WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
QUICK SEARCH:   [advanced]


     
-


HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (52)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stella, N.
Right arrow Articles by Prémont, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stella, N.
Right arrow Articles by Prémont, J.

 Previous Article  |  Next Article 

Volume 17, Number 9, Issue of May 1, 1997 pp. 2939-2946
Copyright ©1997 Society for Neuroscience

Interleukin-1 Enhances the ATP-Evoked Release of Arachidonic Acid from Mouse Astrocytes

Nephi Stella1, 2, Angeles Estellés1, Julio Siciliano1, Martine Tencé1, Solange Desagher1, Daniele Piomelli2, Jacques Glowinski1, and Joël Prémont1

1 Laboratoire de Neuropharmacologie, Institut National de la Santé et de la Recherche Médicale U114, Collège de France, 75231 Paris Cedex 05, France, and 2 The Neurosciences Institute, San Diego, California 92121

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

During neuropathological states associated with inflammation, the levels of cytokines such as interleukin-1beta (IL-1beta ) are increased. Several studies have suggested that the neuronal damage observed in pathogenesis implicating IL-1beta are caused by an alteration in the neurochemical interactions between neurons and astrocytes. We report here that treating striatal astrocytes in primary culture with IL-1beta for 22-24 hr enhances the ATP-evoked release of arachidonic acid (AA) with no effect on the ATP-induced accumulation of inositol phosphates. The molecular mechanism responsible for this effect involves the expression of P2Y2 receptors (a subtype of purinoceptor activated by ATP) and cytosolic phospholipase A2 (cPLA2, an enzyme that mediates AA release). Indeed, P2Y2 antisense oligonucleotides reduce the ATP-evoked release of AA only from IL-1beta -treated astrocytes. Further, both the amount of cPLA2 (as assessed by Western blotting) and the release of AA resulting from direct activation of cPLA2 increased fourfold in cells treated with IL-1beta . We also report evidence indicating that the coupling of newly expressed P2Y2 receptors to cPLA2 is dependent on PKC activity. These results suggest that during inflammatory conditions, IL-1beta reveals a functional P2Y2 signaling pathway in astrocytes that results in a dramatic increase in the levels of free AA. This pathway may thus contribute to the neuronal loss associated with cerebral ischemia or traumatic brain injury.

Key words: purinoceptor; phospholipase; cytokine; inflammation; glutamate; neurotoxicity

INTRODUCTION

ATP acts both as an intracellular source of energy and an intercellular signaling molecule. Several studies carried out in smooth muscle nerve endings, peripheral ganglia, and brain have shown that ATP is (1) stored in neuronal vesicles; (2) released in a Ca2+-dependent manner; (3) able to activate specific receptors; and (4) hydrolyzed by ecto-ATPases (for review, see Zimmermann, 1994). By way of illustration, it is present in synaptic vesicles of cholinergic interneurones of the striatum where it is co-localized and co-released with acetylcholine (Richardson and Brown, 1987).

This purine binds to and activates a family of purinoceptors (P2 receptors) namely P2X, P2Y, P2U, P2Z, and P2T, which have been classified based on the potencies of structural ATP analogs (Fredholm et al., 1994). For most of them, cDNAs have been cloned and characterized (Lustig et al., 1993; Webb et al., 1993, 1996; Communi et al., 1995; Nguyen et al., 1995; Chang et al., 1995; Akbar et al., 1996). It was recently recommended that the P2X/P2Y division be used to distinguish between members of this receptor family that are ligand-gated ion channels or G-protein-coupled receptors, respectively. Accordingly, an official nomenclature of P2Y1-P2Yn has been assigned for the G-protein-coupled receptors, whereas P2Y2 receptors correspond to the formerly P2U receptor.

ATP has been implicated in neuro-neuronal communication (Edwards et al., 1992; Evans et al., 1992; Galligan and Bertrand, 1994), as well as in neuro-glial interactions. Indeed, activation of purinoceptors present in primary cultures of rat astrocytes leads to the accumulation of inositol phosphate derivatives (Pearce et al., 1989; Kastritsis et al., 1992; Salter and Hicks, 1994) and to the release of AA (Gebicke-Haerter et al., 1988; Pearce et al., 1989; Bruner and Murphy, 1990). Stimulation of second messenger pathways by ATP is thought to regulate several properties of astrocytes, some of which may be involved in mechanisms of neural injury (Enkvist and McCarthy, 1992; Christjanson et al., 1993; Abbracchio et al., 1994; Neary et al., 1994; Sorg et al., 1995).

Various cytokines and growth factors are produced in the CNS under pathological conditions (e.g., bacterial or viral infections and neurodegenerative diseases) and participate in the remodeling of the affected area (Perry et al., 1993). One such cytokine, IL-1beta , which is primarily present in activated microglia or invading macrophages (Giulian et al., 1986; Hertier et al., 1988; Woodroofe et al., 1991) binds to high-affinity interleukin-1 (IL-1) receptors and induces a large variety of cellular responses (Dinarello, 1994). At low concentrations (in the pM range), IL-1beta binds to receptors present on astrocytes (Ban et al., 1993) and induces the expression of various genes (Benveniste et al., 1990; Negro et al., 1992; Théry et al., 1992; Das and Potter, 1995). In particular, IL-1beta has been shown to enhance the amounts of both secreted and cytosolic phospholipase A2 isoenzymes (sPLA2 and cPLA2) (Oka and Arita, 1991; Ozaki et al., 1994). This process may be responsible for the enhanced release of eicosanoids from astrocytes after cytokine treatment (Yamamoto et al., 1988; Katsuura et al., 1989).

Based on these observations, the present study was undertaken to determine whether IL-1beta modifies the second messenger signaling pathways stimulated by ATP. We have found that treating primary cultures of striatal astrocytes for 22-24 hr with IL-1beta enhances the ATP-evoked release of AA. The molecular mechanisms involved in the effect of the cytokine implicate both the induction of P2Y2 receptors and an increase in the amount of cPLA2. Therefore, by promoting the expression of these two proteins, IL-1beta reveals a functional P2Y2 signaling pathway that is absent in untreated astrocytes.

MATERIALS AND METHODS

Poly-L-ornithine (MW, 30,000-70,000), fatty acid-free BSA, ATP, UTP, 2MeS-ATP, thimerosal, pyruvate, PMA, histone III-S, phosphatidylserine, diolein, and human recombinant interleukin-6 (IL-6) were obtained from Sigma (St. Louis, MO); leupeptin, aprotinin, N-[1-(2,3-dioleoyloxy) propyl]N,N,N-trimethylammonium methylsulfate (DOTAP), adenosine deaminase (ADA), and glutamate-pyruvate transaminase (GPT) from Boehringer Mannheim (Mannheim, Germany); [3H]arachidonic acid ([3H]AA, 8.25 TBq), myo-[2-3H]inositol with PTG-271 (633 GBq/mmol), [gamma -32P]ATP (111 TBq/mmol), Hybond C-ECL nitrocellulose membranes, HRP-coupled anti-rabbit IgG antibodies and ECL reagent from Amersham (Arlington Heights, IL); autoradiographic films (Cronex) from Dupont (Wilmington, DE); MEM and F-12 nutrient from Life Technologies; Nu-Serum from Collaborative Research; human recombinant interleukin-1beta (IL-1beta , Saxon, CA); human recombinant interleukin-1alpha (IL-1alpha ) from Biosource International, Camarillo, CA, and oligonucleotides from GENSET, Paris, France. Rabbit anti-phospholipase A2 was a gift from L.-L. Lin, Genetics Institute, Cambridge, MA (Clark et al., 1991).

