Previous Article | Next Article 
Volume 17, Number 9,
Issue of May 1, 1997
pp. 3262-3273
Copyright ©1997 Society for Neuroscience
Inhibition of Tumor Necrosis Factor-
Action within the CNS
Markedly Reduces the Plasma Adrenocorticotropin Response to Peripheral
Local Inflammation in Rats
Andrew V. Turnbull1,
Fernando J. Pitossi2,
Jean-Jacques Lebrun1,
Soon Lee1,
Jon C. Meltzer3,
Dwight M. Nance3,
Adriana del
Rey2,
Hugo O. Besedovsky2, and
Catherine Rivier1
1 The Clayton Foundation Laboratories for Peptide
Biology, The Salk Institute, La Jolla, California 92037, 2 Institute for Normal and Pathological
Physiology-Immunophysiology, Philipps-Universitat Marburg, 35037 Marburg, Germany, and 3 Department of Pathology, University
of Manitoba, Winnipeg, Manitoba, R3E 0W3, Canada.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
The present study tested the hypothesis that the cytokine tumor
necrosis factor-
(TNF-
) is an important CNS mediator of the
hypothalamo-pituitary-adrenal (HPA) axis response to local inflammation
in the rat. Recombinant murine TNF-
administered directly into the
cerebroventricles of normal rats produced a dose-dependent increase in
plasma adrenocorticotropin (ACTH) concentration. Local inflammation
induced by the intramuscular injection of turpentine (50 µl/100 gm
body weight) also produced an increase in plasma ACTH, peaking at
160-200 pg/ml at 7.5 hr after injection (compared with 10-30 pg/ml in
controls). Intracerebroventricular pretreatment with either 5 µl of
anti-TNF-
antiserum or 1-50 µg of soluble TNF receptor construct
(rhTNFR:Fc) reduced the peak of the ACTH response to local inflammation
by 62-72%. In contrast, intravenous treatment with the same doses of
anti-TNF-
or rhTNFR:Fc had no significant effect on the ACTH
response to local inflammation. Although these data indicated an action
of TNF-
specifically within the brain, no increase in brain TNF-
protein (measured by bioassay) or mRNA (assessed using either in
situ hybridization histochemical or semi-quantitative RT-PCR
procedures) was demonstrable during the onset or peak of HPA activation
produced by local inflammation. Furthermore, increased passage of
TNF-
from blood to brain seems unlikely, because inflammation did
not affect plasma TNF-
biological activity. Collectively these data
demonstrate that TNF-
action within the brain is critical to the
elaboration of the HPA axis response to local inflammation in the rat,
but they indicate that increases in cerebral TNF-
synthesis are not
a necessary accompaniment.
Key words:
tumor necrosis factor-
;
corticotropin-releasing
factor;
local inflammation;
adrenocorticotropin;
CNS;
intraventricular
INTRODUCTION
Acute or chronic inflammation produces a sequelae
of hematological, neurological, autonomic, and neuroendocrine responses that are collectively known as the acute phase response (APR). Critical
to the development of the APR are the synthesis, secretion, and action
of cytokines, a family of polypeptides originally described as
intercellular mediators within the immune system (Blalock, 1989
;
Dinarello and Wolff, 1993
; Besedovsky and del Rey, 1996
). Indeed,
administration of either interleukin-1 (IL-1), IL-6, or tumor necrosis
factor-
(TNF-
) to normal healthy laboratory animals or to human
volunteers mimics many aspects of the APR, including activation of the
hypothalamo-pituitary-adrenal (HPA) axis (Turnbull and Rivier, 1995
;
Besedovsky and del Rey, 1996
).
The influence of recombinant cytokines on HPA activity and their
mechanism(s) of action have been studied extensively. The primary
mechanism by which increased blood or brain cytokine concentrations elicit activation of the HPA axis is at the level of hypothalamic corticotropin-releasing factor (CRF) release (Turnbull and Rivier, 1995
, 1996b
). Indeed, IL-1, IL-6, or TNF-
increases hypothalamic secretion of CRF in vitro and in vivo, and
passive immunoneutralization of CRF inhibits the elevation in plasma
ACTH concentrations produced by each of these three cytokines
(Berkenbosch et al., 1987
; Sapolsky et al., 1987
; Uehara et al., 1987
;
Naitoh et al., 1988
; Tsagarakis et al., 1989
; Bernardini et al., 1990
;
Navarra et al., 1991
; Watanobe et al., 1991
; Watanobe and Takebe,
1992
). In contrast, the participation of endogenous
cytokines in inflammation-induced activation of the HPA axis has been
less well studied and largely restricted to the study of ACTH responses
to systemic administration of the bacterial cell wall product endotoxin
[or lipopolysaccharide (LPS)] (Tilders et al., 1994
). Such work has
indicated that inhibition of the action of either TNF-
, IL-1, or
IL-6 reduces or prevents the rise in plasma ACTH levels in response to
systemic LPS (Rivier et al., 1989
; Kakucska et al., 1993
; Perlstein et
al., 1993
; Schotanus et al., 1993
; Ebisui et al., 1994
); however, the
site(s) of production or action of cytokines that influence HPA
activity during inflammation is unclear.
Tissue undergoing inflammation undoubtedly contains markedly elevated
levels of TNF-
, IL-1, and IL-6. The synthesis and secretion of
TNF-
seems to be a proximal event in the cytokine cascade, because
its concentration rises more rapidly than that of either IL-1 or IL-6,
and inhibition of its action during inflammatory events abrogates many
of the ensuing responses, including the production of IL-1 and IL-6
(Fong et al., 1989
; Le Contel et al., 1990
; Creasey et al., 1991
;
DeForge and Remick, 1991
; Zanetti et al., 1992
; Cooper et al., 1994a
;
Givalois et al., 1994
). Furthermore, plasma concentrations of one or
more of these cytokines may also be elevated, depending on the nature,
site, intensity, and duration of the inflammatory insult (Turnbull and
Rivier, 1995
).
