 |
Previous Article | Next Article 
Volume 17, Number 6,
Issue of March 15, 1997
pp. 1971-1980
Copyright ©1997 Society for Neuroscience
Light and Electron Microscopic Localization of Presenilin-1 in
Primate Brain
James J. Lah,
Craig J. Heilman,
Norman R. Nash,
Howard D. Rees,
Hong Yi,
Scott E. Counts, and
Allan I. Levey
Department of Neurology, Emory University School of Medicine,
Atlanta, Georgia 30322
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Several genes have been implicated in the pathogenesis of
early-onset familial Alzheimer's disease. A majority of the autosomal dominant cases are linked to recently identified mutations in the
presenilin-1 gene on chromosome 14. The native presenilin-1 protein in
primates has not been well characterized, and its precise localization
is unknown. We have studied the native presenilin-1 protein in monkey
brain and peripheral tissues by using a monoclonal antibody specific
for the N-terminal domain of human presenilin-1. Western blots detect
polypeptide species of ~49 and ~32 kDa from COS-7 and PC12 cells
transfected with full-length human presenilin-1 cDNA and from in
vitro translations of the normal human presenilin-1 mRNA. A 32 kDa polypeptide is detected in monkey peripheral tissues, with the
highest expression in testis and lung. In all brain regions the 32 kDa
band is the predominant form of presenilin-1, and it is found in
particulate subfractions. Light microscopic immunocytochemistry reveals
presenilin-1 staining in all brain regions, with the strongest labeling
in neurons and neuropil. In addition, weaker immunoreactivity is also
present in glia and blood vessels. Neuronal staining shows significant
variability, with particularly intense labeling of certain cell types,
including large neocortical and hippocampal pyramidal neurons,
magnocellular basal forebrain neurons, brainstem motoneurons, and some
populations of interneurons. By electron microscopic
immunocytochemistry, highly selective presenilin-1 staining is seen on
the cytoplasmic surfaces of membranous organelles, which suggest
localization to the endoplasmic reticulum-Golgi intermediate
compartment, a subdomain of the endoplasmic reticulum, and some coated
transport vesicles.
Key words:
presenilin;
Alzheimer's disease;
immunocytochemistry;
electron microscopy;
endoplasmic reticulum;
intermediate compartment;
transport vesicles;
coated vesicles;
monoclonal antibody
INTRODUCTION
Alzheimer's disease (AD) is a common and
devastating neurodegenerative disorder that causes progressive
cognitive and behavioral deterioration. The disease is genetically
heterogeneous, and the study of several autosomal dominant familial AD
(FAD) variants has led to identification of three genes that carry
pathogenic mutations. The amyloid precursor protein (APP) gene is
linked to chromosome 21-linked FAD (Chartier-Harlin et al., 1991 ; Goate et al., 1991 ; Murrell et al., 1991 ), and recently the genes associated with chromosome 14- and chromosome 1-linked FAD have been identified (Levy-Lahad et al., 1995 ; Rogaev et al., 1995 ; Sherrington et al.,
1995 ). Presenilin-1 (PS1) and presenilin-2 (PS2) are highly homologous
genes (67% amino acid identity; Levy-Lahad et al., 1995 ; Rogaev et
al., 1995 ) that encode a novel family of membrane-associated proteins.
Northern blot and in situ hybridization studies of
presenilin mRNAs show widespread expression in brain and peripheral
tissues of both humans and rodents (Rogaev et al., 1995 ; Sherrington et al., 1995 ; Kovacs et al., 1996 ; Suzuki et al., 1996 ). Recent studies of
PS1 protein have revealed endoproteolytic cleavage resulting in N- and
C-terminal fragments of ~27 and ~17 kDa, respectively (Thinakaran
et al., 1996 ). Moreover, mutations in PS1 seem to alter the
endoproteolytic processing, leading to an abnormal accumulation of the
full-length protein (Mercken et al., 1996 ; Thinakaran et al., 1996 ).
The light microscopic distribution of native PS1 in mouse brain (Elder
et al., 1996 ; Moussaoui et al., 1996 ) and the localization of
epitope-tagged presenilins in transfected cells (Kovacs et al., 1996 )
have been reported. However, little is known about the presenilin
proteins in primates. Given the species selectivity of AD pathology, a
detailed examination of the native proteins in primate brain, including
precise subcellular localization, is critical for providing insights
into normal presenilin functions and their role in AD.
To facilitate our study of PS1, we have generated a monoclonal antibody
specific for the N terminus of human PS1. This antibody has been used
to characterize PS1 in human brain and in cases of familial and
sporadic AD in which the protein is localized to neurofibrillary
tangles and senile plaques (Levey et al., 1997 ). Here, we report on the
characterization of the antibody and its use in examining the native
PS1 protein in normal nonhuman primate brain and peripheral tissues. By
Western blotting, PS1 is detected in a variety of tissues and brain
regions as a membrane-associated polypeptide that migrates with an
approximate Mr of 32 kDa. Light microscopic
immunocytochemistry confirms widespread neuronal localization of PS1.
However, our analysis also reveals a broader distribution, which
includes non-neuronal elements in brain. Extension of these studies to
the ultrastructural localization of PS1 demonstrates the presence of
highly selective labeling on the cytoplasmic surface of a population of
coated vesicles and a smooth endoplasmic reticulum (SER)-like
compartment. Moreover, the distribution in neuronal cell bodies
suggests localization to the ER-Golgi intermediate compartment. These
findings have a number of implications for PS1 function.
MATERIALS AND METHODS
Isolation of presenilin cDNAs. PS1 and PS2 were
cloned from a human amygdala cDNA library (Clontech, Palo Alto, CA) by
PCR. Oligonucleotides were designed to be specific for either PS1 or PS2 and contained a unique restriction site to facilitate subcloning. The sequences of the oligonucleotide primers were
ggcggggaagcttatatacctaat and cgggaatctagactttgttag or
accaagtgtccgggatccagacctctctgcggc and
caatgaaaattccctcgagcttgcagcctgtggcac for PS1 or PS2, respectively. The
resulting fragments were subcloned independently into pCDNA3 (Invitrogen, San Diego, CA), and the sequences were verified by dideoxy
sequencing (Sequenase, Amersham, Arlington Heights, IL). The PS1 clone
contains all known exons (Clark et al., 1995 ) and codes for a
full-length protein of 467 amino acids. Our full-length PS2 clone
contains 50 base pairs of 5 untranslated and 30 base pairs of 3
untranslated sequence, and it is predicted to encode a protein of 448 amino acids.
Bacterial expression of presenilin fusion proteins. Fusion
proteins were generated for use in antibody production and
characterization of antibody specificity. Two constructs were made
encoding glutathione S-transferase (GST) fused to
overlapping regions of the N terminus of PS1 (amino acids 2-70 and
21-80, respectively) by subcloning PCR fragments into pGEX-2T
(Pharmacia, Piscataway, NJ). The PCR fragments were obtained by
amplifying the corresponding regions of human PS1 cDNA with the
introduction of in-frame BamHI and EcoRI sites
and stop codons. The oligonucleotides used were PS12-70: gttgctccaggatccgagttacctgcaccgttgtcc and
ttaattgaattcctaatcttcttcctcatcttgctcc; PS121-80:
ttaattggatcccacctgagcaatactgtacg and
gagcatgaattcctacttggcgccatatttcaatgt. The N-terminal region of PS2
(amino acids 1-76) (Levy-Lahad et al., 1995 ) was used to produce
another fusion protein for evaluation of specificity of PS1 antibodies.
This region was amplified from the PS2 full-length clone by PCR with
specific oligonucleotides (tccagaggcggatccatgctcacattcatggcctct and
gtatttgaggaattctcattcctccaggcctggcggccg) that again introduced
BamHI and EcoRI sites at the 5 and 3 ends, respectively. The recombinant proteins GST-PS12-70,
GST-PS121-80, and GST-PS21-76 were
expressed in Escherichia coli strain BL21(DE3)pLysS and
purified by affinity chromatography with glutathione agarose, using
methods previously described (Smith and Johnson, 1988 ; Levey et al.,
1991 ).
Monoclonal antibody production. A hybridoma cell line was
generated that secretes a monoclonal antibody reactive with the N
terminus of human PS1. Briefly, a female Sprague Dawley rat was
immunized over a 4 month period with repeated intradermal and
intraperitoneal injections of GST-PS121-80 fusion protein (100 µg). Three days after a final intravenous boost, the spleen was
harvested and lymphoid cells were isolated by centrifugation via
Ficoll-Hypaque (Pharmacia). The rat spleen cells were fused with the
murine nonsecreting myeloma cell line Sp2/0 at a 2:1 ratio, using 50%
polyethylene glycol 1500, and then plated in selection media (DMEM,
20% fetal bovine serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 0.1 mM
hypoxanthine, 0.0004 mM aminopterin, and 0.016 mM thymidine) at a final concentration of 500,000 cells/ml
in 96-well microtiter plates. Hybridomas were screened by
immunoblotting with GST and GST-PS121-80. A single
hybridoma cell line was isolated after repeated cloning at limiting
dilutions. Culture supernatants were concentrated 20- to 30-fold by
ammonium sulfate precipitation and dialyzed into PBS.
