 |
 Previous Article | Next Article 
Volume 17, Number 6,
Issue of March 15, 1997
pp. 2181-2186
Copyright ©1997 Society for Neuroscience
 -MSH Modulates Local and Circulating Tumor Necrosis Factor-
in Experimental Brain Inflammation
Nilum Rajora1,
Giovanni Boccoli4,
Dennis Burns3,
Sarita Sharma1,
Anna P. Catania4, and
James M. Lipton1, 2
Departments of 1 Physiology,
2 Anesthesiology and Pain Management, and
3 Pathology, University of Texas Southwestern Medical
Center at Dallas, Dallas, Texas 75235-9040, and 4 Clinica
Medica I, Ospedale Maggiore, Milan 20122, Italy
 ABSTRACT
- INTRODUCTION
- MATERIALS AND METHODS
- RESULTS
- DISCUSSION
- FOOTNOTES
- REFERENCES
ABSTRACT 
Tumor necrosis factor (TNF- ) underlies pathological processes
and functional disturbances in acute and chronic neurological disease and injury. The neuroimmunomodulatory peptide -MSH modulates actions and production of proinflammatory cytokines including TNF-,
but there is no prior evidence that it alters TNF- induced within
the brain. To test for this potential influence of the peptide, TNF-
was induced centrally by local injection of bacterial lipopolysaccharide (LPS). -MSH given once i.c.v. with LPS challenge, twice daily intraperitoneally (i.p.) for 5 d between central LPS injections, or both i.p. and centrally, inhibited production of TNF-
within brain tissue. Inhibition of TNF- protein formation by -MSH
was confirmed by inhibition of TNF- mRNA. Plasma TNF- concentration was elevated markedly after central LPS, indicative of an
augmented peripheral host response induced by the CNS signal. The
increase was inhibited by -MSH treatments, in relation to inhibition
of central TNF-. Presence within normal mouse brain of mRNA for the
-MSH receptor MC-1 suggests that the inhibitory effects of -MSH
on brain and plasma TNF- might be mediated by this receptor subtype.
The inhibitory effect of -MSH on brain TNF- did not depend on
circulating factors because the effect also occurred in brain tissue
in vitro. This indicates that -MSH can act directly
on brain cells to inhibit their production of TNF-. If central
TNF- contributes to pathology in CNS disease and injury, and
promotes inflammation in the periphery, agents that act on brain
-MSH receptors should decrease the pathological TNF- reaction and
promote tissue survival.
Key words:
-MSH;
TNF-;
modulation of CNS inflammation;
neurodegenerative disease;
LPS;
neuroimmunomodulation;
anti-inflammatory;
anticytokine
INTRODUCTION
With improvement in understanding of cytokine
mediators of inflammation and with recent identification of these
mediators in certain CNS diseases, it is likely that the importance of
inflammatory cytokines and processes in all CNS injuries and disorders
will eventually be recognized. Although several inflammatory cytokines likely contribute to CNS inflammation, TNF- may be especially important in CNS disease. TNF- has been linked to multiple
sclerosis, HIV infection of the CNS, Alzheimer's disease, meningitis,
and acute brain injury as a result of ischemia/reperfusion or of
trauma.
TNF- occurs in abundance in lesions of multiple sclerosis, which,
with its capacity to promote myelin destruction and to increase
adhesion molecule expression, makes it a prime suspect in etiology of
the lesions (Raine, 1994 ). Expression of TNF- mRNA predominates in
perivascular inflammatory cuffs rather than in parenchymal cells,
suggesting that circulating inflammatory cells that have entered the
brain are the major source of the cytokine in this disease (Woodroofe
and Cuzner, 1993). Experimental multiple sclerosis is improved by
anti-TNF- antibodies and by soluble TNF- receptors (Selmaj and
Raine, 1995). Direct infection of neurons by HIV is not responsible for
manifestation of neurological disease. Rather, it seems that
macrophages and/or microglia are affected and thereby alter the
functions of neurons and glia via release of proinflammatory cytokines
such as TNF- (Koka et al., 1995; Tyor et al., 1995). The cytokines
promote dysmyelination and inflammation, and neurological symptoms
result. It seems that the HIV envelope protein gp120 is toxic to human
brain cell cultures through induction of TNF- and interleukin 6 (Yeung et al., 1995). It has been known for some time that portions of
the HIV envelope protein induce TNF- in primary brain culture
(Merrill et al., 1992). Alzheimer's disease, marked by progressive
intellectual failure, is characterized by formation within the brain of
aggregates of  -amyloid protein and infiltration of reactive
microglia and astrocytes. Recent evidence suggests that in this
disorder, microglia-induced neuronal injury stems from a synergistic
effect of -amyloid protein and interferon- in triggering
production of proinflammatory and toxic TNF- and nitrogen
intermediates (Meda et al., 1995). TNF- has been observed in CSF of
patients with bacterial meningitis (Glimaker et al., 1993; Dulderian et
al., 1995) and in experimental bacterial meningitis I (Kimberlin et
al., 1995). There is evidence that such increases are a result of
elevated production of TNF- by ependymal cells of the choroid plexus
(Tarlow et al., 1993). In experimental brain ischemia/reperfusion,
TNF- mRNA appears early and precedes infiltration of inflammatory
cells into the injured zone (Feuerstein et al., 1994). It is found
early in neurons, in and around ischemic tissue, and later in
macrophages in infarcted tissue. The cytokine concentration is
increased in the CSF of victims of traumatic head injury (Ross et al.,
1994).
