 |
|||||
|
|||||
|
|||||
|
|||||
|
|||||
Previous Article | Next Article
Volume 17, Number 4, Issue of February 15, 1997 pp. 1206-1216
Copyright ©1997 Society for NeuroscienceDevelopmental Regulation of Synaptotagmin I, II, III, and IV mRNAs in the Rat CNS
Frédérique Berton, Cécile Iborra, Jeanne-Andrée Boudier, Michael J. Seagar, and Béatrice Marquèze Institut National de la Santé et de la Recherche Médicale U 374, Institut Jean Roche, Faculté de Médecine-Secteur Nord, 13916 Marseille Cedex 20, France
ABSTRACT
Synaptotagmin I is an abundant synaptic vesicle protein that has an essential function in mediating Ca2+-triggered neurotransmitter release. We have analyzed the distribution of four neural synaptotagmin isoforms during postnatal development of the rat CNS by in situ hybridization. Synaptotagmin I, II, III, and IV genes have distinct patterns of spatiotemporal expression except in cerebellum granule cells, where the four transcripts were detected during the formation of parallel fiber/Purkinje cell synapses. Throughout development synaptotagmin I mRNAs were widely expressed in brain, whereas synaptotagmin II transcripts were predominant in spinal cord. At all stages synaptotagmin III mRNAs were expressed uniformly in most neurons examined, although at a low level. Synaptotagmin I, II, and III gene expressions mainly increased during development and persisted in adulthood, mirroring neuronal differentiation. Conversely, synaptotagmin IV transcripts were predominant during perinatal development in a heterogeneous population of neurons and subsequently were expressed uniformly at a low level. Intense labeling was observed in the hippocampal CA3 field and in the subiculum, but not in the CA1 field, of the newborn rat. In cerebral cortex, lamina-specific labeling was detected with a high expression in cell layer V. Only a small number of Purkinje cell clusters were labeled in the flocculus and paraflocculus of the cerebellum. Heterogeneous sets of neurons expressing synaptotagmin IV gene also were observed in spinal cord. We thus speculate that synaptotagmin IV may a play a role in the development of the mammalian nervous system.
Key words: synaptotagmin; exocytosis; neurotransmitter release; development; synaptogenesis; in situ hybridization
INTRODUCTION
Calcium entry through voltage-gated channels triggers exocytosis of neurotransmitters from nerve terminals with millisecond latency. This implies the presence of sensor proteins that detect a rise in cytoplasmic calcium concentration and, consequently, promote the fusion of synaptic vesicles at the presynaptic plasma membrane. Persuasive evidence has been obtained that the synaptotagmins play a crucial role in the Ca2+-dependent regulation of neurosecretion (Geppert et al., 1994
) (for review, see Littleton and Bellen, 1995
Nine synaptotagmin isoforms have been reported in mammals (Perin et al., 1990
Synaptotagmins interact with multiple proteins implicated in synaptic vesicle trafficking. These include the neurexins (Petrenko et al., 1991
Whether the other isoforms also can mediate Ca2+-regulated exocytosis remains to be established, although they display many similar biochemical properties to synaptotagmin I. Synaptotagmins II, and III have been detected in fractions enriched in synaptic vesicles (Ullrich et al., 1994
We present a detailed direct comparison of the spatial and temporal expression patterns of synaptotagmin I, II, III, and IV mRNAs in the developing mammalian brain using the in situ hybridization technique, which suggests distinct functional roles for the gene products.
MATERIALS AND METHODS
Oligonucleotide probes. Oligonucleotide probes [44-45 base pairs (bp)] of unique sequence were synthesized (CIML, France) and purified by ethanol precipitation. The probe sequences for rat synaptotagmin I (Perin et al., 1990end-labeled with 5
-35S]-dATP (>1000 Ci/mmol; Amersham, Arlington Heights, IL) to similar specific activities in the range from 0.5 × 109 to 1.5 × 109 dpm/µg, using terminal deoxynucleotidyl transferase (Boehringer Mannheim, Mannheim, Germany) with a 30:1 molar ratio of dATP/oligonucleotide. Unincorporated nucleotides were removed by a spin column procedure using Sephadex G-25 (Pharmacia, Uppsala, Sweden).