Cell culture. Primary cultures of striatal astrocytes were prepared as described previously (El-Etr et al., 1989). Briefly, striata were removed from 16-d-old Swiss mouse embryos (Iffa Credo, Lyon, France). Mechanically dissociated cells were plated (200,000 cells/ml) on either 12-well Falcon culture dishes (1 ml/well) or 90 mm dishes (12.5 ml/dish), previously coated with 1.5 µg/ml polyornithine. The culture medium consisted in a mixture of MEM and F-12 nutrient (1:1) supplemented with 33 mM glucose, 2 mM glutamine, 13 mM NaHCO3, 5 mM HEPES, pH 7.0, and 5% Nu-serum. Cells were cultured at 37°C for 18-21 d in a humidified atmosphere of 95% air/5% CO2. The culture medium was first changed on day 7, and cytosine arabinoside (2 µM) was added for 72 hr to avoid the formation of cell multilayers and the proliferation of microglia. On day 10, cells were rinsed once with PBS containing 33 mM glucose (PBSglc) and fresh culture medium was added. Thereafter, the culture medium was changed on days 14 and 17. Under these conditions, after 21 d in culture, >95% of the cells were stained by the indirect immunofluorescence technique using a rabbit antibody against GFAP (ICN, Costa Mesa, CA). The remaining 5% of the cells could be immature glioblasts, which are known to be unlabeled by GFAP antibodies (Cameron and Rakic, 1991). Cultures were devoid of microglial cells and neurons, because no immunostaining was observed using the monoclonal anti-mouse macrophage antibody anti-MAC 1 (Serotec) (Frei et al., 1987) and the anti-neurofilament-triplet antibodies (kindly provided by Dr. R. K. Liem, Columbia University), respectively (see Marin et al., 1993).

Measurement of [3H]AA release. The release of [3H]AA was measured as described previously (Stella et al., 1994) with slight modifications. Briefly, astrocytes cultured in 12-well dishes were labeled for 22-24 hr in a fresh culture medium containing [3H]AA (1 µCi/ml). Cells were then washed three times at 37°C with Locke-HEPES buffer (L-H buffer; 1 ml/well) containing (in mM): NaCl 145, KCl 5.5, CaCl2 1.1, MgCl2 1.1, NaHCO3 3.6, glucose 5.5, HEPES 20, pH 7.4, supplemented with fatty acid-free BSA (1 mg/ml). Cells were then preincubated for 10 min in the same medium containing thimerosal (50 µM) to inhibit AA reacylation (see Stella et al., 1994) and the adenosine degrading enzyme ADA (1 IU/ml) to prevent any possible modulating effect of endogenous adenosine (El-Etr et al., 1989). Cells were then exposed to the effectors for 15 min at 37°C in the same medium supplemented with GPT (5 IU) and 1 mM pyruvate to prevent the potentiation of the ATP-evoked release of AA by endogenous glutamate (Stella et al., 1994). Incubation media were recovered and centrifuged for 5 min at 200 × g to eliminate nonadherent cells, and the radioactivity was estimated in the supernatant. HPLC analysis, performed as described previously (Delumeau et al., 1991), indicated that >95% of the radioactivity is recovered in a peak having the same retention time as authentic AA.

Measurement of [3H]phospholipids by TLC. After 22-24 hr of labeling with [3H]AA, cells were washed three times with PBSglc. Ice-cold methanol (0.5 ml) containing 2% acetic acid was then added, cells were scraped off with a rubber policeman, culture dishes were rinsed twice with 0.5 ml methanol, and lysates were sonicated for 5 min. Lipids were extracted by adding 1.5 ml of CHCl3, 0.8 ml of H20, and 20,000 dpm of 1,2-di[14C]palmitoyl-phosphatidylcholine (112 mCi/mmol) to the combined methanolic solution of two dishes. The monophase was shaken and left for several hours at 4°C. CHCl3 and H2O (1.5 ml each; both ice-cold) were then added to disrupt the phases. Extracts were again vigorously shaken and left at 4°C overnight for the ensuing layers to separate. Aliquots of the lower CHCl3 phase were counted to determine the radioactivity, and this was used as an index of the phospholipid extraction efficiency. After extraction, lipids were dried, resuspended in CHCl3/CH3OH solution (5:1), and spotted on silica gel plates 60 (F254, Merck, Darmstadt, Germany) previously activated at 100°C for 30 min. Phospholipids were separated by bidimensional TLC with CHCl3/CH3OH/NH4 (25%)/H20 (87:52:5:5 by volume) and CHCl3/CH3OH/acetic acid/H20 (94:42:12:2 by volume). Spots were visualized with iodine vapor by using standards of the major phospholipids, and radioactivity was determined with 10 ml of Aquasol 2.

Measurement of [3H]inositol phosphate ([3H]IP) formation. The accumulation of [3H]IP was measured as previously described (Stella et al., 1994) with slight modifications. Briefly, astrocytes cultured in 12-well dishes were incubated for 22-24 hr in a fresh culture medium containing myo-[3H]inositol (2 µCi/ml). Cells were washed three times with L-H buffer at 37°C and then preincubated for 10 min in L-H buffer supplemented with lithium (10 mM) and ADA (1 IU/ml). Cells were then exposed to the effectors for 15 min at 37°C in the same medium supplemented with GPT (5 IU) and pyruvate (1 mM). The incubation was stopped by adding successively 0.1% Triton X-100 in 0.1 M NaOH (400 µl) and 0.1% Triton X-100 in 0.1 M HCl (400 µl). Lysates were recovered, and [3H]IPs were then extracted and estimated as described previously (El-Etr et al., 1989).

RNA isolation and reverse transcriptase polymerase chain reaction (RT/PCR). RNA was isolated from untreated or IL-1beta -treated astrocytes grown in 90 mm dishes by lysing the cells with guanidium isothiocyanate and subsequent extraction with acidified phenol and chloroform (1:1) (Chomczynski and Sacchi, 1987). After total RNA extraction, first-strand DNA synthesis was performed with Avian Myeloblastosis Virus reverse transcriptase (AMVRT, Boehringer Mannheim) after priming with an oligo-(dT)18. The reaction mixture contained 50 mM Tris, 30 mM KCl, 8 mM MgCl2, 1 mM dithiothreitol, 0.1% BSA, 25 IU of RNase inhibitor, and 0.4 mM dATP, dCTP, dTTP, and dGTP. The cDNA was used as template in a PCR containing two P2Y2-specific oligonucleotides: GACCTGGAACCCTGGAATAGCACCA and CTCCCCAGGCACCGGTGCACGCTGAT, sense and antisense corresponding to amino acid 4-13 and 126-136, respectively. Mouse genomic DNA was used as a positive control. Cycling parameters were 94°C for 30 sec, 57°C for 45 sec, and 70°C for 1 min for 30 cycles and a final incubation at 72°C for 10 min. Amplified products were resolved by agarose gel electrophoresis. The 396 bp PCR product was isolated from the gel (Qiaex extraction kit, Qiagen, Hilden, Germany), inserted into the PCRII vector using the TA cloning kit (Invitrogen, San Diego, CA) and sequenced using modified T7 polymerase (sequenase kit, Amersham).

Oligodeoxynucleotide treatment. The antisense phosphorothioate oligodeoxynucleotides (Genset SA) P2Y2-AS 5'-CAG GTC TGC TGC CAT-3' and the scrambled phosphorothioate oligodeoxynucleotides P2Y2-SCR 5'-GTG CCT GTA CGT ACC-3' were used to treat the cells. Astrocytes cultured in 12-well dishes were incubated for 8 hr with a fresh culture medium containing oligodeoxynucleotides (10 µg) and DOTAP (10 mg/ml). DOTAP was applied to enhance the uptake of oligodeoxynucleotides into the cells (Bennet et al., 1992; Capaccioli et al., 1993). [3H]AA (1 µCi/well) and cytokines were then added to the cells for 22-24 hr.