Recent reports of elevated cytokine synthesis within the CNS in
response to peripheral injection of LPS identify an additional possible
mechanism by which cytokines generated in response to peripheral
inflammation may influence the activity of the HPA axis (Schobitz et
al., 1994
; Hopkins and Rothwell, 1995
; Turnbull and Rivier, 1995
;
Besedovsky and del Rey, 1996
). This is a particularly attractive
hypothesis, because the activation of the HPA axis in response to
either recombinant cytokines or inflammatory insults depends on the
synthesis and secretion of hypothalamic CRF. Cytokine expression within
the CNS has been reported in astrocytes, microglia, neurons, brain
endothelial cells, and ependymal cells (Schobitz et al., 1994
; Hopkins
and Rothwell, 1995
). Consistent with a neuromodulatory role for IL-1,
IL-6, and TNF-
within the CNS, their receptors have discrete
neuroanatomical distributions (Schobitz et al., 1994
; Hopkins and
Rothwell, 1995
; Turnbull and Rivier, 1995
; Besedovsky and del Rey,
1996
; Rothwell et al., 1996
). As in the periphery, a CNS cytokine
cascade seems likely (Romero et al., 1993
; Norris et al., 1994
).
The present study sought to determine the role of cytokines within the
brain in the mediation of the HPA axis response to a peripheral,
discrete tissue inflammation in the rat (Turnbull et al., 1994
;
Turnbull and Rivier, 1996a
). Because of the proximal nature of TNF-
in the generation of cytokines and subsequent responses, our study
focused on this cytokine.
MATERIALS AND METHODS
Reagents. Anti-TNF-
antiserum was produced by
immunization of rabbits with recombinant murine TNF-
and was kindly
donated by Dr. S. L. Kunkel (Department of Pathology, University of
Michigan). This antiserum recognizes both recombinant and natural
murine TNF-
and displays high cross-reactivity with rat TNF-
, but
it does not cross-react with recombinant IL-1
or IL-1
(Chensue et
al., 1988
; and our own data) or block lymphotoxin (TNF-
) (Long et
al., 1990
). Furthermore, it binds and neutralizes the biological effects of rat TNF-
, both in vitro and in vivo
(Chensue et al., 1988
; Colletti et al., 1990
; Long et al., 1990
; Remick
et al., 1990
), and large systemic doses (0.3-1.0 ml of neat serum) to rats inhibit pulmonary edema produced by hepatic ischemia/reperfusion injury (Colletti et al., 1990
), elevations in plasma IL-6 and fever in
response to local inflammation (Cooper et al., 1994a
), and they
exacerbate LPS-induced fever (Long et al., 1990
). In the present study,
rats were passively immunized with either 5 µl of neat or 500 µl of
1:100 anti-TNF-
, with similar volumes of neat or diluted normal
rabbit serum (NRS) (Colorado Serum, Denver, CO) used as control
injections.
A dimeric soluble TNF receptor (p80) was prepared by linkage of the
cDNA encoding the soluble (extracellular) portion of p80 with a DNA
fragment encoding the Fc region of human IgG1 (Mohler et al., 1993
).
The resulting soluble receptor construct (rhTNFR:Fc) has been
demonstrated to inhibit the actions of TNF-
both in vivo
and in vitro (Peppel et al., 1991
; Mohler et al., 1993
;
Wooley et al., 1993
) and was kindly provided by Dr. M. B. Widmer
(Immunex, Seattle, WA). rhTNFR:Fc was diluted in sterile PBS containing 0.1% BSA.
Recombinant murine (rm) TNF-
[code: 88/532 (First International
Standard)] was obtained from the National Institute for Biological Standards and Control (NIBSC, South Mimms, UK) and used as a standard in the analysis of TNF-
bioactivity. rmTNF-
(activity = 7 × 107 IU/mg protein) obtained from R & D Systems
(Minneapolis, MN) was used for in vivo experiments. LPS
(Escherichia coli serotype O26:B6; code L3755, lot 20H4025)
was purchased from Sigma (St. Louis, MO) and dissolved in PBS.
Animals. Male Sprague Dawley rats (initial body weight
170-240 gm) were purchased from Harlan Sprague Dawley Laboratories (Indianapolis, IN) and housed in animal facilities (ambient temperature 22°C) adjacent to experimental rooms. They were maintained on a 12 hr
light/dark cycle (lights on at 6 A.M.) and provided rat chow
(Harlan-Teklad, Madison, WI) and water ad libitum. All
procedures described were approved by The Salk Institute Animal Use and
Care Committee.
Surgical preparation and intracerebroventricular treatment.
Rats were equipped with intravenous catheters 48 hr before
experimentation, as described previously (Turnbull and Rivier, 1996a
).
In a number of the experiments, animals received injections directly
into the cerebroventricles via indwelling guide cannulae, which were implanted 7-9 d before intravenous cannulation, as described (Turnbull and Rivier, 1996c
). Intracerebroventricular treatments (5 µl) were
administered via a connecting injection needle (Plastics One), which
extended 1 mm beyond the tip of the guide cannula, and injections were
performed over a period of 60 sec. Passive immunoneutralization of
cerebral TNF-
by intracerebroventricular infusion of 5 µl
anti-TNF-
antiserum was performed the day before (i.e., 16 hr
before) induction of local inflammation, a pretreatment regime that
results in extensive tissue penetration of antibodies (Thomas et al.,
1991
; Doyle et al., 1992
; Van der Zee et al., 1992
, 1995
) and avoids
possible stress-induced hormone secretion caused by the intracerebral
injection of immune serum. Soluble TNF receptor construct was
administered immediately before induction of inflammation, as reported
by others (Fan et al., 1996
; Galasso et al., 1996
). After completion of
experiments, animals were killed, and 5 µl of india ink was injected
via the intracerebroventricular assembly. Only data from animals that
showed a distribution of ink throughout the ventricular system (i.e.,
third, fourth, and lateral ventricles and cerebral aqueduct) were
included in subsequent analyses.
Induction of local inflammation and electrofootshocks.