If TNF- causes or promotes pathology in multiple CNS disorders,
agents that inhibit its production should preserve neurological function. A neuroimmunomodulatory peptide, -MSH, is known to inhibit
the in vivo and in vitro actions and production
of proinflammatory cytokines (Lipton and Catania, 1991, 1993, 1997),
but no tests have been performed on the influence of the peptide on
TNF- production induced within the brain. The main purpose of the
present investigations was to determine whether -MSH inhibits
central production of TNF- in vivo and in
vitro.
MATERIALS AND METHODS
Animals. The experiments were approved by the local
Internal Review Board for Animal Research. Male BALB/c mice (Simonsen Laboratories, Gilroy CA), ~20 gm body weight, were housed at
23-25°C in groups not exceeding five animals per cage [28 cm
(length) × 18 cm (width) × 13 cm (height)]. Before the experiments,
the mice were acclimatized to standard lighting and temperature
conditions with food and water freely available.
Influence of -MSH treatments on brain TNF- in vivo.
-MSH1-13 obtained from Sigma (St. Louis, MO) was
dissolved in saline just before injection. For determinations of
in vivo brain TNF- protein and mRNA, and for MC-1 mRNA,
brains were removed 1 hr after LPS administration. At the time of
decapitation, trunk blood was collected in lightly heparinized 1.5 ml
tubes. The LPS used to promote TNF- production was derived from
Salmonella typhosa (Difco, catalog #0901). Saline (20 µl)
or LPS (5 µg) in saline was injected into the cerebral ventricles of
mice anesthetized with ether using procedures described previously
(Lipton et al., 1991; Lipton and Catania, 1993). -MSH (10 µg) for
i.c.v. injection was likewise dissolved in 0.1 µl saline.
Intraperitoneal injections of -MSH (50 µg) or saline vehicle were
0.1 ml in volume.
Influence of -MSH on TNF- production by brain tissue
in vitro. Brains were dissected intact, immediately sectioned
midsagittally, and the halves were weighed and placed in 1 ml medium
(DMEM with 10% FBS, 2 mM L-glutamine, 200 U/ml
penicillin, and 200 µg/ml streptomycin) in individual wells of a
24-well plate. Each sample was minced with a scalpel blade and washed
with medium. After 15 min at room temperature, the washing was
repeated. LPS (2.5 µg), LPS + -MSH, or medium control was added to
wells containing 500 µl of DMEM, and incubation at 37°C was
continued for 1 hr. Ten microliters of supernatant from each well were
assayed for TNF- concentration.
TNF- determinations. Concentrations of TNF- in brain
and plasma were determined with an L929 cell cytotoxicity assay, with human TNF- used as control and for production of standard curves. The triplicate samples were incubated overnight with L929 cells in
medium containing 100 µg/ml cyclohexamide (Sigma) in 96-well plates.
The TNF- concentrations were determined with reference to intensity
at 550 nm in an ELISA plate reader (BT 2000, Fisher-Biotech). Each
plate contained standards.
Northern analysis for TNF- mRNA. RNA was isolated by
homogenization in guanidinium thiocyanate followed by phenol/chloroform extraction. Total RNA (15 µg) was fractionated on a
formaldehyde-denaturing agarose gel and transferred overnight to a
nylon membrane that was subsequently baked at 80°C for 1 hr. The
membrane was prehybridized for 6 hr at 42°C with a solution
containing 2× Denhardt's reagent, 100 µg/ml salmon sperm DNA, 40%
formamide, 4× SSC, 7 µM Tris, pH 7.4, and 3% SDS. cDNA
probe was radiolabeled with [32P]dCTP (3000 Ci/mmol;
DuPont NEN) by random primer labeling (Prime-a-Gene Labeling System,
Promega). The blot was hybridized overnight with 1-2 × 106 cpm/ml probe for mouse TNF- at 42°C in the same
solution. Blots were then washed three times in 2× SSC and 0.1% SDS
at room temperature for 15 min, and then two more times for 30 min at
high stringency (0.1× SSC, 0.1% SDS, 68°C). The blot was then
exposed to X-ray film with 2 intensifying screens at  70°C for 2-3
d. Ethidium bromide was used to evaluate equivalence of RNA
loading.