Measurement of protein kinase C (PKC) activity. Astrocytes grown in 90 mm dishes were washed three times with ice-cold PBSglc and then scraped into 5 ml of lysis buffer containing (in mM): 10 MgCl2, 2 EDTA, 0.5 EGTA, 1 phenyl methyl sulfonyl fluoride, 5 dithiothreitol, as well as 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 20 mM Tris-HCl, pH 7.4. Unless otherwise stated, all following procedures were performed at 4°C. Cell suspension was homogenized with a loose-fitting glass-glass Dounce homogenizer and centrifuged for 12 min at 180,000 × g. Supernatant (cytosolic fraction) was retained, and the pellet (membrane fraction) was resuspended by homogenization into 5 ml of lysis buffer, stirred with 1% Nonidet P-40 for 1 hr, and then centrifuged for 12 min at 180,000 × g. Resulting detergent-solubilized membranes and cytosolic fractions were applied to DE-52 columns (1 ml) previously equilibrated with the lysis buffer. Columns were then washed with 6 ml of lysis buffer, and PKC was eluted with 2 ml of lysis buffer supplemented with 150 mM NaCl. PKC activities in the cytosolic and membrane fractions (30 µl DE-52 eluate) were assayed in a 20 mM Tris-HCl buffer, pH 7.4, with 10 mM MgCl2, 1.5 mM CaCl2, 0.8 µg diolein, and 5 µg phosphatidylserine (total volume 100 µl) with 50 µg histone III-S as substrate. The reaction was started by adding 10 µl gamma -[32P]ATP (100 µM, 0.5 µCi/assay), performed at 30°C for 10 min (the reaction is linear for 10 min) and stopped by adding 20 µl ice-cold phosphoric acid (150 mM). Histones were retained on ion-exchange filters (Watman P-81). PKC activity was defined as the difference between [32P] incorporated into histones in the presence or absence of calcium, phosphatidylserine, and diolein and was expressed as total nanomoles of ATP incorporated into histones during a 10 min incubation. Protein concentrations were measured according to the method described by Bradford (1976) using BSA as standard. Treatment with IL-1beta for 22-24 hr did not significantly change the total protein content of astrocytes per well.

cPLA2 analysis by Western blotting. After a typical [3H]AA release experiment, the incubation L-H buffer medium was removed, cells were solubilized in 1% (wt/vol) SDS, and the homogenate was boiled for 5 min. Protein concentration was determined with a bicinchoninic acid method (Smith et al., 1985) using BSA as standard. Samples containing equal amounts of proteins (100 µg) were mixed with Laemmli sample buffer (Laemmli, 1970) and loaded onto 8% (wt/vol) polyacrylamide gels for SDS-PAGE. Proteins were transferred electrophoretically to nitrocellulose sheets (Towbin et al., 1979). Immunoblot analysis was performed with rabbit anti-cPLA2 antibodies in 150 mM NaCl, 5% (wt/vol) free-fat dry milk and 50 mM Tris-HCl, pH 7.4. Immunoreactivity was detected with ECL (New England Nuclear, Boston, MA) using HRP-coupled donkey anti-rabbit secondary antibodies (Amersham). Immunoreactive bands were quantified using a computer-assisted densitometer (IMSTAR, Paris, France).

Statistical analysis. Results are expressed in (percent of the control ATP response), where data = response in the presence of all the agents tested - corresponding basal AA response (i.e., in the absence of ATP)/response evoked by 200 µM ATP from untreated cells - basal AA release from untreated cells. Data are expressed as mean ± SEM of n independent determinations and were statistically analyzed using InStat (GraphPad Software, San Diego, CA).

RESULTS

Activation of IL-1 receptors enhances the ATP-evoked release of [3H]AA

ATP stimulated the release of [3H]AA from striatal astrocytes in primary culture (Fig. 1) (Stella et al., 1994). Treatment of astrocytes for 22-24 hr with increasing concentrations of IL-1beta enhanced the release of [3H]AA evoked by the maximally effective concentration of ATP (200 µM) (Fig. 1). IL-1beta treatment enhanced basal [3H]AA release by only 40% (Fig. 1), whereas it induced a doubling of the ATP response (Fig. 2A). The ATP-evoked release of [3H]AA was not changed when IL-1beta (100 pM) was applied simultaneously with ATP (Table 1).
Fig. 1. Effect of increasing concentrations of IL-1beta on the ATP-evoked release of [3H]AA from striatal astrocytes. Striatal astrocytes were treated for 22-24 hr with increasing concentrations of IL-1beta and then [3H]AA release was estimated during 15 min in the absence (basal) or presence of ATP (200 µM), as described in Materials and Methods. Each data point corresponds to the mean ± SEM of n = 12 determinations from four independent experiments performed in triplicate. The EC50 for IL-1beta is approx  5 pM.
[View Larger Version of this Image (22K GIF file)]

Fig. 2. Enhancement by IL-1beta of the ATP-evoked release of [3H]AA but not of the evoked accumulation of [3H]IPs. Both [3H]AA release (A) and [3H]IPs accumulation (B) were estimated in the presence of increasing concentrations of ATP in striatal astrocytes, which were either untreated (-IL-1beta ) or treated (+IL-1beta ) with IL-1beta (100 pM) for 22-24 hr, as described in Materials and Methods. Each data point corresponds to the mean ± SEM of n = 12 determinations from four independent experiments performed in triplicate and is expressed in percent of the control ATP response measured in the same experiment.
[View Larger Version of this Image (22K GIF file)]

Table 1. Activation of the IL-1 receptor enhances the ATP-evoked release of [3H]AA

Cytokine treatments ATP-evoked release of [3H]AA (% of the control ATP response)
IL-1beta 15 min 106  ± 6
IL-1beta 22 -24 hr 211  ± 9*
IL-1alpha 22 -24 hr 170  ± 9*
IL-1beta  + IL-1alpha 22 -24 hr 186  ± 19*
IL-1ra 23 hr 87  ± 5
IL-1ra + IL-1beta 23 and 22 hr 99  ± 7
IL-6 22 -24 hr 96  ± 3
Astrocytes were treated for the indicated period with IL-1beta (100 pM), IL-1alpha (100 pM), IL-6 (100 pM), and the IL-1 receptor antagonist IL-1ra (10 nM). [3H]AA release evoked by ATP (200 µM) was then estimated, as described in Materials and Methods. Each data point corresponds to the mean ± SEM of n = 9 determinations from three independent experiments performed in triplicate. Data are expressed in percent of the control ATP (200 µM)-evoked release of AA measured in the same experiment in -IL-1beta cells. * p > 0.01: significantly different from the control ATP response (ANOVA followed by Dunnett's test).

Involvement of IL-1 receptors was demonstrated by using the IL-1 receptor antagonist protein IL-1ra (Hannum et al., 1990). IL-1ra (10 nM) completely prevented the enhancing effect of IL-1beta on the ATP-evoked release of [3H]AA (Table 1) as well as its small effects on basal [3H]AA release (data not shown). IL-1alpha , which is also an agonist of IL-1 receptors (Sims et al., 1988), reproduced the enhancing effect of IL-1beta on the ATP response (Table 1). Furthermore, as expected for two cytokines acting on common IL-1 receptors, enhancing effects of IL-1alpha and IL-1beta were not additive (Table 1). It has been described previously that astrocytes produce and secrete IL-6 in response to IL-1beta (Benveniste et al., 1990); therefore, we examined whether IL-6 could account for the effect of IL-1beta . However, IL-6 did not change the ATP-evoked release of [3H]AA (Table 1).