Transfection of mammalian cells. African green monkey kidney
COS-7 and rat adrenal pheochromocytoma PC12 cells were transiently or
stably transfected with PS1 cDNA cloned behind the cytomegalovirus (CMV) promoter in pCDNA3. Briefly, the cells were plated onto 10 cm
dishes at a density of 10,000/cm2 (COS-7) or
50,000/cm2 (PC12) and grown in a 37°C incubator with 5%
carbon dioxide. After 24 hr, 20 µg of plasmid DNA was added to each
plate in a 1 ml solution of (in mM): 25 BES, 140 sodium
chloride, 0.750 sodium phosphate, and 125 calcium chloride, pH 6.95;
then the cells were returned to a 37°C incubator with 3% carbon
dioxide for an additional 18-24 hr. The media were replaced with fresh
growth media and returned to 5% carbon dioxide. COS-7 cells
transiently expressing PS1 were grown for 48 hr and harvested for
Western blot analysis. Stable PC12 transfectants were selected with 400 µg/ml Geneticin (Life Technologies, Gaithersburg, MD), and single
colonies were isolated. Clonal cell lines were established by limiting
dilution cloning to ensure growth from an individual cell.
In vitro translation. Translation of both PS1 and PS2
RNA was performed in vitro with rabbit reticulocyte lysates
(Promega, Madison, WI). Briefly, RNA transcripts of both PS1 and PS2
were made by runoff transcription (mCAP RNA capping kit, Stratagene, La
Jolla, CA) as per the manufacturer's protocol and translated with or
without canine pancreatic microsomal membranes. Reactions were in a
total volume of 25 µl and provided sufficient protein so that 2 µl
was suitable for use in Western blotting experiments.
Western blotting. Western blotting studies were performed to
assess antibody specificity and presenilin expression. Preparations of
PC12 cells, COS-7 cells, in vitro translation products, and brain tissues were denatured in SDS loading buffer. Samples were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE with 12%
acrylamide) and transferred to polyvinylidene fluoride membranes
(Immobilon P, Millipore, Bedford, MA) electrophoretically. The blots
were blocked (30 min) in 5% nonfat dried milk, 0.1% Tween-20, and 20 mM Tris-saline, pH 7.4, at room temperature and incubated
overnight at 4°C with primary antibody [PS1 N-terminus monoclonal
1:500; anti-synaptophysin monoclonal 1:200,000 (SY38, Pierce, Rockford,
IL)]. Then they were rinsed several times and incubated for 1 hr with
horseradish peroxidase-conjugated goat anti-mouse IgG (1:10,000 in
blocking buffer); immunoreactive proteins were visualized by enhanced
chemiluminescence (ECL, Amersham). When needed for reprobing, blots
were stripped by incubating in SDS buffer (2% SDS, 100 mM
-mercaptoethanol, and 62.5 mM Tris-HCl, pH 6.8) for 30 min at 75°C. For controls, PS1 antibody was preincubated for 1 hr at
room temperature with 100 µg/ml GST-PS121-80 fusion
protein. The preadsorbed antibody was used at a final dilution of
1:500.
Tissue fractionation. A technique for subcellular
fractionation of brain tissue was adapted from a method for synaptosome purification (Gray and Whittaker, 1962 ). Fresh tissue was homogenized on ice in a solution of 0.32 M sucrose, 10 mM
Tris, pH 8.0, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 1 µg/ml pepstatin A in a Wheaton glass tissue grinder. The crude
nuclear pellet was centrifuged at 1000 × g for 10 min.
A washed nuclear pellet, P1, was obtained by resuspension and
centrifugation of the crude pellet in 0.32 M sucrose
buffer. The supernatant, S1, was transferred to a fresh tube and
centrifuged at 10,000 × g for 20 min to obtain a crude P2 pellet and a S2 fraction. The crude P2 pellet was washed three times
by resuspension and centrifugation. The washed P2 was resuspended in
0.32 M sucrose solution and layered on a step gradient
containing 1.2 and 0.8 M sucrose. The gradient was
centrifuged for 3 hr at 53,000 × g at 4°C in a
Beckman ultracentrifuge. Fraction P2-0.32 M, containing
predominantly small myelin fragments, was collected from the 0.32-0.80
M sucrose interface. Fraction P2-0.80 M,
enriched in synaptosomes, was collected from the 0.8-1.2 M
sucrose interface. Fraction P2-1.20 M, containing
mitochondria and lysosomes, pelleted through the densest layer of the
gradient. P2-0.32 M, P2-0.80 M, and P3
fractions were pelleted by 100,000 × g centrifugation of P2-0.32 M, P2-0.80 M, and S2 fractions,
respectively, for 1 hr in 0.32 M sucrose. The P3 pellet
contained microsomal membranes, and the S3 fraction consisted mainly of
ribosomes and soluble proteins (Gray and Whittaker, 1962 ).
Immunocytochemistry. Rhesus monkeys (n = 4),
weighing 5-11 kg, were perfused with 3 or 4% paraformaldehyde,
combined in one case with 0.05% glutaraldehyde. These and all other
animals used in this study were maintained in accordance with United
States Public Health Service and National Institutes of Health
guidelines for the care and use of laboratory animals. For light
microscopy, blocks were frozen on dry ice and sectioned at 40 µm on a
freezing microtome. For electron microscopy, blocks of forebrain, motor cortex, hippocampus, and cerebellum were sectioned at 40 µm on a
vibratome (Technical Products International, St. Louis, MO). Immunocytochemical processing was performed with free-floating sections
and immunoperoxidase methods previously described (Levey et al., 1991 ).
The monoclonal antibody to PS1 was used at 1:100-500 dilution from
concentrated culture supernatants. Control sections were processed in
parallel, in which the primary antibody was either omitted or
preadsorbed with the GST-PS121-80 fusion protein (100 µg/ml); preadsorption with the GST carrier protein (100 µg/ml)
alone had no effect on staining. Biotinylated goat anti-rat IgG (1:200
dilution; Vector Labs, Burlingame, CA) and avidin-biotinylated
horseradish peroxidase complex (Vectastain Elite, Vector Labs) were
used to localize the primary antibody. Immunoreactivity was visualized
with 0.05% 3,3 -diaminobenzidine tetrahydrochloride (DAB) and 0.01%
H2O2 in 50 mM Tris, pH 7.6. Sections for light microscopy were slide-mounted, air-dried, dehydrated through a graded alcohol series and xylene, and, finally, coverslipped for microscopic examination. Sections for electron microscopic immunocytochemistry were post-fixed in 1% osmium tetroxide, stained with 2% uranyl acetate, dehydrated through graded alcohol and propylene oxide, and embedded in Eponate 12 resin. Ultrathin sections were cut on a Reichert Ultracut S ultramicrotome (Leica, Deerfield, IL)
and collected on mesh copper grids for examination on a JEOL JEM-100C
transmission electron microscope.
RESULTS
Specificity of a monoclonal antibody to the N terminus of PS1
To characterize the native PS1 protein, we developed a rat
monoclonal antibody raised against a fusion protein antigen containing a divergent hydrophilic region of the N terminus
(GST-PS121-80) of human PS1 (Sherrington et al., 1995 ).
On Western blots, the antibody reacted strongly with the antigen and
another overlapping fusion protein containing amino acids 2-70 of PS1
(GST-PS12-70), indicating that the recognized epitope
lies between residues 21-70 (Fig.
1A). As expected, given the divergence
in this region of the presenilins (~20% identity), the antibody
showed no detectable cross-reactivity with the N terminus of PS2
(GST-PS21-76).
Fig. 1.
Characterization of anti-human PS1 monoclonal
antibody by Western blot analysis. A, Purified samples
(~20 ng) of glutathione S-transferase
(GST), two GST-PS1 fusion
proteins, and a GST-PS2 fusion protein were blotted and
probed with our anti-PS1 monoclonal antibody ( -PS1, left
panel) and then stripped and reprobed with an antibody
specific for GST ( -GST, right panel). The
subscripts refer to amino acid residues of either PS1 or PS2
incorporated in the fusion protein constructs. The monoclonal antibody
recognized the immunogen
(GST-PS121-80) and another
fusion protein containing overlapping sequences
(GST-PS12-70) but did not bind
to GST or a fusion protein containing the N terminus of PS2. Anti-GST
antibody bound GST and all fusion proteins. Degradation of the
GST-PS12-70 peptide or early
termination of translation products resulted in three fragments, two of
which were recognized by our PS1 antibody. B, In vitro
translation was performed with no added mRNA ( ), full-length PS1 mRNA
(PS1), or full-length PS2 mRNA (PS2), in
the presence or absence of microsomes (microsomes +,
). Equal aliquots of each reaction mixture (2 µl) were
immunoblotted and probed with our monoclonal antibody to PS1. Control
reactions without exogenous mRNA or with PS2 mRNA produced no
immunoreactive material. Translation of PS1 mRNA produced a strongly
immunoreactive band at ~49 kDa and weaker bands at ~32 and ~26
kDa. Synthesis of each polypeptide was enhanced by the presence of
microsomal membranes. C, Homogenates (25 µg/lane) of
transfected rat PC12 (PC12-PS1) and monkey COS-7
(COS7-PS1) cells expressing the human PS1 gene were
immunoblotted and probed with anti-PS1 antibody (left
panel). Two primary immunoreactive bands were seen at 49 and 32 kDa. The smaller polypeptide was more abundant in transfected
PC12 cells, whereas the larger band predominated in transfected COS-7
cells. Control lanes from untransfected parent cells
(PC12, COS7) did not contain
immunoreactive bands, but on overexposed blots the 32 kDa band was seen
in untransfected COS-7 cell homogenates. Preadsorption of the
monoclonal antibody with GST-PS121-80 eliminated all
bands (right panel).
