WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (80)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rajora, N.
Right arrow Articles by Lipton, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rajora, N.
Right arrow Articles by Lipton, J. M.

 Previous Article  |  Next Article 

Volume 17, Number 6, Issue of March 15, 1997 pp. 2181-2186
Copyright ©1997 Society for Neuroscience

alpha -MSH Modulates Local and Circulating Tumor Necrosis Factor-alpha in Experimental Brain Inflammation

Nilum Rajora1, Giovanni Boccoli4, Dennis Burns3, Sarita Sharma1, Anna P. Catania4, and James M. Lipton1, 2

Departments of 1 Physiology, 2 Anesthesiology and Pain Management, and 3 Pathology, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75235-9040, and 4 Clinica Medica I, Ospedale Maggiore, Milan 20122, Italy

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Tumor necrosis factor (TNF-alpha ) underlies pathological processes and functional disturbances in acute and chronic neurological disease and injury. The neuroimmunomodulatory peptide alpha -MSH modulates actions and production of proinflammatory cytokines including TNF-alpha , but there is no prior evidence that it alters TNF-alpha induced within the brain. To test for this potential influence of the peptide, TNF-alpha was induced centrally by local injection of bacterial lipopolysaccharide (LPS). alpha -MSH given once i.c.v. with LPS challenge, twice daily intraperitoneally (i.p.) for 5 d between central LPS injections, or both i.p. and centrally, inhibited production of TNF-alpha within brain tissue. Inhibition of TNF-alpha protein formation by alpha -MSH was confirmed by inhibition of TNF-alpha mRNA. Plasma TNF-alpha concentration was elevated markedly after central LPS, indicative of an augmented peripheral host response induced by the CNS signal. The increase was inhibited by alpha -MSH treatments, in relation to inhibition of central TNF-alpha . Presence within normal mouse brain of mRNA for the alpha -MSH receptor MC-1 suggests that the inhibitory effects of alpha -MSH on brain and plasma TNF-alpha might be mediated by this receptor subtype. The inhibitory effect of alpha -MSH on brain TNF-alpha did not depend on circulating factors because the effect also occurred in brain tissue in vitro. This indicates that alpha -MSH can act directly on brain cells to inhibit their production of TNF-alpha . If central TNF-alpha contributes to pathology in CNS disease and injury, and promotes inflammation in the periphery, agents that act on brain alpha -MSH receptors should decrease the pathological TNF-alpha reaction and promote tissue survival.

Key words: alpha -MSH; TNF-alpha ; modulation of CNS inflammation; neurodegenerative disease; LPS; neuroimmunomodulation; anti-inflammatory; anticytokine


INTRODUCTION

With improvement in understanding of cytokine mediators of inflammation and with recent identification of these mediators in certain CNS diseases, it is likely that the importance of inflammatory cytokines and processes in all CNS injuries and disorders will eventually be recognized. Although several inflammatory cytokines likely contribute to CNS inflammation, TNF-alpha may be especially important in CNS disease. TNF-alpha has been linked to multiple sclerosis, HIV infection of the CNS, Alzheimer's disease, meningitis, and acute brain injury as a result of ischemia/reperfusion or of trauma.

TNF-alpha occurs in abundance in lesions of multiple sclerosis, which, with its capacity to promote myelin destruction and to increase adhesion molecule expression, makes it a prime suspect in etiology of the lesions (Raine, 1994). Expression of TNF-alpha mRNA predominates in perivascular inflammatory cuffs rather than in parenchymal cells, suggesting that circulating inflammatory cells that have entered the brain are the major source of the cytokine in this disease (Woodroofe and Cuzner, 1993). Experimental multiple sclerosis is improved by anti-TNF-alpha antibodies and by soluble TNF-alpha receptors (Selmaj and Raine, 1995). Direct infection of neurons by HIV is not responsible for manifestation of neurological disease. Rather, it seems that macrophages and/or microglia are affected and thereby alter the functions of neurons and glia via release of proinflammatory cytokines such as TNF-alpha (Koka et al., 1995; Tyor et al., 1995). The cytokines promote dysmyelination and inflammation, and neurological symptoms result. It seems that the HIV envelope protein gp120 is toxic to human brain cell cultures through induction of TNF-alpha and interleukin 6 (Yeung et al., 1995). It has been known for some time that portions of the HIV envelope protein induce TNF-alpha in primary brain culture (Merrill et al., 1992). Alzheimer's disease, marked by progressive intellectual failure, is characterized by formation within the brain of aggregates of beta -amyloid protein and infiltration of reactive microglia and astrocytes. Recent evidence suggests that in this disorder, microglia-induced neuronal injury stems from a synergistic effect of beta -amyloid protein and interferon-gamma in triggering production of proinflammatory and toxic TNF-alpha and nitrogen intermediates (Meda et al., 1995). TNF-alpha has been observed in CSF of patients with bacterial meningitis (Glimaker et al., 1993; Dulderian et al., 1995) and in experimental bacterial meningitis I (Kimberlin et al., 1995). There is evidence that such increases are a result of elevated production of TNF-alpha by ependymal cells of the choroid plexus (Tarlow et al., 1993). In experimental brain ischemia/reperfusion, TNF-alpha mRNA appears early and precedes infiltration of inflammatory cells into the injured zone (Feuerstein et al., 1994). It is found early in neurons, in and around ischemic tissue, and later in macrophages in infarcted tissue. The cytokine concentration is increased in the CSF of victims of traumatic head injury (Ross et al., 1994).

