurotransmitters, i.e.,
dopamine, serotonin, adenosine, and ACh (Brudzynski et al., 1991 ;
Cruickshank et al., 1994 ; Role and Berg, 1996 ; Wilkie et al., 1996 ;
Yang et al., 1996 ; Wonnacott, 1997 ). ADNFLE can be treated effectively
by the sodium channel blocker carbamazepine (Scheffer et al., 1994 ).
This leaves the question open of which neurotransmitters besides ACh
are involved in the pathology. Occurrence of ADNFLE seizures in a
strict relationship to the sleep-wake cycle indicates a possible
involvement of cholinergic ascending brain stem systems (Meierkord,
1994 ; Szymusiak, 1995 ; Everitt and Robbins, 1997 ). Further
physiological studies are needed to clarify the mechanisms of
involvement of mutant 4 AChRs in the ADNFLE.
Recently, five mutations in the M2 transmembrane domain of the muscle
nicotinic AChRs were identified as responsible for congenital myasthenic syndromes (CMS) (Ohno et al., 1995 ; Engel et al., 1996 ). In
addition, mutations causing CMS also have been found in other parts of
1, 1, , and subunits (Engel et al., 1993 , 1996 ; Gomez and
Gammack, 1995 ; Ohno et al., 1995 , 1996 ; Sine et al., 1995 ; Gomez et
al., 1996 ). A total of >60 muscle AChR mutants has been found (A. Engel, personal communication). Properties of the recombinant mutated
AChRs were compared with the properties of native AChRs from the
intercostal muscle tissue obtained by biopsy from patients. Because the
functional roles of 4 2 AChRs are less well known and the tissue
is inaccessible, such elegant analysis will not soon be possible on
neuronal AChRs. However, the recent groundswell in discovery of
mutations in muscle AChRs suggests that there also may be many such
mutations in neuronal AChRs waiting to be discovered.
FOOTNOTES
Received July 7, 1997; revised Sept. 17, 1997; accepted Sept. 18, 1997.
This work was supported by grants to J.L. from the National Institutes
of Health (NS11323), the Smokeless Tobacco Research Council,
Incorporated, and the Muscular Dystrophy Association. M.N. was
supported by a National Research Service Award fellowship.
A.K., V.G., and M.N. contributed equally to this work.
Correspondence should be addressed to Dr. Jon Lindstrom, 217 Stemmler
Hall, Department of Neuroscience, Medical School of the University of
Pennsylvania, Philadelphia, PA 19104-6074.
REFERENCES
-
Akabas M,
Kaufmann C,
Archdeacon P,
Karlin A
(1994)
Identification of acetylcholine receptor channel-lining residues in the entire M2 segment of the
subunit.
Neuron
13:919-927[Web of Science][Medline]. -
Anand R,
Conroy WG,
Schoepfer R,
Whiting P,
Lindstrom J
(1991)
Neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes have a pentameric quaternary structure.
J Biol Chem
266:11192-11198[Abstract/Free Full Text].
-
Anand R,
Bason L,
Saedi MS,
Gerzanich V,
Peng X,
Lindstrom J
(1993)
Reporter epitopes: a novel approach to examine transmembrane topology of integral membrane proteins applied to the
1 subunit of the nicotinic acetylcholine receptor.
Biochemistry
32:9975-9984[Medline]. -
Bertrand D,
Galzi JL,
Devillers-Thiery A,
Bertrand S,
Changeux JP
(1993)
Mutations at two distinct sites within the channel domain M2 alter calcium permeability of neuronal
7 nicotinic receptor.
Proc Natl Acad Sci USA
90:6971-6975[Abstract/Free Full Text]. -
Brudzynski SM,
McLachlan RS,
Girvin JP
(1991)
Involvement of M1 and M2 muscarinic receptors of the basal forebrain in cholinergically mediated changes in the rat locomotion.
Prog Neuropsychopharmacol Biol Psychiatry
15:279-284[Medline].
-
Charnet P,
Labarca C,
Leonard RJ,
Vogelaar NJ,
Czyzyk L,
Gouin A,
Davidson N,
Lester HA
(1990)
An open-channel blocker interacts with adjacent turns of
-helices in the nicotinic acetylcholine receptor.