Table 1. 5
Synaptotagmin I probes TgIa complementary to bases 1800-1843 TACTGGCTAAAGAGCACTATGTGGGCAGATGCAGAAAGGCTTCG TgIb complementary to bases 2527-2571 TGAAGCTATGCTAGATGCAGTGGTAGGAACGCATTGGCTCCTGTT TgIs bases 1800-1843 CGAAGCCTTTCTGCATCTGCCCACATAGTGCTCTTTAGCCAGTA Synaptotagmin II probes TgIIa complementary to bases 1923-1966 TTTCGCAAGGACTATGAGAGCTTCTGGCCTCTGACCACTTAAGC TgIIb complementary to bases 2447-2491 AGTTGTGAGGAGCTCTGCAATGTCTAGCTTGTCACTGTCCACCAA TgIIs bases 1923-1966 GCTTAAGTGGTCAGAGGCCAGAAGCTCTCATAGTCCTTGCGAAA Synaptotagmin III probes TgIIIa complementary to bases 1809-1853 TTCTCTGACAATCCTTTGCCGCCCTTGGTAAAGCTGCTTAGAGTC TgIIIb complementary to bases 1853-1896 GTCCAATCCCAGGCCTAGACCAGACCCTCACTCTGAATTCTCTT TgIIIs bases 1809-1853 GACTCTAAGCAGCTTTACCAAGGGCGGCAAAGGATTGTCAGAGAA Synaptotagmin IV probes TgIVa complementary to bases 269-312 ATTGCCATTGAGGTCTCGCTTCTCGAGATCAAGGTGCAGGGAAA TgIVb complementary to bases 334-377 AAGAGCTTTGGGGTGACATTTTCCAGATCAGAAGAGCTGCCAGC TgIVs bases 269-312 TTTCCCTGCACCTTGATCTCGAGAAGCGAGACCTCAATGGCAAT
Tissue preparation. Nonperfused rats of different ages were decapitated. Brains or cervicothoracic regions of the spinal cord were removed and frozen on dry ice. Cryostat sections (12 µm) were cut, mounted onto poly-L-lysine-coated slides, and dried at room temperature. Experiments were performed on horizontal, coronal, and sagittal brain sections of newborn and 2-, 4-, 6-, 10-, 13-, 15-, 20-, and 30-d-old and adult rats. Sections were stored at 80°C until required. On the day of the experiment, sections were fixed in 4% paraformaldehyde, rinsed in PBS, dehydrated into 95% ethanol, and dried.
In situ hybridization. Radiolabeled probe was dissolved in hybridization buffer [50% (v/v) formamide, 4× SSC (0.15 M NaCl and 0.015 M Na-citrate), and 10% (w/v) dextran sulfate] at final concentrations of 0.14-0.5 nM and applied to sections. Hybridization was performed at 42°C under a Parafilm cover. Sections were washed to a final stringency of 1× SSC at 55°C and exposed to Kodak X-Omat or Biomax film at room temperature or dipped in Ilford K5 emulsion. Slides were developed in D-19 (Eastman Kodak, Rochester, NY) and counterstained with toluidine blue. To examine the specificity of the signals observed, we hybridized sections at each stage with two independent antisense oligonucleotides complementary to different regions of each transcript. Only TgIIIa antisense oligonucleotide was used on sections that were dipped in emulsion. Control experiments with the sense oligonucleotide probes TgIs, TgIIs, TgIIIs, and TgIVs were performed at all ages, as detailed above. The anatomy of sections and autoradiographs was determined by using the atlas of the adult (Paxinos and Watson, 1986 
Fig. 1. Overview of postnatal expression of synaptotagmin I, II, III, and IV transcripts in rat brain. In situ hybridization of synaptotagmin I (A-E), II (F-J), III (K-O), and IV (P-T) mRNAs in horizontal sections of newborn (P0), 6- (P6), 15- (P15), and 20-d-old (P20) and adult (Ad) rat brain. Exposure was on Kodak Biomax film for 2 weeks with synaptotagmin I and IV probes, 5 weeks with synaptotagmin II, and 6 weeks with synaptotagmin III probes. Negative digitalized images were produced by scanning autoradiographic films. Synaptotagmin I, II, and IV mRNA distributions were obtained in the same experiment. Cb, Cerebellum; CPu, caudate putamen; Cx, cortex; DG, dentate gyrus; Gl, glomerular layer; Hi, hippocampus; IC, inferior colliculi; Igr, internal granule cell layer; M, mitral cell layer; Mhb, medial habenula; OB, olfactory bulb; Rt, reticular thalamic nucleus; S, septum; SC, superior colliculi; Th, thalamus. Scale bar, A-T, 5 mm.
[View Larger Version of this Image (130K GIF file)]
RESULTS
Specificity of probes
To assess the expression of synaptotagmin I, II, III, and IV transcripts in the developing rat CNS, we used specific oligonucleotide probes corresponding to distinct nucleotidic sequences. Synaptotagmin I, II, and III oligonucleotides were identical to those used in our previous study on adult rat tissues (Marquèze et al., 1995
Figures 1 and 2 provide an overview of synaptotagmin expression from birth (P0) until adulthood in brain and spinal cord. Because of the broad spatiotemporal areas studied and the nonlinear response of film to radioactivity, results shown in these figures should be considered as semi-quantitative. However, cellular localizations of synaptotagmin transcripts were characterized in different areas of the brain (Figs. 3-7) in conditions of a more linear dose-response scale. Table 2 summarizes synaptotagmin mRNA levels in the CNS obtained by evaluating both x-ray films and emulsion-coated slides. 
