WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (80)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Page, K. M.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Page, K. M.
Right arrow Articles by Dolphin, A. C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

 Previous Article  |  Next Article 

Volume 17, Number 4, Issue of February 15, 1997 pp. 1330-1338
Copyright ©1997 Society for Neuroscience

The Intracellular Loop between Domains I and II of the B-Type Calcium Channel Confers Aspects of G-Protein Sensitivity to the E-Type Calcium Channel

Karen M. Page, Gary J. Stephens, Nicholas S. Berrow, and Annette C. Dolphin

Department of Pharmacology, Royal Free Hospital School of Medicine, London NW3 2PF, United Kingdom

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Neuronal voltage-dependent calcium channels undergo inhibitory modulation by G-protein activation, generally involving both kinetic slowing and steady-state inhibition. We have shown previously that the beta -subunit of neuronal calcium channels plays an important role in this process, because when it is absent, greater receptor-mediated inhibition is observed (Campbell et al., 1995b). We therefore hypothesized that the calcium channel beta -subunits normally may occlude G-protein-mediated inhibition. Calcium channel beta -subunits bind to the cytoplasmic loop between transmembrane domains I and II of the alpha 1-subunits (Pragnell et al., 1994). We have examined the hypothesis that this loop is involved in G-protein-mediated inhibition by making chimeras containing the I-II loop of alpha 1B or alpha 1A inserted into alpha 1E (alpha 1EBE and alpha 1EAE, respectively). This strategy was adopted because alpha 1B (the molecular counterpart of N-type channels) and, to a lesser extent, alpha 1A (P/Q-type) are G-protein-modulated, whereas this has not been observed to any great extent for alpha 1E. Although alpha 1B, coexpressed with alpha 2-delta and beta 1b transiently expressed in COS-7 cells, showed both kinetic slowing and steady-state inhibition when recorded with GTPgamma S in the patch pipette, both of which were reversed with a depolarizing prepulse, the chimera alpha 1EBE (and, to a smaller extent, alpha 1EAE) showed only kinetic slowing in the presence of GTPgamma S, and this also was reversed by a depolarizing prepulse. These results indicate that the I-II loop may be the molecular substrate of kinetic slowing but that the steady-state inhibition shown by alpha 1B may involve a separate site on this calcium channel.

Key words: calcium channel; G-protein; beta -subunit; alpha 1B; alpha 1E; modulation


INTRODUCTION

Voltage-dependent calcium channels are hetero-oligomers consisting of a number of subunits: alpha 1, which is the pore-forming subunit, and several accessory subunits, including alpha 2-delta and beta (Dolphin, 1995). Cloning has revealed six different alpha 1-subunits, termed A, B, C, D, E, and S (Tanabe et al., 1987; Snutch et al., 1990). C, D, and S correspond to L-type channels (for review, see Dolphin, 1995), and alpha 1B corresponds to the omega -conotoxin (CTX) GVIA-sensitive N-type calcium channel (Dubel et al., 1992). In contrast, the physiological counterparts of the alpha 1A and alpha 1E calcium channels are less clearly established (Sather et al., 1993; Soong et al., 1993; Schneider et al., 1994; Stea et al., 1994; Berrow et al., 1997; Stephens et al., 1997).

Neuronal and neurosecretory subtypes of calcium channels, including N, P, Q, and L, have been shown to be inhibited by various neurotransmitters and modulatory agents (Kleuss et al., 1991; Menon-Johansson et al., 1993; Mintz and Bean, 1993; Zhang et al., 1993). The modulation involves activation of a G-protein that is usually, but not invariably, pertussis toxin-sensitive (Hille, 1992; Dolphin, 1995). In many systems evidence has been obtained that the G-protein involved is Go (Kleuss et al., 1991; Wang et al., 1992; Campbell et al., 1993). Recent expression studies have reconstituted G-protein modulation of cloned alpha 1A and alpha 1B, but not alpha 1E, calcium channels by several receptors (Bourinet et al., 1996; Toth et al., 1996). The main mechanism of modulation is thought to be membrane-delimited (i.e., not involving a soluble second messenger) and to be attributable to a direct interaction between activated G-protein subunits and one of the calcium channel subunits (Hille, 1992). The calcium channel beta -subunits are intracellular proteins that bind to the cytoplasmic loop between domains I and II of the alpha 1-subunit of all calcium channels (Pragnell et al., 1994). We have obtained evidence, by antisense depletion of calcium channel beta -subunits from cultured rat dorsal root ganglion neurons, that coupling of calcium channels to G-proteins may involve direct or indirect competition between the activated G-protein and the calcium channel beta -subunit for binding to the calcium channel alpha 1-subunit (Berrow et al., 1995; Campbell et al., 1995b). This was confirmed in a coexpression study of calcium channel subunits in Xenopus oocytes, in which it was found that G-protein modulation of alpha 1A by activation of expressed opiate receptors was greater in the absence of a coexpressed calcium channel beta -subunit (Bourinet et al., 1996). Recent studies also suggest that G-protein subunits involved in interaction with alpha 1A and alpha 1B are the Gbeta gamma -subunits (Herlitze et al., 1996; Ikeda, 1996). It is therefore possible that these G-protein subunits interact with the I-II loop of calcium channel alpha 1-subunits to produce modulation of the channel.

The hypothesis that the I-II loop of alpha 1A and alpha 1B calcium channels is involved in G-protein modulation has been tested in the present study by creating a chimera, which consists of alpha 1E with the I-II loops from alpha 1A or alpha 1B, to determine whether the ability to be modulated by G-protein activation in this way can be conferred on the alpha 1E calcium channel.


MATERIALS AND METHODS

Construction of chimeras. The rat alpha 1A (GenBank accession number M64373[GenBank]), alpha 1E (L15453[GenBank]), and beta 1b (X61394[GenBank]) cDNAs (Starr et al., 1991; Soong et al., 1993; Tomlinson et al., 1993) were provided by Dr. T. Snutch (University of British Columbia, Vancouver, Canada) in a modified pMT2 expression vector (Genetics Institute, Cambridge, MA). The rabbit alpha 1B (D14157) (Fujita et al., 1993) was provided by Dr. Y. Mori (Seiriken, Okazaki, Japan); the full-length rat alpha 2-delta (neuronal splice variant, M86621) (Kim et al., 1992) was provided by Dr. H. Chin (National Institutes of Health, Bethesda, Maryland). The S65T mutant of GFP was a gift from Dr. S. Moss (University College London, London, UK). All DNAs were subcloned, using standard techniques, into the pMT2 vector for transient expression in COS-7 cells.

To produce chimeras containing the I-II loop of alpha 1A or B substituted for the same region of alpha 1E, we performed PCR on alpha 1E subcloned into the EcoRI site of the pcDNA3 vector (Invitrogen, San Diego, CA). Chimeric primers were directed against regions of the IS6 and IIS1 domains conserved between alpha 1E, alpha 1A, and alpha 1B. Rat alpha 1A and rabbit alpha 1B I-II loops were amplified using the primers GGAACTGGCTGTACTTCATCC (at position 1024 in alpha 1E, 1010 in alpha 1A, and 1112 in alpha 1B) and CACTCAGGACGATCCAGTAGAA (position 1500 in alpha 1E, 1492 in alpha 1A, and 1594 in alpha 1B) to give 482 base pair (bp) fragments. Then the 482 bp products were used as primers in two individual second-stage PCR reactions in the presence of alpha 1E, one containing the pcDNA3 forward primer, CTCACTATAGGGAGACCCAAGC, and the other containing the reverse primer, GACTTCATGGAGCTCATCAAGG (position 1852 in alpha 1E). These PCR products (of 1430 and 834 bp) were combined in a third-stage reaction, in the absence of alpha 1E, and extended to give a full-length product of 1782 bp. To facilitate subcloning, we put a 3314 bp fragment (between XbaI nucleotide 822 and ApaI 4134) into the XbaI-ApaI sites of pcDNA3. The 1782 bp product was digested with the enzymes XbaI and AccB7I, and the 980 bp DNA was subcloned back into the 3314 bp fragment in pcDNA3. All PCR was performed using the proofreading Pfu polymerase (Stratagene, La Jolla, CA) for 30 cycles of 95°C for 30 sec, 54°C for 1 min, and 75°C for 2 min. The sequence of the chimeras between the XbaI (822 bp, alpha 1E) and AccB7I (1802 bp) sites was verified by the SequiTherm Cycle Sequencing kit (Epicenter Technologies, Madison, WI). The 3314 bp XbaI-ApaI DNA was subcloned back into the remainder of the alpha 1E pMT2 vector. This resulted in chimeras with substitution of the I-II loop of alpha 1E for that of alpha 1A or B. Part of IS6 also was substituted, but this is identical in the three sequences, except for V293 in alpha 1E, which is substituted by M in alpha 1A, B, and the chimeras.