If TNF-alpha causes or promotes pathology in multiple CNS disorders, agents that inhibit its production should preserve neurological function. A neuroimmunomodulatory peptide, alpha -MSH, is known to inhibit the in vivo and in vitro actions and production of proinflammatory cytokines (Lipton and Catania, 1991, 1993, 1997), but no tests have been performed on the influence of the peptide on TNF-alpha production induced within the brain. The main purpose of the present investigations was to determine whether alpha -MSH inhibits central production of TNF-alpha in vivo and in vitro.


MATERIALS AND METHODS

Animals. The experiments were approved by the local Internal Review Board for Animal Research. Male BALB/c mice (Simonsen Laboratories, Gilroy CA), ~20 gm body weight, were housed at 23-25°C in groups not exceeding five animals per cage [28 cm (length) × 18 cm (width) × 13 cm (height)]. Before the experiments, the mice were acclimatized to standard lighting and temperature conditions with food and water freely available.

Influence of alpha -MSH treatments on brain TNF-alpha in vivo. alpha -MSH1-13 obtained from Sigma (St. Louis, MO) was dissolved in saline just before injection. For determinations of in vivo brain TNF-alpha protein and mRNA, and for MC-1 mRNA, brains were removed 1 hr after LPS administration. At the time of decapitation, trunk blood was collected in lightly heparinized 1.5 ml tubes. The LPS used to promote TNF-alpha production was derived from Salmonella typhosa (Difco, catalog #0901). Saline (20 µl) or LPS (5 µg) in saline was injected into the cerebral ventricles of mice anesthetized with ether using procedures described previously (Lipton et al., 1991; Lipton and Catania, 1993). alpha -MSH (10 µg) for i.c.v. injection was likewise dissolved in 0.1 µl saline. Intraperitoneal injections of alpha -MSH (50 µg) or saline vehicle were 0.1 ml in volume.

Influence of alpha -MSH on TNF-alpha production by brain tissue in vitro. Brains were dissected intact, immediately sectioned midsagittally, and the halves were weighed and placed in 1 ml medium (DMEM with 10% FBS, 2 mM L-glutamine, 200 U/ml penicillin, and 200 µg/ml streptomycin) in individual wells of a 24-well plate. Each sample was minced with a scalpel blade and washed with medium. After 15 min at room temperature, the washing was repeated. LPS (2.5 µg), LPS + alpha -MSH, or medium control was added to wells containing 500 µl of DMEM, and incubation at 37°C was continued for 1 hr. Ten microliters of supernatant from each well were assayed for TNF-alpha concentration.

TNF-alpha determinations. Concentrations of TNF-alpha in brain and plasma were determined with an L929 cell cytotoxicity assay, with human TNF-alpha used as control and for production of standard curves. The triplicate samples were incubated overnight with L929 cells in medium containing 100 µg/ml cyclohexamide (Sigma) in 96-well plates. The TNF-alpha concentrations were determined with reference to intensity at 550 nm in an ELISA plate reader (BT 2000, Fisher-Biotech). Each plate contained standards.

Northern analysis for TNF-alpha mRNA. RNA was isolated by homogenization in guanidinium thiocyanate followed by phenol/chloroform extraction. Total RNA (15 µg) was fractionated on a formaldehyde-denaturing agarose gel and transferred overnight to a nylon membrane that was subsequently baked at 80°C for 1 hr. The membrane was prehybridized for 6 hr at 42°C with a solution containing 2× Denhardt's reagent, 100 µg/ml salmon sperm DNA, 40% formamide, 4× SSC, 7 µM Tris, pH 7.4, and 3% SDS. cDNA probe was radiolabeled with [32P]dCTP (3000 Ci/mmol; DuPont NEN) by random primer labeling (Prime-a-Gene Labeling System, Promega). The blot was hybridized overnight with 1-2 × 106 cpm/ml probe for mouse TNF-alpha at 42°C in the same solution. Blots were then washed three times in 2× SSC and 0.1% SDS at room temperature for 15 min, and then two more times for 30 min at high stringency (0.1× SSC, 0.1% SDS, 68°C). The blot was then exposed to X-ray film with 2 intensifying screens at -70°C for 2-3 d. Ethidium bromide was used to evaluate equivalence of RNA loading.