Activation of IL-1 receptors does not affect the ATP-induced accumulation of [3H]IPs

ATP not only evokes the release of [3H]AA, but also strongly stimulates the accumulation of [3H]IPs in striatal astrocytes (Stella et al., 1994). However, IL-1beta treatment only marginally affected both the efficacy and the potency of ATP in stimulating the accumulation of [3H]IPs (Fig. 2B).

IL-1beta induces the expression of a functional P2Y2 receptor gene

To investigate the molecular mechanism involved in the effect of IL-1beta on the ATP-evoked release of AA, we first determined whether treatment of astrocytes with the cytokine would induce a modification in the expression of purinoceptors.

Treatment of astrocytes with Il-1beta changed the efficacy of ATP in releasing [3H]AA but not its potency (EC50 approx  10 µM) (Fig. 2B). This result suggests that if IL-1beta induces the expression of a purinoceptor, this receptor should also be activated by ATP with an EC50 in the µM range. Seven subtypes of P2Y receptors have been identified (P2Y1: Webb et al., 1993; P2Y2: Lustig et al., 1993; P2Y3: Webb et al., 1996a; P2Y4: Communi et al., 1995; Nguyen et al., 1995; P2Y5: Webb et al., 1996b; P2Y6: Chang et al., 1995; P2Y7: Akbar et al., 1996). Among these receptors, solely P2Y1 and P2Y2 receptors are activate by ATP with an EC50 in the µM range.

We first used a pharmacological approach to investigate whether the expression of P2Y1 or P2Y2 receptors was induced by IL-1beta in astrocytes. At present, purinoceptors can only be distinguished by selective agonists, because specific antagonists are not available (Harden et al., 1995). It has been shown that P2Y1 receptors are fully activated by 1 µM 2MeS-ATP (Filtz et al., 1994). At 1 µM, 2MeS-ATP evoked a significant release of [3H]AA from untreated astrocytes, yet this response was not affected by treating astrocytes with IL-1beta (Table 2). It has been shown that P2Y2 receptors are fully activated by 10 µM UTP (Lustig et al., 1993). At 10 µM, UTP did not evoke a significant release of [3H]AA from untreated astrocytes, whereas it evoked a strong response in IL-1beta -treated astrocytes (Table 2). These results, although not conclusive, suggest an induced expression in P2Y2 receptors after IL-1beta treatment.

Table 2. Effects of purinoceptor agonists on the release of [3H]AA

Agents µM [3H]AA release (% of the control ATP response)
 -IL-1beta +IL-1beta
UTP 10 14  ± 4 84  ± 12**
2 MeS-ATP 1 40  ± 5 45  ± 9
Astrocytes were either untreated (-IL-1beta ) or treated for 22-24 hr with 100 pM IL-1beta (+IL-1beta ). Cells were then incubated for 15 min with the purinoceptor agonists used at the indicated concentrations. Each data point corresponds to the mean ± SEM of n = 9 determinations from three independent experiments performed in triplicate. Data are expressed in percent of the control ATP (200 µM)-evoked release of AA measured in the same experiments in -IL-1beta cells. ** p < 0.01 was found when compared with -IL-1beta condition (two-tailed unpaired Student's t test).

To assess whether the expression of P2Y2 receptors was indeed induced in IL-1beta -treated astrocytes, we performed RT/PCR analysis using specific primers (see Materials and Methods) and astrocytic cDNA as template. The 396 bp PCR product (isolated, subcloned, and sequenced) corresponding to the N-terminal of the mouse P2Y2 receptor (amino acid 4-136) was detected in astrocytes treated with IL-1beta but not in untreated cells (Fig. 3A).

Fig. 3. Expression of P2Y2 receptors and inhibitory effect of P2Y2 receptor oligodeoxynucleotides on the IL-1beta -evoked release of [3H]AA. A, Total RNA (0.5 µM) isolated from untreated or IL-1beta -treated astrocytes was reverse transcribed, and the recombinant sequence was amplified by PCR using specific mouse P2Y2 receptor primers (see Materials and Methods). Shown is one PCR product repeated three times with similar results. Lane 1 shows the assay in the absence of DNA, lane 2 RNA from untreated astrocytes, lane 3 IL-1beta -treated astrocytes, lane 4 mouse genomic DNA was used as positive control. M, Molecular weight marker. As a control in the RT step, the cDNA corresponding to a phosphoprotein present in astrocytes, PEA-15, was amplified from both untreated and IL-1beta -treated astrocytes (data not shown) (Estellés et al., 1996). B, Astrocytes were pretreated for 8 hr in the presence of 10 mg/ml DOTAP and 10 µM antisense (P2Y2-AS) or scrambled (P2Y2-SCR) oligonucleotides. Then, cells were either untreated (-IL-1beta ) or treated (+IL-1beta ) with IL-1beta (100 pM) for 22-24 hr. [3H]AA release was estimated in the presence of UTP (10 µM) or ATP (200 µM) as described in Materials and Methods. Each data point corresponds to the mean ± SEM of n = 9 determinations from three independent experiments performed in triplicate and is expressed in percent of the control ATP (200 µM)-evoked release of AA measured in the same experiment. Further supporting the specificity of oligodeoxynucleotides is the observation showing that P2Y2-AS did not change a receptor-independent-evoked release of [3H]AA resulting from the combined application of PMA (0.1 µM) and ionomycin (2 µM) in IL-1beta -treated cells and that P2Y2-SCR had a small nonspecific enhancing effect (data not shown).
[View Larger Version of this Image (39K GIF file)]

To prevent the expression of P2Y2 receptors induced by the cytokine treatment, an antisense oligodeoxynucleotide directed against the ATG initiation codon of this receptor was designed (P2Y2-AS; see Materials and Methods). Pretreatment of the astrocytes with P2Y2-AS indeed abolished the UTP (10 µM)-evoked release of [3H]AA observed in IL-1beta -treated astrocytes (Fig. 3B). We then addressed the question of whether an induction of P2Y2 receptors could be responsible for the enhanced ATP response observed in IL-1beta -treated cells. Pretreating astrocytes with P2Y2-AS resulted in a significant reduction of the ATP (200 µM)-evoked release of [3H]AA from IL-1beta -treated astrocytes but did not alter the ATP response in untreated cells (Fig. 3B).

As a control in the oligodeoxynucleotide treatment step, we used scrambled oligodeoxynucleotides (P2Y2-SCR). Pretreating astrocytes with P2Y2-SCR did not result in a lowering of either the UTP- or the ATP-evoked release of [3H]AA (Fig. 3B). Intriguingly, we observed a nonspecific enhancement of each agonist-evoked release of [3H]AA that we studied, this effect being independent of whether astrocytes were treated with IL-1beta (Fig. 3B).