Fig. 2. Overview of postnatal expression of synaptotagmin I, II, III, and IV transcripts in rat spinal cord. In situ hybridization of synaptotagmin I (A-C), II (D-F), III (G-I), and IV (J-L) mRNAs on newborn (P0), 6- (P6), and 20-d-old (P20) sections. Exposures were on Kodak Biomax film for 7 weeks. The dorsal horns are oriented toward the top of each photomicrograph. Scale bar, A-L, 1 mm.
[View Larger Version of this Image (108K GIF file)]
Fig. 3. Differential distributions of synaptotagmin I, II, and IV transcripts in the developing olfactory bulb. High-power bright-field photomicrographs of 6- (P6), 15- (P15), and 20-d-old (P20) rat brain sections show the distribution of synaptotagmin I (A-C), II (D-F), and IV (G-I) mRNAs. Exposure times of the emulsion-coated slides were 6 weeks. Gl, Glomerular layer; Igr, internal granule cell layer. Arrowheads point to the mitral cell layer (M). Scale bar, A-I, 35 µm.
[View Larger Version of this Image (142K GIF file)]
Table 2. Relative distribution of synaptotagmin I, II, III, and IV mRNAs in different regions of the rat CNS during postnatal development
Area Age Synaptotagmin I Synaptotagmin II PO P4-P6 P13-P15 P20 Adult PO P4-P6 P13-P15 P20 Adult Olfactory bulb Glomerular layer + +++ +++ +++ +++ ND ND ND ND ND Mitral cell layer +++ +++ +++ +++ +++ ND ND ND ND ND Internal granule cell layer ND + + ++ ++ ND ND ND ND ND Cortex Layer II/III ++ ++ ++++ +++ +++ ND ND ND ND ND Layer IV ++ ++ ++++ +++ +++ ND ND ND ND ND Layer V/VI ++ ++ ++++ +++ +++ ND ND *+++ *+++ *+++ Caudate putamen + + ++ ++ ++ ND ND ND ND ND Thalamus ++ ++ +++ ++ ++ ND ND + + + Hippocampus CA1/CA2 cell layer ++ +++ +++ ++++ +++ ND ND *++ *++ *++ CA/3/CA4 cell layer + ++ +++ ++++ +++ ND ND *++ *++ *++ Dentate gyrus + ++ +++ +++ ++ ND ND ND ND ND Cerebellum Purkinje cell layer ND ++ ND ND ND ND ND ++ ++ ++ Granule cell layer +++ +++ +++ +++ +++ ND ND +++ +++ +++ *++++ *++++ *++++ Spinal cord Dorsal horn +++ +++ +++ ++ ++ + ++ ++ +++ +++ Ventral horn ++ ++ + ND ND +++ +++ +++ +++ +++ Area Age Synaptotagmin III Synaptotagmin IV PO P4-P6 P13-P15 P20 Adult PO P4-P6 P13-P15 P20 Adult Olfactory bulb Glomerular layer + + + + + + + + + + Mitral cell layer + + + + + + + + + + Internal granule cell layer + + + + + + + + + + Neocortex Layer II/III + + + + + +++ ++++ ++ ++ + Layer IV + + + + + +++ + + + + Layer V/VI + + + + + +++ ++++ ++ ++ + Caudate putamen + + + + + +++ ++ + + + Thalamus + + + + + +++ ++ + + + Hippocampus Ca1/CA2 cell layer + + + + + ND ++ ++ + + CA3/CA4 cell layer + + + + + +++ ++++ ++ ++ ++ Dentate gyrus + + + + + ND ++ ++ ++ + Cerebellum Purkinje cell layer ND ND ND ND ND *+++ *++++ ++ ++ ++ Granule cell layer ND + ++ ++ ++ + ++ ++++ ++++ +++ Spinal cord Dorsal horn + + + + + *++++ *++++ ++ ++ ++ *++ *++ Ventral horn + + + + + *+++ *++++ ++ ++ ++ *+ *++ In situ hybridization signals obtained with 35S-labeled oligonucleotide probes on sections were assessed as intense (++++), strongly positive (+++), positive (++), weakly detectable (+), and not detected (ND). Asterisk indicates that signals were observed only on some cells. Regional distribution in brain and spinal cord
Synaptotagmin I The distribution of synaptotagmin I transcripts in adult rat brain was similar to those previously described (Ullrich et al., 1994Cellular distribution
The distribution of synaptotagmin mRNAs is described below in greater detail in four brain regions that highlight the distinct ontogenetic expression patterns. Because of the uniform low level of synaptotagmin III transcripts in the brain, their cellular distribution is not shown in Figures 3, 5, and 7.