Determination of melanocortin 1 receptor mRNA. Total RNA
(200 µg) was isolated from normal mouse brain by guanidinium
thiocyanate, phenol, chloroform extraction and used to generate cDNA.
Genomic DNA was digested with DNase in reverse transcriptase (RT)
buffer for 30 min at 37°C. The DNase was inactivated by
phenol-chloroform extraction. cDNA was produced using Moloney murine
leukemia virus RT (BRL, Gaithersburg, MD). In some tubes, the RT was
omitted to control for amplification from contaminating cDNA or genomic DNA. Portions of the cDNA were used for PCR with primer pairs specific
for the murine MC-1 isoform (529 bp). The forward primer was (5 to 3)
GTGAGTCTGGTGGAGAATGTGC and the reverse primer was TTTTGTGGAGCTGGGCAATGCC. The primers were chosen in regions of low
similarity among known MC receptors. PCR mixtures contained: 1 µM primers, 1.5-2.5 mM MG2+, 200 µM dNTP, 1× reaction buffer, 1 U of Taq DNA polymerase, and 5 µl cDNA in 20 µl. The PCR profile consisted of 35 cycles of
94°C for 45 sec, 60°C for 45 sec, and 72°C for 75 sec, followed by a 5 min final extension at 72°C. The PCR products were size fractionated by agarose gel electrophoresis, transferred to nylon membrane, and hybridized with a 32P end-labeled internal
oligo probe specific for the MC-1 receptor (5 to 3)
CAGCATCGTCTCCAGCACCCTC.
Statistical analysis. Data were analyzed using one-way ANOVA
procedures, followed by Dunnet's test for multiple comparisons of
group means.
RESULTS
Brain TNF- protein and mRNA
Concentrations of TNF- protein in control brains
harvested after i.c.v. administration of LPS were markedly increased
(Fig. 1), whereas in experiments on brains of normal
untreated mice, TNF- was low or undetectable (data not shown). All
of the -MSH treatments inhibited TNF- protein production within
the brain. A single central injection of the peptide greatly reduced
TNF- concentration, a similar inhibition was observed in animals
given -MSH intraperitoneally (i.p.) twice daily for 5 d (final
-MSH injection ~16 hr before the second LPS injection), and the
greatest inhibition occurred in mice given -MSH systemically for 5 days as well as centrally at the time of LPS injection, 1 hr before brains were removed. These results indicate that a single dose of
centrally injected peptide acts rapidly to inhibit local TNF- production. Further, this single injection is as effective as repeated
systemic injections of -MSH. Given the positive effects of central
and systemic -MSH injections, it is not surprising that the greatest
inhibition occurred in mice given -MSH by both routes. The
inhibitory influence of -MSH on central TNF- was confirmed by
Northern analysis of TNF- mRNA abundance (Fig.
2).
Fig. 1.
-MSH given centrally (10 µg) and/or
systemically (50 µg, repeated) inhibited TNF- induction within the
brain by local injection of LPS (5 µg). Scores are means ± SEM.
After ANOVA revealed significant differences among means
(p < 0.001), Dunnett's test was used for comparisons of individual means. **p < 0.01, relative to saline (i.c.v.) + saline (i.p.);
+p < 0.01 versus other means.
[View Larger Version of this Image (12K GIF file)]
Fig. 2.
Representative Northern blot of TNF- mRNA
abundance in whole mouse brains. Representative examples from two mice
given LPS alone (SALINE IP, ICV) and two others
from the group (-MSH IP, ICV) that showed the
greatest inhibitory effect of -MSH on TNF- protein. The blot was
hybridized with 32P-labeled cDNA probe for mouse TNF-.
Ethidium bromide staining of agarose gel demonstrated equal loading of
samples. This is representative of two experiments.
[View Larger Version of this Image (28K GIF file)]
Plasma TNF-
Central administration of LPS markedly increased circulating
TNF- in animals that did not receive -MSH treatment (Fig.
3). These results indicate that a very small amount of
LPS acting within the brain can greatly increase circulating TNF-.
The circulating concentrations of TNF- after central administration
of LPS were five- to sixfold greater than those induced in the brain.
Plasma of normal untreated mice had no significant concentrations of TNF-. Much as for brain TNF-, plasma TNF- concentration was reduced by a single injection of -MSH into the brain, by repeated systemic injections of the peptide, and by combined central and peripheral injections of -MSH. The marked inhibitory effects of
combined central and systemic -MSH injections suggest that activity
of -MSH receptors in the brain and in the periphery alter systemic
TNF- induced by LPS acting centrally. It is notable that the
inhibition of plasma TNF- paralleled the inhibition of brain TNF-
induced by central -MSH.
Fig. 3.