IL-1beta treatment enhances the amount of cytosolic PLA2

Is an induction of P2Y2 receptors the sole molecular mechanism responsible for the enhancing effect of IL-1beta on the ATP-evoked release of AA from astrocytes? It is known that IL-1beta increases the expression of cPLA2 (Lin et al., 1992). Therefore, we measured the release of [3H]AA evoked by a direct stimulation of cPLA2 activity. Receptor-independent-evoked release of [3H]AA can be measured by the concomitant activation of PKC and the increase in [Ca2+]i (two processes that are involved in the activation of cPLA2) (Lin et al., 1992, 1993). Treatment of astrocytes with increasing concentrations of IL-1beta progressively enhanced the evoked release of [3H]AA induced by the co-application of PMA (0.1 µM) and ionomycin (2 µM) (Fig. 4). At 100 pM, IL-1beta enhanced by fourfold the receptor-independent-evoked release of [3H]AA.
Fig. 4. Stimulatory effect of increasing concentrations of IL-1beta on the receptor-independent-evoked release of [3H]AA and on the amount of cPLA2. [3H]AA release was estimated as described in Materials and Methods in either the absence (basal) or the presence of PMA (0.1 µM) + ionomycin (iono, 2 µM) from astrocytes treated for 22-24 hr with increasing concentrations of IL-1beta . Each data point corresponds to the mean ± SEM of n = 9 determinations from three independent experiments performed in triplicate. The maximal effective concentration for IL-1beta is approx  50 pM and its EC50 approx  5 pM; inset, astrocytes were treated or not treated for 22-24 hr with IL-1beta (100 pM). Quantification of the amount of cPLA2 was performed by Western blotting using an anti-cPLA2 antibody, as described in Materials and Methods.
[View Larger Version of this Image (29K GIF file)]

This enhancing effect of IL-1beta on the receptor-independent-evoked release of [3H]AA did not result from an increased incorporation of [3H]AA into the putative substrates of cPLA2. Indeed, as estimated by TLC, the total incorporation of [3H]AA into the entire phospholipid fraction was not significantly modified by the cytokine treatment (data not shown), nor was its partition in the different phospholipid subclasses: phosphatidylcholine (30 ± 1%; 30 ± 2%), phosphatidylinositol/phosphatidylserine (30 ± 2%; 33 ± 1%), phosphatidylethanolamine (40 ± 1%; 37 ± 3%), in the presence or absence of IL-1beta , respectively (n = 9).

Using specific antibodies directed against cPLA2 and subsequent quantification of the immunoreactive bands by computer-assisted densitometer, we investigated whether IL-1beta treatment could enhance the expression of this enzyme. Indeed, the amount of cPLA2 was increased by 4.5-fold in astrocytes treated with the cytokine (see Fig. 4, inset).

PKC activity is required in the P2Y2 receptor-mediated release of [3H]AA

What are the proteins involved in transducing an activation of P2Y2 receptors to a stimulation of cPLA2 activity? Several observations suggest that PKC activity is necessary in the enhanced ATP-evoked release of AA observed in IL-1beta -treated astrocytes. We found that both staurosporine (0.2 µM; data not shown) and the selective PKC inhibitor Ro 31-8220 (3 µM) prevented the enhancement of the ATP (200 µM)-evoked release of [3H]AA (Fig. 5). Also, prolonged application of PMA (1 µM for 22-24 hr) reduced by 81 ± 4% the total activity of PKC (n = 9) and prevented the enhancing effect of IL-1beta on the ATP-evoked response (Fig. 5). This treatment also strongly reduced the UTP (10 µM)-evoked release of [3H]AA in cytokine-treated cells (Fig. 5). By contrast, in untreated astrocytes, PKC inhibitors or PKC downregulation did not affect or only slightly affected the ATP-evoked release of [3H]AA (Fig. 5).
Fig. 5. Effect of a PKC inhibitor or long-term PMA treatment on the release of [3H]AA evoked by ATP or UTP. Astrocytes were either untreated (-IL-1beta ) or treated (+IL-1beta ) with IL-1beta (100 pM) for 22-24 hr in either the presence or the absence of PMA (1 µM), as indicated in Materials and Methods. [3H]AA release was estimated in the presence of ATP (200 µM) or UTP (10 µM), as described in Materials and Methods. PKC inhibitor Ro 31-8220 (3 µM) was present only during the stimulation period. Each data point corresponds to the mean ± SEM of n = 9 determinations from three independent experiments performed in triplicate and is expressed in percent of the control ATP (200 µM)-evoked release of AA measured in the same experiment.
[View Larger Version of this Image (27K GIF file)]

Additional experiments indicated that the PKC dependency of the IL-1beta - induced enhancement of the ATP-evoked release of [3H]AA did not result from an upregulation or a mobilization of PKC activity. The cellular repartition of PKC activity (i.e., soluble and particulate fractions) was not changed by the cytokine treatment: (in nanomoles of 32P incorporated during 10 min incubation per milligram of protein): soluble fraction, 10.9 ± 0.4 and 9.8 ± 05; particulate fraction, 4.1 ± 0.4 and 5.4 ± 0.5 in untreated and IL-1beta -treated cells, respectively (n = 9).

DISCUSSION

In the present study, we demonstrate that IL-1beta modifies the population of functional purinoceptors present on astrocytes. By inducing the expression of P2Y2 (P2U) receptors, IL-1beta enhances the ATP-evoked release of AA. Also, we present evidence showing that stimulation of these newly expressed P2Y2 receptors by ATP enhances cPLA2 activity in a PKC-dependent manner.

P2Y2 receptors appear to be absent in untreated astrocytes. In support of this conclusion, it was observed that (1) a concentration of UTP shown to be maximally effective on cells expressing the P2Y2 receptor cDNA (i.e., 10 µM) (see Lustig et al., 1993; Erb et al., 1995) was without effect on the release of AA from untreated astrocytes (Table 2); (2) exposure of untreated astrocytes to P2Y2-AS oligodeoxynucleotides did not affect the ATP-evoked release of AA (Fig. 3B); and (3) in four independent PCR reactions, we were never able to amplify P2Y2 mRNA (Fig. 3A). These results suggest that expression of the P2Y2 receptor gene is under the control of a promotor induced by the signaling pathway coupled to an activation of IL-1 receptors.

Expression of functional P2Y2 receptors in IL-1beta -treated cells may not be solely responsible for the enhancement of the ATP-evoked release of AA, because a marked increase in the amount of cPLA2 was also detected in our experiments. This result is in agreement with those obtained in both glioma cells and fibroblasts treated with the cytokine (Lin et al., 1992; Ozaki et al., 1994). The IL-1beta treatment increased fourfold the release of AA stimulated by application of PMA and ionomycin. This effect was associated with a similar fourfold increase in the amount of cPLA2 (Fig. 4). Previous studies have demonstrated that cPLA2 is activated by PKC (Lin et al., 1993). Because downregulation and inhibition of PKC activity abolished both the UTP-evoked release of AA and the enhancement of the ATP response in IL-1beta -treated astrocytes (Fig. 5), it seems likely that both agonists bind to the newly synthesized P2Y2 receptors, which subsequently activate cPLA2 in a PKC-dependent manner. On the other hand, the ATP-evoked release of AA from untreated astrocytes could involve other types of PLA2 isoenzymes, because this process did not depend on PKC activity (Fig. 5).

What is the physiopathological relevance of these results? It has been shown that during acute brain inflammation (such as that which occurs in cerebral ischemia and traumatic brain injury) or during chronic neurodegeneration (amyotrophic lateral sclerosis and scrapie), invading macrophages or microglia are activated and produce IL-1beta (for review, see Perry et al., 1995). IL-1beta can, in turn, activate IL-1 receptors on astrocytes and induce gene expression. We have shown here that IL-1beta reveals a functional signaling pathway at the P2Y2 receptor, which results in an increase of the ATP-evoked release of AA. In previous studies performed on striatal astrocytes, we have shown that glutamate also evokes AA release and that a synergistic response is observed when glutamate is applied together with ATP (Stella et al., 1994). Such synergistic response is enhanced further by IL-1beta (our unpublished observations). Therefore, the combined release of IL-1beta from inflammatory cells and of glutamate and ATP from nerve terminals may cause a dramatic increase in the levels of nonesterified AA.