Sterile local inflammation was induced in the hindlimb by intramuscular injection of 50 µl of turpentine/100 gm body weight into the left thigh muscles (Turnbull et al., 1994
; Turnbull and Rivier, 1996a
). This
produced a pronounced swelling of the limb that was evident ~3-4 hr
after injection. Control animals received a similar injection of 0.9%
sterile saline, which produced no visible degree of swelling.
Electrofootshocks were applied to conscious, unrestrained rats using a
footshock chamber of dimensions 30 cm wide × 26 cm deep × 26 cm high. One shock of 1 mA amplitude and 1 sec duration was applied
every 3 min for a total of 45 min.
Sample collection and preparation. Blood samples were
collected from undisturbed rats as described previously (Turnbull and Rivier, 1996a
). For experiments in which repeated measurements were
made, a maximum of 0.4 ml blood/sample was drawn on up to four
occasions. Each time a blood sample was drawn, 0.2-0.3 ml of sterile,
heparinized saline was injected to replace the volume of fluid lost.
This paradigm permits at least five consecutive blood samples to be
withdrawn without overt effects on HPA activity (Turnbull and Rivier,
1996a
,c
). Furthermore, the plasma ACTH response to turpentine is
similar in rats sampled via intravenous cannulae and in surgically
naive rats sampled from trunk blood after decapitation (Turnbull and
Rivier, 1996a
). After collection, each blood sample was divided into
two chilled tubes: one containing EDTA (for measurement of ACTH) and
the other containing preservative-free, sterile heparin (for
measurement of TNF-
). Samples were centrifuged, and plasma was
aliquoted and stored at
20°C (for ACTH) or
70°C (for
TNF-
).
Determination of TNF-
bioactivity in specific, dissected brain
regions was performed using the supernatants of tissue homogenates obtained by mincing and homogenizing (20 strokes of a dounce) brain
tissue in assay medium, excluding fetal bovine serum (200 µl/hypothalamus, 250 µl/hippocampus, and 2 ml/cerebral cortex). Homogenates were spun at 16,000 g on a bench-top microfuge
for 15 min, and the supernatant was decanted and stored at
70°C
until assay. Total protein content of the supernatants was determined by a Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA), based
on the micro-Lowry method.
ACTH assay. Plasma ACTH concentrations were determined using
a two-site immunoradiometric assay (Allegro, Nichols Institute, San
Juan Capistrano, CA), as described previously (Rivier and Shen, 1994
).
Assay sensitivity was 5 pg/ml, and coefficients of variation at
concentrations of 32 and 307 pg/ml were 1.9% and 2.4% within, and
18.2% and 15.7% between assays, respectively.
Analysis of TNF-
bioactivity. Biological activity of
TNF-
was determined by comparing the cytotoxicity of samples to L929 cells with that of the rmTNF-
international standard (code: 88/532). L929 cells were cultured (7.5% CO2/92.5% 02,
37°C, 100% humidity) in RPMI-1640 media (Cellgro, Herndon, VA)
containing 5% fetal bovine serum (Gemini BioProducts, Calabasas, CA),
2 mM L-glutamine (Sigma), 50 µM
2-
-mercaptoethanol (Sigma), and 50 U penicillin and 50 µg
streptomycin/ml (Sigma) in 15-cm-diameter tissue culture dishes (Becton
Dickinson, Cockeysville, MD). Confluent cells were removed using ~15
ml of trypsin EDTA solution (IX, Sigma) and gentle agitation. Cells
were washed and resuspended in media containing 0.5 µg/ml mitomycin C
(Sigma). One hundred microliters of cells were then plated in standard
96-well microtiter plates (Costar Corporation, Cambridge, MA) at a
concentration of 2 × 105 cells/ml, and cultured
overnight. Cells were then incubated with serially diluted (1:2 to 1:3)
standard or samples for ~24 hr. Media was removed from the cells by
inverting the plates, and cell survival was determined colorimetrically
using the tetrazolium salt MTT
[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
(Sigma)]. One hundred microliters of MTT (1 mg/ml in PBS) were added
to each well, and the plates were wrapped in foil and incubated at
37°C. After 4 hr, the tetrazolium salt precipitate was dissolved by
adding 150 µl of 0.04 M HCl-2-propanol to each well.
After an overnight incubation (room temperature) in the dark, the
plates were read on a microplate reader (MR700, Dynatech Laboratories,
Chantilly, VA) at 570 nm test wavelength and 640 nm reference
wavelength. Concentrations of unknown samples were determined by
measuring the displacement of their dilution curves from the standard,
expressed as international units. All samples were assayed in either
duplicate or triplicate (on separate plates), and each plate contained
an internal control (plasma from an animal injected with 1 mg/kg LPS,
which had previously been diluted 1:100). All samples from a single
experiment were determined in the same assay, with the detection limits
of the assay varying between 1 and 70 IU/ml.
In situ hybridization histochemistry. Animals were
anesthetized deeply with an intraperitoneal injection of 35% chloral
hydrate and perfused via the ascending aorta with saline followed by
cold 4% paraformaldehyde in 0.1 M borate buffer, pH 9.5. Brains were post-fixed for 3-4 hr and then transferred to 10%
sucrose/4% paraformaldehyde/0.1 M borate buffer overnight
at 4°C. Frozen 30 µm sections were cut by a Histoslide microtome,
collected in cryoprotectant (0.05 M sodium phosphate
buffer, 30% ethylene glycol, 20% glycerol), and stored at
20°C
until histochemical analysis.
Before hybridization, tissue sections were mounted onto gelatin and
poly-L-lysine-coated slides, air-dried, and stored under a
vacuum overnight. The slides were washed initially in a PBS/0.1% Brij
35 detergent buffer, pH 7.4. They then were treated with 5 µg/ml of
proteinase K (EM Science, Gibbstown, NJ) in 0.1 M Tris, pH
8.0, 50 mM EDTA/0.1% Brij for 20 min at 37°C. The tissue
was fixed for 5 min in 4% paraformaldehyde/diethylpyrocarbonate,
acetylated with 0.25% acetic anhydride in 0.1 M
triethanolamine/0.1% Brij, pH 8.0, for 10 min, soaked in methanol for
5 min, and air-dried. The slides were treated in prehybridization
mixture (50% formamide, 2× SSC, 1 mM EDTA, 1 mM Tris, pH 7.3, 1× Denhardt's solution, 0.1 mg/ml yeast
tRNA, 5% dextran sulfate) for 30 min at 37°C and then air-dried for
~5 min, before hybridization.