-MSH given centrally and/or peripherally
inhibited increases in circulating TNF- induced by central injection
of LPS. Overall, ANOVA was significant (p < 0.001). Dunnett's test: **p < 0.01 relative to
saline (i.c.v.) + saline (i.p.); +p < 0.05 relative to saline (i.c.v.) + -MSH (i.p.) p < 0.01 relative to -MSH (i.c.v.) + saline (i.p.).
[View Larger Version of this Image (14K GIF file)]
Evidence of MC-1 receptor expression in the brain
To test the idea that the primary -MSH receptor MC-1, recently
found in murine macrophages and in human macrophages and neutrophils (Star et al., 1995; Rajora et al., 1996; Catania et al., 1996), likewise occurs in brain tissue, normal mouse brain was subjected to
RT-PCR and Southern analysis. This analysis revealed a substantial signal at 529 bp, consistent with the size of the cDNA for the murine
MC-1 receptor (Fig. 4). Control analysis of other murine tissues (e.g., lung), and of cells of the L929 fibroblast line used for
TNF- determinations, did not show any evidence of MC-1 expression.
Fig. 4.
Representative Southern blot of RT-PCR product for
murine MC-1 receptor in normal mouse brain. No bands were observed in
lanes containing reaction mixture without tissue (not shown) or without RT (RT). Lanes containing mouse genomic DNA (1 µg) or MC-1 cDNA also contained the 529 bp product. Approximately 10 µg of cDNA (20 µl) was used in this experiment. Exposure time was
30 min. Washes (all room temperature): first washes = 3 for 5 min,
2× SSC + 0.1% SDS; second washes = 2 for 30 min, 2× SSC + 0.1%
SDS.
[View Larger Version of this Image (23K GIF file)]
Effect of -MSH on TNF- production by brain tissue
in vitro
If, as the results above suggest, -MSH acts centrally to
inhibit TNF- production, the peptide may reduce production of the cytokine by brain cells per se, without the influence of factors in the
blood supply in the live animal. To test this idea, brain samples were
incubated with LPS (2.5 µg), and with LPS + concentrations of -MSH
for 1 hr, and samples of medium were analyzed for TNF-. Marked
increases in TNF- were induced by LPS in control tissue. -MSH
inhibited TNF- production in a dose-related fashion (Fig. 5), which indicates a direct effect of the peptide on
brain cells that produce the cytokine. These results demonstrate that
no secondary influence of -MSH via circulating mediators is
necessary for the inhibition.
Fig. 5.
Dose-related inhibition by -MSH of TNF-
protein production by tissue derived from half murine brains incubated
with LPS for 1 hr. Control value was the mean TNF- production
(60.1 ± 12.7 U/gm) for all of the opposite hemibrains incubated
with LPS but without -MSH. Scores are means ± SEM of percent
inhibition of TNF- production relative to control derived from three
separate experiments.
[View Larger Version of this Image (12K GIF file)]
Brain TNF- mRNA after a single injection of LPS
In view of reports of CNS tolerance to central LPS administration
(Faggioni et al., 1995), the effect of single LPS (5 µg) injections
into the brain was tested in otherwise untreated mice. These injections
resulted in the greatest abundance of brain TNF- mRNA observed in
this study (Fig. 6). This result indicates that the
greatest effect of LPS on TNF- expression within the brain occurs
after the first injection and, with evidence of lesser abundance after
a second injection made 5 d later, supports the idea of CNS
tolerance to LPS treatment.
Fig. 6.
Representative Northern blot showing that single
acute i.c.v. injections of LPS (1) had greater effects
on brain TNF- mRNA abundance than injections that were preceded
5 d earlier by a similar i.c.v. injection (2).
Ethidium bromide staining of agarose gel demonstrated equal loading of
samples. Representative of two experiments: 2 d exposure,
70°C, two intensifying screens.
[View Larger Version of this Image (31K GIF file)]
DISCUSSION
TNF- within the brain
-MSH acts locally within the brain to inhibit production of
TNF- both in vivo and in vitro. Central
injection of -MSH inhibited TNF- production, and expression of
TNF- mRNA, in live mice within 1 hr after local injection of LPS.
This result was confirmed in vitro by marked inhibition by
-MSH of TNF- production by brain tissue. These converging
observations indicate that the neuropeptide -MSH modulates brain
TNF- concentration via actions directly within the parenchyma. The
cell source of this rapid increase in TNF- was not determined;
however, it is clear that astrocytes (for example, see Kimberlin et
al., 1995) as well as microglia (for example, see Meda et al., 1995)
and ependymal cells (for example, see Tarlow et al., 1993) can produce
the cytokine.