Free AA decreases glutamate reuptake by astrocytes and neurons (Yu et al., 1986; Barbour et al., 1989). Because both ATP and glutamate evoke the release of AA (see also Dumuis et al., 1988, 1990; Lazarewicz et al., 1988), it is possible that the combined actions of these neurotransmitter and IL-1beta may constitute a feedforward mechanism that enhances the extracellular concentrations of glutamate. In support of this hypothesis are studies showing that extracellular concentrations of glutamate are increased during cerebral ischemia, a response linked to AA formation (Bazan, 1970; Katchman and Hershkowitz, 1994).

High levels of free AA can cause neuronal damage either directly (Okuda et al., 1994) or by enhancing glutamate-mediated toxicity (Choi, 1988; Miller et al., 1992). Because the levels of both glutamate and ATP may be further enhanced as a consequence of cell death (Gordon, 1986), the concomitant presence of high levels of these molecules may again constitute a feedforward mechanism, which compromises neuro-astrocytic interactions and leads to neuronal death. Finally, IL-1beta has also been shown to perturb the finely tuned energy supply from astrocytes to neurons, i.e., by enhancing glucose uptake into astrocytes, a process that may render neurons more prone to neurodegeneration (Yu et al., 1995) (for review, see Magistretti et al., 1995).

Together, these lines of evidence suggest that during inflammatory conditions in the brain, glutamate, ATP, and IL-1beta may cooperate in enhancing the release of AA. They may in turn aggravate glutamate neurotoxicity, establishing a feedforward mechanism that may contribute to cerebral tissue damage and neuronal death.

FOOTNOTES

Received Jan. 2, 1997; revised Feb. 5, 1997; accepted Feb. 10, 1997.

  

We wish to express our gratitude to Drs. Jean-Antoine Girault, Stephen Jenkinson, and Joe Gally for helpful suggestions.

Correspondence should be addressed to Dr. Nephi Stella, The Neurosciences Institute, 10640 John J. Hopkins Drive, San Diego, CA 92121