[View Larger Version of this Image (33K GIF file)]
Western blot analysis also revealed strong antibody reactivity with the
human protein expressed by in vitro translation of PS1 mRNA
(Fig. 1B). The major immunoreactive protein was ~49
kDa. This is somewhat smaller than the predicted size of the
full-length protein encoded by the PS1 cDNA (467 amino acids,
Mr 52,664; Sherrington et al., 1995 ), but it is
similar to the Mr of PS1 recently reported by
others, using antibodies to the loop region and different epitopes at
the N terminus (Elder et al., 1996 ; Mercken et al., 1996 ; Moussaoui et
al., 1996 ; Thinakaran et al., 1996 ). Less intense immunoreactive bands
of ~32 and ~26 kDa were also present in the PS1 translation products. Expression of each of these polypeptides was facilitated by
the introduction of microsomes (Fig. 1B). The
monoclonal antibody did not react with the PS2 polypeptide (Fig.
1B), the presence of which was confirmed by
radiolabeling of the translation products and autoradiography (data not
shown). Thus, our monoclonal antibody reacted selectively with
full-length PS1 protein produced by cell-free translation as well as
with truncated polypeptides bearing the N-terminal epitope.
Expression of PS1 protein in mammalian cells
PS1 protein was expressed in rat pheochromocytoma PC12 cells and
in African green monkey kidney COS-7 cells and analyzed by Western
blotting (Fig. 1C). The monoclonal antibody reacted strongly with both a 49 kDa protein and a more abundant 32 kDa polypeptide in
PC12 cells stably transfected with the human PS1 cDNA. In COS-7 cells
transiently transfected with PS1 cDNA, the dominant immunoreactive species were a doublet at 49 kDa and a 32 kDa polypeptide. In addition,
several faint bands between 35-40 kDa sometimes were seen (Fig.
2A, lane 1). On overexposed blots, a
32 kDa protein was detectable in untransfected COS-7 cells but at much
lower levels than in the transfected cells. Because COS-7 cells express PS1 mRNA, as verified by PCR (data not shown), the 32 kDa band in
untransfected cells likely represents endogenous monkey PS1 protein. In
contrast, no endogenous PS1 immunoreactivity was detectable in
untransfected PC12 cells. This finding implies that if PC12 cells
express the rat PS1 homolog, then there is divergence between rodent
and human species in the region recognized by our antibody. This
possibility was confirmed by Western blot and immunocytochemical analysis of rat brain (data not shown), suggesting the epitope is in a
region of the N terminus (amino acids 21-46) that is unique to the
human PS1 (Takahashi et al., 1996 ). Finally, immunoreactivity in PC12
and COS-7 cells was depleted by preadsorption of the monoclonal antibody with the antigen, confirming the immunological specificity of
binding (Fig. 1C).
Fig. 2.
PS1 in monkey peripheral tissues. Homogenates (50 µg/lane) were immunoblotted and probed with anti-PS1 antibody.
Homogenate from COS7-PS1 (25 µg) was run for
comparison. PS1 immunoreactivity in tissue homogenates was seen only as
a 32 kDa band. The strongest bands were found in testis and lung,
whereas PS1 protein was undetectable in pancreas and muscle. The 32 kDa
band in all samples, as well as the 49 kDa band present in transfected
COS-7 cells, was eliminated by preadsorption with GST-PS1 fusion
protein (right panel, arrowhead). A
nonspecific band at ~95 kDa, present in muscle and lung
(asterisk), was unaffected by preadsorption.
[View Larger Version of this Image (34K GIF file)]
PS1 distribution in peripheral tissues
Northern blot results have indicated that PS1 is transcribed in a
wide variety of peripheral tissues (Rogaev et al., 1995 ; Sherrington et
al., 1995 ; Kovacs et al., 1996 ; Suzuki et al., 1996 ). To assess the
distribution of PS1 protein, we prepared a broad range of monkey
tissues for immunoblot analysis with the PS1 monoclonal antibody. In
all tissues in which PS1 was detected, the antibody recognized a
predominant band that comigrated with the 32 kDa band in
PS1-transfected COS-7 cells (Fig. 2, left panel). Preadsorption of the primary antibody with PS1 fusion protein depleted
this band in all samples, demonstrating specificity of binding (Fig. 2,
right panel). Although higher molecular weight species, including the presumed full-length protein at ~49 kDa, were
seen in PS1-transfected COS-7 cells, only the 32 kDa band was seen in
the monkey tissue samples. Even in samples in which the 32 kDa species
was quite abundant, the full-length protein was not detected.
Different tissues showed significant variability in the abundance of
PS1 protein, and it did not always parallel the reported mRNA levels
(Kovacs et al., 1996 ; Suzuki et al., 1996 ). The highest levels of PS1
protein were found in samples from testis and lung. In contrast, PS1
was not detectable in pancreas or skeletal muscle. Other tissues that
were examined (liver, kidney, spleen, salivary glands, and heart)
revealed an intermediate range of PS1 immunoreactivity. An additional
prominent band migrating at ~95 kDa was seen in skeletal muscle and
lung samples (Fig. 2, asterisk). However, preadsorption of
the primary antibody failed to eliminate this band, indicating that it
represents a nonspecific band produced by the detection system. These
results suggest that the PS1 protein, as well as mRNA, is present in a
variety of non-neural tissues. The differences between patterns of mRNA
and protein expression implies potential differences in translation
efficiency, mRNA stability, or protein half-life in different tissues.
Furthermore, in peripheral tissues, Western blotting detects a 32 kDa
polypeptide, but the full-length PS1 is not visualized. This suggests
that the native PS1 produced in a variety of monkey tissues is
processed efficiently into a 32 kDa polypeptide that contains the
N-terminal epitope recognized by our antibody. It should be noted that
the C-terminal 17 kDa peptide, which recently was reported (Thinakaran et al., 1996 ), could be present in these tissues as well; however, because of the epitope specificity of our antibody, this band would not
be detected.
PS1 distribution in monkey brain
To determine the abundance of PS1 in different brain regions, we
dissected a variety of cortical and subcortical structures from monkey
brain and analyzed them for PS1 by Western blotting. Our antibody
detected PS1 immunoreactivity in all brain regions, primarily as a 32 kDa polypeptide, and labeled a much fainter band at ~49 kDa (Fig.
3A). Both bands comigrated with the two major
bands from PS1-transfected COS-7 cells. However, the lower band in
brain was somewhat broader and had a slightly slower electrophoretic mobility than the corresponding band in PS1-transfected COS-7, suggesting potential differences in post-translational modifications. There were only slight differences in the band intensity across different brain regions. Notably, two regions that have been reported to contain high levels of PS1 mRNA in rat brain by in situ
hybridization, hippocampus and cerebellum (Kovacs et al., 1996 ; Suzuki
et al., 1996 ), did not contain disproportionately high levels of PS1
protein. Thus, PS1 was found at similar levels throughout the monkey
brain, suggesting a role in general neuronal function rather than a
region- or cell type-specific activity.
Fig. 3.
PS1 in monkey brain and analysis of brain
subfractions. A, Homogenates from different regions of
monkey brain (50 µg) and COS7-PS1 (25 µg) were
blotted and probed with anti-PS1 antibody. A strong band at ~32 kDa
and a much weaker band at ~49 kDa comigrating with the
COS7-PS1 bands can be seen in all samples, but the
lower band seems to have slightly slower electrophoretic
mobility in brain samples. Comparable signal was found from all brain
regions. B, Monkey cortex homogenate was fractionated by
sucrose gradient centrifugation, and 50 µg of each subfraction was
analyzed by immunoblotting. The blot was probed with anti-PS1 antibody
( -PS1; top panel), stripped, and reprobed with
an antibody to the synaptic vesicle integral membrane protein
synaptophysin ( -SY; bottom panel). Both
synaptophysin and PS1 immunoreactivity were enriched in particulate
fractions, especially the synaptosome-enriched fraction
(P2-0.80 M) and the microsomal pellet
(P3). PS1 immunoreactivity was undetectable in the
high-speed supernatant (S3) but was present in the
washed nuclear pellet (P1). Conversely, synaptophysin
was present in S3, but was undetectable in
P1.
[View Larger Version of this Image (38K GIF file)]
To extend the localization of PS1 in brain, we followed the PS1
immunoreactivity on Western blots with subcellular fractions of monkey
cortex (Fig. 3B, top panel). The same blot
was stripped and reprobed for synaptophysin immunoreactivity (Fig.
3B, bottom panel) to allow comparison of PS1
distribution with that of a well characterized integral membrane
protein from synaptic vesicles (Wiedenmann and Franke, 1985 ). PS1 and
synaptophysin were enriched in certain particulate fractions, most
notably the synaptosome-enriched fraction (Fig. 3B, P2-0.80
M) and the high-speed microsomal pellet (Fig.
3B, P3). However, there are clear differences between PS1 and synaptophysin distribution in brain subfractions. Significant PS1
immunoreactivity persisted in the washed nuclear pellet, whereas synaptophysin immunoreactivity did not (Fig. 3B, P1).
Conversely, synaptophysin remained faintly detectable in the high-speed
supernatant (Fig. 3B, S3), whereas PS1 did not. These
results suggest a localization of PS1 to a nonsynaptic vesicle membrane
compartment that is enriched in an intermediate density P2 subfraction
and high-speed microsomal pellet (P3). Potential organelle associations
based on these results would include plasma membrane, ER, and Golgi
apparatus (Gray and Whittaker, 1962 ). However, more specific immunoblot
localization of PS1 will require comparison of its distribution
relative to other organelle-specific markers.