Systemically administered -MSH inhibits brain
TNF- production
Repeated i.p. injections of -MSH likewise inhibited the
increase in brain TNF- caused by central injection of LPS, and the combination of central and systemic -MSH injections had the greatest inhibitory effect. This observation suggests that repeated systemic administration of -MSH alters the reactivity of brain cells to LPS
stimulation, although the mechanisms underlying this alteration are
unknown. It is notable that the greatest inhibitory effect on TNF-
production was caused by repeated administration of -MSH and of
acute central administration of the peptide. It may be that the latter
effect results from a combination of influences induced by centrally
injected -MSH acting within the brain, and systemically injected
-MSH acting on peripheral host cells and on brain melanocortin
receptors. There is direct evidence that -MSH administered
systemically reaches the brain (Wilson, 1988), albeit in small amounts.
Further, systemically administered -MSH reduces fever in minutes, an
antipyretic effect that can occur only through an action of the peptide
within the CNS. This observation is very important for potential
clinical use of -MSH to control TNF- production in animals or
humans in whom local brain injections are unsafe or impractical. One of
the main questions is whether -MSH could be administered before
neurosurgical procedures and thereby modulate local inflammatory
responses to surgery or contamination. In keeping with this idea, in
recent research on basilar artery ischemia/reperfusion in dogs (Huh et
al., 1997), disturbance of the brainstem auditory evoked potential was
less in animals given -MSH IV, particularly when it was administered
during ischemia.
Central LPS markedly increases circulating TNF-
It is remarkable that a small amount of LPS injected into the
brain promotes not only local TNF- production but circulating TNF- even moreso. This observation, noted previously (Faggioni et
al., 1995), has far-reaching implications. In brief, it may be that the
induction of central TNF-, or a more direct action of LPS within the
brain, causes marked increases in production of TNF- within the
circulation, presumably by monocytes. Because the concentrations of
TNF- induced within the brain are substantially less than those
induced in the circulation, it is unlikely that the circulating TNF-
originates from the brain. The nature of the signals from brain to the
periphery are not clear. TNF--producing cells in the brain may
invoke neural and/or humoral signals. Nor is the physiological
significance of the phenomenon known, although it may be that sensing
of central TNF- promotes circulating TNF- to counteract
challenges to the host. Such an increase in circulating TNF- after
central LPS may explain the increase in peripheral inflammation after
central injection of "endogenous pyrogen" (EP, Dulaney et al.,
1992). In those experiments, central administration of undiluted EP
significantly increased peripheral inflammation in the mouse; dilutions
of EP had lesser or no effects. A proinflammatory influence of central
TNF- could be detrimental in organisms with preexisting inflammatory
disease in the periphery; for example, central TNF- might promote
peripheral inflammation in rheumatoid arthritis or inflammatory bowel
disease by inducing high concentrations of the cytokine in the
bloodstream.
Central -MSH modulates the increase in circulating TNF-
induced by LPS acting solely within the brain
Whatever the basis of the increase in circulating TNF-,
injection of -MSH into the brain reduced it. The dose of -MSH
that inhibited circulating TNF- effectively reduced peripheral
inflammation after central injection in earlier experiments (Lipton et
al., 1991; Ceriani et al., 1994; Macaluso et al., 1994). If circulating TNF- contributes to the inflammatory response in the periphery, central -MSH likely inhibits this inflammation in some part by modulating circulating TNF-. It is clear that descending neurogenic anti-inflammatory pathways in the spinal cord are necessary for the
anti-inflammatory actions of central -MSH (Macaluso et al., 1994).
It may be that these pathways are the means through which central
-MSH modulates production of TNF- by peripheral host cells,
although it is likely that modulation of release of peripheral substance P and calcitonin gene-related peptide is also
responsible.
Effects of systemic -MSH
The results indicate that systemically administered -MSH
inhibits circulating TNF- concentration. There are three potential mechanisms: (1) a direct inhibitory action on TNF- producing cells
(e.g., monocytes) in the circulation, (2) an effect of the -MSH that
penetrates to the brain on central descending anti-inflammatory pathways, or (3) some combination of these two. That -MSH inhibits release of proinflammatory mediators from monocytic cells is clear; we
have noted (Lipton et al., 1997) that TNF- production by human peripheral blood mononuclear cells is inhibited by -MSH, which indicates that a direct effect of the peptide on melanocortin receptors
on monocytes is possible. As stated above, -MSH injected systemically is known to reach the brain and may, therefore, inhibit TNF- production in the circulation via unknown pathways. Finally, it
is clear that -MSH can alter inflammatory processes by acting directly on host cells in the periphery and by acting within the brain.
Because systemic -MSH is available at both sites, it is reasonable
to assume that the peptide acts at both these sites.
Evidence for MC-1 receptors within the brain
The inhibitory effects of -MSH on TNF- production by brain
tissue in vivo and in vitro indicates that
receptors for the peptide reside within the brain. Indeed, there is
prior evidence for three melanocortin receptor subtypes in brain: MC-3,
MC-4, and MC-5 (Hol et al., 1995). Further, our RT-PCR evidence
supports observations made in in situ hybridization and
immunohistochemistry experiments (Xia et al., 1995) that the MC-1
receptor is likewise expressed in brain tissue. MC-1 may therefore
contribute to the anti-TNF- activity of the peptide. It is not yet
possible to determine the precise contribution of the melanocortin
receptor subtypes to inhibition of TNF- production; all four
subtypes found within the brain respond to -MSH and may therefore
contribute to its anti-inflammatory effect. However, it should be
possible to test the relative contributions of the receptor subtypes to modulation of TNF- production in whole brain by incubating brain tissue with antibodies to them.