REFERENCES

  • Abbracchio MP, Saffrey MJ, Höpker V, Burnstock G (1994) Modulation of astroglial cell proliferation by analogues of adenosine and ATP in primary cultures of rat striatum. Neuroscience 59:67-76[Web of Science][Medline].
  • Akbar MGK, Dasari RV, Webb TE, Ayyanathan K, Pillarisetti K, Sandhu AK, Athwal RS, Daniel JL, Ashby B, Barnard EA, Kunapuli SP (1996) Molecular cloning of a novel P2 purinoceptor from human erythroleukemia cells. J Biol Chem 271:18363-18367[Abstract/Free Full Text].
  • Ban EM, Sarliève LL, Haour FG (1993) Interleukin-1 binding sites on astrocytes. Neuroscience 52:725-733[Web of Science][Medline].
  • Barbour B, Szatkowski M, Ingledew N, Attwell D (1989) Arachidonic acid induces a prolonged inhibition of glutamate uptake into glial cells. Nature 342:918-920[Medline].
  • Bazan NG (1970) Effects of ischemia and electroconvulsive shock on fatty acid pool in the brain. BBA 218:1-10.
  • Bennet C, Chiang M-Y, Chan H, Shoemaker J, Mirabelli C (1992) Cationic lipids enhance cellular uptake and activity of phosphorothioate antisense oligonucleotides. Mol Pharmacol 41:1023-1033[Abstract].
  • Benveniste EN, Sparacio SM, Norris JG, Grenett HE, Fuller GM (1990) Induction and regulation of interleukin-6 gene expression in rat astrocytes. J Neuroimmunol 30:201-212[Web of Science][Medline].
  • Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annu Rev Biochem 72:248-254.
  • Bruner G, Murphy S (1990) ATP-evoked arachidonic acid mobilization in astrocytes is via a P2y-purinergic receptor. J Neurochem 55:1569-1575[Web of Science][Medline].
  • Cameron RS, Rakic P (1991) Glial cell lineage in the cerebral cortex: a review and synthesis. Glia 4:124-137[Web of Science][Medline].
  • Capaccioli S, Di Pasquale G, Mini E, Mazzei T, Quattrone A (1993) Cationic lipids improve antisense oligonucleotide uptake and prevent degradation in cultured cells and human serum. Biochem Biophys Res Commun 197:812-825[Web of Science][Medline].
  • Chang K, Hanaoka K, Kumada M, Takuwa Y (1995) Molecular cloning and functional analysis of a novel P2 nucleotide receptor. J Biol Chem 270:26152-26158[Abstract/Free Full Text].
  • Choi DW (1988) Glutamate neurotoxicity and diseases of the nervous system. Neuron 1:623-634[Web of Science][Medline].
  • Chomczynski P, Sacchi N (1987) Single step method of RNA isolation by acid guanidium thyocyanate phenol chloroform extraction. Annu Rev Biochem 162:156-159.
  • Christjanson LJ, Middlemiss PJ, Rathbone MP (1993) Stimulation of astrocyte proliferation by purine and pyrimidine nucleotides and nucleosides. Glia 7:176-182[Web of Science][Medline].
  • Clark JD, Lin L-L, Kriz RW, Ramesha CS, Sultzman LA, Lin AY, Milona N, Knopf JL (1991) A novel arachidonic acid-selective cytosolic PLA2 contains a Ca++-dependent translocation domain with homology to PKC and GAP. Cell 65:1043-1051[Web of Science][Medline].
  • Communi D, Pirotton S, Parmentier M, Boeynaems J-M (1995) Cloning and functional expression of a human uridine nucleotide receptor. J Biol Chem 270:30849-30852[Abstract/Free Full Text].
  • Das S, Potter H (1995) Expression of the Alzheimer amyloid-promoting factor antichymotrypsin is induced in human astrocytes by IL-1. Cell 14:447-456.
  • Delumeau J-C, Tencé M, Marin P, Cordier J, Glowinski J, Prémont J (1991) Synergistic regulation of cytosolic Ca2+ concentration by adenosine and alpha 1-adrenergic agonists in mouse striatal astrocytes. Eur J Neurosci 3:539-550[Web of Science][Medline].
  • Dinarello CA (1994) The interleukin-1 family: 10 years of discovery. FASEB J 8:1314-1325[Abstract].
  • Dumuis A, Sebben M, Haynes L, Pin J-P, Bockaert J (1988) NMDA receptors activate the arachidonic acid cascade system in striatal neurons. Nature 336:68-70[Medline].
  • Dumuis A, Pin J-P, Oomagari K, Sebben M, Bockaert J (1990) Arachidonic acid released from striatal neurons by joint stimulation of ionotropic and metabotropic quisqualate receptors. Nature 347:182-184[Medline].
  • Edwards FA, Gibbs AJ, Colquhoun D (1992) ATP receptor-mediated synaptic currents in the central nervous system. Nature 359:144-147[Medline].
  • El-Etr M, Cordier J, Glowinski J, Prémont J (1989) A neuroglial cooperativity is required for the potentiation by 2-chloroadenosine of the muscarinic-sensitive phospholipase C in the striatum. J Neurosci 9:1473-1480[Abstract].
  • Enkvist MOK, McCarthy KD (1992) Activation of protein kinase C blocks astroglial gap junction communication and inhibits the spread of calcium waves. J Neurochem 59:519-526[Web of Science][Medline].
  • Erb L, Garrad R, Wang Y, Quinn T, Turner JT, Weisman GA (1995) Site-directed mutagenesis of P2U purinoceptors. J Biol Chem 270:4185-4188[Abstract/Free Full Text].
  • Estellés A, Yokoyama M, Nothias F, Vincent J-D, Glowinski J, Vernier P, Chneiweiss H (1996) The major astrocytic phosphoprotein PEA-15 is encoded by two mRNAs conserved on their full length in mouse and human. J Biol Chem 271:14800-14806[Abstract/Free Full Text].
  • Evans RJ, Derkach V, Surprenant A (1992) ATP mediates fast synaptic transmission in mammalian neurons. Nature 357:503-505[Medline].
  • Filtz TM, Li Q, Boyer JL, Nicholas RA, Harden TK (1994) Expression of a cloned P2Y purinergic receptor that couples to phospholipase C. Mol Pharmacol 46:8-14[Abstract].
  • Fredholm BB, Abbracchio MP, Burnstock G, Daly JW, Harden KT, Jacobson KA, Leff P, Williams M (1994) Nomenclature and classification of purinoceptors. Pharmacol Rev 46:143-156[Web of Science][Medline].
  • Frei K, Siepl C, Groscurth P, Bodmer S, Schwerdel C, Fontana A (1987) Antigen presentation and tumor cytotoxicity by interferon-gamma -treated microglia cells. Eur J Immunol 17:1271-1278[Web of Science][Medline].
  • Galligan JJ, Bertrand PP (1994) ATP mediates fast synaptic potentials in enteric neurons. J Neurosci 14:7563-7571[Abstract].
  • Gebicke-Haerter PJ, Wurster S, Schobert A, Hertting G (1988) P2-purinoceptor induced prostaglandin synthesis in primary rat astrocyte cultures. Naunyn Schmiedebergs Arch Pharmacol 338:704-707[Web of Science][Medline].
  • Giulian D, Baker TJ, Shih L-CN, Lachman LB (1986) Interleukin-1 of the central nervous system is produced by ameboid microglia. J Exp Med 164:594-604[Abstract/Free Full Text].
  • Gordon JL (1986) Extracellular ATP: effects, source and fate. Biochem J 233:309-319[Web of Science][Medline].
  • Hannum CH, Wilcox CJ, Arend WP, Joslin FG, Dripps DJ, Heimdal PL, Armes LG, Sommer A, Eisenberg SP, Thompson RC (1990) Interleukin-1 receptor antagonist activity of a human interleukin-1 inhibitor. Nature 343:336-340[Medline].
  • Harden TK, Boyer JL, Nicholas RA (1995) P2-purinergic receptors: subtype-associated signaling responses and structure. In: Annual review of pharmacology and toxicology (Cho AK, Blaschke TF, Loh HH, Way JL, eds), pp 541-579. Palo Alto, CA.
  • Hertier E, Ayala J, Denèffle P, Bousseau A, Rouget P, Mallat M, Prochiantz A (1988) Brain macrophages synthesize interleukin-1 and interleukin-1 mRNAs in vitro. J Neurosci Res 21:391-397[Web of Science][Medline].
  • Kastritsis CHC, Salm AK, McCarthy KD (1992) Stimulation of the P2y purinergic receptor on type 1 astroglia results in inositol phosphate formation and calcium mobilization. J Neurochem 58:1277-1284[Web of Science][Medline].
  • Katchman AN, Hershkowitz N (1994) Arachidonic acid participates in the anoxia-induced increase in mEPSC frequency in CA1 neurons of the rat hippocampus. Neurosci Lett 168:217-220[Web of Science][Medline].
  • Katsuura G, Gottschall PE, Dahl RR, Arimura A (1989) Interleukin-1 BETA increases prostaglandin E2 in rat astrocyte cultures: modulatory effect of neuropeptides. Endocrinology 124:3125-3127[Abstract/Free Full Text].
  • Laemmli UK (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
  • Lazarewicz JW, Wroblewski JT, Palmer ME, Costa E (1988) Activation of N-methyl-D-aspartate-sensitive glutamate receptors stimulates arachidonic acid releases in primary cultures of cerebellar granule cells. Neuropharmacology 27:765-769[Web of Science][Medline].
  • Lin L-L, Lin AY, DeWitt DL (1992a) Interleukin-1alpha induces the accumulation of cytosolic phospholipase A2 and the release of prostaglandin E2 in human fibroblasts. J Biol Chem 267:23451-23454[Abstract/Free Full Text].
  • Lin L-L, Lin AY, Knopf JL (1992b) Cytosolic phospholipase A2 is coupled to hormonally regulated release of arachidonic acid. Proc Natl Acad Sci USA 89:6147-6151[Abstract/Free Full Text].
  • Lin L-L, Wartmann M, Lin AY, Knopf JL, Seth A, Davis RJ (1993) cPLA2 is phosphorylated and activated by MAP kinase. Cell 72:269-278[Web of Science][Medline].
  • Lustig KD, Shiau AK, Brake AJ, Julius D (1993) Expression cloning of an ATP receptor from mouse neuroblastoma cells. Proc Natl Acad Sci USA 90:5113-5117[Abstract/Free Full Text].
  • Magistretti PJ, Pellerin L, Martin J-L (1995) Brain energy metabolism: an integrated cellular perspective. In: Psychopharmacology (Kupfer FEBDJ, ed), pp 657-670. New York: Raven.
  • Marin P, Stella N, Cordier J, Glowinski J, Prémont J (1993) Role of arachidonic acid and glutamate in the formation of inositol phosphates induced by noradrenalin in striatal astrocytes. Mol Pharmacol 44:1176-1184[Abstract].
  • Miller B, Sarantis M, Traynelis SF, Attwell D (1992) Potentiation of NMDA receptor currents by arachidonic acid. Nature 355:722-725[Medline].
  • Neary JT, Whittemore SR, Zhu Q, Norenberg MD (1994) Synergistic activation of DNA synthesis in astrocytes by fibroblast growth factors and extracellular ATP. J Neurochem 63:490-494[Web of Science][Medline].
  • Negro A, Tavella A, Facci L, Callegaro L, Skaper SD (1992) Interleukin-1beta regulates proenkephalin gene expression in astrocytes cultured from rat cortex. Glia 6:206-212[Web of Science][Medline].
  • Nguyen T, Erb L, Weisman GA, Marchese A, Heng HHQ, Garrad RC, George SR, Turner JT, O'Dowd BF (1995) Cloning, expression, and chromosomal localization of the human uridine nucleotide receptor gene. J Biol Chem 270:30845-30848[Abstract/Free Full Text].
  • Oka S, Arita H (1991) Inflammatory factors stimulate expression of group II phospholipase A2 in rat cultured astrocytes. J Biol Chem 266:9956-9960[Abstract/Free Full Text].
  • Okuda S, Saito H, Katsuki H (1994) Arachidonic acid: toxic and trophic effects on cultured hippocampal neurons. Neuroscience 63:691-699[Web of Science][Medline].
  • Ozaki M, Morii H, Qvist R, Watanabe Y (1994) Interleukin-1beta induces cytosolic phospholipase A2 gene in rat C6 glioma cell line. Biochem Biophys Res Commun 205:12-17[Web of Science][Medline].
  • Pearce B, Murphy S, Jeremy J, Morrow C, Dandona P (1989) ATP-evoked Ca2+ mobilization and prostanoid release from astrocytes: P2-purinergic receptors linked to phosphoinositide hydrolysis. J Neurochem 52:971-977[Web of Science][Medline].
  • Perry HV, Bell MD, Brown HC, Matyszak MK (1995) Inflammation in the nervous system. Curr Opin Neurobiol 5:636-641[Web of Science][Medline].
  • Perry VH, Andersson P-B, Gordon S (1993) Macrophages and inflammation in the central nervous system. Trends Neurosci 16:268-273[Web of Science][Medline].
  • Richardson PJ, Brown SJ (1987) ATP release from affinity-purified rat cholinergic nerve terminals. J Neurochem 48:622-630[Web of Science][Medline].
  • Salter MW, Hicks JL (1994) ATP-evoked increases in intracellular calcium in neurons and glia from the dorsal spinal cord. J Neurosci 14:1563-1575[Abstract].
  • Sims JE, March CJ, Cosman D, Widmer MB, MacDonald HR, McMahan CJ, Grubin CE, Wignall JM, Jackson JL, Call SM, Friend D, Alpert AR, Gillis S, Urdal DL, Dower SK (1988) cDNA expression cloning of the IL-1 receptor, a member of the immunoglobulin superfamily. Science 241:585-589[Abstract/Free Full Text].
  • Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC (1985) Measurement of protein using bicinchoninic acid. Annu Rev Biochem 150:76-85.
  • Sorg O, Pellerin L, Stolz M, Beggah S, Magistretti PJ (1995) Adenosine triphosphate and arachidonic acid stimulate glycogenolysis in primary cultures of mouse cerebral cortical astrocytes. Neurosci Lett 188:109-112[Web of Science][Medline].
  • Stella N, Tencé M, Glowinski J, Prémont J (1994a) Glutamate induces the release of arachidonic acid by interacting with an atypical metabotropic receptor present on mouse brain astrocytes. Renal Physiol Biochem 17:153-156[Web of Science][Medline].
  • Stella N, Tencé M, Glowinski J, Prémont J (1994b) Glutamate-evoked release of arachidonic acid from mouse brain astrocytes. J Neurosci 14:568-575[Abstract].
  • Théry C, Stanley ER, Mallat M (1992) Interleukin 1 and tumor necrosis factor-alpha stimulate the production of colony-stimulating factor 1 by murine astrocytes. J Neurochem 59:1183-1186[Web of Science][Medline].
  • Towbin H, Staehlin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76:4350-4354[Abstract/Free Full Text].
  • Webb TE, Simon J, Krishek BJ, Bateson AN, Smart TG, King BF, Burnstock G, Barnard EA (1993) Cloning and functional expression of a brain G-protein-coupled ATP receptor. FEBS Lett 324:219-225[Web of Science][Medline].
  • Webb TE, Henderson D, King BF, Wang S, Simon J, Bateson AN, Burnstock G, Barnard EA (1996a) A novel G protein-coupled P2 purinoceptor (P2Y3) activated preferentially by nucleoside diphosphates. Mol Pharmacol 50:258-265[Abstract].
  • Webb TE, Kaplan MG, Barnard EA (1996b) Identification of 6H1 as a P2Y purinoceptor: P2Y5. Biochem Biophys Res Commun 219:105-110[Web of Science][Medline].
  • Woodroofe MN, Sarna GS, Wadhwa M, Hayes GM, Loughlin AJ, Tinker A, Cuzner ML (1991) Detection of interleukin-1 and interleukin-6 in adult rat brain, following mechanical injury, by in vivo microdialysis: evidence of a role for microglia in cytokine production. J Neuroimmunol 33:227-236[Web of Science][Medline].
  • Yamamoto K, Miwa T, Ueno R, Hayaishi O (1988) Muramyl dipeptide-elicited production of PGD2 from astrocytes in culture. Biochem Biophys Res Commun 156:882-888[Web of Science][Medline].
  • Yu ACH, Chan PH, Fishman RA (1986) Effects of arachidonic acid on glutamate and gamma -aminobutyric acid uptake in primary cultures of rat cerebral cortical astrocytes and neurons. J Neurochem 47:1181-1189[Web of Science][Medline].
  • Yu N, Maciejewski-Lenoir D, Bloom FE, Magistretti PJ (1995) Tumor necrosis factor-alpha and interleukin-1alpha enhance glucose utilization by astrocytes: involvement of phospholipase A2. Mol Pharmacol 48:550-558[Abstract].
  • Zimmermann H (1994) Signalling via ATP in the nervous system. Trends Neurosci 17:420-426[Web of Science][Medline].
Copyright ©1997 Society for Neuroscience   0270-6474/1997/172939-08$05.00/0