PS1 immunocytochemical localization in monkey brain
The distribution of PS1 was defined further by immunocytochemical
localization at the light and electron microscopic levels. Light
microscopy revealed widespread distribution of PS1 immunoreactivity in
all regions of monkey brain, including cerebral cortex, hippocampal formation, striatum, basal forebrain, thalamus, brainstem, and cerebellum (Fig. 4). Preadsorption with PS1 fusion
protein eliminated antibody staining in all regions (Fig.
4F). The low-power survey revealed a preponderance of
immunoreactivity in gray matter. At the resolution of light microscopy,
areas of neuropil appeared to be somewhat diffusely stained, with some
variations in the intensity of immunoreactivity from region to region
(Fig. 4). In the cerebral cortex, the neuropil in superficial layers
was more intensely immunoreactive than in deeper layers (Figs. 4, 5A). There has been a report of prominent axonal staining in
some brainstem areas in rodents (Elder et al., 1996 ), but no
significant accumulation of PS1 immunoreactivity was seen in any
cortical or subcortical white matter tracts in monkey brains (Fig.
4).
Fig. 4.
Regional light microscopic distribution of native
PS1 protein in monkey brain. Sections of monkey brain at various levels were stained for PS1 immunoreactivity. Labeling was seen in all sections and was concentrated in areas of gray matter. Coronal sections
are shown at the level of the caudate head (A), anterior commissure (B), anterior thalamus (C),
hippocampus and lateral geniculate (D), and the
cerebellum and pons (E). Preadsorption of the anti-PS1
monoclonal antibody with GST-PS121-80 eliminated all
staining, demonstrating the specificity of the immunocytochemical reaction (F). Cd, Caudate;
Pu, putamen; ac, anterior commissure; Am, amygdala; Th, thalamus;
GP, globus pallidus; LGN, lateral geniculate; SN, substantia nigra; Hi,
hippocampus; ERC, entorhinal cortex; Cb,
cerebellum; Pn, pontine nuclei.
[View Larger Version of this Image (90K GIF file)]
Fig. 5.
Cellular distribution of native PS1 protein in
monkey brain. A, PS1 immunoreactivity in monkey frontal
cortex is concentrated in neurons. Virtually every neuron appeared to
possess some staining for PS1, but the staining was most intense in
pyramidal neurons in layer 3 (arrowheads) and layer 5 (arrows). Scale bar, 100 µm. B,
Hippocampal CA3 pyramidal neurons (arrowheads) stained
for PS1 in the cell bodies and primary dendrites. In addition,
intensely stained interneurons at the oriens-alveus border were
seen frequently (arrows). Scale bar, 50 µm.
C, Higher magnification views of cortical pyramidal
neurons from monkey frontal cortex (arrows) revealed punctate labeling, which was concentrated in a perinuclear
distribution. In this plane of focus, punctate staining can be followed
into a slender basilar process (arrowheads). Scale bar,
20 µm. D, Similar intense and punctate staining was
seen in other cell types, including neurons in the nucleus basalis
magnocellularis (arrow). Scale bar, 20 µm.
E, Non-neuronal cells, including glia
(arrowheads) and blood vessels
(asterisk), labeled weakly for PS1. A small neuron,
slightly out of the plane of focus (arrow), demonstrates the typically more intense staining seen in neurons. Scale bar, 20 µm.
[View Larger Version of this Image (123K GIF file)]
Although there were considerable differences in the intensity of
labeling among cell populations, virtually all neurons showed some PS1
immunoreactivity. Light staining also was found in glial cells (Fig.
5E, arrowheads), and there appeared to be
weak labeling of at least some blood vessels (Fig. 5E,
asterisk). In neuronal somata, the PS1 antibody produced punctate
staining that typically was most intense around the nucleus but
extended throughout the cell body (Fig. 5). Moreover, the labeling
extended into neuronal processes, and, in some planes of sectioning,
immunoreactivity could be followed well into the lengths of both
dendrites and axons (Fig. 5C, arrowheads). Select neurons in
a number of brain regions, including pyramidal neurons in layers 3 and
5 of cerebral cortex (Fig. 5A), displayed dramatic staining
for PS1. In particular, large pyramidal neurons in the deep layers of
frontal cortex frequently stained intensely (Fig. 5A,C,
arrows). Other large neurons, including magnocellular basal
forebrain neurons (Fig. 5D) and motor neurons of brainstem
nuclei (data not shown), showed similar immunoreactivity. However,
intense PS1 immunoreactivity was not seen in all large neurons. Large
cerebellar Purkinje cells demonstrated only low levels of staining for
PS1 (data not shown); conversely, some small neurons, including
interneurons in the entorhinal cortex and hippocampus, showed strong
PS1 labeling (Fig. 5B, arrows). The pattern of PS1
immunoreactivity in monkey brain is heterogeneous, and some of the more
intensely stained neurons correspond to vulnerable populations affected
in AD (Terry et al., 1981 ; Hof et al., 1990 ). However, the regional and
cellular patterns of PS1 expression are more widespread than the
pathology in the disease.
At the ultrastructural level, PS1 immunoreactivity was found in
neuronal cell bodies, neuronal processes in the neuropil, glial cells,
and some blood vessels. In both neuronal and glial cell bodies, pockets
of PS1 labeling were seen on the cytoplasmic face of smooth membranous
profiles, which frequently clustered adjacent to the Golgi apparatus
(Figs. 6, 7A). Many of the
labeled organelles were small- to intermediate-sized vesicles or
elongated tubulovesicular profiles suggestive of SER (Fig.
6A,B). Rarely, the cis-Golgi stacks were
labeled (Fig. 6C), but the remainders of the Golgi stacks
were devoid of immunoreactivity (Figs. 6D,E, 7A). Most of the labeled membranes possessed a smooth
surface. However, our PS1 antibody also labeled some coated vesicles
that were seen near the Golgi and, occasionally, seen in continuity with Golgi membranes (Fig. 6D,E, arrows). It should
be noted that PS1-labeled vesicles were not exclusive to neurons or the
Golgi apparatus. Figure 7B shows a forming coated pit in an
endothelial cell (asterisk) with adjacent PS1-immunoreactive
vesicles (arrowheads). Within neuronal cell bodies, PS1 was
distributed to tubulovesicular profiles, smooth vesicles, coated
vesicles, and cis-Golgi stacks; other morphologically
identifiable organelles, such as the nucleus, rough ER, lysosomes, and
mitochondria, did not have detectable PS1 immunoreactivity. The pattern
of immunoreactivity in cell bodies reveals a specific association with
a population of transport vesicles and indicates a distribution in the
ER-Golgi intermediate compartment (Hauri and Schweizer, 1992 ; Rexach
et al., 1994 ; Krijnse-Locker et al., 1995 ).
Fig. 6.
Ultrastructural localization of PS1 in hippocampal
neurons. A, B, Vesicular
(arrows) and tubular (asterisk) membrane
profiles stained with diaminobenzidine reaction products often were
seen in clusters within neuronal cell bodies. Although these stained profiles were often near the Golgi apparatus, the Golgi stacks themselves were mainly devoid of immunoreactivity
(C-E). C, Occasional examples of PS1
staining of the Golgi stacks were seen on the cis-Golgi,
facing the nucleus (asterisk). D,
E, In addition, occasional labeled vesicles were found
in continuity with a Golgi stack (arrow). These
profiles, as well as some free vesicles near the Golgi, appeared to
possess a cytoplasmic coat material typical of coated transport
vesicles (C and E,
arrowheads). Nuc, Nucleus. Scale bars,
100 nm.
[View Larger Version of this Image (98K GIF file)]
Fig. 7.
Ultrastructural localization of PS1 in glia and
blood vessels in frontal cortex. A, The distribution of
PS1 immunoreactivity in glial cells was similar to that in neuronal
cell bodies. Labeling was present on vesicular profiles
(arrows), which tended to cluster near the Golgi
apparatus. As in neurons, the Golgi stacks themselves were unstained
(Go, Golgi apparatus). Scale bar, 100 nm.
B, Labeled vesicular profiles
(arrowheads) were seen adjacent to a coated pit in an
endothelial cell (asterisk). These vesicles also
appeared to possess cytoplasmic coats, but they were somewhat
indistinct because of the presence of diaminobenzidine reaction
products on the cytoplasmic membrane surfaces. Scale bar, 100 nm.
[View Larger Version of this Image (159K GIF file)]
In the neuropil, PS1 staining labeled dendritic spines and occasional
presynaptic elements (Fig. 8). As in the cell bodies, labeling was seen on the cytoplasmic surface of membranous organelles. In dendritic spines, these structures generally had the appearance of
smooth tubular membranes or vesicles (Fig. 8A,B),
which morphologically resemble a dendritic SER subcompartment that has
been described previously (Satoh et al., 1990 ; Takei et al., 1992 ).
Labeling in presynaptic elements was seen less frequently, but PS1
immunoreactivity was seen occasionally on the cytoplasmic surfaces of
some vesicles (Fig. 8C,D). The vast majority of synaptic
vesicles was unlabeled, and clusters of presynaptic vesicles at
synaptic junctions apposed to postsynaptic densities generally lacked
PS1 staining (e.g., Fig. 8A,B). It is possible that
PS1 may be present on a very small subpopulation of synaptic vesicles.
Alternatively, the labeled membranes may represent nonsynaptic vesicle
components of the presynaptic terminal, such as elements of the SER
network, which is known to extend into distal axons and terminals
(Takei et al., 1992 ; Terasaki et al., 1994 ; Krijnse-Locker et al.,
1995 ). Taken as a whole, these ultrastructural observations in monkey
brain suggest a localization of PS1 to a subcompartment of the SER in both cell bodies and processes.