Transfection of COS-7 cells. COS-7 cells were cultured and transfected by electroporation essentially as described previously (Campbell et al., 1995a). In all, 15, 10, 5, and 1 µg of the pMT2-alpha 1, alpha 2-delta , beta 1b, and GFP constructs, respectively, were used for transfection. If all subunits were not transfected, the total 31 µg of cDNA was made up by pMT2 vector. Successfully transfected cells were identified for electrophysiological studies by expression of GFP, and recordings were made between 2 and 4 d after transfection.

Electrophysiology. Recordings were made at room temperature (20-22°C) from COS-7 cells that had been replated between 1 and 16 hr previously, using a nonenzymatic cell dissociation medium (Sigma, St. Louis, MO). Only small cells with a circular morphology were used. Mean cell capacitance was ~20 pF. Cells were viewed briefly with a fluorescein filter block, and only fluorescent cells expressing GFP, which were spatially isolated and with a compact morphology and smooth surface as visualized by Hoffmann optics, were used in experiments. The internal (pipette) and external solutions and recording techniques are similar to those previously described (Campbell et al., 1995b). The patch pipette solution contained (in mM): Cs aspartate 140, EGTA 5, MgCl2 2, CaCl2 0.1, K2ATP 2, GTP 0.1, and HEPES 10, pH 7.2, 310 mOsm with sucrose. GTPgamma S (100 µM) was included where stated. The external solution contained (in mM): tetraethylammonium (TEA) bromide 160, KCl 3, NaHCO3 1.0, MgCl2 1.0, HEPES 10, glucose 4, and BaCl2 10, pH 7.4, 320 mOsm with sucrose. Pipettes of resistance 2-4 MOmega were used, and the holding current at -100 mV was normally <20 pA. Cells were used only where series resistance was compensated to 80%, and space clamp was adequate as judged by graded activation of IBa. The voltage errors from the residual uncompensated series resistance were <1 mV for the largest currents, and no further correction was made. An Axopatch 1D or Axon 200A amplifier was used, and data were filtered at 2-5 kHz and digitized at 5-20 kHz. Analysis was performed by pClamp 6 and Origin 3.5. Data are given as mean ± SEM, and current records are shown after leak and residual capacitance current subtraction (P/4 or P/8 protocol).


RESULTS

Characteristics of alpha 1E and alpha 1B expressed in COS-7 cells

The alpha 1-subunits A, B, and E and the alpha 1EBE chimera (Fig. 1A) were transiently expressed with accessory subunits alpha 2-delta and beta 1b in COS-7 cells. The properties of alpha 1E and alpha 1B were clearly distinct from each other in terms of both voltage dependence of their activation (Fig. 1B) and kinetics of inactivation (Fig. 1C,D). alpha 1E was activated at slightly more negative potentials than alpha 1B, the midpoint for activation being 5 mV more hyperpolarized, and it showed a slightly steeper voltage dependence (Fig. 1B, Table 1). Most strikingly, it also showed a much greater degree of inactivation than alpha 1B during 1500 msec steps (Fig. 1D compared with Fig. 1C). However, the steady-state inactivation profiles of alpha 1E and alpha 1B were very similar (Table 1). The chimera alpha 1EBE, the sequence of which was identical to that of alpha 1E except for replacement of the entire intracellular loop between domains I and II with that of alpha 1B and one substitution in IS6 (Fig. 1A; see Materials and Methods), showed a more depolarized voltage dependence of activation than alpha 1E, similar to alpha 1B (Fig. 1B). Its steady-state inactivation parameters were similar to alpha 1E and alpha 1B (Table 1); it showed inactivation kinetics intermediate between those of alpha 1B and alpha 1E (Fig. 1E, Table 1). The current densities resulting from expression of alpha 1E, alpha 1B, and alpha 1EBE were similar (Table 1), but the percentage of GFP-positive cells expressing alpha 1E was greater (~80%) than for alpha 1B (~40%). The percentage of cells expressing alpha 1EBE was similar to that for alpha 1E.
Fig. 1. IBa was recorded from cells transfected with alpha 1E, alpha 1B, and alpha 1EBE, together with alpha 2-delta and beta 1b. A, Schematic diagram of the chimera alpha 1EBE. B, The holding potential VH was -100 mV, and 20-30 msec steps to increasing test potentials Vt were applied to maximally activate IBa without any inactivation. Tail current amplitudes were measured after repolarization to -80 mV. The tail current I-V relationships were normalized to the maximum tail current amplitude, and the mean ± SEM of four, seven, and three experiments for alpha 1B (black-square), alpha 1E (triangle ), and alpha 1EBE (open circle ) are given. The curves were fit (dotted lines) with a Boltzmann equation of the form: Inorm = 1/{1+exp[(Vt-V50)/k]}, in which V50 is the voltage for 50% activation and k is the slope factor. The values for the parameters are given in Table 1 for the mean ± SEM of the individual activation curves. C-E, Cells were held at -100 mV, and 1500 msec steps to voltages between -30 and 0 mV (C, D) or -35 to -5 mV (E) (Delta V 10 mV) were applied to examine the rate of inactivation of IBa. tau inact values are given in Table 1.
[View Larger Version of this Image (26K GIF file)]

Table 1. Biophysical parameters of calcium channel currents resulting from expression of alpha 1B, alpha 1E, alpha 1EBE, and alpha 1EAE with beta 1b and alpha 2-delta in COS-7 cells


Control  alpha 1B  alpha 1E  alpha 1EBE  alpha 1EAE

Peak IBa pA/pF  -30.9  ± 7.2 (8)  -29.8  ± 7.2 (10)  -25.6  ± 7.6 (8)  -48.5  ± 11.4 (9)
Current activation
V50 mV  -11.4  ± 3.9 (4)  -16.4  ± 1.9 (7)  -9.1  ± 7.1 (3)  -14.0  ± 3.0 (7)
k mV 6.0  ± 0.7 (4) 4.3  ± 0.8 (7) 6.6  ± 0.7 (3) 6.6  ± 0.7 (n = 7)
Steady-state inactivation
V50 mV  -61.3  ± 7.1 (3)  -59.7  ± 3.6 (3)  -56.8  ± 4.1 (4) ND
k mV  -6.6  ± 1.1 (3)  -11.5  ± 1.3 (3)  -5.5  ± 1.7 (4) ND
 tau inact at -10 mV msec 1021  ± 648 (6) 210  ± 25 (5) 503.4  ± 68.8t> (7) 438  ± 65t> (10)

GTPgamma S  alpha 1B (GTPgamma S)  alpha 1E (GTPgamma S)  alpha 1EBE (GTPgamma S)  alpha 1EAE (GTPgamma S)