Neuron
4:87-95[Web of Science][Medline]. -
Charnet P,
Labarca C,
Cohen B,
Davidson N,
Lester H,
Pilar P
(1992)
Pharmacological and kinetic properties of
4 2 neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes.
J Physiol (Lond)
450:375-394[Abstract/Free Full Text]. -
Cooper E,
Couturier S,
Ballivet M
(1991)
Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor.
Nature
350:235-238[Medline].
-
Cruickshank JW,
Brudzynski SM,
McLachlan RS
(1994)
Involvement of M1 muscarinic receptors in the initiation of cholinergically induced epileptic seizures in the rat brain.
Brain Res
643:125-129[Web of Science][Medline].
-
Engel AG,
Uchitel OD,
Walls TJ,
Nagel A,
Harper CM,
Bodensteiner J
(1993)
Newly recognized congenital myasthenic syndrome associated with high conductance and fast closure of the acetylcholine receptor channel.
Ann Neurol
34:38-47[Web of Science][Medline].
-
Engel AG,
Ohno K,
Milone M,
Wang HL,
Nakano S,
Bouzat C,
Pruitt JN,
Hutchinson DO,
Brengman JM,
Bren N,
Sieb JP,
Sine SM
(1996)
New mutations in acetylcholine receptor subunit genes reveal heterogeneity in the slow-channel congenital myasthenic syndrome.
Hum Mol Genet
5:1217-1227[Abstract/Free Full Text].
-
Everitt B,
Robbins T
(1997)
Central cholinergic systems and cognition.
Annu Rev Psychol
48:649-684[Web of Science][Medline].
-
Figl A,
Viseshakul N,
Forsayeth J,
Cohen BN
(1997)
A mutation associated with epilepsy enhances desensitization of the
4 2 neuronal nicotinic receptor.
Biophys J
72:A150. -
Filatov GN,
White MM
(1995)
The role of conserved leucines in the M2 domain of the acetylcholine receptor in channel gating.
Mol Pharmacol
48:379-384[Abstract].
-
Forman SA,
Yellen G,
Thiele EA
(1996)
Alternative mechanism for pathogenesis of an inherited epilepsy by a nicotinic AChR mutation [letter].
Nat Genet
13:396-397[Web of Science][Medline].
-
Francis M,
Papke R
(1996)
Muscle-type nicotinic acetylcholine receptor delta subunit determines sensitivity to noncompetitive inhibitors, while the
subunit regulates divalent permeability.
Neuropharmacology
35:1547-1556[Web of Science][Medline]. -
Gerzanich V,
Anand R,
Lindstrom J
(1994)
Homomers of
8 and 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.
Mol Pharmacol
45:212-220[Abstract]. -
Gomez CM,
Gammack JT
(1995)
A leucine-to-phenylalanine substitution in the acetylcholine receptor ion channel in a family with the slow-channel syndrome.
Neurology
45:982-985[Abstract/Free Full Text].
-
Gomez CM,
Maselli R,
Gammack J,
Lasalde J,
Tamamizu S,
Cornblath DR,
Lehar M,
McNamee M,
Kuncl RW
(1996)
A
-subunit mutation in the acetylcholine receptor channel gate causes severe slow-channel syndrome.
Ann Neurol
39:712-723[Web of Science][Medline]. -
Gopalakrishnan M,
Monteggia L,
Anderson D,
Molinari E,
Piattoni-Kaplan M,
Donnelly-Roberts D,
Arneric S,
Sullivan J
(1996)
Stable expression, pharmacological properties, and regulation of the human neuronal nicotinic acetylcholine
4 2 receptor.
J Pharmacol Exp Ther
276:289-297[Abstract/Free Full Text]. -
Harvey SC,
Maddox FN,
Luetje CW
(1996)
Multiple determinants of dihydro-
-erythroidine sensitivity on rat neuronal nicotinic receptor subunits.
J Neurochem
67:1953-1959[Web of Science][Medline]. -
Imoto K,
Busch C,
Sakmann B,
Mishina M,
Konno T,
Nakai J,
Bujo H,
Mori Y,
Fukuda K,
Numa S
(1988)
Rings of negatively charged amino acids determine the acetylcholine receptor channel conductance.