TNF-
and IL-1
riboprobes were produced and quantitated using
digoxigenin (dig) nucleic acid production and detection kits (Boehringer Mannheim, Indianapolis, IN), as described (Meltzer et al.,
1997
). To produce probe templates, an aliquot of first-strand amplification was added to a PCR reaction containing sense or antisense
primers with a T7 RNA polymerase sequence. Primers for TNF-
(5
-TAATACGACTCACTATAGGGAGATACTGAACTTCGGGGTGATTGGTCC, 3
- TAATACGACTCACTATAGGGAGACAGCCTTGTCCCTTGAAGAGAACC) and IL-
(5
-TAATACGACTCACTATAGGGAGACCTTGTGCAAGTGTCTGAAGCAG, 3
-TAATACGACTCACTATAGGGAGACTTCAAAGATGAAGGAAAAGAAGGTGC) were
custom-designed and obtained from Biocan (Mississauga, Ontario,
Canada). PCR product was then in vitro-transcribed using T7
RNA polymerase with dig-uridine triphosphate present. Dig-labeled
TNF-
or IL-1
riboprobe (1 ng/ml) in prehybridization mixture was
applied to each slide and then coverslipped. The slides were incubated
at 95°C for 5 min and then allowed to hybridize overnight at
50°C.
The coverslips were removed by gentle soaking in 2× SSC/0.1% Brij and
then treated with 20 mg/ml RNase A (Sigma) in the 2× SSC/0.1% Brij
buffer for 30 min at 37°C. The slides were washed consecutively in
1× SSC/0.1% Brij, 0.1× SSC/0.1% Brij, and 2× SSC/Brij buffer,
washed in a 10 mM sodium phosphate/0.1% Brij buffer, and
then blocked for 1 hr in a 1% Boehringer block solution dissolved in
0.1 M maleic acid, 0.15 M NaCl/0.1% Brij. The
slides were air-dried for ~5 min and then incubated with a sheep
anti-dig alkaline phosphatase-conjugated antibody (1:250; Boehringer
Mannheim) under coverslips overnight at 4°C.
The following morning, the coverslips were removed by gentle soaking in
the 10 mM sodium phosphate/Brij buffer. The slides were
air-dried for ~5 min and then developed in the detection solution
(10% polyvinyl alcohol, 1 mM levamisole, 0.46 mM NBT, 0.43 mM 5-bromo-4-chloro-3-indoyl
phosphate in 50 mM MgCl2/100 mM
Tris in 100 mM NaCl, pH 9.3). The slides were coverslipped and incubated overnight at 30°C.
The color reaction was stopped when the desired intensity was reached
by soaking the coverslips off using 10 mM Tris, pH 8.0/1 mM EDTA buffer. The sections were coverslipped in glycerol
gel (50% glycerol, 7.5% gelatin, 0.1% sodium azide in water) and
examined microscopically.
Semi-quantitative RT-PCR (SQ-PCR). The expression of mRNA
for TNF-
, IL-1
, and IL-6 in specific brain regions, as well as the pituitary and blood pellets from control animals and rats subjected
to local inflammation, was analyzed by SQ-PCR. Hypothalami, hippocampus, and cerebral cortex were dissected rapidly, and whole pituitary was removed quickly after decapitation. These samples were
frozen in liquid nitrogen and stored at
70°C until analysis. Trunk
blood was collected, and blood cell pellets were obtained by
centrifugation at 4°C for 10 min and stored at
70°C.
RNA extraction was performed using the TRIzol reagent (Life
Technologies, Gaithersburg, MD). Tissues were homogenized in 1 ml
TRIzol/50-100 mg of tissue with a Polytron homogenizer for 10 sec at
maximal speed. Chloroform was added at 1:5 of the initial volume of
TRIzol. Samples were incubated at room temperature for 15 min and then
centrifuged at 12,000 g for 10 min at 4°C. After precipitation of the upper aqueous phase with isopropanol for 45 min,
the pellet was washed with 75% ethanol, dried briefly, and dissolved
in RNase-free water. The purity and amounts of the RNA obtained were
checked by measuring the optical density at 260 and 280 nm.
Total RNAs were reverse-transcribed using a commercial kit (Superscript
II RT kit, Life Technologies). Three micrograms of total RNA were
incubated at 70°C for 10 min with 1 µl of oligo dT12-18 (0.5 µg/µl) and water to a final volume of 12 µl, and subsequently
kept on ice for 1 min. Four microliters of 5× synthesis buffer (100 mM Tris-HCl, pH 8.4, 250 mM KCl, 12.5 mM MgCl2, 0.5 mg/ml BSA), 1 µl of 10 mM dNTP mix, 2 µl of 0.1 M DTT, and 1 µl of
Superscript II reverse transcriptase were added to the mixture and
incubated at room temperature for 10 min. The tubes were transferred to
42°C for 60 min. The reaction was terminated by incubating the
samples at 70°C for 15 min.
IL-1
, IL-6, and TNF-
cDNAs were quantified from 200 ng of
reverse-transcribed RNA by co-amplification with 100 fg of a
multispecific internal control (pRat6) by PCR, as described previously
(Bouaboula et al., 1992
; Pitossi et al., 1997
). pRat6 carries priming
sites for several rat cytokines and house-keeping genes, including
IL-1
, IL-6, TNF-
, and
-microglobulin (Pitossi and Besedovsky,
1996
). The sequences of the primers used were as follows: for IL-1
, sense: TCCATGAGCTTTGTACAAGG, and antisense: GGTGCTGATGTA CCAGTTGG; for
IL-6, sense: TGTTCTCAGGGAGATCCTGG, and antisense: TCCAGGTAGAAACGGAACTC; for TNF-
, sense: AAATGGGCTCCCTCTCATCA, and antisense:
AGCCTTGTCCCTTGAAGAGA; for
2-microglobulin, sense:
ATCTTTCTGGTGCTTGTCTC, and antisense: AGTGTGAGCCAGGATGTAGT. The ratio
obtained after 30 cycles of amplification between the amounts of cDNA
and pRat6 represents the relative abundance of a distinct cDNA in a
sample.