This article has been cited by other articles:


Home page
 J. Nutr.Home page
J. A. Joseph, B. Shukitt-Hale, and L. M. Willis
Grape Juice, Berries, and Walnuts Affect Brain Aging and Behavior
J. Nutr., September 1, 2009; 139(9): 1813S - 1817S.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Clin. Nutr.Home page
J. A Joseph, B. Shukitt-Hale, and G. Casadesus
Reversing the deleterious effects of aging on neuronal communication and behavior: beneficial properties of fruit polyphenolic compounds
Am. J. Clinical Nutrition, January 1, 2005; 81(1): 313S - 316S.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
G. Y. Sun, J. Xu, M. D. Jensen, and A. Simonyi
Phospholipase A2 in the central nervous system: implications for neurodegenerative diseases
J. Lipid Res., February 1, 2004; 45(2): 205 - 213.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Lafon-Cazal, O. Adjali, N. Galeotti, J. Poncet, P. Jouin, V. Homburger, J. Bockaert, and P. Marin
Proteomic Analysis of Astrocytic Secretion in the Mouse: COMPARISON WITH THE CEREBROSPINAL FLUID PROTEOME
J. Biol. Chem., June 27, 2003; 278(27): 24438 - 24448.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
E. HANSSON and L. RONNBACK
Glial neuronal signaling in the central nervous system
FASEB J, March 1, 2003; 17(3): 341 - 348.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. You, C. R. Jacobs, T. H. Steinberg, and H. J. Donahue
P2Y Purinoceptors Are Responsible for Oscillatory Fluid Flow-induced Intracellular Calcium Mobilization in Osteoblastic Cells
J. Biol. Chem., December 6, 2002; 277(50): 48724 - 48729.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
R. S. Ostrom, C. Gregorian, R. M. Drenan, K. Gabot, B. K. Rana, and P. A. Insel
Key role for constitutive cyclooxygenase-2 of MDCK cells in basal signaling and response to released ATP
Am J Physiol Cell Physiol, August 1, 2001; 281(2): C524 - C531.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
G. R. John, J. E. Simpson, M. N. Woodroofe, S. C. Lee, and C. F. Brosnan
Extracellular Nucleotides Differentially Regulate Interleukin-1{beta} Signaling in Primary Human Astrocytes: Implications for Inflammatory Gene Expression
J. Neurosci., June 15, 2001; 21(12): 4134 - 4142.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
J. S. H. Liu, G. R. John, A. Sikora, S. C. Lee, and C. F. Brosnan
Modulation of Interleukin-1beta and Tumor Necrosis Factor alpha Signaling by P2 Purinergic Receptors in Human Fetal Astrocytes
J. Neurosci., July 15, 2000; 20(14): 5292 - 5299.
[Abstract] [Full Text] [PDF]

Home page
 NeuroscientistHome page
A. A. Farooqui, W. Y. Ong, L. A. Horrocks, and T. Farooqui
Brain Cytosolic Phospholipase A2: Localization, Role, and Involvement in Neurological Diseases
Neuroscientist, June 1, 2000; 6(3): 169 - 180.
[Abstract] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. R. John, E. Scemes, S. O. Suadicani, J. S. H. Liu, P. C. Charles, S. C. Lee, D. C. Spray, and C. F. Brosnan
IL-1beta differentially regulates calcium wave propagation between primary human fetal astrocytes via pathways involving P2 receptors and gap junction channels
PNAS, September 28, 1999; 96(20): 11613 - 11618.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
M. C. LaPointe and E. Isenovic
Interleukin-1ß Regulation of Inducible Nitric Oxide Synthase and Cyclooxygenase-2 Involves the p42/44 and p38 MAPK Signaling Pathways in Cardiac Myocytes
Hypertension, January 1, 1999; 33(1): 276 - 282.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (52)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stella, N.
Right arrow Articles by Prémont, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stella, N.
Right arrow Articles by Prémont, J.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help
-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-