Fig. 8.
Ultrastructural localization of PS1 in the
neuropil. A, B, The majority of neuropil
staining was seen in dendrites and dendritic spines. The
immunoreactivity localized to tubulovesicular profiles (asterisks), which likely represent elements of the SER
(PSD, postsynaptic density). C, D,
Labeling was seen occasionally within presynaptic elements identified
by the presence of typical synaptic vesicles. Staining is seen on
vesicular profiles (arrows), typically localized just
beneath the plasma membrane. Note that the vast majority of synaptic
vesicles was unlabeled, and the labeled vesicles did not appear to be
at sites of synaptic contacts, as indicated by the lack of postsynaptic
densities on the apposed membranes. Scale bar, 100 nm.
[View Larger Version of this Image (152K GIF file)]
DISCUSSION
Mutations in the PS1 gene cause aggressive, early-onset AD via an
unknown mechanism. A better understanding of the normal function of PS1
may provide important clues to the nature of the dysfunction(s), which
leads to the pathological changes in this disease. The present study
provides a detailed immunochemical examination of primate PS1 with a
highly sensitive monoclonal antibody specific for the human PS1
N-terminal domain. Western blots identify a 32 kDa PS1 polypeptide that
is widely expressed in brain and peripheral tissues. The
immunocytochemical results reveal labeling of neurons in all brain
regions and weaker immunoreactivity in non-neuronal cells. Our electron
microscopic immunocytochemical studies strongly suggest that PS1 is
localized to a population of transport vesicles, a subdomain of the
SER, and the ER-Golgi intermediate compartment. These findings have a
number of implications regarding the expression, processing, and
possible functions of PS1 protein.
The Western blot results raise several issues regarding PS1 processing.
The 49 kDa band observed in various expression systems almost certainly
represents the full-length PS1 protein. It approximates the calculated
size for the 467-amino-acid polypeptide (Mr of 52,664) and corresponds to the size reported in other studies (Elder et
al., 1996 ; Kovacs et al., 1996 ; Mercken et al., 1996 ; Sahara et al.,
1996 ; Thinakaran et al., 1996 ). The predominant protein in cell free
translation systems and transiently transfected COS-7 cells is the 49 kDa polypeptide, but in stably transfected PC12 cells and monkey
tissues the 32 kDa polypeptide predominates. We also have detected low
levels of an endogenous 32 kDa PS1-immunoreactive peptide in
untransfected COS-7 cells. However, our N-terminal antibody does not
recognize the rat PS1 homolog and, therefore, does not detect PS1 in
untransfected PC12 cells. Because both the 49 and 32 kDa species seen
in our expression systems derive from a full-length human PS1 cDNA, we
can exclude the possibility that the various polypeptides arise by
alternative splicing (Clark et al., 1995 ; Rogaev et al., 1995 ; Anwar et
al., 1996 ; Sahara et al., 1996 ). Recently, endoproteolytic cleavage of
PS1 resulting in regulated accumulation of N- and C-terminal
derivatives has been reported in transgenic mice (Thinakaran et al.,
1996 ). More extensive study will be necessary to better characterize
the endoproteolytic cleavage events, the distribution of full-length,
N-, and C-terminal PS1 species, and the potential functional
implications of these observations.
The detection of PS1 protein in peripheral tissues was not unexpected.
The original reports of PS1 and PS2 transcription in a variety of
tissues (Rogaev et al., 1995 ; Sherrington et al., 1995 ), have been
confirmed by subsequent Northern blot and in situ
hybridization studies (Kovacs et al., 1996 ; Sahara et al., 1996 ; Suzuki
et al., 1996 ). Although the relative level of PS1 protein does not
parallel that of the mRNA exactly, they are both widespread in
peripheral tissues. It is noteworthy that the highest levels of both
PS1 mRNA (Suzuki et al., 1996 ) and protein (Fig. 2) have been found in
testis. The only known genes with significant homology to the
presenilins are spe-4 (L'Hernault and Arduengo, 1992 ) and
sel-12 (Levitan and Greenwald, 1995 ) from
Caenorhabditis elegans. The SEL-12 protein has not yet been
characterized, but SPE-4 is known to play a role in the packaging of
major sperm protein during spermatogenesis (L'Hernault and Arduengo,
1992 ). The abundance of PS1 mRNA and protein in testis suggests the
possibility that PS1 may play an analogous role in spermatogenesis.
The precise localization of PS1 may yield important information in
discerning the function of the protein. Our examination of various
brain regions by Western blot analysis reveals no obvious differences
in PS1 abundance. Immunocytochemical analysis, however, shows clear
variability in the intensity of labeling of individual cells. Although
some of the most intensely stained cells correspond to populations
vulnerable to pathological changes in AD, including neocortical and
hippocampal pyramidal neurons and magnocellular basal forebrain neurons
(Terry et al., 1981 ; Whitehouse et al., 1981 ; Hof et al., 1990 ), PS1 is
not limited to these cell types. At the light microscopic level,
punctate immunoreactivity is most concentrated in neuronal cell bodies,
proximal dendrites, and areas of neuropil. Weaker labeling is present
in non-neuronal cells in the brain (i.e., glia and blood vessels), and
we do not detect significant axonal staining in any areas of cortical
or subcortical white matter. This pattern of immunocytochemical
staining is similar to that seen in normal human brain (Levey et al.,
1997 ).
Recently, two groups have reported immunocytochemical localization of
PS1 in rodent brains, using polyclonal antibodies raised to synthetic
peptides from the large internal loop region of PS1 (Elder et al.,
1996 ; Moussaoui et al., 1996 ). Both groups report widespread
distribution in brain regions, similar to our findings in primate
brain; however, there are some significant differences. The
immunoreactivity in rodent brains was exclusive to neurons, and no
staining was seen in glia or blood vessels. Within neurons, the pattern
of labeling reported by Moussaoui et al. (1996) was similar to ours. In
contrast, Elder et al. (1996) reported a marked concentration of PS1 in
the apical dendrites of olfactory bulb mitral cells, neocortical
pyramidal cells, hippocampal pyramidal cells, and cerebellar Purkinje
cells, with much weaker staining of cell bodies and axons in these
cells. Neurons in the brainstem and spinal cord showed more prominent
staining in the cell body and axon (Elder et al., 1996 ). The source of
these differences is not clear, but they may be attributable to the
epitope specificity of the antibodies. The endoproteolytic cleavage of
PS1 is suspected to occur between amino acid residues 260-320 in or
near the proximal loop domain (Thinakaran et al., 1996 ). This could
produce significant differences between N-terminal- and loop-specific
antibodies.
Both presenilins are highly hydrophobic molecules and have been
presumed to be integral membrane proteins. Our fractionation and
electron microscopic immunocytochemistry studies confirm this hypothesis. In previous immunofluorescence studies, PS1 and PS2 were
localized to ER and Golgi in transiently transfected neuroglioma cells
overexpressing epitope-tagged proteins (Kovacs et al., 1996 ). More
recently, PS1 overexpressed in a neuronal cell line infected with
recombinant virions was localized to SER and rough ER by confocal
microscopy (Cook et al., 1996 ). At the ultrastructural level, our
antibody localizes the N terminus of native PS1 in monkey brain to the
cytoplasmic face of membranous organelles in cell bodies and in the
neuropil. Within neuronal cell bodies much of the PS1 immunoreactivity
is found on tubulovesicular membranes, which are most likely elements
of the SER. However, the entire network of ER membranes does not appear
homogeneously stained, and rough ER does not seem to possess
significant amounts of PS1. In the Golgi apparatus, the Golgi stacks
themselves are seldom stained, but occasional staining is seen on the
presumptive cis-Golgi (facing the nucleus). This pattern of
immunoreactivity suggests that PS1 may be localized selectively in the
ER-Golgi intermediate compartment involved in intracellular protein
trafficking (Hauri and Schweizer, 1992 ; Rexach et al., 1994 ;
Krijnse-Locker et al., 1995 ). The possibility of a role for PS1 in
intracellular transport functions is supported by the identification of
PS1-immunoreactive coated vesicles. The specific molecular
identification of these coated vesicles will require additional study,
but their association with Golgi stacks suggests that they may be coat
protomer complex I coated vesicles (Aridor et al., 1995 ; Rothman and
Wieland, 1996 ; Schekman and Orci, 1996 ). These indications of a role
for PS1 in intracellular transport are even more intriguing when
considered in light of reports that mutations in the presenilins affect
the processing and secretion of A peptide (Martins et al., 1995 ; Borchelt et al., 1996 ; Duff et al., 1996 ; Scheuner et al., 1996 ). The
localization of PS1 to intracellular transport vesicles and the
ER-Golgi intermediate compartment offers a possible intersection between APP and PS1, which may be important in understanding the pathogenesis of AD.
By both light and electron microscopic immunocytochemistry, PS1
immunoreactivity extends beyond neuronal cell bodies. Labeled vesicular
profiles occasionally are found within presynaptic elements. However, a
vast majority of synaptic vesicles are not stained, and PS1 and
synaptophysin have different distributions in subcellular fractions.