Determination of melanocortin 1 receptor mRNA. Total RNA (200 µg) was isolated from normal mouse brain by guanidinium thiocyanate, phenol, chloroform extraction and used to generate cDNA. Genomic DNA was digested with DNase in reverse transcriptase (RT) buffer for 30 min at 37°C. The DNase was inactivated by phenol-chloroform extraction. cDNA was produced using Moloney murine leukemia virus RT (BRL, Gaithersburg, MD). In some tubes, the RT was omitted to control for amplification from contaminating cDNA or genomic DNA. Portions of the cDNA were used for PCR with primer pairs specific for the murine MC-1 isoform (529 bp). The forward primer was (5' to 3') GTGAGTCTGGTGGAGAATGTGC and the reverse primer was TTTTGTGGAGCTGGGCAATGCC. The primers were chosen in regions of low similarity among known MC receptors. PCR mixtures contained: 1 µM primers, 1.5-2.5 mM MG2+, 200 µM dNTP, 1× reaction buffer, 1 U of Taq DNA polymerase, and 5 µl cDNA in 20 µl. The PCR profile consisted of 35 cycles of 94°C for 45 sec, 60°C for 45 sec, and 72°C for 75 sec, followed by a 5 min final extension at 72°C. The PCR products were size fractionated by agarose gel electrophoresis, transferred to nylon membrane, and hybridized with a 32P end-labeled internal oligo probe specific for the MC-1 receptor (5' to 3') CAGCATCGTCTCCAGCACCCTC.

Statistical analysis. Data were analyzed using one-way ANOVA procedures, followed by Dunnet's test for multiple comparisons of group means.


RESULTS

Brain TNF-alpha protein and mRNA

Concentrations of TNF-alpha protein in control brains harvested after i.c.v. administration of LPS were markedly increased (Fig. 1), whereas in experiments on brains of normal untreated mice, TNF-alpha was low or undetectable (data not shown). All of the alpha -MSH treatments inhibited TNF-alpha protein production within the brain. A single central injection of the peptide greatly reduced TNF-alpha concentration, a similar inhibition was observed in animals given alpha -MSH intraperitoneally (i.p.) twice daily for 5 d (final alpha -MSH injection ~16 hr before the second LPS injection), and the greatest inhibition occurred in mice given alpha -MSH systemically for 5 days as well as centrally at the time of LPS injection, 1 hr before brains were removed. These results indicate that a single dose of centrally injected peptide acts rapidly to inhibit local TNF-alpha production. Further, this single injection is as effective as repeated systemic injections of alpha -MSH. Given the positive effects of central and systemic alpha -MSH injections, it is not surprising that the greatest inhibition occurred in mice given alpha -MSH by both routes. The inhibitory influence of alpha -MSH on central TNF-alpha was confirmed by Northern analysis of TNF-alpha mRNA abundance (Fig. 2).
Fig. 1. alpha -MSH given centrally (10 µg) and/or systemically (50 µg, repeated) inhibited TNF-alpha induction within the brain by local injection of LPS (5 µg). Scores are means ± SEM. After ANOVA revealed significant differences among means (p < 0.001), Dunnett's test was used for comparisons of individual means. **p < 0.01, relative to saline (i.c.v.) + saline (i.p.); +p < 0.01 versus other means.
[View Larger Version of this Image (12K GIF file)]


Fig. 2. Representative Northern blot of TNF-alpha mRNA abundance in whole mouse brains. Representative examples from two mice given LPS alone (SALINE IP, ICV) and two others from the group (alpha -MSH IP, ICV) that showed the greatest inhibitory effect of alpha -MSH on TNF-alpha protein. The blot was hybridized with 32P-labeled cDNA probe for mouse TNF-alpha . Ethidium bromide staining of agarose gel demonstrated equal loading of samples. This is representative of two experiments.
[View Larger Version of this Image (28K GIF file)]

Plasma TNF-alpha

Central administration of LPS markedly increased circulating TNF-alpha in animals that did not receive alpha -MSH treatment (Fig. 3). These results indicate that a very small amount of LPS acting within the brain can greatly increase circulating TNF-alpha . The circulating concentrations of TNF-alpha after central administration of LPS were five- to sixfold greater than those induced in the brain. Plasma of normal untreated mice had no significant concentrations of TNF-alpha . Much as for brain TNF-alpha , plasma TNF-alpha concentration was reduced by a single injection of alpha -MSH into the brain, by repeated systemic injections of the peptide, and by combined central and peripheral injections of alpha -MSH. The marked inhibitory effects of combined central and systemic alpha -MSH injections suggest that activity of alpha -MSH receptors in the brain and in the periphery alter systemic TNF-alpha induced by LPS acting centrally. It is notable that the inhibition of plasma TNF-alpha paralleled the inhibition of brain TNF-alpha induced by central alpha -MSH.
Fig. 3. alpha -MSH given centrally and/or peripherally inhibited increases in circulating TNF-alpha induced by central injection of LPS. Overall, ANOVA was significant (p < 0.001). Dunnett's test: **p < 0.01 relative to saline (i.c.v.) + saline (i.p.); +p < 0.05 relative to saline (i.c.v.) + alpha -MSH (i.p.) p < 0.01 relative to alpha -MSH (i.c.v.) + saline (i.p.).
[View Larger Version of this Image (14K GIF file)]