Peak IBa pA/pF  -18.7  ± 6.1* (6)  -31.6  ± 7.0 (7)  -20.3  ± 4.3 (12)  -45.0  ± 10.9 (6)
Current activation
V50 mV  -7.9  ± 5.3 (4)  -16.1  ± 2.5 (6)  -10.7  ± 4.7 (3)  -9.2  ± 5.4 (4)
k mV 7.6  ± 1.1black-lozenge  (4) 4.7  ± 1.1 (6) 7.3  ± 0.65lozenge  (3) 6.2  ± 0.5 (4)
Steady-state inactivation
V50 mV  -58.5  ± 4.5 (3)  -58.3  ± 3.2 (3)  -54.7  ± 3.5 (3) ND
k mV  -6.4  ± 0.6 (3)  -9.9  ± 1.3 (3)  -6.6  ± 1.2 (3) ND
 tau inact at -10 mV msec 1377  ± 405t> (7) 218  ± 24 (5) 470.8  ± 91.7black-lozenge  (6) 513  ± 82t> (5)

Peak IBa was determined from I-V relationships. Activation data were determined from tail currents as described in the legend to Figure 1B. For steady-state inactivation, cells were held at -100 mV, and depolarizing prepulses of 15 sec duration were applied between -100 and 0 mV (Delta  10 mV) before recording the maximum IBa at -5 to +10 mV. Values were expressed as a fraction of the maximum IBa seen in each cell, and V50 and k were determined from a Boltzmann relationship of the form given in the legend to Figure 1. tau inact was determined from 600-2000 msec steps to -10 mV, as shown in Figure 1C-E. Data are given as mean ± SEM, with the number of determinations in parentheses. Significance of difference between data in the presence of GTPgamma S compared with control data for each calcium channel clone is given by * p < 0.05,  ** p < 0.01. Significance of difference of alpha 1B and the two chimeras from alpha 1E is given by black-lozenge p < 0.05,  # p < 0.01. ND, Not determined.

Comparison of the effect of GTPgamma S on the kinetics of activation of alpha 1B, alpha 1E, and alpha 1EBE

To examine the effect of G-protein activation on the expressed calcium channel currents, we included 100 µM GTPgamma S in the patch pipette, and currents were recorded after it had diffused into the cell for 2-5 min. GTPgamma S produced a clear slowing of the activation of alpha 1B, but not alpha 1E, currents as compared with control currents recorded in the absence of GTPgamma S (Fig. 2A compared with 2B), indicative of G-protein modulation of alpha 1B, but not alpha 1E, currents. This was most evident from examination of the time constant of activation (tau act) at depolarizations between -20 and 0 mV when the current amplitude is submaximal (Fig. 2D).
Fig. 2. IBa was recorded from cells transfected with alpha 1B (A), alpha 1E (B), and alpha 1EBE (C), together with alpha 2-delta and beta 1b. Cells were held at -100 mV, and 100 msec steps from -20 mV (Delta  5 mV) were applied to examine the kinetics of activation of IBa. The examples given are from different cells recorded either in the absence or in the presence of GTPgamma S in the patch pipette. Mean amplitudes of the maximum IBa are given in Table 1. A single exponential was fit to the activation phase of the current, initiated after the transient positive-going current had decayed back to baseline, to quantify the rate of activation. Examples of single exponential fits (heavy dotted lines) are given for the maximum currents at 0 mV for the two families of traces in A. The time constant of activation (tau act) is 7.9 msec for control and 11.0 msec for the GTPgamma S-containing cell. D, The tau act values were plotted against voltage for alpha 1EBE (open circle ), alpha 1B (square ), and alpha 1E (triangle ), both under control conditions (open symbols) and in the presence of GTPgamma S (closed symbols). The mean ± SEM is shown for the number of cells given in parentheses on the figure. It is clear that only alpha 1B and alpha 1EBE show slowed activation in the presence of GTPgamma S, particularly at submaximal voltages for IBa activation. Statistical significance (Student's t test) of GTPgamma S groups from their respective controls is given by *p < 0.05, **p < 0.01 for alpha 1EBE, #p < 0.05 and ##p < 0.01 for alpha 1B.
[View Larger Version of this Image (30K GIF file)]

Because of the possibility that the site of G-protein modulation of calcium channels resided on the I-II loop of the alpha 1B-subunit, we examined the ability of the alpha 1EBE chimera to be modulated by G-protein activation. GTPgamma S now produced a slowing of the activation of the alpha 1EBE calcium channel current similar to that found for alpha 1B (Fig. 2C,D). Thus the incorporation of the I-II loop from alpha 1B into alpha 1E endows the chimera with the ability to be modulated by G-proteins. However, a comparison of the current-voltage relationships from cells recorded in the absence or presence of GTPgamma S in the patch pipette indicates that G-protein activation has had a greater inhibitory effect on the amplitude of alpha 1B currents (Fig. 3A) than is evident for the alpha 1EBE chimera (Fig. 3B). No effect was observed of GTPgamma S on the current-voltage relationships for alpha 1E (Fig. 3C), and there was no effect of G-protein activation on the steady-state inactivation parameters for any of the calcium channel clones (Table 1).


Fig. 3. Mean current-voltage relationships were determined for cells under control conditions (open symbols) and in the presence of GTPgamma S (closed symbols) for alpha 1B (square , 8; black-square, 6), alpha 1EBE (open circle , 12; bullet , 9), and alpha 1E (triangle , 6; black-triangle, 6). The data are the mean ± SEM for the numbers given in parentheses. Statistical significance between control and GTPgamma S groups is given by *p < 0.05 (Student's t test).
[View Larger Version of this Image (24K GIF file)]

Effect of depolarizing prepulses on activation of parental alpha 1E, alpha 1B, and chimeric alpha 1EBE calcium channels

Depolarizing prepulses previously have been shown to reverse the G-protein modulation of calcium currents (Tsunoo et al., 1986; Grassi and Lux, 1989). This protocol was used in the present study to examine the extent of calcium channel current modulation by GTPgamma S for both parental and chimeric channels. Depolarizing prepulses to varying voltages (+80 to +140 mV) markedly enhanced calcium current activation and amplitude of alpha 1B currents in the presence of GTPgamma S while having less effect on alpha 1B currents in the absence of GTPgamma S. The maximum enhancement was observed with 100 msec depolarizing prepulses to +120 mV (results not shown). For subsequent experiments, a constant prepulse to +120 mV was used, and test pulses of increasing amplitude were applied immediately before (P1) and 10 msec after (P2) the depolarizing prepulse. Thus the effect of the depolarizing prepulse on current-voltage and tau act-voltage relationships was examined. For alpha 1B, in GTPgamma S-dialyzed cells, the prepulse produced a marked enhancement of the calcium channel current amplitude and its rate of activation, particularly at small depolarizations (Fig. 4A-C). Therefore, the prepulse shifted the voltage for half-activation of the current by approximately -6 mV. At -20 mV, the P2/P1 ratio was 0.61 ± 0.04 (n = 6) for tau act and 1.76 ± 0.23 (n = 6) for IBa amplitude. No significant effect was observed either on tau act or IBa amplitude in the absence of GTPgamma S (Fig. 4D-F).
Fig. 4. Cells were transfected with alpha 1B, alpha 2-delta , and beta 1b and recorded after 3-4 d in culture. IBa was examined immediately before (P1) and 10 msec after (P2) application of a depolarizing prepulse to +120 mV, according to the voltage protocol given in A and D. P1 and P2 both were augmented at 0.05 Hz from -40 mV with Delta  10 mV to activate currents in cells recorded in the presence of GTPgamma S (A) or in control cells (B). The IBa amplitude and tau act were determined for the currents evoked by P1 (square ) and P2 (bullet ), and these are plotted against the step potential of P1 and P2 for IBa and tau act in GTPgamma S-modulated (B, C) and control (E, F) cells, respectively. The mean ± SEM is given for six GTPgamma S-modulated and seven control cells. The statistical significance of difference between both tau act and IBa amplitude evoked in P1 and P2 was determined by paired t test; *p < 0.05, **p< 0.01.
[View Larger Version of this Image (26K GIF file)]