Fig. 5. Distinct distributions of synaptotagmin I, II, and IV transcripts in the developing rat hippocampus. High-power bright-field photomicrographs through the CA3 cell layer illustrate the distribution of synaptotagmin I (A-C), II (D-F), and IV(G-I) on 4- (P4), 13- (P13), and 20-d-old (P20) rat brain sections. Exposure times were 6 weeks. Arrowheads highlight labeled CA3 cells. Scale bar, A-I, 23 µm.
[View Larger Version of this Image (161K GIF file)]
Fig. 7. Differential distributions of synaptotagmin I, II, and IV transcripts in the developing cerebellum. High-power bright-field photomicrographs display the distribution of synaptotagmin I (A-C), II (D-F), and IV (G-I) transcripts on 6- (P6), 15- (P15), and 20-d-old (P20) rat brain sections. Exposure times were 6 weeks. EGL, External germinal layer; mol, molecular layer; Pj, Purkinje cell layer; Gr, granule cell layer. Arrowheads point to some highly labeled cells in the granule cell layer. Arrows show the labeling of the premigratory zone of the external plexiform layer. Scale bars: A, D, G, 14 µm; B, C, E, F, H, I, 23 µm.
[View Larger Version of this Image (162K GIF file)]
Olfactory bulb
Synaptotagmin I transcripts predominated at all stages in most neurons Labeling of synaptotagmin I mRNAs was already intense in the mitral cell layer (Fig. 1A) in newborn rats and persisted in adulthood. The level of hybridization was also important in the glomerular and internal granule cell layers from P6 (Fig. 3A-C). The distribution of synaptotagmin III and IV (Fig. 3G-I) transcripts resembled those of synaptotagmin I, but the levels of hybridization were low at all stages examined. The level of labeling obtained with synaptotagmin II antisense probes in Figure 3D-F corresponded to the level of nonspecific hybridization obtained with the sense probe (data not shown).Neocortex
Synaptotagmin IV transcripts were the most abundant at early stages of postnatal development In newborn rats, cortical neurons mainly expressed synaptotagmin IV transcripts (Fig. 1P; data not shown on emulsion-dipped sections). A high level of hybridization was maintained during the first week. In 4-d-old rats, signals were restricted to several layers, possibly layers II-III and V (Fig. 4D), whereas synaptotagmin I transcripts were present at a lower level in all laminas explored (Fig. 4A).
Fig. 4. Distinct expression of synaptotagmin I and IV transcripts at P4 in cortex (A, D), hippocampus (B, E), and cerebellum (C, F). Bright-field photomicrographs of coronal sections display the distribution of synaptotagmin I (A-C) and synaptotagmin IV (D-F) transcripts. Exposure times were 6 weeks. A, D, Cortex; B, E, hippocampus; C, F, cerebellum. An arrowhead points to some highly labeled cells in F. CA1, CA1 cell layer; CA3, CA3 cell layer; DG, dentate gyrus; EGL, external germinal layer (arrowheads in C and F); Fl, flocculus. Ventral side of the cerebellum is oriented toward the left of photomicrographs C and F. Scale bars: A, D, 135 µm; B, C, E, F, 240 µm.
[View Larger Version of this Image (80K GIF file)]
Expression of synaptotagmin I transcripts reached a maximum on sections from 15- to 20-d-old rats (Fig. 1C,D), whereas signals with synaptotagmin IV probes diminished (Fig. 1R-T).
As previously described in the adult (Ullrich et al., 1994 Hippocampus
Synaptotagmin IV transcripts were predominant during the first week after birth Synaptotagmin IV transcripts were already highly expressed in the newborn rat. A heterogeneous distribution was observed in the hippocampus. The labeling was intense in the CA3-CA4 area and in the subiculum (Fig. 1P; data on emulsion-dipped sections not shown) but not detectable in the CA1 field and in the para- and presubiculum. At stages P4-P6 the level of hybridization of synaptotagmin IV was still very pronounced in the CA3-CA4 field (Figs. 4E, 5G), whereas synaptotagmin I transcripts were mostly present in the CA1 area (Fig. 4B).A subpopulation of CA1-CA3 neurons expressed synaptotagmin II transcripts As previously observed on adult hippocampal sections (Ullrich et al., 1994
Synaptotagmin I transcripts increased steadily from P0 through adulthood (Figs. 1A-E, 5A-C) while the level of synaptotagmin IV mRNAs decreased (Figs. 1Q-T, 5G-I). Cerebellum
During perinatal development, the synaptotagmin IV gene was highly expressed in clusters of Purkinje cells Synaptotagmin IV gene expression was detected as early as P0 (data not shown) and became pronounced at P4 only in the most rostral part of the cerebellum, essentially deep in the fissure closest to the fourth ventricle between the parafloccular and floccular lobes, as seen on several sagittal, horizontal, and serial coronal sections (Fig. 4F). A striking segregation of the labeling was observed in clusters of putative Purkinje cells. On Figure 6B a section of the flocculus hybridized with the synaptotagmin IV sense probe is displayed. Unlabeled Purkinje cells are clearly distinguished by their more intense staining with toluidine blue. In the same area of the cerebellum hybridized with the antisense probe (Fig. 6A), the labeled cells showed the same morphology and localization as Purkinje cells. A temporal expression pattern was established by comparing the hybridization pattern at P0, P2, P4, and P6 (data not shown). The highest level of expression in the clusters was observed at P4.