Nature
335:645-648[Medline].
-
Kayadjanian N,
Retaux S,
Menetrey A,
Besson MJ
(1994)
Stimulation by nicotine of the spontaneous release of [3H]gamma-aminobutyric acid in the substantia nigra and in the globus pallidus of the rat.
Brain Res
649:129-135[Web of Science][Medline].
-
Lena C,
Changeux JP,
Mulle C
(1993)
Evidence for "preterminal" nicotinic receptors on GABAergic axons in the rat interpeduncular nucleus.
J Neurosci
13:2680-2688[Abstract].
-
Leonard JP,
Kelso SR
(1990)
Apparent desensitization of NMDA responses in Xenopus oocytes involves calcium-dependent chloride current.
Neuron
4:53-60[Web of Science][Medline].
-
Leonard RJ,
Charnet P,
Labarca C,
Vogelaar NJ,
Czyzyk L,
Gouin A,
Davidson N,
Lester HA
(1991)
Reverse pharmacology of the nicotinic acetylcholine receptor. Mapping the local anesthetic binding site.
Ann NY Acad Sci
625:588-599[Web of Science][Medline].
-
Lindstrom J,
Anand R,
Peng X,
Gerzanich V,
Wang F,
Li Y
(1995)
Neuronal nicotinic receptor subtypes.
Ann NY Acad Sci
757:100-116[Web of Science][Medline].
-
Matsubayashi H,
Swanson K,
Albuquerque E
(1997)
Amantadine inhibits nicotinic acetylcholine receptor function in hippocampal neurons.
J Pharmacol Exp Ther
281:834-844[Abstract/Free Full Text].
-
McMahon LL,
Yoon KW,
Chiappinelli VA
(1994)
Nicotinic receptor activation facilitates GABAergic neurotransmission in the avian lateral spiriform nucleus.
Neuroscience
59:689-698[Web of Science][Medline].
-
Meierkord H
(1994)
Epilepsy and sleep.
Curr Opin Neurol
7:107-112[Web of Science][Medline].
-
Melton D,
Kreig P,
Rebagliati M,
Maniatis T,
Zinn K,
Green M
(1984)
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res
12:7035-7056[Abstract/Free Full Text].
-
Miner LL,
Collins AC
(1988)
The effect of chronic nicotine treatment on nicotine-induced seizures.
Psychopharmacology
95:52-55[Medline].
-
Ohno K,
Hutchinson DO,
Milone M,
Brengman JM,
Bouzat C,
Sine SM,
Engel AG
(1995)
Congenital myasthenic syndrome caused by prolonged acetylcholine receptor channel openings due to a mutation in the M2 domain of the
subunit.
Proc Natl Acad Sci USA
92:758-762[Abstract/Free Full Text]. -
Ohno K,
Wang HL,
Milone M,
Bren N,
Brengman JM,
Nakano S,
Quiram P,
Pruitt JN,
Sine SM,
Engel AG
(1996)
Congenital myasthenic syndrome caused by decreased agonist binding affinity due to a mutation in the acetylcholine receptor epsilon subunit.
Neuron
17:157-170[Web of Science][Medline].
-
Peng X,
Gerzanich V,
Anand R,
Whiting P,
Lindstrom J
(1994)
Nicotine-induced increase in neuronal nicotinic receptors results from a decrease in the rate of receptor turnover.
Mol Pharmacol
46:523-530[Abstract].
-
Phillips HA,
Scheffer IE,
Berkovic SF,
Hollway GE,
Sutherland GR,
Mulley JC
(1995)
Localization of a gene for autosomal dominant nocturnal frontal lobe epilepsy to chromosome 20q 13.2.
Nat Genet
10:117-118[Web of Science][Medline].
-
Picciotto M,
Zoli M,
Lena C,
Bessis A,
Lallemand Y,
Lenovere N,
Vincent P,
Rich E,
Brulet P,
Changeux J-P
(1995)
Abnormal avoidance learning in mice lacking functional high-affinity nicotine receptor in the brain.
Nature
374:65-67[Medline].