In summary, the results extend to the CNS the observations of the
anti-inflammatory effects of the neuropeptide -MSH. Inflammation in
peripheral tissues is modulated by -MSH acting on its receptors on
neutrophils and macrophages and those within the brain. The rapid
anti-TNF- effects of -MSH within brain tissue per se likely occur
via direct actions of the peptide on local brain cells (astrocytes and
microglia) that produce TNF-. Modulation of circulating TNF- via
-MSH-induced inhibition of central cytokine signals provides a new
avenue for control of peripheral inflammatory reactions, via actions on
melanocortin receptors within the brain.
FOOTNOTES
Received Oct. 7, 1996; revised Dec. 23, 1996; accepted Dec. 31, 1996.
This research was supported by National Institutes of Health Grant
NS10046 from the National Institute of Neurological Diseases and
Stroke, a Comitato Nazionale delle Richerche Grant, VIII Progetto AIDS,
Istituto Superiore di Sanita, Italy, Grant PP0406 from the National
Multiple Sclerosis Society, and NATO Collaborative Research Grant CGR
950556.
Correspondence should be addressed to Dr. J. M. Lipton, University of
Texas Southwestern Medical Center, Dallas TX
75235-9040.
REFERENCES
-
Catania A,
Rajora N,
Capsoni F,
Minonzio F,
Star RA,
Lipton JM
(1996)
The neuropeptide -MSH has specific receptors on neutrophils and reduces chemotaxis in vitro.
Peptides
17:675-679 .
[ISI][Medline]
-
Ceriani G,
Macaluso A,
Catania A,
Lipton JM
(1994)
Central neurogenic antiinflammatory action of -MSH: modulation of peripheral inflammation induced by cytokines and other mediators of inflammation.
Neuroendocrinology
59:138-143 .
[ISI][Medline]
-
Dulaney R,
Macaluso A,
Woerner J,
Hiltz ME,
Catania A,
Lipton JM
(1992)
Changes in periperal inflammation induced by the central actions of an -MSH analog and of endogenous pyrogen.
Prog Neuroendocrin Immunol
5:179-186.
-
Dulderian SJ,
Kilpatrick L,
Costarino Jr AT,
McCawley L,
Fein J,
Corcoran L,
Zirin S,
Harris MC
(1995)
Cytokine elevations in infants with bacterial and aseptic meningitis.
J Pediatr
125:872-876.
-
Faggioni R,
Fantuzzi G,
Villa P,
Buurman W,
van Tits LJH,
Ghezzi P
(1995)
Independent down-regulation of central and peripheral tumor necrosis factor production as a result of lipopolysaccharide tolerance in mice.
Infect Immunol
63:1473-1477 .
[Abstract]
-
Feuerstein GZ,
Liu T,
Barone FC
(1994)
Cytokines, inflammation, and brain injury: role of tumor necrosis factor.
Cerebrovasc Brain Metab Rev
6:341-360 .
[ISI][Medline]
-
Glimaker M,
Kragsbjerg P,
Forsgren M,
Olcen P
(1993)
Tumor necrosis factor (TNF) in cerebrospinal fluid from patients with meningitis of different etiologies: high levels of TNF indicate bacterial meningitis.
J Infect Dis
167:882-889 .
[ISI][Medline]
-
Hol EM,
Gispen WH,
Bar PR
(1995)
ACTH-related peptdes: receptors and signal transduction systems involved in their neurotropic and neuroprotective actions.
Peptides
16:979-993 .
[ISI][Medline]
-
Huh S-K,
Lipton JM,
Batjer HHI
(1997)
The protective effects of -melanocyte stimulating hormone on canine brainstem ischemia.
J Neurosurg
40:132-139.
-
Kimberlin DW,
Velasco S,
Paris MM,
Hickey SM,
McCracken Jr GH,
Nisen PD
(1995)
Modulation of expression of genes involved in the inflammatory response by lipopolysaccharide and temperature in cultured human astroglial cells.
Immunol Invest
24:775-785 .
[ISI][Medline]
-
Koka P,
He K,
Camerini D,
Tran T,
Yashar SS,
Merrill JE
(1995)
The mapping of HIV-1 gp160 epitopes required for interleukin-1 and tumor necrosis factor production in glial cells.
J Neuroimmunol
57:179-191 .
[ISI][Medline]
-
Lipton JM,
Catania A
(1993)
Pyrogenic and inflammatory actions of cytokines and their modulation by neuropeptides: techniques and interpretations.