For alpha 1E, there was little effect at any potential of a depolarizing prepulse, either on tau act or on current amplitude in the presence or absence of GTPgamma S. For example, at -20 mV in control cells, tau act was 5.7 ± 0.6 msec and 4.5 ± 0.4 msec before and after the prepulse, respectively. The P2/P1 ratio was 0.81 ± 0.05 (n = 6; p < 0.05, paired t test). The corresponding values were 5.4 ± 1.7 msec and 4.6 ± 1.2 msec in the presence of GTPgamma S, giving a P2/P1 ratio of 0.89 ± 0.04 (n = 5). At the same potential, the P2/P1 ratios for the current amplitudes were 0.99 ± 0.06 in control cells and 1.03 ± 0.04 in GTPgamma S-dialyzed cells. Thus we conclude that alpha 1E is not subject to G-protein modulation in this system, although there is a small degree of prepulse facilitation of the control activation kinetics.

In marked contrast with its effect on the parental alpha 1E, the depolarizing prepulse significantly enhanced the rate of activation of the chimera alpha 1EBE calcium channel current (Fig. 5), particularly in the presence of GTPgamma S (Fig. 5A,C). For example, at -20 mV, P2/P1 for tau act was 0.63 ± 0.05 (n = 8; Fig. 5C) in the presence of GTPgamma S and 0.75 ± 0.08 (n = 5; Fig. 5F) under control conditions. Clearly, there is some prepulse facilitation of the activation kinetics of alpha 1EBE IBa in the absence of GTPgamma S, but this is increased greatly in its presence. However, there was no effect of the prepulse on current amplitude, either in the presence or absence of GTPgamma S (Fig. 5B,E).


Fig. 5. Cells were transfected with the alpha 1EBE chimera, together with alpha 2-delta and beta 1b, and experiments were performed exactly as described in the legend to Figure 4. The mean ± SEM is given for nine GTPgamma S-modulated and five control cells. The statistical significance of difference between both tau act and IBa amplitude evoked in P1 (square ), and P2 (bullet ) was determined by paired t test; *p < 0.01, **p < 0.001.
[View Larger Version of this Image (27K GIF file)]

Characteristics of chimeric alpha 1EAE expressed in COS-7 cells

Because there is evidence in the literature that alpha 1A also may be G-protein-modulated, although to a more limited extent than alpha 1B (Bourinet et al., 1996), a similar chimera also was made containing the intracellular I-II loop of alpha 1A, replacing the I-II loop of alpha 1E (alpha 1EAE). We previously have described the properties of the alpha 1A clone expressed in the COS-7 cell expression system (Berrow et al., 1997). It was not examined further in this study, because its low expression levels precluded direct comparison. The properties of the alpha 1EAE chimera are shown in Figure 6 and Table 1. The voltage dependence of activation was similar to alpha 1E (Table 1) and much more negative than alpha 1A (V50 +9.5 mV; Berrow et al., 1997). The inactivation kinetics were intermediate between alpha 1E and alpha 1B, being similar to alpha 1EBE (Fig. 6A, Table 1). A comparison of tau inact between alpha 1EAE and data previously obtained for alpha 1A was difficult because of the differences in their voltage range for activation, given the voltage dependence of inactivation kinetics. However, at +10 mV, tau inact was 297 ± 54 msec (n = 8) for alpha 1EAE, as compared with 414 ± 15 msec (n = 5) at +15 mV for alpha 1A (Berrow et al., 1997).
Fig. 6. Cells were transfected with the alpha 1EAE chimera, together with alpha 2-delta and beta 1b, and IBa was recorded after 3 d in culture. A, IBa was activated by 600 msec steps to examine the rate of inactivation of alpha 1EAE. B, IBa was activated by 100 msec steps, and tau act was measured as described in the legend to Figure 3 for cells recorded in the presence of 100 µM GTPgamma S in the patch pipette (bullet , n = 5), or in its absence (open circle , n = 7). C, IBa was recorded in the presence (bullet ) or absence (square ) of a +120 mV depolarizing prepulse applied 30 msec before the test pulse to -20 mV for a control cell (left) and a cell containing GTPgamma S (right). Prepulse facilitation was observed only in the GTPgamma S-containing cell.
[View Larger Version of this Image (21K GIF file)]

A small effect of GTPgamma S was observed on the kinetics of activation of alpha 1EAE (Fig. 6B, Table 1), tau act for IBa at -20 mV being 9.7 ± 1.6 msec (n = 7) in control cells and 14.4 ± 2.1 msec (n = 5) in cells recorded in the presence of GTPgamma S. In agreement with this, in GTPgamma S-dialyzed cells a depolarizing prepulse to +120 mV applied before a test pulse to -20 mV decreased tau act from 9.1 ± 2.0 msec to 7.1 ± 2.1 msec (n = 5; p < 0.01, paired t test; Fig. 6C). However, the same depolarizing prepulse produced no facilitation of the amplitude of IBa (50.9 ± 20.7 pA/pF to 55.6 ± 20.6 pA/pF; n = 5; Fig. 6C). In control cells, no effect of the same depolarizing prepulse was observed either on the amplitude or tau act of IBa.


DISCUSSION

G-protein regulation of alpha 1B and alpha 1EBE in COS-7 cells

The most significant result of the present study is that the cytoplasmic loop between domains I and II of the B-type calcium channel alpha 1-subunit is sufficient to confer aspects of G-protein sensitivity on the alpha 1E calcium channel clone, which itself shows no or little G-protein modulation (Bourinet et al., 1996; Toth et al., 1996; Yassin et al., 1996). It was first necessary for us to demonstrate classical G-protein modulation of the alpha 1B calcium channel expressed in COS-7 cells. Because of the lack of suitable endogenous receptors in COS-7 cells, we have chosen to produce G-protein activation by dialysis of GTPgamma S from the patch pipette. The expressed alpha 1B currents exhibited both of the classical characteristics of G-protein modulation: reduced amplitude and slowed activation in the presence of GTPgamma S. Furthermore, both of these effects could be reversed by a depolarizing prepulse. This has been shown previously for opiate modulation of alpha 1B in oocytes (Bourinet et al., 1996) and for somatostatin modulation of alpha 1B in a stable HEK293 cell line (Toth et al., 1996). Although COS-7 cells contain no Galpha o, they have several Galpha i species as well as Galpha q and Galpha 11 (Boyer et al., 1989). GTPgamma S is able to bypass the specificity for Go of receptor-mediated modulation of calcium channels (McFadzean et al., 1989; Kleuss et al., 1991; Campbell et al., 1993) and will liberate Gbeta gamma from all available sources. Recent evidence suggests that this is the G-protein species responsible for modulation of the neuronal calcium channels alpha 1A and alpha 1B (Herlitze et al., 1996; Ikeda, 1996).