Fig. 6. Cellular expression of synaptotagmin IV transcripts at P4 in the flocculus of the cerebellum. Shown are bright-field photomicrographs of sagittal sections hybridized with the synaptotagmin IV antisense (A) and sense (B) probes. Exposure times were 6 weeks. EGL, External germinal layer; Pj, Purkinje cell layer. Scale bar, A, B, 17 µm.
[View Larger Version of this Image (140K GIF file)]
At P6, the level of labeling of synaptotagmin IV transcripts in the Purkinje cell clusters was decreasing. Previously unlabeled neurons began to express synaptotagmin IV transcripts at a low level (Fig. 7G), thus giving a more uniform pattern of expression among Purkinje cells. These neurons also expressed synaptotagmin I (Fig. 7A), whereas no hybridization was detected with synaptotagmin II (Fig. 7D) and III probes (data not shown). Postmitotic premigratory granule cells expressed the synaptotagmin I gene Granule cells already express synaptotagmin I at P0. Strikingly, synaptotagmin I mRNAs also were found in the premigratory zone of the external granular layer occupied by postmitotic neurons migrating from the germinative layer to the internal cell layer through the Purkinje cell layer (see arrows, Fig. 7B,C). At later stages of differentiation, granule cells expressed the four synaptotagmin genes At ~P15-P20 (Figs. 1, 7B,C,E,F,H,I) expression of the four synaptotagmin transcripts reached its highest level in the granular cell layer. Also, a strong level of synaptotagmin I hybridization, which attained a peak of intensity ~P15-P20, was observed on discrete neurons in the granular cell layer that were possibly Golgi cells (see arrowheads, Fig. 7B,C), as previously described in adult tissue (Marquèze et al., 1995
From P15, synaptotagmin I mRNAs (Fig. 7B,C) were no longer detectable in Purkinje cells, whereas synaptotagmin II (Fig. 7E,F) and synaptotagmin IV (Fig. 7H,I) mRNAs were expressed uniformly.
DISCUSSION
As a basis for further functional studies, we have analyzed the distribution of four synaptotagmin isoforms during postnatal development in a major period of synaptogenesis in the CNS. In this discussion we assume that the observed changes in mRNA levels induce parallel changes in the biosynthesis of the various protein components. A very distinct spatial regulation of synaptotagmin I, II, and III mRNAs has been described in the adult brain (Ullrich et al., 1994
The temporal regulation of the four transcripts was very distinct. The overall levels of synaptotagmin I mRNAs in brain and synaptotagmin II in spinal cord steadily increased, whereas synaptotagmin IV mRNAs in these regions decreased through adulthood. Synaptotagmin III gene was expressed at a low level at all stages. Ontogeny of synaptotagmin I transcripts
The upregulation of synaptotagmin I gene expression in brain correlated with neuronal differentiation. Synaptotagmin I transcripts were present in most neurons, which is compatible with a general role of the protein in the release of neurotransmitters from nerve terminals.
In the olfactory bulb, the level of synaptotagmin I transcripts was already very high in the newborn rat. In the mouse, all types of synapses are already present in the newborn animal, which is a sign of the precocity of the olfactory system (Jacobson, 1991
This should be compared with the delayed postnatal synaptogenesis in the neocortex. At a time of dramatic increase in the connectivity of the mammalian cerebral cortex, which occurs during the early postnatal development (from P2 to P25), an increase of the level of synaptotagmin I mRNA was observed.
In cerebellum, our in situ developmental studies show that granule neurons express messages for synaptotagmin I immediately before migrating to their final anatomical destination. Immunoreactivity of synaptophysin, a transmembrane protein of synaptic vesicles, also has been described in immature granule cells (Leclerc et al., 1989
In the spinal cord, synaptotagmin I transcripts were confined to the dorsal horn except at early stages of differentiation when labeling was observed also in the ventral horn. Synaptotagmin II mRNAs were predominant and displayed a uniform distribution. The level of labeling steadily increased during synaptic maturation (Jacobson, 1991 Ontogeny of synaptotagmin IV transcripts
However, important differences were seen in the ontogenesis of synaptotagmin IV in the CNS. A transitory high expression was noticeable during the first week after birth in restricted cells, which were mostly efferent neurons that transmit information from one brain region to another. Subsequently, the intensity of labeling in these cells diminished and a low level was observed in most neurons.