Evidence of MC-1 receptor expression in the brain

To test the idea that the primary alpha -MSH receptor MC-1, recently found in murine macrophages and in human macrophages and neutrophils (Star et al., 1995; Rajora et al., 1996; Catania et al., 1996), likewise occurs in brain tissue, normal mouse brain was subjected to RT-PCR and Southern analysis. This analysis revealed a substantial signal at 529 bp, consistent with the size of the cDNA for the murine MC-1 receptor (Fig. 4). Control analysis of other murine tissues (e.g., lung), and of cells of the L929 fibroblast line used for TNF-alpha determinations, did not show any evidence of MC-1 expression.
Fig. 4. Representative Southern blot of RT-PCR product for murine MC-1 receptor in normal mouse brain. No bands were observed in lanes containing reaction mixture without tissue (not shown) or without RT (-RT). Lanes containing mouse genomic DNA (1 µg) or MC-1 cDNA also contained the 529 bp product. Approximately 10 µg of cDNA (20 µl) was used in this experiment. Exposure time was 30 min. Washes (all room temperature): first washes = 3 for 5 min, 2× SSC + 0.1% SDS; second washes = 2 for 30 min, 2× SSC + 0.1% SDS.
[View Larger Version of this Image (23K GIF file)]

Effect of alpha -MSH on TNF-alpha production by brain tissue in vitro

If, as the results above suggest, alpha -MSH acts centrally to inhibit TNF-alpha production, the peptide may reduce production of the cytokine by brain cells per se, without the influence of factors in the blood supply in the live animal. To test this idea, brain samples were incubated with LPS (2.5 µg), and with LPS + concentrations of alpha -MSH for 1 hr, and samples of medium were analyzed for TNF-alpha . Marked increases in TNF-alpha were induced by LPS in control tissue. alpha -MSH inhibited TNF-alpha production in a dose-related fashion (Fig. 5), which indicates a direct effect of the peptide on brain cells that produce the cytokine. These results demonstrate that no secondary influence of alpha -MSH via circulating mediators is necessary for the inhibition.
Fig. 5. Dose-related inhibition by alpha -MSH of TNF-alpha protein production by tissue derived from half murine brains incubated with LPS for 1 hr. Control value was the mean TNF-alpha production (60.1 ± 12.7 U/gm) for all of the opposite hemibrains incubated with LPS but without alpha -MSH. Scores are means ± SEM of percent inhibition of TNF-alpha production relative to control derived from three separate experiments.
[View Larger Version of this Image (12K GIF file)]

Brain TNF-alpha mRNA after a single injection of LPS

In view of reports of CNS tolerance to central LPS administration (Faggioni et al., 1995), the effect of single LPS (5 µg) injections into the brain was tested in otherwise untreated mice. These injections resulted in the greatest abundance of brain TNF-alpha mRNA observed in this study (Fig. 6). This result indicates that the greatest effect of LPS on TNF-alpha expression within the brain occurs after the first injection and, with evidence of lesser abundance after a second injection made 5 d later, supports the idea of CNS tolerance to LPS treatment.
Fig. 6. Representative Northern blot showing that single acute i.c.v. injections of LPS (1) had greater effects on brain TNF-alpha mRNA abundance than injections that were preceded 5 d earlier by a similar i.c.v. injection (2). Ethidium bromide staining of agarose gel demonstrated equal loading of samples. Representative of two experiments: 2 d exposure, -70°C, two intensifying screens.
[View Larger Version of this Image (31K GIF file)]


DISCUSSION

TNF-alpha within the brain

alpha -MSH acts locally within the brain to inhibit production of TNF-alpha both in vivo and in vitro. Central injection of alpha -MSH inhibited TNF-alpha production, and expression of TNF-alpha mRNA, in live mice within 1 hr after local injection of LPS. This result was confirmed in vitro by marked inhibition by alpha -MSH of TNF-alpha production by brain tissue. These converging observations indicate that the neuropeptide alpha -MSH modulates brain TNF-alpha concentration via actions directly within the parenchyma. The cell source of this rapid increase in TNF-alpha was not determined; however, it is clear that astrocytes (for example, see Kimberlin et al., 1995) as well as microglia (for example, see Meda et al., 1995) and ependymal cells (for example, see Tarlow et al., 1993) can produce the cytokine.