-
Ramirez-Latorre J,
Yu CR,
Qu X,
Perin F,
Karlin A,
Role L
(1996)
Functional contributions of
5 subunit to neuronal acetylcholine receptor channels.
Nature
380:347-351[Medline]. -
Riedel WJ,
Jolles J
(1996)
Cognition enhancers in age-related cognitive decline.
Drugs Aging
8:245-274[Web of Science][Medline].
-
Role LW,
Berg DK
(1996)
Nicotinic receptors in the development and modulation of CNS synapses.
Neuron
16:1077-1085[Web of Science][Medline].
-
Scheffer IE,
Bhatia KP,
Lopes-Cendes I,
Fish DR,
Marsden CD,
Andermann F,
Andermann E,
Desbiens R,
Cendes F,
Manson JI,
Berkovic S
(1994)
Autosomal dominant frontal epilepsy misdiagnosed as sleep disorder.
Lancet
343:515-517[Web of Science][Medline].
-
Scheffer IE,
Bhatia KP,
Lopes-Cendes I,
Fish DR,
Marsden CD,
Andermann E,
Andermann F,
Desbiens R,
Keene D,
Cendes F,
Manson J,
Constantinou J,
McIntosh A,
Berkovic S
(1995)
Autosomal dominant nocturnal frontal lobe epilepsy: a distinctive clinical disorder.
Brain
118:61-73[Abstract/Free Full Text].
-
Sigworth F,
Sine S
(1987)
Data transformation for improved display and fitting of single channel dwell time histograms.
Biophys J
52:1047-1054[Web of Science][Medline].
-
Sine SM,
Ohno K,
Bouzat C,
Auerbach A,
Milone M,
Pruitt JN,
Engel AG
(1995)
Mutation of the acetylcholine receptor
subunit causes a slow-channel myasthenic syndrome by enhancing agonist binding affinity.
Neuron
15:229-239[Web of Science][Medline]. -
Singer J,
Janz T
(1990)
Apnea and seizures caused by nicotine ingestion.
Pediatr Emerg Care
6:135-137[Medline].
-
Steinlein OK,
Mulley JC,
Propping P,
Wallace RH,
Phillips HA,
Sutherland GR,
Scheffer IE,
Berkovic SF
(1995)
A missense mutation in the neuronal nicotinic acetylcholine receptor
4 subunit is associated with autosomal dominant nocturnal frontal lobe epilepsy.
Nat Genet
11:201-203[Web of Science][Medline]. -
Steinlein O,
Magnusson A,
Stoodt J,
Bertrand S,
Weiland S,
Berkovic S,
Nakken K,
Propping P,
Bertrand D
(1997)
An insertion of the CHRNA4 gene in a family with autosomal dominant nocturnal lobe epilepsy.
Hum Mol Genet
6:943-947[Abstract/Free Full Text].
-
Szymusiak R
(1995)
Magnocellular nuclei of the basal forebrain: substrates of sleep and arousal regulation.
Sleep
18:478-500[Web of Science][Medline].
-
Vernino S,
Amador M,
Luetje CW,
Patrick J,
Dani JA
(1992)
Calcium modulation and high calcium permeability of neuronal nicotinic acetylcholine receptors.
Neuron
8:127-134[Web of Science][Medline].
-
Vidal C,
Changeux JP
(1996)
Neuronal nicotinic acetylcholine receptors in the brain.
News Physiol Sci
11:202-208.[Abstract/Free Full Text]
-
Wada E,
Wada K,
Boulter J,
Deneris E,
Heinemann S,
Patrick J,
Swanson LW
(1989)
Distribution of
2, 3, 4, and 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat.
J Comp Neurol
284:314-335[Web of Science][Medline]. -
Wang F,
Gerzanich V,
Wells GB,
Anand R,
Peng X,
Keyser K,
Lindstrom J
(1996)
Assembly of human neuronal nicotinic receptor
5 subunits with 3, 2, and 4 subunits.
J Biol Chem
271:17656-17665[Abstract/Free Full Text]. -
Weiland S,
Witzemann V,
Villarroel A,
Propping P,
Steinlein O
(1996)
An amino acid exchange in the second transmembrane segment of a neuronal nicotinic receptor causes partial epilepsy by altering its desensitization kinetics.