These results suggest that the immunoreactivity in presynaptic
terminals does not reside on synaptic vesicles, so the identification
of PS1-positive profiles in presynaptic terminals will require
additional study. Most PS1 immunoreactivity in the neuropil is seen
within dendritic spines on smooth tubulovesicular profiles. The
morphological appearance of these organelles and their characteristic
localization in dendritic spines suggests that they are components of
the SER network (Satoh et al., 1990 ; Takei et al., 1992 ). The SER in
neurons has been characterized as an intricate communicating network
that extends from the cell body into the terminal segments of dendritic
and axonal processes (Broadwell and Cataldo, 1984 ; Terasaki et al.,
1994 ). Furthermore, a significant body of evidence suggests that these
membranes are heterogeneous and contain biochemically and functionally
distinct domains, including molecular specializations involved in
calcium regulation (Satoh et al., 1990 ; Takei et al., 1992 ). Our EM
immunocytochemical results suggest a distribution for PS1 in a
subdomain of the SER. Additional studies aimed at colocalization of PS1
and various molecular markers for SER subdomains should permit a more
precise definition of PS1 distribution and provide additional clues to its cellular function.
FOOTNOTES
Received Oct. 29, 1996; revised Jan. 9, 1997; accepted Jan. 13, 1997.
This work was supported by National Institutes of Health Grant
NS01902-01 (J.L.). We thank David Rye, Margaret Tigges, and the Yerkes
Primate Center for providing monkey tissues used in this study.
Correspondence should be addressed to James J. Lah, Department of
Neurology, Emory University School of Medicine, Woodruff Memorial
Research Building, Suite 6000, P.O. Drawer V, Atlanta, GA
30322.
REFERENCES
-
Anwar R,
Moynihan T,
Ardley H,
Brindle N,
Coletta P,
Cairns N,
Markham A,
Robinson P
(1996)
Molecular analysis of the presenilin 1 (S182) gene in "sporadic" cases of Alzheimer's disease: identification and characterization of unusual splice variants.
J Neurochem
66:1774-1777 .
[Web of Science][Medline]
-
Aridor M,
Bannykh S,
Rowe T,
Balch W
(1995)
Sequential coupling between COPII and COPI vesicle coats in endoplasmic reticulum to Golgi transport.
J Cell Biol
131:875-893 .
[Abstract/Free Full Text]
-
Borchelt DR,
Thinakaran G,
Eckman CB,
Lee MK,
Davenport F,
Ratovitsky T,
Prada C-M,
Kim G,
Seekins S,
Yager D,
Slunt HH,
Wang R,
Seeger M,
Levey AI,
Gandy SE,
Copeland NG,
Jenkins NA,
Price DL,
Younkin SG,
Sisodia SS
(1996)
Familial Alzheimer's disease-linked presenilin 1 variants elevate A
1-42/1-40 ratio in vitro and in vivo.
Neuron
17:1005-1013 .
[Web of Science][Medline]
-
Broadwell R,
Cataldo A
(1984)
The neuronal endoplasmic reticulum: its cytochemistry and contribution to the endomembrane system. II. Axons and terminals.
J Comp Neurol
230:231-248 .
[Web of Science][Medline]
-
Chartier-Harlin MC,
Crawford F,
Houlden H,
Warren A,
Hughes D,
Fidani L,
Goate A,
Rossor M,
Roques P,
Hardy J,
Mullan M
(1991)
Early-onset Alzheimer's disease caused by mutations at codon 717 of the beta-amyloid precursor protein gene.
Nature
353:844-846 .
[Medline]
-
Clark R,
Hutton M,
Fuldner F,
Froelich S,
Karran E,
Talbot C,
Crook R,
Lendon C,
Prihar GCH,
Korenblat K,
Martinez A,
Wragg M,
Busfield F,
Behrens M,
Myers A,
Norton J,
Morris J,
Mehta N,
Pearson C,
Lincoln S,
Baker M,
Duff K,
Zehr C,
Perez-Tur J,
Houlden H,
Ruiz A,
Ossa J,
Lopera F,
Arcos M,
Madrigal L,
Collinge J,
Humphreys C,
Ashworth A,
Sarner S,
Fox N,
Harvey R,
Kennedy A,
Roques P,
Cline R,
Philips C,
Venter J,
Forsell L,
Axelman K,
Lilius L,
Johnston J,
Cowburn R,
Viitanen M,
Winblad B,
Kosik K,
Haltia M,
Poyhonen M,
Dickson D,
Mann D,
Neary D,
Snowden J,
Lantos P,
Lannfelt L,
Rossor M,
Roberts G,
Adams M,
Hardy J,
Goate A
(1995)
The structure of the presenilin 1 (S182) gene and identification of six novel mutations in early onset AD families.
Nat Genet
11:219-222.
[Web of Science][Medline]
-
Cook D,
Sung J,
Golde T,
Felsenstein K,
Wojczyk B,
Tanzi R,
Trajanowski J,
Lee V-Y,
Doms R
(1996)
Expression and analysis of presenilin 1 in a human neuronal system: localization in cell bodies and dendrites.
Proc Natl Acad Sci USA
93:9223-9228 .
[Abstract/Free Full Text]
-
Duff K,
Eckman C,
Zehr C,
Yu X,
Prada C-M,
Perez-Tur J,
Hutton M,
Buee L,
Harigaya Y,
Yager D,
Morgan D,
Gordon MN,
Holcomb L,
Refolo L,
Zenk B,
Hardy J,
Younkin S
(1996)
Increased amyloid-
42(43) in brains of mice expressing mutant presenilin 1.
Nature
383:710-713 .
[Medline]
-
Elder G,
Tezapsidis N,
Carter J,
Shioi J,
Bouras C,
Li H-C,
Johnston J,
Efthimiopoulos S,
Friedrich VLJ,
Robakis N
(1996)
Identification and neuron-specific expression of the S182/presenilin I protein in human and rodent brains.
J Neurosci Res
45:308-320 .
[Web of Science][Medline]
-
Goate A,
Chartier-Harlin MC,
Mullan M,
Brown J,
Crawford F,
Fidani L,
Guiffra L,
Haynes A,
Irving N,
James L,
Mant R,
Newton P,
Rooke K,
Roques P,
Talbot C,
Paricak-Vance M,
Roses A,
Williamson R,
Rossor M,
Owen M,
Hardy J
(1991)
Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease.
Nature
349:704-706 .
[Medline]
-
Gray E,
Whittaker V
(1962)
The isolation of nerve endings from brain: an electron microscopic study of cell fragments derived by homogenization and centrifugation.
J Anat
96:79-87.
[Web of Science][Medline]
-
Hauri H,
Schweizer A
(1992)
The endoplasmic reticulum-Golgi intermediate compartment.
Curr Opin Cell Biol
4:600-608 .
[Medline]
-
Hof P,
Cox K,
Morrison J
(1990)
Quantitative analysis of a vulnerable subset of pyramidal neurons in Alzheimer's disease. I. Superior frontal and inferior temporal cortex.
J Comp Neurol
301:44-54 .
[Web of Science][Medline]
-
Kovacs D,
Fausett H,
Page K,
Kim T-W,
Moir R,
Merriam D,
Hollister R,
Hallmark O,
Mancini R,
Felsenstein K,
Hyman B,
Tanzi R,
Wasco W
(1996)
Alzheimer-associated presenilins 1 and 2: neuronal expression in brain and localization to intracellular membranes in mammalian cells.
Nat Med
2:224-229 .
[Web of Science][Medline]
-
Krijnse-Locker J,
Parton R,
Fuller S,
Griffiths G,
Dotti C
(1995)
The organization of the endoplasmic reticulum and intermediate compartment in cultured rat hippocampal neurons.
Mol Biol Cell
6:1315-1332 .
[Abstract]
-
L'Hernault S,
Arduengo P
(1992)
Mutation of a putative sperm membrane protein in Caenorhabditis elegans prevents sperm differentiation but not its associated meiotic divisions.
J Cell Biol
119:55-68.
[Abstract/Free Full Text]
-
Levey A,
Kitt C,
Simonds W,
Price D,
Brann M
(1991)
Identification and localization of muscarinic acetylcholine receptor proteins in brain with subtype-specific antibodies.
J Neurosci
11:3218-3226 .
[Abstract]
-
Levey A, Heilman C, Lah J, Nash N, Rees H, Wakai M, Mirra S, Rye D,
Nochlin D, Bird T, Mufson E (1997) Presenilin-1 protein
expression in familial and sporadic Alzheimer's disease. Ann Neurol,
in press.
-
Levitan D,
Greenwald I
(1995)
Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene.
Nature
377:351-354 .
[Medline]
-
Levy-Lahad E,
Wasco W,
Poorkaj P,
Romano D,
Oshima J,
Pettingell W,
Yu C,
Jondro P,
Schmidt S,
Wang K,
Crowley A,
Fu Y,
Guenette S,
Galas D,
Nemens E,
Wijsman E,
Bird T,
Schellenberg G,
Tanzi R
(1995)
Candidate gene for the chromosome 1 familial Alzheimer's disease locus.
Science
269:973-977 .
[Abstract/Free Full Text]
-
Martins R,
Turner B,
Carroll R,
Sweeney D,
Kim K,
Wisniewski H,
Blass J,
Gibson G,
Gandy S
(1995)
High levels of amyloid-
protein from S182 (Glu246) familial Alzheimer's cells.
NeuroReport
7:217-220 .
[Web of Science][Medline]
-
Mercken M,
Takahashi H,
Honda T,
Sato K,
Murayama M,
Nakazato Y,
Noguchi K,
Imahori K,
Takashima A
(1996)
Characterization of human presenilin 1 using N-terminal specific monoclonal antibodies: evidence that Alzheimer mutations affect proteolytic processing.
FEBS Lett
389:297-303 .
[Web of Science][Medline]
-
Moussaoui S,
Czech C,
Pradier L,
Blanchard V,
Bonici B,
Gohin M,
Imperato A,
Revah F
(1996)
Immunohistochemical analysis of presenilin-1 expression in the mouse brain.