-2 microglobulin concentration in each reverse-transcribed
sample was determined to check the reverse-transcribed efficiency and
the accuracy of the determination of the RNA concentration. For this
purpose, 1/60 of each reverse-transcribed product was spiked with 0.100 pg of pRat6 and amplified for 30 cycles in the presence of 0.2 µl
32P-
dCTP and
-2 microglobulin specific primers. In
addition, an amount of RNA, similar to that of brain samples, from the
spleen of either control rats or rats treated 2 hr earlier with LPS (2 mg/kg, i.p.) was used as a positive control.
Data presentation and statistical analyses. The data are
presented as mean ± SEM, and the number of subjects in each
experimental group is indicated in the figure legends. Statistical
analyses of repeated ACTH measurements was performed using ANOVA with
repeated measures, followed by least squared means difference analysis as a post hoc test, as appropriate. All other statistical
analyses were performed using an unpaired Student's t test.
A two-tailed probability of <5% (i.e. p < 0.05) was
considered statistically significant.
RESULTS
Intracerebroventricular rmTNF-
elevates plasma
ACTH concentrations
Immediately before the intracerebroventricular injection of either
vehicle (PBS containing 0.01% BSA) or rm TNF-
(1.75-28 × 103 IU), there were no significant differences in plasma
ACTH concentrations (15-78 pg/ml) between the different groups
studied. After intracerebroventricular injection of only the vehicle
(at 12 P.M.), plasma ACTH values remained constant for 60 min but rose
slightly between 120 and 240 min (to a maximum of 70 ± 7 pg/ml).
Figure 1 shows that intracerebroventricular injection of
rm TNF-
significantly affected plasma ACTH concentrations (F(3,18) = 3.288; p < 0.05), with the elevations produced by 7 × 103 and
28 × 103 IU doses achieving statistical significance
(p < 0.05, least squared means). The increase
in plasma ACTH values produced by intracerebroventricular TNF-
was
rapid (within 30 min), dose-dependent (30 min: 1.75 × 103 IU, 180 ± 68 pg/ml; 7 × 103 IU,
284 ± 56 pg/ml; 28 × 103 IU, 445 ± 162 pg/ml), and prolonged (duration 3-4 hr).
Fig. 1.
Effect of rm TNF-
(1.75-28 × 103 IU) infused intracerebro-ventricularly into the
lateral cerebroventricles on plasma ACTH concentrations in rats.
Statistical analyses showed that there was a significant overall
interaction between treatments (F(3,18) = 3.28; p = 0.045), and that both 7 × 103 IU (p = 0.032) and
28 × 103 IU (p = 0.007) doses produced significant elevations in plasma ACTH
concentrations (least squared means). n = 5-7
subjects per experimental group.
[View Larger Version of this Image (30K GIF file)]
Inhibition of TNF-
action within the brain diminishes the rise
in plasma ACTH concentrations due to local inflammation produced by
turpentine but not produced by electrofootshock
Turpentine or saline was injected intramuscularly at 8 A.M. As
reported previously (Turnbull and Rivier, 1996a
), plasma ACTH concentrations in saline-injected animals rose from 5-10 pg/ml at 11 A.M. to 35-70 pg/ml at 5 P.M., as lights-out approached (6 P.M.).
Plasma ACTH concentrations in rats injected intramuscularly with saline
were unaffected by treatment either intracerebroventricularly or
intravenously with either anti-TNF-
or rhTNFR:Fc (Figs.
2, 3, 4).
Fig. 2.
Effect of pretreatment 16 hr before with either
(A) 5 µl of neat anti-TNF-
intracerebroventricularly or (B) 500 µl of 1:100 anti-TNF-
intravenously on the ACTH response to local inflammation induced by 50 µl turpentine/100 gm body weight intramuscularly. Control treatments were intracerebroventricular or intravenous normal
rabbit serum (NRS) plus intramuscular saline. Statistical analysis
showed that turpentine injection and intracerebroventricular treatment
with anti-TNF-
significantly interacted
(F(1,35) = 16.65; p < 0.001; ANOVA with repeated measures), whereas turpentine and
intravenous anti-TNF-
did not significantly interact
(F(1,70) = 1.57; p = 0.214; ANOVA with repeated measures). n = 9-20
subjects per experimental group.
[View Larger Version of this Image (26K GIF file)]
Fig. 3.
Effect of intracerebroventricular pretreatment
with 1-50 µg rhTNFR:Fc on the ACTH response to local inflammation
induced by 50 µl turpentine/100 gm body weight (intramuscular).
Control treatments were PBS (intracerebroventricular) plus saline
(intramuscular). The effects of all three doses were tested in one
experiment, but for the sake of clarity the effects of each dose are
illustrated separately and compared with the one vehicle/saline group
and one vehicle/turpentine group present in this study. Statistical analysis showed that turpentine injection and intracerebroventricular treatment with rhTNFR:Fc significantly interacted
(F(3,63) = 5.14; p = 0.003; ANOVA with repeated measures). n = 7-10
subjects per experimental group.
[View Larger Version of this Image (24K GIF file)]
Fig. 4.
Effect of intravenous pretreatment with 1-50 µg
rhTNFR:Fc on the ACTH response to local inflammation induced by 50 µl
turpentine/100 gm body weight (intramuscular). Control treatments were
PBS (intravenous) plus saline (intramuscular). The effects of all three
doses were tested in one experiment, but for the sake of clarity the
effects of each dose are illustrated separately and compared with the one vehicle/saline group and one vehicle/turpentine group present in
this study. Statistical analysis showed that turpentine injection and
intravenous treatment with rhTNFR:Fc did not significantly interact
(F(3,59) = 0.43; p = 0.730; ANOVA with repeated measures). n = 8-9
subjects per experimental group.