Our data show that in developing neocortex synaptotagmin IV gene expression is most pronounced in layer V. The outgrowth of axons from layer V neurons starts during the final days of the prenatal period. They reach their targets in the mid- and hindbrain in early postnatal life (De Carlos and O'Leary, 1992
In the hippocampus, synaptotagmin IV expression was, strikingly, confined to the CA3 area and not detectable in CA1 cell layer during the first week. There is a "rhinal to dentate" gradient of neurogenesis in the hippocampus. The entorhinal cortex starts to differentiate first; next is the subiculum, then the CA3 field of Ammon's horn, and, finally, the dentate gyrus. Two structures are exceptions to this gradient. The para- and presubiculum are formed significantly later than the subiculum, and CA1 differentiates significantly later than adjacent CA3 cells (Bayer, 1980
A high transitory level of synaptotagmin IV gene expression was observed in very restricted patches of neurons identified as Purkinje cells. Evidence for biochemical heterogeneity in adult Purkinje cells has been provided for different neuropeptides, enzymes, and various molecular markers such as zebrins (Hawkes et al., 1992
Interestingly, in spinal cord a high transitory and heterogeneous expression of the synaptotagmin IV gene also was observed in dorsal and ventral horns during the first week of life (data not shown).
Thus, in several regions of the CNS a subtle regulation of the synaptotagmin IV gene expression was observed at a time that could coincide with the establishment and maturation of certain synapses. This suggests that synaptotagmin IV could be involved in early neuronal differentiation such as axonal growth or the formation and consolidation of synapses. In addition to genetic determinants, activity-dependent processes play a major role in forming neural networks. Because synaptotagmin IV expression may be regulated by elevation of Ca2+ (Vician et al., 1995
FOOTNOTES
Received July 29, 1996; revised Nov. 14, 1996; accepted Nov. 22, 1996.
Correspondence should be addressed to Dr. Béatrice Marquèze, Institut National de la Santé et de la Recherche Médicale U 374, Institut Jean Roche, Faculté de Médecine-Secteur Nord, Boulevard Pierre Dramard, 13916 Marseille Cedex 20, France.
REFERENCES
- Altman J (1972) Postnatal development of the cerebellar cortex in the rat. III. Maturation of the components of the granular layer. J Comp Neurol 145:465-514 . [Web of Science][Medline]
- Bayer SA (1980) Development of the hippocampal region in the rat. I. Neurogenesis examined with 3H-thymidine autoradiography. J Comp Neurol 190:87-114 . [Web of Science][Medline]
- Bennett MK, Calakos N, Scheller RH (1992) Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at the presynaptic active zone. Science 257:255-259 .
[Abstract/Free Full Text] - Craxton M, Goedert M (1995) Synaptotagmin V: a novel synaptotagmin isoform expressed in rat brain. FEBS Lett 361:196-200 . [Web of Science][Medline]
- Crepel F, Mariani J, Delhaye-Bouchaud N (1976) Evidence for a multiple innervation of Purkinje cells by climbing fibers in the immature rat cerebellum. J Neurobiol 7:567-578 . [Web of Science][Medline]
- Davletov BA, Südhof TC (1993) A single C2 domain from synaptotagmin I is sufficient for high affinity Ca2+/phospholipid binding. J Biol Chem 268:26386-26390 .
[Abstract/Free Full Text] - Davletov B, Sontag J-M, Hata Y, Petrenko AG, Fyske EM, Jahn R, Südhof TC (1993) Phosphorylation of synaptotagmin I by casein kinase II. J Biol Chem 268:6816-6822 .
[Abstract/Free Full Text] - De Carlos JA, O'Leary DDM (1992) Growth and targeting of subplate axons and establishment of major cortical pathways. J Neurosci 12:1194-1211 . [Abstract]
- Fukuda M, Kojima T, Aruga J, Niinobe M, Mikoshiba K (1995) Functional diversity of C2 domains of synaptotagmin family
mutational analysis of inositol high polyphosphate binding domain. J Biol Chem 270:26523-26527 .
[Abstract/Free Full Text] - Fukuda M, Kojima T, Mikoshiba K (1996) Phospholipid composition dependence of Ca2+-dependent phospholipid binding to the C2A domain of synaptotagmin IV. J Biol Chem 271:8430-8434 .
[Abstract/Free Full Text] - Gallo V, Upson LM, Hayes WP, Vyklicky L, Winters CA, Buananno A (1992) Molecular cloning and developmental analysis of a new glutamate receptor subunit isoform in cerebellum. J Neurosci 12:1010-1023 . [Abstract]
- Geppert M, Archer III BT, Südhof TC (1991) Synaptotagmin II. J Biol Chem 266:13548-13552 .