FEBS Lett
398:91-96[Web of Science][Medline].
-
Whiting PJ,
Lindstrom JM
(1988)
Characterization of bovine and human neuronal nicotinic acetylcholine receptors using monoclonal antibodies.
J Neurosci
8:3395-3404[Abstract].
-
Wilkie GI,
Hutson P,
Sullivan JP,
Wonnacott S
(1996)
Pharmacological characterization of a nicotinic autoreceptor in rat hippocampal synaptosomes.
Neurochem Res
21:1141-1148[Web of Science][Medline].
-
Wonnacott S
(1997)
Presynaptic nicotinic ACh receptors.
Trends Neurosci
20:92-98[Web of Science][Medline].
-
Woolf A,
Burkhart K,
Caraccio T,
Litovitz T
(1996)
Self-poisoning among adults using multiple transdermal nicotine patches.
J Toxicol Clin Toxicol
34:691-698[Web of Science][Medline].
-
Yang X,
Criswell HE,
Breese GR
(1996)
Nicotine-induced inhibition in medial septum involves activation of presynaptic nicotinic cholinergic receptors on gamma-aminobutyric acid-containing neurons.
J Pharmacol Exp Ther
276:482-489[Abstract/Free Full Text].
-
Zhang M,
Wang Y,
Vyas D,
Neuman R,
Bieger D
(1993)
Nicotinic cholinoceptor-mediated excitatory postsynaptic potentials in rat nucleus ambiguus.
Exp Brain Res
96:83-88[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
J. Luo, P. Taylor, M. Losen, M. H. de Baets, G. D. Shelton, and J. Lindstrom
Main Immunogenic Region Structure Promotes Binding of Conformation-Dependent Myasthenia Gravis Autoantibodies, Nicotinic Acetylcholine Receptor Conformation Maturation, and Agonist Sensitivity
J. Neurosci.,
November 4, 2009;
29(44):
13898 - 13908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. X. Albuquerque, E. F. R. Pereira, M. Alkondon, and S. W. Rogers
Mammalian Nicotinic Acetylcholine Receptors: From Structure to Function
Physiol Rev,
January 1, 2009;
89(1):
73 - 120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kuryatov, J. Onksen, and J. Lindstrom
Roles of Accessory Subunits in {alpha}4{beta}2* Nicotinic Receptors
Mol. Pharmacol.,
July 1, 2008;
74(1):
132 - 143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Teper, D. Whyte, E. Cahir, H. A. Lester, S. R. Grady, M. J. Marks, B. N. Cohen, C. Fonck, T. McClure-Begley, J. M. McIntosh, et al.
Nicotine-Induced Dystonic Arousal Complex in a Mouse Line Harboring a Human Autosomal-Dominant Nocturnal Frontal Lobe Epilepsy Mutation
J. Neurosci.,
September 19, 2007;
27(38):
10128 - 10142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tapia, A. Kuryatov, and J. Lindstrom
Ca2+ Permeability of the ({alpha}4)3(beta2)2 Stoichiometry Greatly Exceeds That of ({alpha}4)2(beta2)3 Human Acetylcholine Receptors
Mol. Pharmacol.,
March 1, 2007;
71(3):
769 - 776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Klaassen, J. Glykys, J. Maguire, C. Labarca, I. Mody, and J. Boulter
Seizures and enhanced cortical GABAergic inhibition in two mouse models of human autosomal dominant nocturnal frontal lobe epilepsy
PNAS,
December 12, 2006;
103(50):
19152 - 19157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kishi and J. H. Steinbach
Role of the Agonist Binding Site in Up-Regulation of Neuronal Nicotinic {alpha}4beta2 Receptors
Mol. Pharmacol.,
December 1, 2006;
70(6):
2037 - 2044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Tumkosit, A. Kuryatov, J. Luo, and J. Lindstrom
beta3 Subunits Promote Expression and Nicotine-Induced Up-Regulation of Human Nicotinic {alpha}6* Nicotinic Acetylcholine Receptors Expressed in Transfected Cell Lines
Mol. Pharmacol.,
October 1, 2006;
70(4):
1358 - 1368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Briggs, E. J. Gubbins, M. J. Marks, C. B. Putman, R. Thimmapaya, M. D. Meyer, and C. S. Surowy
Untranslated Region-Dependent Exclusive Expression of High-Sensitivity Subforms of {alpha}4beta2 and {alpha}3beta2 Nicotinic Acetylcholine Receptors
Mol. Pharmacol.,
July 1, 2006;
70(1):
227 - 240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. G. Hales, J. I. Dunlop, T. Z. Deeb, J. E. Carland, S. P. Kelley, J. J. Lambert, and J. A. Peters
Common Determinants of Single Channel Conductance within the Large Cytoplasmic Loop of 5-Hydroxytryptamine Type 3 and {alpha}4beta2 Nicotinic Acetylcholine Receptors
J. Biol. Chem.,
March 24, 2006;
281(12):
8062 - 8071.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Fonck, B. N. Cohen, R. Nashmi, P. Whiteaker, D. A. Wagenaar, N. Rodrigues-Pinguet, P. Deshpande, S. McKinney, S. Kwoh, J. Munoz, et al.