Systemically administered alpha -MSH inhibits brain TNF-alpha  production

Repeated i.p. injections of alpha -MSH likewise inhibited the increase in brain TNF-alpha caused by central injection of LPS, and the combination of central and systemic alpha -MSH injections had the greatest inhibitory effect. This observation suggests that repeated systemic administration of alpha -MSH alters the reactivity of brain cells to LPS stimulation, although the mechanisms underlying this alteration are unknown. It is notable that the greatest inhibitory effect on TNF-alpha production was caused by repeated administration of alpha -MSH and of acute central administration of the peptide. It may be that the latter effect results from a combination of influences induced by centrally injected alpha -MSH acting within the brain, and systemically injected alpha -MSH acting on peripheral host cells and on brain melanocortin receptors. There is direct evidence that alpha -MSH administered systemically reaches the brain (Wilson, 1988), albeit in small amounts. Further, systemically administered alpha -MSH reduces fever in minutes, an antipyretic effect that can occur only through an action of the peptide within the CNS. This observation is very important for potential clinical use of alpha -MSH to control TNF-alpha production in animals or humans in whom local brain injections are unsafe or impractical. One of the main questions is whether alpha -MSH could be administered before neurosurgical procedures and thereby modulate local inflammatory responses to surgery or contamination. In keeping with this idea, in recent research on basilar artery ischemia/reperfusion in dogs (Huh et al., 1997), disturbance of the brainstem auditory evoked potential was less in animals given alpha -MSH IV, particularly when it was administered during ischemia.

Central LPS markedly increases circulating TNF-alpha

It is remarkable that a small amount of LPS injected into the brain promotes not only local TNF-alpha production but circulating TNF-alpha even moreso. This observation, noted previously (Faggioni et al., 1995), has far-reaching implications. In brief, it may be that the induction of central TNF-alpha , or a more direct action of LPS within the brain, causes marked increases in production of TNF-alpha within the circulation, presumably by monocytes. Because the concentrations of TNF-alpha induced within the brain are substantially less than those induced in the circulation, it is unlikely that the circulating TNF-alpha originates from the brain. The nature of the signals from brain to the periphery are not clear. TNF-alpha -producing cells in the brain may invoke neural and/or humoral signals. Nor is the physiological significance of the phenomenon known, although it may be that sensing of central TNF-alpha promotes circulating TNF-alpha to counteract challenges to the host. Such an increase in circulating TNF-alpha after central LPS may explain the increase in peripheral inflammation after central injection of "endogenous pyrogen" (EP, Dulaney et al., 1992). In those experiments, central administration of undiluted EP significantly increased peripheral inflammation in the mouse; dilutions of EP had lesser or no effects. A proinflammatory influence of central TNF-alpha could be detrimental in organisms with preexisting inflammatory disease in the periphery; for example, central TNF-alpha might promote peripheral inflammation in rheumatoid arthritis or inflammatory bowel disease by inducing high concentrations of the cytokine in the bloodstream.

Central alpha -MSH modulates the increase in circulating TNF-alpha induced by LPS acting solely within the brain

Whatever the basis of the increase in circulating TNF-alpha , injection of alpha -MSH into the brain reduced it. The dose of alpha -MSH that inhibited circulating TNF-alpha effectively reduced peripheral inflammation after central injection in earlier experiments (Lipton et al., 1991; Ceriani et al., 1994; Macaluso et al., 1994). If circulating TNF-alpha contributes to the inflammatory response in the periphery, central alpha -MSH likely inhibits this inflammation in some part by modulating circulating TNF-alpha . It is clear that descending neurogenic anti-inflammatory pathways in the spinal cord are necessary for the anti-inflammatory actions of central alpha -MSH (Macaluso et al., 1994). It may be that these pathways are the means through which central alpha -MSH modulates production of TNF-alpha by peripheral host cells, although it is likely that modulation of release of peripheral substance P and calcitonin gene-related peptide is also responsible.

Effects of systemic alpha -MSH

The results indicate that systemically administered alpha -MSH inhibits circulating TNF-alpha concentration. There are three potential mechanisms: (1) a direct inhibitory action on TNF-alpha producing cells (e.g., monocytes) in the circulation, (2) an effect of the alpha -MSH that penetrates to the brain on central descending anti-inflammatory pathways, or (3) some combination of these two. That alpha -MSH inhibits release of proinflammatory mediators from monocytic cells is clear; we have noted (Lipton et al., 1997) that TNF-alpha production by human peripheral blood mononuclear cells is inhibited by alpha -MSH, which indicates that a direct effect of the peptide on melanocortin receptors on monocytes is possible. As stated above, alpha -MSH injected systemically is known to reach the brain and may, therefore, inhibit TNF-alpha production in the circulation via unknown pathways. Finally, it is clear that alpha -MSH can alter inflammatory processes by acting directly on host cells in the periphery and by acting within the brain. Because systemic alpha -MSH is available at both sites, it is reasonable to assume that the peptide acts at both these sites.