[View Larger Version of this Image (24K GIF file)]
A significant elevation in plasma ACTH concentrations was observed in
all groups of rats subjected to local inflammation induced by the
intramuscular injection of turpentine (p < 0.001 in each experiment; ANOVA with repeated measures) (Figs. 2, 3, 4).
As in our earlier study (Turnbull and Rivier, 1996a
), plasma ACTH concentrations were only slightly elevated 3 hr after turpentine injection (45-50 pg/ml vs 5-10 pg/ml in saline-injected controls) (Fig. 2). Thereafter, plasma ACTH concentrations rose to a peak at 7.5 hr. The plasma ACTH response to turpentine was unaffected by the
control treatments with serum, as indicated by the similar peak ACTH
responses in animals pretreated with NRS intracerebroventricularly (200 ± 23 pg/ml), NRS intravenously (203 ± 19 pg/ml), PBS
intracerebroventricularly (162 ± 20 pg/ml), and PBS intravenously
(195 ± 29 pg/ml).
In animals pretreated intracerebroventricularly with 5 µl of
anti-TNF-
16 hr before, the elevation in plasma ACTH concentration produced by local inflammation induced by turpentine was reduced markedly (Fig. 2). The plasma ACTH responses to turpentine in intracerebroventricular NRS- and anti-TNF-
-treated animals were of
similar temporal profiles, but the magnitude of ACTH response in
intracerebroventricular anti-TNF-
rats was approximately two-thirds smaller (Table 1), and there was a significant
interaction between turpentine and intracerebroventricular treatments
(F(1,35) = 16.65; p < 0.001; ANOVA with repeated measures). In contrast, intravenous pretreatment with 5 µl anti-TNF-
in 0.5 ml had no statistically significant impact on the ACTH response to turpentine
(F(1,70) = 1.57; p = 0.214; ANOVA with repeated measures) (Fig. 2).
As with anti-TNF-
pretreatment, inhibition of TNF-
action
by intracerebroventricular injection of rhTNFR:Fc dramatically reduced
the ACTH response to local inflammation (Fig. 3).
Intracerebroventricular administration of 1-50 µg rhTNFR:Fc
immediately before turpentine produced a significant interaction
between intracerebroventricular and turpentine treatments
(F(3,63) = 5.14; p = 0.003; ANOVA with repeated measures). The extent of inhibition of the
ACTH response at 7.5 hr after turpentine produced by
intracerebroventricular rhTNFR:Fc was similar at the three doses used
(62-72% reduction) and was equal to that afforded by
intracerebroventricular anti-TNF-
(64% reduction) (Table 1). The
effects of intracerebroventricular rhTNFR:Fc on the plasma ACTH
response to turpentine, however, seemed to be dose-dependent at 6 and 9 hr, with lower doses of rhTNFR:Fc producing even higher ACTH
concentrations than those in turpentine-treated controls at 9 hr (PBS:
68 ± 7 pg/ml; rhTNFR:Fc: 50 µg: 55 ± 3 pg/ml; 10 µg:
92 ± 12 pg/ml; 1 µg: 118 ± 27 pg/ml). In contrast to
intracerebroventricular treatment, intravenous treatment with identical
doses of rhTNFR:Fc had no statistically significant effect on the
plasma ACTH response to turpentine (F(3,59) = 0.43; p = 0.730; ANOVA with repeated measures)
(Fig. 4).
Unlike inhibition of TNF-
action within the brain of animals
subjected to local inflammation, intracerebroventricular pretreatment 16 hr before with 5 µl of anti-TNF-
had no significant impact on
the rise in plasma ACTH caused by electrofootshock
(F(1,22) = 0.06; p = 0.815; ANOVA with repeated measures) (Fig. 5). Similar peak plasma ACTH concentrations were observed in NRS- (668 ± 57 pg/ml) and anti-TNF-
- (673 ± 91 pg/ml) treated rats 30 min
after the onset of footshocks.
Fig. 5.
Effect of pretreatment 16 hr before with either 5 µl of neat anti-TNF-
intracerebroventricularly on the ACTH
response to electrofootshock (1 mA, 1 sec duration, 1 shock/3 min).
Control treatment was NRS (intracerebroventricular). Statistical
analysis showed that footshock treatment and intracerebroventricular
treatment with anti-TNF-
did not significantly interact
(F(1,22) = 0.06; p = 0.815; ANOVA with repeated measures). n = 11-13
subjects per experimental group.
[View Larger Version of this Image (25K GIF file)]
Plasma TNF-
bioactive protein is not affected measurably by
local inflammation produced by turpentine
In intravenously cannulated control rats, plasma TNF-
-like
bioactivity was low (below 300 IU/ml) but detectable in four of five
animals (Table 2). Incubation of these same plasma
samples with a 1:100 dilution of NRS slightly increased the magnitude of TNF-
-like activity detected in each sample. When plasma samples were incubated with a 1:100 dilution of anti-TNF-
, however, all TNF-
-like activity was lost (Table 2), indicating that the
cytotoxicity observed in the plasma of control rats was attributable to
authentic TNF-
.
In a separate series of experiments, plasma TNF-
bioactivity in rats
treated with either saline (intramuscularly), turpentine (intramuscularly), or LPS (intravenously) was compared (Table 3). Similar plasma TNF-
bioactivity was observed in
saline- (153-319 IU/ml) and turpentine-injected rats
(193-312 IU/ml) 0-7 hr after treatment, but LPS produced a transient
(1-2 hr) and extremely marked increase (peak 21,324 IU/ml) in plasma
TNF-
bioactivity (Table 3).
Table 3.