Novel Seizure Phenotype and Sleep Disruptions in Knock-In Mice with Hypersensitive {alpha}4* Nicotinic Receptors
J. Neurosci.,
December 7, 2005;
25(49):
11396 - 11411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Person, K. L. Bills, H. Liu, S. K. Botting, J. Lindstrom, and G. B. Wells
Extracellular Domain Nicotinic Acetylcholine Receptors Formed by {alpha}4 and {beta}2 Subunits
J. Biol. Chem.,
December 2, 2005;
280(48):
39990 - 40002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kuryatov, J. Luo, J. Cooper, and J. Lindstrom
Nicotine Acts as a Pharmacological Chaperone to Up-Regulate Human {alpha}4{beta}2 Acetylcholine Receptors
Mol. Pharmacol.,
December 1, 2005;
68(6):
1839 - 1851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. O. Rodrigues-Pinguet, T. J. Pinguet, A. Figl, H. A. Lester, and B. N. Cohen
Mutations Linked to Autosomal Dominant Nocturnal Frontal Lobe Epilepsy Affect Allosteric Ca2+ Activation of the {alpha}4{beta}2 Nicotinic Acetylcholine Receptor
Mol. Pharmacol.,
August 1, 2005;
68(2):
487 - 501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Panicker, H. Cruz, C. Arrabit, K. F. Suen, and P. A. Slesinger
Minimal Structural Rearrangement of the Cytoplasmic Pore during Activation of the 5-HT3A Receptor
J. Biol. Chem.,
July 2, 2004;
279(27):
28149 - 28158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhou, M. E. Nelson, A. Kuryatov, C. Choi, J. Cooper, and J. Lindstrom
Human {alpha}4{beta}2 Acetylcholine Receptors Formed from Linked Subunits
J. Neurosci.,
October 8, 2003;
23(27):
9004 - 9015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Hoopengardner, T. Bhalla, C. Staber, and R. Reenan
Nervous System Targets of RNA Editing Identified by Comparative Genomics
Science,
August 8, 2003;
301(5634):
832 - 836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rodrigues-Pinguet, L. Jia, M. Li, A. Figl, A. Klaassen, A. Truong, H. A Lester, and B. N Cohen
Five ADNFLE mutations reduce the Ca2+ dependence of the mammalian {alpha}4{beta}2 acetylcholine response
J. Physiol.,
July 1, 2003;
550(1):
11 - 26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Fonck, R. Nashmi, P. Deshpande, M. I. Damaj, M. J. Marks, A. Riedel, J. Schwarz, A. C. Collins, C. Labarca, and H. A. Lester
Increased Sensitivity to Agonist-Induced Seizures, Straub Tail, and Hippocampal Theta Rhythm in Knock-In Mice Carrying Hypersensitive alpha 4 Nicotinic Receptors
J. Neurosci.,
April 1, 2003;
23(7):
2582 - 2590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Nelson, A. Kuryatov, C. H. Choi, Y. Zhou, and J. Lindstrom
Alternate Stoichiometries of alpha 4beta 2 Nicotinic Acetylcholine Receptors
Mol. Pharmacol.,
February 1, 2003;
63(2):
332 - 341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rush, A. Kuryatov, M. E. Nelson, and J. Lindstrom
First and Second Transmembrane Segments of alpha 3, alpha 4, beta 2, and beta 4 Nicotinic Acetylcholine Receptor Subunits Influence the Efficacy and Potency of Nicotine
Mol. Pharmacol.,
June 1, 2002;
61(6):
1416 - 1422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Willmore and Y. Ueda
Genetics of Epilepsy
J Child Neurol,
January 1, 2002;
17(1_suppl):
S18 - S27.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Paradiso, J. Zhang, and J. H. Steinbach
The C Terminus of the Human Nicotinic {alpha}4{beta}2 Receptor Forms a Binding Site Required for Potentiation by an Estrogenic Steroid