Evidence for MC-1 receptors within the brain

The inhibitory effects of alpha -MSH on TNF-alpha production by brain tissue in vivo and in vitro indicates that receptors for the peptide reside within the brain. Indeed, there is prior evidence for three melanocortin receptor subtypes in brain: MC-3, MC-4, and MC-5 (Hol et al., 1995). Further, our RT-PCR evidence supports observations made in in situ hybridization and immunohistochemistry experiments (Xia et al., 1995) that the MC-1 receptor is likewise expressed in brain tissue. MC-1 may therefore contribute to the anti-TNF-alpha activity of the peptide. It is not yet possible to determine the precise contribution of the melanocortin receptor subtypes to inhibition of TNF-alpha production; all four subtypes found within the brain respond to alpha -MSH and may therefore contribute to its anti-inflammatory effect. However, it should be possible to test the relative contributions of the receptor subtypes to modulation of TNF-alpha production in whole brain by incubating brain tissue with antibodies to them.

In summary, the results extend to the CNS the observations of the anti-inflammatory effects of the neuropeptide alpha -MSH. Inflammation in peripheral tissues is modulated by alpha -MSH acting on its receptors on neutrophils and macrophages and those within the brain. The rapid anti-TNF-alpha effects of alpha -MSH within brain tissue per se likely occur via direct actions of the peptide on local brain cells (astrocytes and microglia) that produce TNF-alpha . Modulation of circulating TNF-alpha via alpha -MSH-induced inhibition of central cytokine signals provides a new avenue for control of peripheral inflammatory reactions, via actions on melanocortin receptors within the brain.


FOOTNOTES

Received Oct. 7, 1996; revised Dec. 23, 1996; accepted Dec. 31, 1996.

  

This research was supported by National Institutes of Health Grant NS10046 from the National Institute of Neurological Diseases and Stroke, a Comitato Nazionale delle Richerche Grant, VIII Progetto AIDS, Istituto Superiore di Sanita, Italy, Grant PP0406 from the National Multiple Sclerosis Society, and NATO Collaborative Research Grant CGR 950556.

Correspondence should be addressed to Dr. J. M. Lipton, University of Texas Southwestern Medical Center, Dallas TX 75235-9040.