In: Neurobiology of cytokines, part B (DeSouza EB,
ed), pp 61-79. Orlando, FL: Academic.
-
Lipton JM, Catania AP (1997) Antiinflammatory actions of the
neuroimmunomodulator -MSH. Immunol Today, in press.
-
Lipton JM,
Macaluso A,
Hiltz ME,
Catania A
(1991)
Central administration of the peptide -MSH inhibits inflammation in the skin.
Peptides
12:795-798 .
[ISI][Medline]
-
Lipton JM,
Catania A,
Rajora N,
Ceriani G,
Star RA,
Boccoli G
(1997)
Modulation of inflammatory effects of cytokines by the neuropeptide -MSH.
In: Proinflammatory and antiinflammatory peptides. Lung biology in health and disease. New York: Dekkerin press.
-
Macaluso A,
McCoy D,
Ceriani G,
Watanabe T,
Biltz J,
Catania A,
Lipton JM
(1994)
Antiinflammatory influences of -MSH molecules: central neurogenic and peripheral actions.
J Neurosci
14:2377-2382 .
[Abstract]
-
Meda L,
Cassatella MA,
Szendrei GI,
Otvos Jr L,
Baron P,
Villalba M,
Ferrari D,
Rossi F
(1995)
Activation of microglial cells by -amyloid protein and interferon .
Nature
374:647-650 .
[Medline]
-
Merrill JE,
Koyanagi Y,
Zack J,
Thomas L,
Martin F,
Chen IS
(1992)
Induction of interleukin-1 and tumor necrosis factor in brain cultures by human immunodeficiency virus type I.
J Virol
66:2217-2225 .
[Abstract/Free Full Text]
-
Raine CS
(1994)
The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion.
Ann Neurol
36:561-572.
-
Rajora N,
Ceriani G,
Catania A,
Star RA,
Murphy MT,
Lipton JM
(1996)
-MSH production, receptors, and influence on neopterin, in a human monocyte/macrophage cell line.
J Leukocyte Biol
59:248-253 .
[Abstract]
-
Ross SA,
Halliday MI,
Campbell GC,
Byrnes DP,
Rowlands BJ
(1994)
The presence of tumour necrosis factor in CSF and plasma after severe head injury.
Br J Neurosurg
8:419-425 .
[ISI][Medline]
-
Selmaj KW,
Raine CS
(1995)
Experimental autoimmune encephalomyelitis: immunotherapy with anti-tumor necrosis factor antibodies and soluble tumor necrosis factor receptors.
Neurology
45:S44-S49 .
[Abstract]
-
Star RA,
Rajora N,
Huang J,
Chavez R,
Catania A,
Lipton JM
(1995)
Evidence of autocrine modulation of macrophage nitric oxide synthase by -MSH.
Proc Natl Acad Sci USA
92:8016-8020 .
[Abstract/Free Full Text]
-
Tarlow MJ,
Jenkins R,
Comis SD,
Osborne MP,
Stephens S,
Stanley P,
Crocker J
(1993)
Ependymal cells of the choroid plexus express tumor necrosis factor .
Neuropathol Appl Neurobiol
19:324-328 .
[ISI][Medline]
-
Tyor WR,
Wesselingh SL,
Griffin JW,
McArthur JC,
Griffin DE
(1995)
Unifying hypothesis for the pathogenesis of HIV-associated dementia complex, vacuolar myelopathy, and sensory neuropathology.
J Acquir Immune Defic Syndr Hum Retrovirol
9:379-388 .
[ISI][Medline]
-
Wilson JF
(1988)
Low permeability of the blood-brain barier to nanomolar concentrations of immunoreactive -melanotropin.
Psychopharmacology
96:262-266 .
[Medline]
-
Woodroofe MN,
Cuzner ML
(1993)
Cytokine expression in inflammatory multiple sclerosis lesions: detection by non-radioactive in situ hybridization.
Cytokine
5:583-588 .
[ISI][Medline]
-
Xia Y,
Wikberg JE,
Chhajlani V
(1995)
Expression of melanocortin 1 receptor in periacqueductal gray matter.
NeuroReport
6:2193-2196 .
[ISI][Medline]
-
Yeung MC,
Pulliam L,
Lau AS
(1995)
The HIV envelope protein gp120 is toxic to human brain-cell cultures through the induction of interleukin-6 and tumor necrosis factor .
AIDS
9:137-143 .
[ISI][Medline]
This article has been cited by other articles:
|
|
|
|
 
T. Brzoska, T. A. Luger, C. Maaser, C. Abels, and M. Bohm
{alpha}-Melanocyte-Stimulating Hormone and Related Tripeptides: Biochemistry, Antiinflammatory and Protective Effects in Vitro and in Vivo, and Future Perspectives for the Treatment of Immune-Mediated Inflammatory Diseases
Endocr. Rev.,
August 1, 2008;
29(5):
581 - 602.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Catania
The melanocortin system in leukocyte biology
J. Leukoc. Biol.,
February 1, 2007;
81(2):
383 - 392.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Giuliani, C. Mioni, D. Altavilla, S. Leone, C. Bazzani, L. Minutoli, A. Bitto, M.-M. Cainazzo, H. Marini, D. Zaffe, et al.