[Abstract/Free Full Text] - Geppert M, Goda Y, Hammer RE, Li C, Rosahl TW, Stevens CF, Südhof TC (1994) Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79:717-727 . [Web of Science][Medline]
- Hata Y, Davletov B, Petrenko AG, Jahn R, Südhof TC (1993) Interaction of synaptotagmin with the cytoplasmic domains of neurexins. Neuron 10:307-315 . [Web of Science][Medline]
- Hawkes R, Brochu G, Dore L, Gravel C, Leclerc N (1992) Zebrins: molecular markers of compartmentation in the cerebellum. In: The cerebellum revisited (Llinas R, Sotelo C, eds), pp 22-55. New York: Springer.
- Hudson AW, Birnbaum MJ (1995) Identification of a non-neuronal isoform of synaptotagmin. Proc Natl Acad Sci USA 92:5895-5899 .
[Abstract/Free Full Text] - Jacobson M (1991) In: Developmental neurobiology, 3rd Ed. New York: Plenum.
- Komuro H, Rakic P (1992) Selective role of N-type calcium channels in neuronal migration. Science 257:806-809 .
[Abstract/Free Full Text] - Leclerc N, Beesley PW, Brown I, Colonnier M, Gurd JW, Paladino T, Hawkes R (1989) Synaptophysin expression during synaptogenesis in the rat cerebellar cortex. J Comp Neurol 280:197-212 . [Web of Science][Medline]
- Lévêque C, Hoshino T, David P, Shoji-Kasai Y, Leys K, Omori A, Lang B, El Far O, Sato K, Martin-Moutot N, Newsom-Davis J, Takahashi M, Seagar MJ (1992) The synaptic vesicle protein synaptotagmin associates with calcium channels and is a putative Lambert-Eaton myasthenic syndrome antigen. Proc Natl Acad Sci USA 89:3625-3629 .
[Abstract/Free Full Text] - Li C, Ullrich B, Zhang JZ, Anderson RGW, Brose N, Südhof TC (1995) Ca2+-dependent and -independent activities of neural and non-neural synaptotagmins. Nature 375:594-599 . [Medline]
- Littleton JT, Bellen HJ (1995) Synaptotagmin controls and modulates synaptic-vesicle fusion in a Ca2+-dependent manner. Trends Neurosci 18:177-183 . [Web of Science][Medline]
- Marquèze B, Boudier JA, Mizuta M, Inagaki N, Nemoto Y, Takahashi M, Seino S, Seagar M (1995) Differential expression of synaptotagmin I, II, and III mRNAs in the rat central nervous system. J Neurosci 15:4906-4917 . [Abstract]
- Martin-Moutot N, Charvin N, Lévêque C, Sato K, Nishiki T, Kosaki S, Takahashi M, Seagar M (1996) Interaction of SNARE complexes with P/Q-type calcium channels in rat cerebellar synaptosomes. J Biol Chem 271:6567-6570 .
[Abstract/Free Full Text] - Mizuta M, Inagaki N, Nemoto Y, Matsukura S, Takahashi M, Seino S (1994) Synaptotagmin III, a novel isoform of rat synaptotagmin expressed in endocrine and neuronal cells. J Biol Chem 264:11675-11678.
- Paxinos G, Watson C (1986) In: The rat brain in stereotaxic coordinates, 2nd Ed. San Diego: Academic.
- Paxinos P, Törk I, Tecott LH, Valentino KL (1991) In: Atlas of the developing rat brain. San Diego: Academic.
- Perin MS, Fried VA, Mignery GA, Jahn R, Südhof TC (1990) Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature 345:260-263 . [Medline]
- Petrenko AG, Perin MS, Davletov BA, Ushkaryov YA, Geppert M, Südhof TC (1991) Binding of synaptotagmin to the
- Söllner T, Bennett MK, Whiteheart SW, Scheller RH, Rothman JE (1993) A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75:409-418 . [Web of Science][Medline]
- Takahashi M, Arimatsu Y, Fujita S, Fujimoto Y, Kondo S, Hama T, Miyamoto E (1991) Protein kinase C and Ca2+/calmodulin-dependent protein kinase II phosphorylate a novel 58 kDa protein in synaptic vesicles. Brain Res 551:279-292 . [Web of Science][Medline]
- Ullrich B, Südhof TC (1995) Differential distributions of novel synaptotagmins: comparison to synapsins. Neuropharmacology 34:1371-1376 . [Web of Science][Medline]
- Ullrich B, Li C, Zhang JZ, McMahon H, Anderson RGW, Geppert M, Südhof TC (1994) Functional properties of multiple synaptotagmins in brain. Neuron 13:1281-1291 . [Web of Science][Medline]
- Vician L, Lim IK, Ferguson G, Tocco G, Baudry M, Herschman HR (1995) Synaptotagmin IV is an immediate early gene induced by depolarisation in PC12 cells and in brain. Proc Natl Acad Sci USA 92:2164-2168 .