Role of the cytoplasmic I-II loop of alpha 1A and alpha 1B in G-protein modulation

The cytoplasmic I-II loop contains the major binding site for the calcium channel beta -subunit (Pragnell et al., 1994; De Waard et al., 1995; Witcher et al., 1995), the association of which modifies the properties of calcium channel alpha 1-subunits (Lory et al., 1993; Neely et al., 1993; Stea et al., 1993; Berrow et al., 1995). We have shown previously that the presence of the calcium channel beta -subunit reduces the ability of native neuronal calcium channels to be modulated by G-protein activation, because depletion of calcium channel beta -subunits from dorsal root ganglion neurons by antisense oligonucleotide injection enhanced the ability of the calcium current to be modulated by GABAB receptor activation (Campbell et al., 1995b). This result was confirmed in an oocyte expression study (Bourinet et al., 1996) in which the coexpression of a calcium channel beta -subunit with alpha 1A decreased the modulation observed as a result of activation of expressed opiate receptors. We put forward the proposal that there is either direct or allosteric competition between the activated G-protein subunits and the calcium channel beta -subunits for binding to the calcium channel alpha 1-subunit (Campbell et al., 1995b). It is, therefore, feasible to speculate in the light of the present results that the I-II loop of the calcium channel alpha 1B- and alpha 1A-subunits contains an essential site of interaction required for G-protein modulation. Therefore, because our results indicate that the I-II loop of alpha 1B and, to a lesser extent, alpha 1A confer G-protein sensitivity on the alpha 1E calcium channel, it would seem likely that the G-protein subunits mediating this effect (Herlitze et al., 1996; Ikeda, 1996) bind to a region on the I-II loop of alpha 1B. We have preliminary evidence that Gbeta gamma mediates the observed effects associated with the I-II loop (G. J. Stephens, N. S. Berrow, A. C. Dolphin, unpublished observations).

Kinetic slowing, but not steady-state inhibition, is conferred on alpha 1E by the I-II loop of alpha 1B or alpha 1A

Insertion of the I-II loop of alpha 1B into alpha 1E conferred on the resultant chimeric calcium channel one key characteristic of G-protein modulation, that of slowed activation and reversal of this slowing by depolarizing prepulses. The I-II loop of alpha 1A produced a similar, although less marked, effect. However, the other response observed in alpha 1B, inhibition of the steady-state current amplitude, was not present in alpha 1EBE or alpha 1EAE. Several groups previously have noted differences between these two properties: kinetic slowing and scaled or steady-state inhibition (Ciranna et al., 1993; Diversé-Pierluissi et al., 1995). It has been suggested that the kinetic slowing represents voltage-dependent inhibition, possibly a dissociation of activated G-protein from the channel at depolarized potentials (Boland and Bean, 1993). Others have found the steady-state inhibition to be a voltage-independent process (Luebke and Dunlap, 1994), although in many instances prepulse facilitation of G-protein-modulated currents not only restores the control rate of activation of the current but also markedly increases its amplitude (Ikeda, 1991, 1996). A number of pieces of evidence have been put forward to suggest that the two processes involve different calcium channel subtypes (Ciranna et al., 1993), although this would seem unlikely here, because both effects are observed for cloned alpha 1B. However, it also has been suggested that they involve different mechanisms (Diversé-Pierluissi et al., 1995), kinetic slowing being a direct G-protein-mediated process and steady-state inhibition resulting from Gbeta gamma activation of the protein kinase C pathway. The present results would support the hypothesis of two separate mechanisms and would suggest further that whereas kinetic slowing involves the I-II loop of alpha 1B and, to a lesser extent, alpha 1A, another region apart from this loop may be responsible for the G-protein-mediated steady-state inhibition of calcium channel current. However, it is also clear that the kinetics of inactivation of the channel will affect the ability to observe prepulse potentiation of calcium currents, and we have shown in the present experiments that alpha 1EBE shows more rapid voltage-dependent inactivation than alpha 1B. In this context additional experiments are in progress to examine the properties of the mutant alpha 1BEB, with the I-II loop of alpha 1E inserted into alpha 1B.

Role of the cytoplasmic I-II loop and IS6 in determination of inactivation kinetics

Different calcium channel alpha 1-subunits show different intrinsic inactivation rates (Ellinor et al., 1993), alpha 1E being the most rapidly inactivating. Furthermore, the binding of different calcium channel beta -subunits to the alpha 1-subunit modifies inactivation in a subunit-specific manner (Ellinor et al., 1993; Olcese et al., 1994). beta 2a, in contrast to the other beta -subunits, produces a marked reduction in inactivation rate (Ellinor et al., 1993; Olcese et al., 1994). It has been found that the extreme N terminus of the beta -subunit is responsible for determining its inactivation properties (Olcese et al., 1994), whereas the binding domain for the interaction with the I-II loop of the alpha 1-subunit is in the center of the beta -subunit sequence (De Waard et al., 1994). In a previous study on chimeras between the slowly inactivating alpha 1A and the rapidly inactivating alpha 1E (doe-1), it was found that a region including IS6 and stretching 19 amino acids into the I-II loop was important for determining the inactivation properties of the alpha 1-subunit (Zhang et al., 1994). A subsidiary result observed in the present study is that the I-II loop of alpha 1B, when inserted into alpha 1E, produces a current phenotype with inactivation kinetics intermediate between alpha 1B and alpha 1E, again implicating this loop in determination of inactivation properties. Similar results also were found for the I-II loop of alpha 1A inserted into alpha 1E. The only alteration in transmembrane segment IS6 was V293right-arrowM, as described in Materials and Methods. Thus, from the present and previous result (Zhang et al., 1994) it is likely that the inactivation properties of the channel are determined both by the beta -subunit and intrinsically by sites in IS6 and on the I-II loop, probably lying N terminal to the beta -subunit interaction domain.


FOOTNOTES

Received Oct. 25, 1996; revised Dec. 3, 1996; accepted Dec. 10, 1996.

  

We gratefully acknowledge financial support from the Wellcome Trust. We thank the following for generous gifts of cDNAs and reagents: Dr. T. Snutch (University of British Columbia, Vancouver, Canada), alpha 1A, alpha 1E, and beta 1b; Dr. H. Chin (National Institutes of Health, Bethesda, Maryland), alpha 2-delta ; Dr. J. Marshall (Yale University, New Haven, CT), GFP; Dr. Y. Mori (Seiriken, Okazaki, Japan), alpha 1B; Dr. S. Moss (University College London, London, UK), S65right-arrowT GFP; Genetics Institute (Cambridge, MA), pMT2. We also thank Ms. A. Odunlami, Mr. I. Tedder, and Mr. D. Bell for technical assistance and Dr. A. Mathie for reading this manuscript. This work benefited from the use of the Seqnet facility (Daresbury, UK).

Correspondence should be addressed to Dr. A. C. Dolphin at the above address.