TNF- (IU/ml)-like activity in the plasma of saline-,
turpentine-, or LPS-treated rats
| Time (hr) |
Saline (i.m.) |
Turpentine
(i.m.) |
LPS
(i.v.) |
|
| 0 |
153
± 45 |
243 ± 45 |
302 ± 102 |
| 1 |
239 ± 62 |
298
± 91 |
21,324 ± 8345 |
| 2 |
- |
213
± 60 |
6125 ± 1021 |
| 3 |
319 ± 71 |
193 ± 35 |
939
± 129 |
| 4 |
- |
300
± 89 |
- |
| 5 |
267 ± 32 |
218
± 56 |
- |
| 6 |
- |
312
± 82 |
- |
| 7 |
299 ± 76 |
278 ± 56 |
- |
|
|
Rats were injected with either 50 µl/100 gm of either
saline or turpentine (i.m.) or 5 µg/kg LPS (i.v.). n = 3-5 per experimental group. i.m., Intramuscular; i.v., intravenous.
|
|
Local inflammation produced by turpentine does not elicit
measurable increases in brain TNF-
bioactivity or mRNA
Results from the previous two series of experiments indicated that
TNF-
mediates the ACTH response to turpentine-induced local
inflammation by an action within the CNS, and that there is no apparent
rise in TNF-
levels in peripheral blood. This suggests that the
likely site of production of TNF-
that produces the HPA axis
response to local inflammation is within the brain itself.
To determine whether TNF-
protein could be detected in brains,
TNF-
-like activity in the supernatants of brain homogenates was
measured, using methods similar to those that have previously proved
successful for the detection of TNF-
, IL-1, and IL-6
bioactivity/immunoreactivity (Fontana et al., 1984
; Hagan et al., 1993
;
Taupin et al., 1993
; Quan et al., 1996
; and our own unpublished data).
In initial experiments, individual hypothalami from control, untreated
rats were placed in Eppendorf tubes, and 250 µl of tissue culture
media containing 0, 30, or 900 IU of TNF-
was added. The hypothalami
were homogenized as described, and supernatants were assayed for
TNF-
-like activity. No TNF-
-like activity was measurable in
supernatants of hypothalami homogenized in the absence of recombinant
TNF-
. Recovery of "spiked" TNF-
was 73% at 30 IU/hypothalamus and 99% at 900 IU/hypothalamus. In additional
experiments, TNF-
bioactivity was undetectable in the supernatants
of hypothalamic, hippocampal, and cortical homogenates of control
animals, but was markedly elevated in all three regions after
intracerebroventricular injection of 1 µg LPS (Table
4); however, TNF-
-like activity of supernatants of the homogenates from these brain regions of rats 5-8 hr after turpentine remained undetectable (Table 4).
Table 4.
TNF- activity (IU/mg protein) in specific brain regions
in control, turpentine-, and LPS-treated
rats
|
Control |
LPS (1 µg,
i.c.v.) 1 hr |
LPS (1 µg, i.c.v.) 3 hr |
Turpentine 5, 6.5, 8 hr |
|
| Hypothalamus |
Not
detectable |
63.5
± 9.8 |
23.2
± 3.7 |
Not
detectable |
|
(1.7-2.4) |
|
|
(0.2-2.7) |
| Hippocampus |
Not
detectable |
39.3 ± 8.0 |
79.1 ± 23.7 |
Not
detectable |
|
(0.9-1.4) |
|
|
(0.6-4.8) |
| Cerebral
cortex |
Not detectable |
11.0 ± 0.8 |
25.5 ± 2.5 |
Not
detectable |
|
(1.8-4.0) |
|
|
(0.7-3.4) |
|
Rats remained either untreated (control) or were injected either
intramuscularly with 50 µl/100 gm turpentine or
intra-cerebroventricularly (i.c.v.) with LPS (1 µg/rat). Rats
were killed either 1 or 3 hr after LPS or 5, 6.5, or 8 hr after
turpentine; brain regions were dissected and homogenized, and TNF-
activity of the resulting supernatants was determined. Values in
parentheses are the range of detection limits for each sample.
n = 3-4 per group.
|
|
In situ hybridization analysis with dig-labeled TNF-
riboprobes yielded no consistently detectable signal in any region in the brains of control rats, using either antisense or sense probes. With antisense probes, a marked hybridization signal of TNF-
mRNA
was detected in the hippocampal region of rats injected with LPS (100 ng, i.c.v.) 3 hr earlier (Fig. 6). This signal was not apparent with sense probes (data not shown). As in control animals, there was no consistent TNF-
mRNA hybridization signal with either antisense or sense riboprobes in the brains of rats subjected to local
inflammation by injection of turpentine, either 5 hr (data not shown)
or 7.5 hr earlier (Fig. 6). A similar pattern of no signal in either
control or turpentine-injected animals and a strong hybridization
signal in the hippocampus of rats injected with LPS 3 hr earlier was
observed using IL-1
dig-labeled riboprobes (data not shown).
Fig. 6.
Nonradioactive in situ
hybridization histochemical analysis of TNF-
mRNA expression in the
hippocampus of rats injected with either vehicle (left),
3 hr after LPS (100 ng, i.c.v.) (center), or 7.5 hr
after 50 µl turpentine/100 gm body weight (right).
Top panels at 90× magnification and bottom
panels at 225× magnification. cc, Corpus
callosum. These are data from single representative animals of
experiments comprising four subjects per experimental group. No TNF-
mRNA hybridization signal was noted in any other brain regions in any
treatment group.