[Abstract/Free Full Text] - Wassef M, Sotelo C (1984) Asynchrony in the expression of guanosine 3
- Wassef M, Angaut P, Arsenio-Nunes L, Bourrat F, Sotelo C (1992) Purkinje cell heterogeneity: its role in organizing the topography of cerebellar connections. In: The cerebellum revisited (Llinas R, Sotelo C, eds), pp 5-21. New York: Springer.
- Yoshida A, Oho C, Omori A, Kuwara R, Ito T, Takahashi M (1992) HPC-1 is associated with synaptotagmin and
-conotoxin receptor. J Biol Chem 267:24925-24928 .
[Abstract/Free Full Text] - Zhang JZ, Davletov BA, Südhof TC, Anderson RGW (1994) Synaptotagmin I is a high affinity receptor for clathrin AP-2: implications for membrane recycling. Cell 78:751-760 . [Web of Science][Medline]
Copyright ©1997 Society for Neuroscience 0270-6474/1997/171206-11$05.00/0
This article has been cited by other articles:
D. Feldmeyer and G. Radnikow
Developmental alterations in the functional properties of excitatory neocortical synapses
J. Physiol., May 1, 2009; 587(9): 1889 - 1896.
[Abstract] [Full Text] [PDF]
D. Doischer, J. Aurel Hosp, Y. Yanagawa, K. Obata, P. Jonas, I. Vida, and M. Bartos
Postnatal Differentiation of Basket Cells from Slow to Fast Signaling Devices
J. Neurosci., November 26, 2008; 28(48): 12956 - 12968.
[Abstract] [Full Text] [PDF]
L. Cnops, T.-T. Hu, K. Burnat, and L. Arckens
Influence of Binocular Competition on the Expression Profiles of CRMP2, CRMP4, Dyn I, and Syt I in Developing Cat Visual Cortex
Cereb Cortex, May 1, 2008; 18(5): 1221 - 1231.
[Abstract] [Full Text] [PDF]
C. Delaloy, J. Hadchouel, M. Imbert-Teboul, M. Clemessy, A.-M. Houot, and X. Jeunemaitre
Cardiovascular Expression of the Mouse WNK1 Gene during Development and Adulthood Revealed by a BAC Reporter Assay
Am. J. Pathol., July 1, 2006; 169(1): 105 - 118.
[Abstract] [Full Text] [PDF]
G. J. Murphy, L. L. Glickfeld, Z. Balsen, and J. S. Isaacson
Sensory Neuron Signaling to the Brain: Properties of Transmitter Release from Olfactory Nerve Terminals
J. Neurosci., March 24, 2004; 24(12): 3023 - 3030.
[Abstract] [Full Text] [PDF]
M. Fukuda, E. Kanno, Y. Ogata, C. Saegusa, T. Kim, Y. P. Loh, and A. Yamamoto
Nerve Growth Factor-dependent Sorting of Synaptotagmin IV Protein to Mature Dense-core Vesicles That Undergo Calcium-dependent Exocytosis in PC12 Cells
J. Biol. Chem., January 24, 2003; 278(5): 3220 - 3226.
[Abstract] [Full Text] [PDF]
D. Wang and L. Maler
Differential roles of Ca2+/calmodulin-dependent kinases in posttetanic potentiation at input selective glutamatergic pathways
PNAS, June 9, 1998; 95(12): 7133 - 7138.
[Abstract] [Full Text] [PDF]
K. Palm, N. Belluardo, M. Metsis, and T o. Timmusk
Neuronal Expression of Zinc Finger Transcription Factor REST/NRSF/XBR Gene
J. Neurosci., February 15, 1998; 18(4): 1280 - 1296.
[Abstract] [Full Text] [PDF]
G. D. Ferguson, X.-N. Chen, J. R. Korenberg, and H. R. Herschman
The Human Synaptotagmin IV Gene Defines an Evolutionary Break Point between Syntenic Mouse and Human Chromosome Regions but Retains Ligand Inducibility and Tissue Specificity
J. Biol. Chem., November 17, 2000; 275(47): 36920 - 36926.
[Abstract] [Full Text] [PDF]
G. D. Ferguson, S. G. Anagnostaras, A. J. Silva, and H. R. Herschman
Deficits in memory and motor performance in synaptotagmin IV mutant mice
PNAS, May 9, 2000; 97(10): 5598 - 5603.
[Abstract] [Full Text] [PDF]
This Article Abstract 
Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager 
Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (45) Citing Articles via Google Scholar Google Scholar Articles by Berton, F. Articles by Marquèze, B. Search for Related Content PubMed PubMed Citation Articles by Berton, F. Articles by Marquèze, B.
ABSTRACT
|
|
|
|
 |
|