REFERENCES

  • Catania A, Rajora N, Capsoni F, Minonzio F, Star RA, Lipton JM (1996) The neuropeptide alpha -MSH has specific receptors on neutrophils and reduces chemotaxis in vitro. Peptides 17:675-679 . [Web of Science][Medline]
  • Ceriani G, Macaluso A, Catania A, Lipton JM (1994) Central neurogenic antiinflammatory action of alpha -MSH: modulation of peripheral inflammation induced by cytokines and other mediators of inflammation. Neuroendocrinology 59:138-143 . [Web of Science][Medline]
  • Dulaney R, Macaluso A, Woerner J, Hiltz ME, Catania A, Lipton JM (1992) Changes in periperal inflammation induced by the central actions of an alpha -MSH analog and of endogenous pyrogen. Prog Neuroendocrin Immunol 5:179-186.
  • Dulderian SJ, Kilpatrick L, Costarino Jr AT, McCawley L, Fein J, Corcoran L, Zirin S, Harris MC (1995) Cytokine elevations in infants with bacterial and aseptic meningitis. J Pediatr 125:872-876.
  • Faggioni R, Fantuzzi G, Villa P, Buurman W, van Tits LJH, Ghezzi P (1995) Independent down-regulation of central and peripheral tumor necrosis factor production as a result of lipopolysaccharide tolerance in mice. Infect Immunol 63:1473-1477 . [Abstract]
  • Feuerstein GZ, Liu T, Barone FC (1994) Cytokines, inflammation, and brain injury: role of tumor necrosis factor. Cerebrovasc Brain Metab Rev 6:341-360 . [Web of Science][Medline]
  • Glimaker M, Kragsbjerg P, Forsgren M, Olcen P (1993) Tumor necrosis factor alpha  (TNFalpha ) in cerebrospinal fluid from patients with meningitis of different etiologies: high levels of TNFalpha indicate bacterial meningitis. J Infect Dis 167:882-889 . [Web of Science][Medline]
  • Hol EM, Gispen WH, Bar PR (1995) ACTH-related peptdes: receptors and signal transduction systems involved in their neurotropic and neuroprotective actions. Peptides 16:979-993 . [Web of Science][Medline]
  • Huh S-K, Lipton JM, Batjer HHI (1997) The protective effects of alpha -melanocyte stimulating hormone on canine brainstem ischemia. J Neurosurg 40:132-139.
  • Kimberlin DW, Velasco S, Paris MM, Hickey SM, McCracken Jr GH, Nisen PD (1995) Modulation of expression of genes involved in the inflammatory response by lipopolysaccharide and temperature in cultured human astroglial cells. Immunol Invest 24:775-785 . [Web of Science][Medline]
  • Koka P, He K, Camerini D, Tran T, Yashar SS, Merrill JE (1995) The mapping of HIV-1 gp160 epitopes required for interleukin-1 and tumor necrosis factor production in glial cells. J Neuroimmunol 57:179-191 . [Web of Science][Medline]
  • Lipton JM, Catania A (1993) Pyrogenic and inflammatory actions of cytokines and their modulation by neuropeptides: techniques and interpretations. In: Neurobiology of cytokines, part B (DeSouza EB, ed), pp 61-79. Orlando, FL: Academic.
  • Lipton JM, Catania AP (1997) Antiinflammatory actions of the neuroimmunomodulator alpha -MSH. Immunol Today, in press.
  • Lipton JM, Macaluso A, Hiltz ME, Catania A (1991) Central administration of the peptide alpha -MSH inhibits inflammation in the skin. Peptides 12:795-798 . [Web of Science][Medline]
  • Lipton JM, Catania A, Rajora N, Ceriani G, Star RA, Boccoli G (1997) Modulation of inflammatory effects of cytokines by the neuropeptide alpha -MSH. In: Proinflammatory and antiinflammatory peptides. Lung biology in health and disease. New York: Dekkerin press.
  • Macaluso A, McCoy D, Ceriani G, Watanabe T, Biltz J, Catania A, Lipton JM (1994) Antiinflammatory influences of alpha -MSH molecules: central neurogenic and peripheral actions. J Neurosci 14:2377-2382 . [Abstract]
  • Meda L, Cassatella MA, Szendrei GI, Otvos Jr L, Baron P, Villalba M, Ferrari D, Rossi F (1995) Activation of microglial cells by beta -amyloid protein and interferon gamma . Nature 374:647-650 . [Medline]
  • Merrill JE, Koyanagi Y, Zack J, Thomas L, Martin F, Chen IS (1992) Induction of interleukin-1 and tumor necrosis factor alpha  in brain cultures by human immunodeficiency virus type I. J Virol 66:2217-2225 . [Abstract/Free Full Text]
  • Raine CS (1994) The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann Neurol 36:561-572.
  • Rajora N, Ceriani G, Catania A, Star RA, Murphy MT, Lipton JM (1996) alpha -MSH production, receptors, and influence on neopterin, in a human monocyte/macrophage cell line. J Leukocyte Biol 59:248-253 . [Abstract]
  • Ross SA, Halliday MI, Campbell GC, Byrnes DP, Rowlands BJ (1994) The presence of tumour necrosis factor in CSF and plasma after severe head injury. Br J Neurosurg 8:419-425 . [Web of Science][Medline]
  • Selmaj KW, Raine CS (1995) Experimental autoimmune encephalomyelitis: immunotherapy with anti-tumor necrosis factor antibodies and soluble tumor necrosis factor receptors. Neurology 45:S44-S49 . [Abstract]
  • Star RA, Rajora N, Huang J, Chavez R, Catania A, Lipton JM (1995) Evidence of autocrine modulation of macrophage nitric oxide synthase by alpha -MSH. Proc Natl Acad Sci USA 92:8016-8020 . [Abstract/Free Full Text]
  • Tarlow MJ, Jenkins R, Comis SD, Osborne MP, Stephens S, Stanley P, Crocker J (1993) Ependymal cells of the choroid plexus express tumor necrosis factor alpha . Neuropathol Appl Neurobiol 19:324-328 . [Web of Science][Medline]
  • Tyor WR, Wesselingh SL, Griffin JW, McArthur JC, Griffin DE (1995) Unifying hypothesis for the pathogenesis of HIV-associated dementia complex, vacuolar myelopathy, and sensory neuropathology. J Acquir Immune Defic Syndr Hum Retrovirol 9:379-388 . [Web of Science][Medline]
  • Wilson JF (1988) Low permeability of the blood-brain barier to nanomolar concentrations of immunoreactive alpha -melanotropin. Psychopharmacology 96:262-266 . [Medline]
  • Woodroofe MN, Cuzner ML (1993) Cytokine expression in inflammatory multiple sclerosis lesions: detection by non-radioactive in situ hybridization. Cytokine 5:583-588 . [Web of Science][Medline]
  • Xia Y, Wikberg JE, Chhajlani V (1995) Expression of melanocortin 1 receptor in periacqueductal gray matter. NeuroReport 6:2193-2196 . [Web of Science][Medline]
  • Yeung MC, Pulliam L, Lau AS (1995) The HIV envelope protein gp120 is toxic to human brain-cell cultures through the induction of interleukin-6 and tumor necrosis factor alpha . AIDS 9:137-143 . [Web of Science][Medline]