REFERENCES

  • Berrow NS, Campbell V, Fitzgerald EG, Brickley K, Dolphin AC (1995) Antisense depletion of beta -subunits modulates the biophysical and pharmacological properties of neuronal calcium channels. J Physiol (Lond) 482:481-491 . [Abstract/Free Full Text]
  • Berrow NS, Brice NL, Tedder I, Page K, Dolphin AC (1997) Properties of cloned rat alpha 1A calcium channels transiently expressed in the COS-7 cell line. Eur J Neurosci, in press.
  • Boland LM, Bean BP (1993) Modulation of N-type calcium channels in bullfrog sympathetic neurons by luteinizing hormone-releasing hormone: kinetics and voltage dependence. J Neurosci 13:516-533 . [Abstract]
  • Bourinet E, Soong TW, Stea A, Snutch TP (1996) Determinants of the G-protein-dependent opioid modulation of neuronal calcium channels. Proc Natl Acad Sci USA 93:1486-1491 . [Abstract/Free Full Text]
  • Boyer JL, Hepler JR, Harden TK (1989) Hormone and growth factor receptor-mediated regulation of phospholipase C activity. Trends Pharmacol 10:360-364 . [Medline]
  • Campbell V, Berrow N, Dolphin AC (1993) GABAB receptor modulation of Ca2+ currents in rat sensory neurones by the G-protein Go: antisense oligonucleotide studies. J Physiol (Lond) 470:1-11 . [Abstract/Free Full Text]
  • Campbell V, Berrow N, Brickley K, Page K, Wade R, Dolphin AC (1995a) Voltage-dependent calcium channel beta -subunits in combination with alpha-1 subunits have a GTPase activating effect to promote hydrolysis of GTP by Galpha o in rat frontal cortex. FEBS Lett 370:135-140 . [Web of Science][Medline]
  • Campbell V, Berrow NS, Fitzgerald EM, Brickley K, Dolphin AC (1995b) Inhibition of the interaction of G-protein Go with calcium channels by the calcium channel beta -subunit in rat neurones. J Physiol (Lond) 485:365-372 . [Abstract/Free Full Text]
  • Ciranna L, Mouginot D, Feltz P, Schlichter R (1993) Serotonin inhibits Ca2+ currents in porcine melanotrophs by activating 5-HT1C and 5-HT1A receptors. J Physiol (Lond) 463:17-38 . [Abstract/Free Full Text]
  • De Waard M, Pragnell M, Campbell KP (1994) Ca2+ channel regulation by a conserved beta -subunit domain. Neuron 13:495-503 . [Web of Science][Medline]
  • De Waard M, Witcher DR, Pragnell M, Liu H, Campbell KP (1995) Properties of the alpha 1-beta anchoring site in voltage-dependent Ca2+ channels. J Biol Chem 270:12056-12064 . [Abstract/Free Full Text]
  • Diversé-Pierluissi M, Goldsmith PK, Dunlap K (1995) Transmitter-mediated inhibition of N-type calcium channels in sensory neurons involves multiple GTP-binding proteins and subunits. Neuron 14:191-200 . [Web of Science][Medline]
  • Dolphin AC (1995) Voltage-dependent calcium channels and their modulation by neurotransmitters and G-proteins: G. L. Brown prize lecture. Exp Physiol 80:1-36 . [Web of Science][Medline]
  • Dubel SJ, Starr TVB, Hell J, Ahlijanian MK, Enyeart JJ, Catterall WA, Snutch TP (1992) Molecular cloning of the alpha -1 subunit of an omega -conotoxin-sensitive calcium channel. Proc Natl Acad Sci USA 89:5058-5062 . [Abstract/Free Full Text]
  • Ellinor PT, Zhang J-F, Randall AD, Zhou M, Schwarz TL, Tsien RW, Horne WA (1993) Functional expression of a rapidly inactivating neuronal calcium channel. Nature 363:455-458 . [Medline]
  • Fujita Y, Mynlieff M, Dirksen RT, Kim M-S, Niidome T, Nakai J, Friedrich T, Iwabe N, Miyata T, Furuichi T, Furutama D, Mikoshiba K, Mori Y, Beam KG (1993) Primary structure and functional expression of the omega -conotoxin-sensitive N-type calcium channel from rabbit brain. Neuron 10:585-598 . [Web of Science][Medline]
  • Grassi F, Lux HD (1989) Voltage-dependent GABA-induced modulation of calcium currents in chick sensory neurons. Neurosci Lett 105:113-119 . [Web of Science][Medline]
  • Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca2+ channels by G-protein beta gamma -subunits. Nature 380:258-262 . [Medline]
  • Hille B (1992) G-protein-coupled mechanisms and nervous signaling. Neuron 9:187-195 . [Web of Science][Medline]
  • Ikeda SR (1991) Double-pulse calcium channel current facilitation in adult rat sympathetic neurones. J Physiol (Lond) 439:181-214 . [Abstract/Free Full Text]
  • Ikeda SR (1996) Voltage-dependent modulation of N-type calcium channels by G-protein beta gamma -subunits. Nature 380:255-258 . [Medline]
  • Kim H-L, Kim H, Lee P, King RG, Chin H (1992) Rat brain expresses an alternatively spliced form of the dihydropyridine-sensitive L-type calcium channel alpha 2 subunit. Proc Natl Acad Sci USA 89:3251-3255 . [Abstract/Free Full Text]
  • Kleuss C, Hescheler J, Ewel C, Rosenthal W, Schultz G, Wittig B (1991) Assignment of G-protein subtypes to specific receptors inducing inhibition of calcium currents. Nature 353:43-48 . [Medline]
  • Lory P, Varadi G, Slish DF, Varadi M, Schwartz A (1993) Characterization of beta -subunit modulation of a rabbit cardiac L-type Ca2+ channel alpha 1 subunit as expressed in mouse L cells. FEBS Lett 315:167-172 . [Web of Science][Medline]
  • Luebke JI, Dunlap K (1994) Sensory neuron N-type calcium currents are inhibited by both voltage-dependent and -independent mechanisms. Pflügers Arch 428:499-507 . [Web of Science][Medline]
  • McFadzean I, Mullaney I, Brown DA, Milligan G (1989) Antibodies to the GTP binding protein, Go, antagonize noradrenaline-induced calcium current inhibition in NG108-15 hybrid cells. Neuron 3:177-182 . [Web of Science][Medline]
  • Menon-Johansson AS, Berrow N, Dolphin AC (1993) Go transduces GABAB-receptor modulation of N-type calcium channels in cultured dorsal root ganglion neurons. Pflügers Arch 425:335-343 . [Web of Science][Medline]
  • Mintz IM, Bean BP (1993) GABAB receptor inhibition of P-type Ca2+ channels in central neurons. Neuron 10:889-898 . [Web of Science][Medline]
  • Neely A, Wei X, Olcese R, Birnbaumer L, Stefani E (1993) Potentiation by the beta -subunit of the ratio of the ionic current to the charge movement in the cardiac calcium channel. Science 262:575-578 . [Abstract/Free Full Text]
  • Olcese R, Qin N, Schneider T, Neely A, Wei X, Stefani E, Birnbaumer L (1994) The amino terminus of a calcium channel beta -subunit sets rates of channel inactivation independently of the subunit's effect on activation. Neuron 13:1433-1438 . [Web of Science][Medline]
  • Pragnell M, De Waard M, Mori Y, Tanabe T, Snutch TP, Campbell KP (1994) Calcium channel beta -subunit binds to a conserved motif in the I-II cytoplasmic linker of the alpha 1-subunit. Nature 368:67-70 . [Medline]
  • Sather WA, Tanabe T, Zhang J-F, Mori Y, Adams ME, Tsien RW (1993) Distinctive biophysical and pharmacological properties of class A (BI) calcium channel alpha 1 subunits. Neuron 11:291-303 . [Web of Science][Medline]
  • Schneider T, Wei X, Olcese R, Costantin JL, Neely A, Palade P, Perez-Reyes E, Qin N, Zhou J, Crawford GD, Smith RG, Appel SH, Stefani E, Birnbaumer L (1994) Molecular analysis and functional expression of the human type E neuronal Ca2+ channel alpha 1 subunit. Receptors Channels 2:255-270 . [Web of Science][Medline]
  • Snutch TP, Leonard JP, Gilbert MM, Lester HA, Davidson N (1990) Rat brain expresses a heterogeneous family of calcium channels. Proc Natl Acad Sci USA 87:3391-3395 . [Abstract/Free Full Text]
  • Soong TW, Stea A, Hodson CD, Dubel SJ, Vincent SR, Snutch TP (1993) Structure and functional expression of a member of the low voltage-activated calcium channel family. Science 260:1133-1136 . [Abstract/Free Full Text]
  • Starr TVB, Prystay W, Snutch TP (1991) Primary structure of a calcium channel that is highly expressed in the rat cerebellum. Proc Natl Acad Sci USA 88:5621-5625. [Abstract/Free Full Text]
  • Stea A, Dubel SJ, Pragnell M, Leonard JP, Campbell KP, Snutch TP (1993) A beta -subunit normalizes the electrophysiological properties of a cloned N-type Ca2+ channel alpha 1-subunit. Neuropharmacology 32:1103-1116 . [Web of Science][Medline]
  • Stea A, Tomlinson WJ, Soong TW, Bourinet E, Dubel SJ, Vincent SR, Snutch TP (1994) Localization and functional properties of a rat brain alpha 1A calcium channel reflect similarities to neuronal Q- and P-type channels. Proc Natl Acad Sci USA 91:10576-10580 . [Abstract/Free Full Text]
  • Stephens GJ, Page K, Burley JR, Berrow NS, Dolphin AC (1997) Functional expression of rat brain cloned alpha 1E calcium channels in COS-7 cells. Pflügers Arch 433:523-532. [Web of Science][Medline]
  • Tanabe T, Takeshima H, Mikami A, Flockerzi V, Takahashi H, Kangawa K, Kojima M, Matsuo H, Hirose T, Numa S (1987) Primary structure of the receptor for calcium channel blockers from skeletal muscle. Nature 328:313-318 . [Medline]
  • Tomlinson WJ, Stea A, Bourinet E, Charnet P, Nargeot J, Snutch TP (1993) Functional properties of a neuronal class C L-type calcium channel. Neuropharmacology 32:1117-1126 . [Web of Science][Medline]
  • Toth PT, Shekter LR, Ma GH, Philipson LH, Miller RJ (1996) Selective G-protein regulation of neuronal calcium channels. J Neurosci 16:4617-4624 . [Abstract/Free Full Text]
  • Tsunoo A, Yoshii M, Narahashi T (1986) Block of calcium channels by enkephalin and somatostatin in neuroblastoma-glioma hybrid NG108-15 cells. Proc Natl Acad Sci USA 83:9832-9836 . [Abstract/Free Full Text]
  • Wang HY, Pisano MR, Friedman E (1992) Age-related alteration in G-protein function in rat cortex. Ann NY Acad Sci 663:426-428 . [Web of Science][Medline]
  • Witcher DR, De Waard M, Liu H, Pragnell M, Campbell KP (1995) Association of native Ca2+ channel beta -subunits with the alpha 1 subunit interaction domain. J Biol Chem 270:18088-18093 . [Abstract/Free Full Text]
  • Yassin M, Zong SQ, Tanabe T (1996) G-protein modulation of neuronal class E (alpha 1E) calcium channel expressed in GH3 cells. Biochem Biophys Res Commun 220:453-458 . [Web of Science][Medline]
  • Zhang J-F, Randall AD, Ellinor PT, Horne WA, Sather WA, Tanabe T, Schwarz TL, Tsien RW (1993) Distinctive pharmacology and kinetics of cloned neuronal Ca2+ channels and their possible counterparts in mammalian CNS neurons. Neuropharmacology 32:1075-1088 . [Web of Science][Medline]
  • Zhang J-F, Ellinor PT, Aldrich RW, Tsien RW (1994) Molecular determinants of voltage-dependent inactivation in calcium channels. Nature 372:97-100 . [Medline]