FEBS Lett
383:219-222 .
[Web of Science][Medline]
-
Murrell J,
Farlow M,
Ghetti B,
Benson MD
(1991)
A mutation in the amyloid precursor protein associated with hereditary Alzheimer's disease.
Science
254:97-99 .
[Abstract/Free Full Text]
-
Rexach M,
Latterich M,
Schekman R
(1994)
Characteristics of endoplasmic reticulum-derived transport vesicles.
J Cell Biol
5:1133-1148.
-
Rogaev E,
Sherrington R,
Rogaeva E,
Levesque G,
Ikeda M,
Liang Y,
Chi H,
Lin C,
Holman K,
Tsuda T,
Mar L,
Sorbi S,
Nacmias B,
Placentini S,
Amaducci L,
Chumakov I,
Cohen D,
Lannfelt L,
Fraser P,
Rommens J,
George-Hyslop PS
(1995)
Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene.
Nature
376:775-778 .
[Medline]
-
Rothman J,
Wieland F
(1996)
Protein sorting by transport vesicles.
Science
272:227-234 .
[Abstract]
-
Sahara N,
Yahagi Y,
Takagi H,
Kondo T,
Okochi M,
Usami M,
Shirasawa T,
Mori H
(1996)
Identification and characterization of presenilin I-467, I-463, and I-374.
FEBS Lett
381:7-11 .
[Web of Science][Medline]
-
Satoh T,
Ross C,
Villa A,
Supattapone S,
Pozzan T,
Snyder S,
Meldolesi J
(1990)
The inositol 1,4,5,-trisphosphate receptor in cerebellar Purkinje cells: quantitative immunogold labeling reveals concentration in an ER subcompartment.
J Cell Biol
111:615-624 .
[Abstract/Free Full Text]
-
Schekman R,
Orci L
(1996)
Coat proteins and vesicle budding.
Science
271:1526-1533 .
[Abstract]
-
Scheuner D,
Eckman C,
Jensen M,
Song X,
Citron M,
Suzuki N,
Bird T,
Hardy J,
Hutton M,
Kukul W,
Larson E,
Levy-Lahad E,
Viitanen M,
Peskind E,
Poorkaj P,
Schellenberg G,
Tanzi R,
Wasco W,
Lannfelt L,
Selkoe D,
Younkin S
(1996)
Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease.
Nat Med
2:864-870 .
[Web of Science][Medline]
-
Sherrington R,
Rogaev E,
Liang Y,
Rogaeva E,
Levesque G,
Ikeda M,
Chl H,
Lin C,
Li G,
Holman K,
Tsuda T,
Mar L,
Foncin J-F,
Bruni A,
Montesi M,
Sorbi S,
Rainero I,
Pinessi L,
Nee L,
Chumakov I,
Pollen D,
Brookes A,
Sanseau P,
Pollnsky R,
Wasco W,
Silva HD,
Haines J,
Pericak-Vance M,
Tanzi R,
Roses A,
Fraser P,
Rommens J,
George-Hyslop PS
(1995)
Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease.
Nature
375:754-760 .
[Medline]
-
Smith DB,
Johnson KS
(1988)
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:31-40 .
[Web of Science][Medline]
-
Suzuki T,
Nishiyama K,
Murayama S,
Yamamoto A,
Sato S,
Kanazawa I,
Sakaki Y
(1996)
Regional and cellular presenilin 1 gene expression in human and rat tissues.
Biochem Biophys Res Commun
219:708-713 .
[Web of Science][Medline]
-
Takahashi H,
Murayama M,
Takashima A,
Mercken M,
Nakazato Y,
Noguchi K,
Imahori K
(1996)
Molecular cloning and expression of the rat homologue of presenilin-1.
Neurosci Lett
206:113-116 .
[Web of Science][Medline]
-
Takei K,
Stukenbrok H,
Metcalf A,
Mignery G,
Sudhof T,
Volpe P,
Camilli PD
(1992)
Ca2+ stores in Purkinje neurons: endoplasmic reticulum subcompartments demonstrated by the heterogeneous distribution of the InsP3 receptor, Ca2+-ATPase, and calsequestrin.
J Neurosci
12:489-505 .
[Abstract]
-
Terasaki M,
Slater N,
Fein A,
Schmidek A,
Reese T
(1994)
Continuous network of endoplasmic reticulum in cerebellar Purkinje neurons.
Proc Natl Acad Sci USA
91:7510-7514 .
[Abstract/Free Full Text]
-
Terry R,
Peck A,
DeTeresa R,
Schecter R,
Horoupian D
(1981)
Some morphometric aspects of the brain in senile dementia of the Alzheimer's type.
Ann Neurol
10:184-192 .
[Web of Science][Medline]
-
Thinakaran G,
Borchelt D,
Lee M,
Slunt H,
Spitzer L,
Kim G,
Ratovitsky T,
Davenport F,
Nordstedt C,
Seeger M,
Hardy J,
Gandy S,
Levey A,
Jenkins N,
Copeland N,
Price D,
Sisodia S
(1996)
Endoproteolysis of presenilin 1 and regulated accumulation of processed derivatives in vivo.
Neuron
17:181-190 .
[Web of Science][Medline]
-
Whitehouse PJ,
Price DL,
Clark AW,
Coyle JT,
DeLong MR
(1981)
Alzheimer disease: evidence for selective loss of cholinergic neurons in the nucleus basalis.
Ann Neurol
10:122-126 .
[Web of Science][Medline]
-
Wiedenmann B,
Franke W
(1985)
Identification and localization of synaptophysin, an integral membrane glycoprotein of Mr 38,000 characteristic of presynaptic vesicles.
Cell
41:1017-1028 .
[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
V. Dror, T. B. Kalynyak, Y. Bychkivska, M. H. Z. Frey, M. Tee, K. D. Jeffrey, V. Nguyen, D. S. Luciani, and J. D. Johnson
Glucose and Endoplasmic Reticulum Calcium Channels Regulate HIF-1{beta} via Presenilin in Pancreatic {beta}-Cells
J. Biol. Chem.,
April 11, 2008;
283(15):
9909 - 9916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, A. Zacharek, A. Li, X. Cui, C. Roberts, M. Lu, and M. Chopp
Atorvastatin Promotes Presenilin-1 Expression and Notch1 Activity and Increases Neural Progenitor Cell Proliferation After Stroke
Stroke,
January 1, 2008;
39(1):
220 - 226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zhang, A. Haapasalo, D. Y. Kim, L. A. M. Ingano, W. H. Pettingell, and D. M. Kovacs
Presenilin/{gamma}-secretase activity regulates protein clearance from the endocytic recycling compartment
FASEB J,
June 1, 2006;
20(8):
1176 - 1178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Almeida, R. H. Takahashi, and G. K. Gouras
Beta-amyloid accumulation impairs multivesicular body sorting by inhibiting the ubiquitin-proteasome system.
J. Neurosci.,
April 19, 2006;
26(16):
4277 - 4288.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wines-Samuelson and J. Shen
Presenilins in the Developing, Adult, and Aging Cerebral Cortex
Neuroscientist,
October 1, 2005;
11(5):
441 - 451.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
N. L. Chevallier, S. Soriano, D. E. Kang, E. Masliah, G. Hu, and E. H. Koo
Perturbed Neurogenesis in the Adult Hippocampus Associated with Presenilin-1 A246E Mutation
Am. J. Pathol.,
July 1, 2005;
167(1):
151 - 159.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Khvotchev and T. C. Sudhof
Proteolytic Processing of Amyloid-{beta} Precursor Protein by Secretases Does Not Require Cell Surface Transport
J. Biol. Chem.,
November 5, 2004;
279(45):
47101 - 47108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Vetrivel, H. Cheng, W. Lin, T. Sakurai, T. Li, N. Nukina, P. C. Wong, H. Xu, and G. Thinakaran
Association of {gamma}-Secretase with Lipid Rafts in Post-Golgi and Endosome Membranes
J. Biol. Chem.,
October 22, 2004;
279(43):
44945 - 44954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zou, B. Chung, T. Nguyen, S. Mentone, B. Thomson, and D. Biemesderfer
Linking Receptor-mediated Endocytosis and Cell Signaling: EVIDENCE FOR REGULATED INTRAMEMBRANE PROTEOLYSIS OF MEGALIN IN PROXIMAL TUBULE
J. Biol. Chem.,
August 13, 2004;
279(33):
34302 - 34310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Grbovic, P. M. Mathews, Y. Jiang, S. D. Schmidt, R. Dinakar, N. B. Summers-Terio, B. P. Ceresa, R. A. Nixon, and A. M. Cataldo
Rab5-stimulated Up-regulation of the Endocytic Pathway Increases Intracellular {beta}-Cleaved Amyloid Precursor Protein Carboxyl-terminal Fragment Levels and A{beta} Production
J. Biol. Chem.,
August 15, 2003;
278(33):
31261 - 31268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Pasternak, R. D. Bagshaw, M. Guiral, S. Zhang, C. A. Ackerley, B. J. Pak, J. W. Callahan, and D. J. Mahuran
Presenilin-1, Nicastrin, Amyloid Precursor Protein, and {gamma}-Secretase Activity Are Co-localized in the Lysosomal Membrane
J. Biol. Chem.,
July 11, 2003;
278(29):
26687 - 26694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Meyer, N. Strutz, L. C. Gahring, and S. W. Rogers
Glutamate Receptor Subunit 3 Is Modified by Site-specific Limited Proteolysis Including Cleavage by {gamma}-Secretase
J. Biol. Chem.,
June 20, 2003;
278(26):
23786 - 23796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Pigino, G. Morfini, A. Pelsman, M. P. Mattson, S. T. Brady, and J. Busciglio
Alzheimer's Presenilin 1 Mutations Impair Kinesin-Based Axonal Transport
J. Neurosci.,
June 1, 2003;
23(11):
4499 - 4508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Herreman, G. Van Gassen, M. Bentahir, O. Nyabi, K. Craessaerts, U. Mueller, W. Annaert, and B. De Strooper
{gamma}-Secretase activity requires the presenilin-dependent trafficking of nicastrin through the Golgi apparatus but not its complex glycosylation
J. Cell Sci.,
March 15, 2003;
116(6):
1127 - 1136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Kim, J. Y. Leem, J. J. Lah, H. H. Slunt, A. I. Levey, G. Thinakaran, and S. S. Sisodia
Multiple Effects of Aspartate Mutant Presenilin 1 on the Processing and Trafficking of Amyloid Precursor Protein
J. Biol. Chem.,
November 9, 2001;
276(46):
43343 - 43350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Tarabal, J. Caldero, J. Llado, R. W. Oppenheim, and J. E. Esquerda
Long-Lasting Aberrant Tubulovesicular Membrane Inclusions Accumulate in Developing Motoneurons after a Sublethal Excitotoxic Insult: A Possible Model for Neuronal Pathology in Neurodegenerative Disease
J. Neurosci.,
October 15, 2001;
21(20):
8072 - 8081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Selkoe
Alzheimer's Disease: Genes, Proteins, and Therapy
Physiol Rev,
April 1, 2001;
81(2):
741 - 766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Pigino, A. Pelsman, H. Mori, and J. Busciglio
Presenilin-1 Mutations Reduce Cytoskeletal Association, Deregulate Neurite Growth, and Potentiate Neuronal Dystrophy and Tau Phosphorylation
J. Neurosci.,
February 1, 2001;
21(3):
834 - 842.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Siman, A. G. Reaume, M. J. Savage, S. Trusko, Y.-G. Lin, R. W. Scott, and D. G. Flood
Presenilin-1 P264L Knock-In Mutation: Differential Effects on Abeta Production, Amyloid Deposition, and Neuronal Vulnerability
J. Neurosci.,
December 1, 2000;
20(23):
8717 - 8726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Grilli, E. Diodato, G. Lozza, R. Brusa, M. Casarini, D. Uberti, R. Rozmahel, D. Westaway, P. St George-Hyslop, M. Memo, et al.