Copyright ©1997 Society for Neuroscience   0270-6474/1997/172181-06$05.00/0



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
T. Brzoska, T. A. Luger, C. Maaser, C. Abels, and M. Bohm
{alpha}-Melanocyte-Stimulating Hormone and Related Tripeptides: Biochemistry, Antiinflammatory and Protective Effects in Vitro and in Vivo, and Future Perspectives for the Treatment of Immune-Mediated Inflammatory Diseases
Endocr. Rev., August 1, 2008; 29(5): 581 - 602.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Catania
The melanocortin system in leukocyte biology
J. Leukoc. Biol., February 1, 2007; 81(2): 383 - 392.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Giuliani, C. Mioni, D. Altavilla, S. Leone, C. Bazzani, L. Minutoli, A. Bitto, M.-M. Cainazzo, H. Marini, D. Zaffe, et al.
Both Early and Delayed Treatment with Melanocortin 4 Receptor-Stimulating Melanocortins Produces Neuroprotection in Cerebral Ischemia
Endocrinology, March 1, 2006; 147(3): 1126 - 1135.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
A. Catania, S. Gatti, G. Colombo, and J. M. Lipton
Targeting Melanocortin Receptors as a Novel Strategy to Control Inflammation
Pharmacol. Rev., March 1, 2004; 56(1): 1 - 29.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. Shiratori, K. Ohgami, I. B. Ilieva, Y. Koyama, K. Yoshida, and S. Ohno
Inhibition of Endotoxin-Induced Uveitis and Potentiation of Cyclooxygenase-2 Protein Expression by {alpha}-Melanocyte-Stimulating Hormone
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 159 - 164.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-W. Yoon, S.-H. Goh, J.-S. Chun, E.-W. Cho, M.-K. Lee, K.-L. Kim, J.-J. Kim, C.-J. Kim, and H. Poo
{alpha}-Melanocyte-stimulating Hormone Inhibits Lipopolysaccharide-induced Tumor Necrosis Factor-{alpha} Production in Leukocytes by Modulating Protein Kinase A, p38 Kinase, and Nuclear Factor {kappa}B Signaling Pathways
J. Biol. Chem., August 29, 2003; 278(35): 32914 - 32920.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. E. Scholzen, C. Sunderkotter, D.-H. Kalden, T. Brzoska, M. Fastrich, T. Fisbeck, C. A. Armstrong, J. C. Ansel, and T. A. Luger
{alpha}-Melanocyte Stimulating Hormone Prevents Lipopolysaccharide-Induced Vasculitis by Down-Regulating Endothelial Cell Adhesion Molecule Expression
Endocrinology, January 1, 2003; 144(1): 360 - 370.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-M. Deng, Z.-Q. Liu, and A. Tarkowski
Intracisternally Localized Bacterial DNA Containing CpG Motifs Induces Meningitis
J. Immunol., October 15, 2001; 167(8): 4616 - 4626.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. E. Wisse, R. S. Frayo, M. W. Schwartz, and D. E. Cummings
Reversal of Cancer Anorexia by Blockade of Central Melanocortin Receptors in Rats
Endocrinology, August 1, 2001; 142(8): 3292 - 3301.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Kiriyama, H. Tsuchiya, T. Murakami, K. Satoh, and Y. Tokumitsu
Calcitonin Induces IL-6 Production via Both PKA and PKC Pathways in the Pituitary Folliculo-Stellate Cell Line
Endocrinology, August 1, 2001; 142(8): 3563 - 3569.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Katsuki, Y. Sumida, E. C. Gabazza, S. Murashima, T. Tanaka, M. Furuta, R. Araki-Sasaki, Y. Hori, K. Nakatani, Y. Yano, et al.
Plasma Levels of Agouti-Related Protein Are Increased in Obese Men
J. Clin. Endocrinol. Metab., May 1, 2001; 86(5): 1921 - 1924.
[Abstract] [Full Text]


Home page
PhysiologyHome page
J. M. Lipton, A. Catania, and T. Ichiyama
Marshaling the Anti-Inflammatory Influence of the Neuroimmunomodulator {alpha}-MSH
Physiology, August 1, 2000; 15(4): 192 - 195.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Haycock, S. J. Rowe, S. Cartledge, A. Wyatt, G. Ghanem, R. Morandini, I. G. Rennie, and S. MacNeil
alpha -Melanocyte-stimulating Hormone Reduces Impact of Proinflammatory Cytokine and Peroxide-generated Oxidative Stress on Keratinocyte and Melanoma Cell Lines
J. Biol. Chem., May 19, 2000; 275(21): 15629 - 15636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Taherzadeh, S. Sharma, V. Chhajlani, I. Gantz, N. Rajora, M. T. Demitri, L. Kelly, H. Zhao, T. Ichiyama, A. Catania, et al.
alpha -MSH and its receptors in regulation of tumor necrosis factor-alpha production by human monocyte/macrophages
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 1999; 276(5): R1289 - R1294.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Q.-H. Huang, V. J. Hruby, and J. B. Tatro
Role of central melanocortins in endotoxin-induced anorexia
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 1999; 276(3): R864 - R871.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (80)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rajora, N.
Right arrow Articles by Lipton, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rajora, N.
Right arrow Articles by Lipton, J. M.

-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-