J. Neurosci.,
September 1, 2001;
21(17):
6561 - 6568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Rho and T. W. Storey
Molecular Ontogeny of Major Neurotransmitter Receptor Systems in the Mammalian Central Nervous System: Norepinephrine, Dopamine, Serotonin, Acetylcholine, and Glycine
J Child Neurol,
April 1, 2001;
16(4):
271 - 280.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Buisson and D. Bertrand
Chronic Exposure to Nicotine Upregulates the Human {alpha}4{beta}2 Nicotinic Acetylcholine Receptor Function
J. Neurosci.,
March 15, 2001;
21(6):
1819 - 1829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. G. Wilson and A. Karlin
Acetylcholine receptor channel structure in the resting, open, and desensitized states probed with the substituted-cysteine-accessibility method
PNAS,
January 10, 2001;
(2001)
31567798.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Gambardella, G. Annesi, M. De Fusco, A. Patrignani, U. Aguglia, F. Annesi, A. A. Pasqua, P. Spadafora, R. L. Oliveri, P. Valentino, et al.
A new locus for autosomal dominant nocturnal frontal lobe epilepsy maps to chromosome 1
Neurology,
November 28, 2000;
55(10):
1467 - 1471.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Figl and B. N Cohen
The {beta} subunit dominates the relaxation kinetics of heteromeric neuronal nicotinic receptors
J. Physiol.,
May 1, 2000;
524(3):
685 - 699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Alkondon, E. F. R. Pereira, H. M. Eisenberg, and E. X. Albuquerque
Nicotinic Receptor Activation in Human Cerebral Cortical Interneurons: a Mechanism for Inhibition and Disinhibition of Neuronal Networks
J. Neurosci.,
January 1, 2000;
20(1):
66 - 75.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hirose, H. Iwata, H. Akiyoshi, K. Kobayashi, M. Ito, K. Wada, S. Kaneko, and A. Mitsudome
A novel mutation of CHRNA4 responsible for autosomal dominant nocturnal frontal lobe epilepsy
Neurology,
November 1, 1999;
53(8):
1749 - 1749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E Nelson and J. Lindstrom
Single channel properties of human {alpha}3 AChRs: impact of {beta}2, {beta}4 and {alpha}5 subunits
J. Physiol.,
May 1, 1999;
516(3):
657 - 678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Figl, N. Viseshakul, N. Shafaee, J. Forsayeth, and B. N Cohen
Two mutations linked to nocturnal frontal lobe epilepsy cause use-dependent potentiation of the nicotinic ACh response
J. Physiol.,
December 15, 1998;
513(3):
655 - 670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Zwart and H. P. M. Vijverberg
Four Pharmacologically Distinct Subtypes of alpha 4beta 2 Nicotinic Acetylcholine Receptor Expressed in Xenopus laevis Oocytes
Mol. Pharmacol.,
December 1, 1998;
54(6):
1124 - 1131.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Auerbach and G. Akk
Desensitization of Mouse Nicotinic Acetylcholine Receptor Channels: A Two-Gate Mechanism
J. Gen. Physiol.,
August 1, 1998;
112(2):
181 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. G. Wilson and A. Karlin
Inaugural Article: Acetylcholine receptor channel structure in the resting, open, and desensitized states probed with the substituted-cysteine-accessibility method
PNAS,
January 30, 2001;
98(3):
1241 - 1248.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|