Copyright ©1997 Society for Neuroscience   0270-6474/1997/171330-09$05.00/0



This article has been cited by other articles:


Home page
J. Neurosci.Home page
Y. Zhang, Y.-h. Chen, S. D. Bangaru, L. He, K. Abele, S. Tanabe, T. Kozasa, and J. Yang
Origin of the Voltage Dependence of G-Protein Regulation of P/Q-type Ca2+ Channels
J. Neurosci., December 24, 2008; 28(52): 14176 - 14188.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Raybaud, Y. Dodier, P. Bissonnette, M. Simoes, D. G. Bichet, R. Sauve, and L. Parent
The Role of the GX9GX3G Motif in the Gating of High Voltage-activated Ca2+ Channels
J. Biol. Chem., December 22, 2006; 281(51): 39424 - 39436.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
H. W. Tedford and G. W. Zamponi
Direct G Protein Modulation of Cav2 Calcium Channels
Pharmacol. Rev., December 1, 2006; 58(4): 837 - 862.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
H. W. Tedford, A. E. Kisilevsky, J. B. Peloquin, and G. W. Zamponi
Scanning Mutagenesis Reveals a Role for Serine 189 of the Heterotrimeric G-Protein Beta 1 Subunit in the Inhibition of N-Type Calcium Channels
J Neurophysiol, July 1, 2006; 96(1): 465 - 470.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Li, A. Hummer, J. Han, M. Xie, K. Melnik-Martinez, R. L. Moreno, M. Buck, M. D. Mark, and S. Herlitze
G Protein {beta}2 Subunit-derived Peptides for Inhibition and Induction of G Protein Pathways: EXAMINATION OF VOLTAGE-GATED Ca2+ AND G PROTEIN INWARDLY RECTIFYING K+ CHANNELS
J. Biol. Chem., June 24, 2005; 280(25): 23945 - 23959.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Li, H. Zhong, T. Scheuer, and W. A. Catterall
Functional Role of a C-Terminal G{beta}{gamma}-Binding Domain of Cav2.2 Channels
Mol. Pharmacol., September 1, 2004; 66(3): 761 - 769.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. J. Doering, A. E. Kisilevsky, Z.-P. Feng, M. I. Arnot, J. Peloquin, J. Hamid, W. Barr, A. Nirdosh, B. Simms, R. J. Winkfein, et al.
A Single G{beta} Subunit Locus Controls Cross-talk between Protein Kinase C and G Protein Regulation of N-type Calcium Channels
J. Biol. Chem., July 9, 2004; 279(28): 29709 - 29717.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Rousset, T. Cens, A. Gouin-Charnet, F. Scamps, and P. Charnet
Ca2+ and Phosphatidylinositol 4,5-Bisphosphate Stabilize a G{beta}{gamma}-sensitive State of CaV2 Ca2+ Channels
J. Biol. Chem., April 9, 2004; 279(15): 14619 - 14630.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Hummer, O. Delzeith, S. R. Gomez, R. L. Moreno, M. D. Mark, and S. Herlitze
Competitive and Synergistic Interactions of G Protein {beta}2 and Ca2+ Channel {beta}1b Subunits with Cav2.1 Channels, Revealed by Mammalian Two-hybrid and Fluorescence Resonance Energy Transfer Measurements
J. Biol. Chem., December 5, 2003; 278(49): 49386 - 49400.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
A. C. Dolphin
G Protein Modulation of Voltage-Gated Calcium Channels
Pharmacol. Rev., December 1, 2003; 55(4): 607 - 627.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
H. L. Agler, J. Evans, H. M. Colecraft, and D. T. Yue
Custom Distinctions in the Interaction of G-protein {beta} Subunits with N-type (CaV2.2) Versus P/Q-type (CaV2.1) Calcium Channels
J. Gen. Physiol., May 27, 2003; 121(6): 495 - 510.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
K. Melliti, M. Grabner, and G. R Seabrook
The familial hemiplegic migraine mutation R192q reduces G-protein-mediated inhibition of p/q-type (Cav2.1) calcium channels expressed in human embryonic kidney cells
J. Physiol., January 15, 2003; 546(2): 337 - 347.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-C. Lee, S. Choi, T. Lee, H.-L. Kim, H. Chin, and H.-S. Shin
Molecular basis of R-type calcium channels in central amygdala neurons of the mouse
PNAS, February 14, 2002; (2002) 52697799.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Kaneko, C. B. Cooper, N. Nishioka, H. Yamasaki, A. Suzuki, S. E. Jarvis, A. Akaike, M. Satoh, and G. W. Zamponi
Identification and Characterization of Novel Human Cav2.2 (alpha 1B) Calcium Channel Variants Lacking the Synaptic Protein Interaction Site
J. Neurosci., January 1, 2002; 22(1): 82 - 92.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. E. Jarvis and G. W. Zamponi
Distinct Molecular Determinants Govern Syntaxin 1A-Mediated Inactivation and G-Protein Inhibition of N-Type Calcium Channels
J. Neurosci., May 1, 2001; 21(9): 2939 - 2948.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Herlitze, H. Zhong, T. Scheuer, and W. A. Catterall
Allosteric modulation of Ca2+ channels by G proteins, voltage-dependent facilitation, protein kinase C, and Cavbeta subunits
PNAS, April 10, 2001; 98(8): 4699 - 4704.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Zhong, B. Li, T. Scheuer, and W. A. Catterall
Control of gating mode by a single amino acid residue in transmembrane segment IS3 of the N-type Ca2+ channel
PNAS, April 10, 2001; 98(8): 4705 - 4709.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
R. C. Foehring, P. G. Mermelstein, W.-J. Song, S. Ulrich, and D. J. Surmeier
Unique Properties of R-Type Calcium Currents in Neocortical and Neostriatal Neurons
J Neurophysiol, November 1, 2000; 84(5): 2225 - 2236.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. D Mark, S. Wittemann, and S. Herlitze
G protein modulation of recombinant P/Q-type calcium channels by regulators of G protein signalling proteins
J. Physiol., October 1, 2000; 528(1): 65 - 77.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. A. Simen and R. J. Miller
Involvement of Regions in Domain I in the Opioid Receptor Sensitivity of alpha 1B Ca2+ Channels
Mol. Pharmacol., May 1, 2000; 57(5): 1064 - 1074.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
A. L. Cahill, J. H. Hurley, and A. P. Fox
Coexpression of Cloned alpha 1B, beta 2a, and alpha 2/delta Subunits Produces Non-Inactivating Calcium Currents Similar to Those Found in Bovine Chromaffin Cells