Both Early and Delayed Treatment with Melanocortin 4 Receptor-Stimulating Melanocortins Produces Neuroprotection in Cerebral Ischemia
Endocrinology,
March 1, 2006;
147(3):
1126 - 1135.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Catania, S. Gatti, G. Colombo, and J. M. Lipton
Targeting Melanocortin Receptors as a Novel Strategy to Control Inflammation
Pharmacol. Rev.,
March 1, 2004;
56(1):
1 - 29.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Shiratori, K. Ohgami, I. B. Ilieva, Y. Koyama, K. Yoshida, and S. Ohno
Inhibition of Endotoxin-Induced Uveitis and Potentiation of Cyclooxygenase-2 Protein Expression by {alpha}-Melanocyte-Stimulating Hormone
Invest. Ophthalmol. Vis. Sci.,
January 1, 2004;
45(1):
159 - 164.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-W. Yoon, S.-H. Goh, J.-S. Chun, E.-W. Cho, M.-K. Lee, K.-L. Kim, J.-J. Kim, C.-J. Kim, and H. Poo
{alpha}-Melanocyte-stimulating Hormone Inhibits Lipopolysaccharide-induced Tumor Necrosis Factor-{alpha} Production in Leukocytes by Modulating Protein Kinase A, p38 Kinase, and Nuclear Factor {kappa}B Signaling Pathways
J. Biol. Chem.,
August 29, 2003;
278(35):
32914 - 32920.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. E. Scholzen, C. Sunderkotter, D.-H. Kalden, T. Brzoska, M. Fastrich, T. Fisbeck, C. A. Armstrong, J. C. Ansel, and T. A. Luger
{alpha}-Melanocyte Stimulating Hormone Prevents Lipopolysaccharide-Induced Vasculitis by Down-Regulating Endothelial Cell Adhesion Molecule Expression
Endocrinology,
January 1, 2003;
144(1):
360 - 370.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-M. Deng, Z.-Q. Liu, and A. Tarkowski
Intracisternally Localized Bacterial DNA Containing CpG Motifs Induces Meningitis
J. Immunol.,
October 15, 2001;
167(8):
4616 - 4626.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. E. Wisse, R. S. Frayo, M. W. Schwartz, and D. E. Cummings
Reversal of Cancer Anorexia by Blockade of Central Melanocortin Receptors in Rats
Endocrinology,
August 1, 2001;
142(8):
3292 - 3301.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kiriyama, H. Tsuchiya, T. Murakami, K. Satoh, and Y. Tokumitsu
Calcitonin Induces IL-6 Production via Both PKA and PKC Pathways in the Pituitary Folliculo-Stellate Cell Line
Endocrinology,
August 1, 2001;
142(8):
3563 - 3569.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Katsuki, Y. Sumida, E. C. Gabazza, S. Murashima, T. Tanaka, M. Furuta, R. Araki-Sasaki, Y. Hori, K. Nakatani, Y. Yano, et al.
Plasma Levels of Agouti-Related Protein Are Increased in Obese Men
J. Clin. Endocrinol. Metab.,
May 1, 2001;
86(5):
1921 - 1924.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. M. Lipton, A. Catania, and T. Ichiyama
Marshaling the Anti-Inflammatory Influence of the Neuroimmunomodulator {alpha}-MSH
Physiology,
August 1, 2000;
15(4):
192 - 195.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. W. Haycock, S. J. Rowe, S. Cartledge, A. Wyatt, G. Ghanem, R. Morandini, I. G. Rennie, and S. MacNeil
alpha -Melanocyte-stimulating Hormone Reduces Impact of Proinflammatory Cytokine and Peroxide-generated Oxidative Stress on Keratinocyte and Melanoma Cell Lines
J. Biol. Chem.,
May 19, 2000;
275(21):
15629 - 15636.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Taherzadeh, S. Sharma, V. Chhajlani, I. Gantz, N. Rajora, M. T. Demitri, L. Kelly, H. Zhao, T. Ichiyama, A. Catania, et al.
alpha -MSH and its receptors in regulation of tumor necrosis factor-alpha production by human monocyte/macrophages
Am J Physiol Regulatory Integrative Comp Physiol,
May 1, 1999;
276(5):
R1289 - R1294.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q.-H. Huang, V. J. Hruby, and J. B. Tatro
Role of central melanocortins in endotoxin-induced anorexia
Am J Physiol Regulatory Integrative Comp Physiol,
March 1, 1999;
276(3):
R864 - R871.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