Presenilin-1 regulates the neuronal threshold to excitotoxicity both physiologically and pathologically
PNAS,
November 7, 2000;
97(23):
12822 - 12827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tanahashi and T. Tabira
Alzheimer's disease-associated presenilin 2 interacts with DRAL, an LIM-domain protein
Hum. Mol. Genet.,
September 1, 2000;
9(15):
2281 - 2289.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xia, W. J. Ray, B. L. Ostaszewski, T. Rahmati, W. T. Kimberly, M. S. Wolfe, J. Zhang, A. M. Goate, and D. J. Selkoe
Presenilin complexes with the C-terminal fragments of amyloid precursor protein at the sites of amyloid beta -protein generation
PNAS,
August 1, 2000;
97(16):
9299 - 9304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Mattson, H. Zhu, J. Yu, and M. S. Kindy
Presenilin-1 Mutation Increases Neuronal Vulnerability to Focal Ischemia In Vivo and to Hypoxia and Glucose Deprivation in Cell Culture: Involvement of Perturbed Calcium Homeostasis
J. Neurosci.,
February 15, 2000;
20(4):
1358 - 1364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hauri, F Kappeler, H Andersson, and C Appenzeller
ERGIC-53 and traffic in the secretory pathway
J. Cell Sci.,
January 2, 2000;
113(4):
587 - 596.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Ray, M. Yao, J. Mumm, E. H. Schroeter, P. Saftig, M. Wolfe, D. J. Selkoe, R. Kopan, and A. M. Goate
Cell Surface Presenilin-1 Participates in the gamma -Secretase-like Proteolysis of Notch
J. Biol. Chem.,
December 17, 1999;
274(51):
36801 - 36807.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Haass and B. D. Strooper
The Presenilins in Alzheimer's Disease--Proteolysis Holds the Key
Science,
October 29, 1999;
286(5441):
916 - 919.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. G. Annaert, L. Levesque, K. Craessaerts, I. Dierinck, G. Snellings, D. Westaway, P. St. George-Hyslop, B. Cordell, P. Fraser, and B. De Strooper
Presenilin 1 Controls {gamma}-Secretase Processing of Amyloid Precursor Protein in Pre-Golgi Compartments of Hippocampal Neurons
J. Cell Biol.,
October 18, 1999;
147(2):
277 - 294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Imafuku, T. Masaki, M. Waragai, S. Takeuchi, M. Kawabata, S.-i. Hirai, S. Ohno, L.E. Nee, C.F. Lippa, I. Kanazawa, et al.
Presenilin 1 Suppresses the Function of C-Jun Homodimers via Interaction with Qm/Jif-1
J. Cell Biol.,
October 4, 1999;
147(1):
121 - 134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pastorcic and H. K. Das
An Upstream Element Containing an ETS Binding Site Is Crucial for Transcription of the Human Presenilin-1 Gene
J. Biol. Chem.,
August 20, 1999;
274(34):
24297 - 24307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakai, A. Yamasaki, M. Sakaguchi, K. Kosaka, K. Mihara, Y. Amaya, and S. Miura
Membrane Topology of Alzheimer's Disease-related Presenilin 1. EVIDENCE FOR THE EXISTENCE OF A MOLECULAR SPECIES WITH A SEVEN MEMBRANE-SPANNING AND ONE MEMBRANE-EMBEDDED STRUCTURE
J. Biol. Chem.,
August 13, 1999;
274(33):
23647 - 23658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Schwarzman, N. Singh, M. Tsiper, L. Gregori, A. Dranovsky, M. P. Vitek, C. G. Glabe, P. H. St. George-Hyslop, and D. Goldgaber
Endogenous presenilin 1 redistributes to the surface of lamellipodia upon adhesion of Jurkat cells to a collagen matrix
PNAS,
July 6, 1999;
96(14):
7932 - 7937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Weihl, G. D. Ghadge, S. G. Kennedy, N. Hay, R. J. Miller, and R. P. Roos
Mutant Presenilin-1 Induces Apoptosis and Downregulates Akt/PKB
J. Neurosci.,
July 1, 1999;
19(13):
5360 - 5369.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Arduengo, O. Appleberry, P Chuang, and S. L'Hernault
The presenilin protein family member SPE-4 localizes to an ER/Golgi derived organelle and is required for proper cytoplasmic partitioning during Caenorhabditis elegans spermatogenesis
J. Cell Sci.,
June 14, 1999;
111(24):
3645 - 3654.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Saura, T. Tomita, F. Davenport, C. L. Harris, T. Iwatsubo, and G. Thinakaran
Evidence That Intramolecular Associations between Presenilin Domains Are Obligatory for Endoproteolytic Processing
J. Biol. Chem.,
May 14, 1999;
274(20):
13818 - 13823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-S. Hong, L. Caromile, Y. Nomata, H. Mori, D. E. Bredesen, and E. H. Koo
Contrasting Role of Presenilin-1 and Presenilin-2 in Neuronal Differentiation In Vitro
J. Neurosci.,
January 15, 1999;
19(2):
637 - 643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Johnston, C. L. Ward, and R. R. Kopito
Aggresomes: A Cellular Response to Misfolded Proteins
J. Cell Biol.,
December 28, 1998;
143(7):
1883 - 1898.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wu, E. J. A. Hubbard, J. K. Kitajewski, and I. Greenwald
Evidence for functional and physical association between Caenorhabditis elegans SEL-10, a Cdc4p-related protein, and SEL-12 presenilin
PNAS,
December 22, 1998;
95(26):
15787 - 15791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Guo, N. Robinson, and M. P. Mattson
Secreted beta -Amyloid Precursor Protein Counteracts the Proapoptotic Action of Mutant Presenilin-1 by Activation of NF-kappa B and Stabilization of Calcium Homeostasis
J. Biol. Chem.,
May 15, 1998;
273(20):
12341 - 12351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Thinakaran, C. L. Harris, T. Ratovitski, F. Davenport, H. H. Slunt, D. L. Price, D. R. Borchelt, and S. S. Sisodia
Evidence That Levels of Presenilins (PS1 and PS2) Are Coordinately Regulated by Competition for Limiting Cellular Factors
J. Biol. Chem.,
November 7, 1997;
272(45):
28415 - 28422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ratovitski, H. H. Slunt, G. Thinakaran, D. L. Price, S. S. Sisodia, and D. R. Borchelt
Endoproteolytic Processing and Stabilization of Wild-type and Mutant Presenilin
J. Biol. Chem.,
September 26, 1997;
272(39):
24536 - 24541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mitsuda, A. D. Roses, and M. P. Vitek
Transcriptional Regulation of the Mouse Presenilin-1 Gene
J. Biol. Chem.,
September 19, 1997;
272(38):
23489 - 23497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. A. Maltese, S. Wilson, Y. Tan, S. Suomensaari, S. Sinha, R. Barbour, and L. McConlogue
Retention of the Alzheimer's Amyloid Precursor Fragment C99 in the Endoplasmic Reticulum Prevents Formation of Amyloid beta -Peptide
J. Biol. Chem.,
June 1, 2001;
276(23):
20267 - 20279.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|