J. Neurosci., March 1, 2000; 20(5): 1685 - 1693.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. E. Jarvis, J. M. Magga, A. M. Beedle, J. E. A. Braun, and G. W. Zamponi
G Protein Modulation of N-type Calcium Channels Is Facilitated by Physical Interactions between Syntaxin 1A and Gbeta gamma
J. Biol. Chem., February 25, 2000; 275(9): 6388 - 6394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. J. Kamp, H. Hu, and E. Marban
Voltage-dependent facilitation of cardiac L-type Ca channels expressed in HEK-293 cells requires beta -subunit
Am J Physiol Heart Circ Physiol, January 1, 2000; 278(1): H126 - H136.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. Canti, K. M. Page, G. J. Stephens, and A. C. Dolphin
Identification of Residues in the N Terminus of alpha 1B Critical for Inhibition of the Voltage-Dependent Calcium Channel by Gbeta gamma
J. Neurosci., August 15, 1999; 19(16): 6855 - 6864.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Hamid, D. Nelson, R. Spaetgens, S. J. Dubel, T. P. Snutch, and G. W. Zamponi
Identification of an Integration Center for Cross-talk between Protein Kinase C and G Protein Modulation of N-type Calcium Channels
J. Biol. Chem., March 5, 1999; 274(10): 6195 - 6202.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Q.-Q. Sun and N. Dale
G-Proteins Are Involved in 5-HT Receptor-Mediated Modulation of N- and P/Q- But Not T-Type Ca2+ Channels
J. Neurosci., February 1, 1999; 19(3): 890 - 899.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. E. Garcia, B. Li, R. E. Garcia-Ferreiro, E. O. Hernandez-Ochoa, K. Yan, N. Gautam, W. A. Catterall, K. Mackie, and B. Hille
G-Protein beta -Subunit Specificity in the Fast Membrane-Delimited Inhibition of Ca2+ Channels
J. Neurosci., November 15, 1998; 18(22): 9163 - 9170.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Namkung, S. M. Smith, S. B. Lee, N. V. Skrypnyk, H.-L. Kim, H. Chin, R. H. Scheller, R. W. Tsien, and H.-S. Shin
Targeted disruption of the Ca2+ channel beta 3 subunit reduces N- and L-type Ca2+ channel activity and alters the voltagedependent activation of P/Q-type Ca2+ channels in neurons
PNAS, September 29, 1998; 95(20): 12010 - 12015.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
U. Meza and B. Adams
G-Protein-Dependent Facilitation of Neuronal alpha 1A, alpha 1B, and alpha 1E Ca Channels
J. Neurosci., July 15, 1998; 18(14): 5240 - 5252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Furukawa, T. Nukada, Y. Mori, M. Wakamori, Y. Fujita, H. Ishida, K. Fukuda, S. Kato, and M. Yoshii
Differential Interactions of the C terminus and the Cytoplasmic I-II Loop of Neuronal Ca2+ Channels with G-protein alpha  and beta gamma Subunits. I. MOLECULAR DETERMINATION
J. Biol. Chem., July 10, 1998; 273(28): 17585 - 17594.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. M. Page, C. Canti, G. J. Stephens, N. S. Berrow, and A. C. Dolphin
Identification of the Amino Terminus of Neuronal Ca2+ Channel alpha 1 Subunits alpha 1B and alpha 1E as an Essential Determinant of G-Protein Modulation
J. Neurosci., July 1, 1998; 18(13): 4815 - 4824.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Formenti, M. Martina, A. Plebani, and M. Mancia
Multiple modulatory effects of dopamine on calcium channel kinetics in adult rat sensory neurons
J. Physiol., June 1, 1998; 509(2): 395 - 409.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. A. Simen and R. J. Miller
Structural Features Determining Differential Receptor Regulation of Neuronal Ca Channels
J. Neurosci., May 15, 1998; 18(10): 3689 - 3698.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. J Stephens, N. L Brice, N. S Berrow, and A. C Dolphin
Facilitation of rabbit {alpha}1B calcium channels: involvement of endogenous G{beta}{gamma} subunits
J. Physiol., May 15, 1998; 509(1): 15 - 27.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. J Stephens, C. Canti, K. M Page, and A. C Dolphin
Role of domain I of neuronal Ca2+ channel {alpha}1 subunits in G protein modulation
J. Physiol., May 15, 1998; 509(1): 163 - 169.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. W. Zamponi and T. P. Snutch
Decay of prepulse facilitation of N type calcium channels during G protein inhibition is consistent with binding of a single Gbeta gamma subunit
PNAS, March 31, 1998; 95(7): 4035 - 4039.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. Sun, L. H. Philipson, and R. J. Miller
Regulation of K+ and Ca++ Channels by a Family of Neuropeptide Y Receptors
J. Pharmacol. Exp. Ther., February 1, 1998; 284(2): 625 - 632.
[Abstract] [Full Text]


Home page
J. Physiol.Home page
P. Delmas, D. A Brown, M. Dayrell, F. C Abogadie, M. P Caulfield, and N. J Buckley
On the role of endogenous G-protein {beta}{gamma} subunits in N-type Ca2+ current inhibition by neurotransmitters in rat sympathetic neurones
J. Physiol., January 15, 1998; 506(2): 319 - 329.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. E. Hamm
The Many Faces of G Protein Signaling
J. Biol. Chem., January 9, 1998; 273(2): 669 - 672.
[Full Text] [PDF]


Home page
J. Physiol.Home page
A. C Dolphin
Mechanisms of modulation of voltage-dependent calcium channels by G proteins
J. Physiol., January 1, 1998; 506(1): 3 - 11.
[Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
L. R. Shekter, R. Taussig, S. E. Gillard, and R. J. Miller
Regulation of Human Neuronal Calcium Channels by G Protein beta gamma Subunits Expressed in Human Embryonic Kidney 293 Cells
Mol. Pharmacol., August 1, 1997; 52(2): 282 - 291.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-C. Lee, S. Choi, T. Lee, H.-L. Kim, H. Chin, and H.-S. Shin
Molecular basis of R-type calcium channels in central amygdala neurons of the mouse
PNAS, March 5, 2002; 99(5): 3276 - 3281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (80)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Page, K. M.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Page, K. M.
Right arrow Articles by Dolphin, A. C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-