[View Larger Version of this Image (72K GIF file)]
SQ-PCR analysis was performed on RNA extracted from several brain
regions (hypothalamus, hippocampus, and cortex), the pituitary, and
blood cell pellets. To determine the contribution of contaminating blood cells to the signals obtained in the experimental brain samples,
serial 1:10 dilutions of cDNAs from peripheral blood of the
corresponding experimental animals were amplified. The last dilution
tested contained cDNA derived from 3 ng of total RNA and represents 10 times any possible contribution of blood cells to the cytokine signal
(Pitossi et al., 1997
). This last dilution showed no detectable
blood-borne signal for all cytokines tested (data not shown). Figure
7 shows a representative ethidium bromide-stained
agarose gel comparing TNF-
mRNA in the various experimental samples,
and Figure 8 shows mean ± SEM for the ratios of
the detection of cytokine mRNA (TNF-
, IL-1
, and IL-6) to that of
the internal standard (pRat6). SQ-PCR indicated detectable levels of
TNF-
mRNA in all samples examined, with the relative abundance
compared with internal control being pituitary > blood > cortex > hypothalamus > hippocampus. Positive control
samples from rat spleen showed an 18-fold increase in TNF-
mRNA
levels 2 hr after LPS treatment, compared with controls; however,
injection of turpentine 7.5 hr earlier produced no effect on TNF-
mRNA levels in any of the regions tested (hypothalamus, hippocampus, cortex, pituitary, or blood) (Figs. 7, 8). Similarly IL-1
and IL-6
mRNA levels were unchanged by turpentine treatment (Fig. 8).
Fig. 7.
Detection of TNF-
transcripts by SQ-PCR.
Ethidium bromide-stained agarose gel showing the different amplicons,
which are indicated by arrows [competitive fragment
(c.f.): 480 basepair (bp); TNF-
amplicon: 248 bp].
Lane 1: cortex control; lane 2: cortex
after turpentine treatment (turp); lane 3: hypothalamus control; lane 4: hypothalamus turp; lane
5: hippocampus control; lane 6:
hippocampus turp; lane 7: pituitary control; lane
8: pituitary turp; lane 9: blood control;
lane 10: blood turp; lane 11: no reverse
transcriptase added to the RT-PCR; lane 12: no cDNA
added to the PCR; lane 13: spleen control; lane
14: spleen from rat given LPS (1 mg/kg, i.p.); lane
15: 500 molecules of the (pRat6); M: 100 bp ladder molecular weight marker.
[View Larger Version of this Image (48K GIF file)]
Fig. 8.
Mean ± SEM of the relative abundance of
cytokine transcript (TNF-
, top; IL-1
,
middle; IL-6, bottom) compared with the
competitive fragment (pRat6). Statistical analyses (unpaired
Student's t test) indicated no significant differences
between control and turpentine-treated rats for any transcript in any
region examined. Samples from spleen indicated marked increases in
cytokine transcripts after treatment with LPS (2 hr after 1 mg/kg,
i.p.), compared with control, untreated rats. TNF-
: control
0.63 ± 0.10, LPS 33.47 ± 11.09; IL-1
: control 2.89 ± 0.44, LPS 52.86 ± 12.34; IL-6 0.24 ± 0.08, LPS
22.35 ± 3.84). n = 3 subjects per
experimental group.
[View Larger Version of this Image (23K GIF file)]
DISCUSSION
The present work demonstrates that TNF-
plays a major role
within the CNS in activating the HPA axis during acute local
inflammation in rats. Injection of recombinant TNF-
into the
cerebroventricles of otherwise normal, healthy animals produced a
rapid, marked, and sustained elevation in plasma ACTH concentrations.
During acute local inflammation, the consequent elevations in plasma ACTH concentrations were reduced markedly by inhibition of TNF-
action specifically within the brain, either by intracerebral passive
immunoneutralization or by previous intracerebral treatment with a
soluble receptor construct that binds and inhibits the actions of
TNF-
(Peppel et al., 1991
; Mohler et al., 1993
; Wooley et al.,
1993
).
The profound increases in plasma ACTH concentrations produced by
intracerebral TNF-
observed here are in marked contrast to previous
studies. Sharp et al. (1989)
and van der Meer et al. (1996) reported
that human TNF-
administered either into the lateral
cerebroventricle or directly into the median eminence has no effect on
plasma ACTH levels. Conversely, these authors (Sharp et al., 1989
; van
de Meer et al., 1996
), as well as others (Bernardini et al., 1990
;
Besedovsky et al., 1991
; Watanobe and Takebe, 1992
; Sharp and Matta,
1993
), have reported marked ACTH secretagogue activity of human TNF-
when administered intravenously. The apparent difference between the
effects of intracerebral mouse and human TNF-
on plasma ACTH
concentration may reflect the differing pharmacological profiles of the
two identified TNF receptors, TNF-R1 and TNF-R2. Murine TNF-R1 has high
affinity for either mouse or human TNF-
, whereas at murine TNF-R2
only mouse TNF-
is effective (Lewis et al., 1991
; Heller et al.,
1992
; Mackay et al., 1994
). Should the same pharmacology be true at rat
TNF-
receptors, as has been suggested (Stefferl et al., 1996
), then the increase in plasma ACTH concentrations induced by intracerebral mouse but not human TNF-
indicates that TNF-R2 is the major receptor isoform involved in cerebral TNF-
modulation of HPA activity.
Our work also clearly indicates an important role of
endogenous cerebral TNF-
in regulating the response of
the HPA axis to local inflammation. Inflammation was induced by the
intramuscular injection of turpentine, which produces an initial
transient (1-2 hr after injection) series of physiological responses
(elevation in body temperature, hypermetabolism, activation of the HPA
axis) attributable to nociceptive afferent inputs (Cooper and Rothwell, 1991
; Turnbull et al., 1994
; Turnbull and Rivier, 1996a
). This is
followed by a full-blown APR that commences at ~3-4 hr, lasts for at
least 24 hr, and is mediated, at least in part, by a number of
cytokines, e.g., IL-1, IL-6, and TNF-
(Oldenburg et al., 1993
; Cooper et al., 1994a
; Kopf et al., 1994
; Turnbull et al., 1994
; Zheng
et al., 1995
; Turnbull and Rivier, 1996a
). Here we demonstrate that
inhibition of TNF-
action specifically within the brain markedly
reduces the ACTH response that is apparent 3.0-7.5 hr after turpentine
administration. In contrast, the ACTH response to mild
electrofootshocks was unaffected by intracerebroventricular anti-TNF-
, indicating that inhibition of TNF-
action within the
brain does not affect the responsiveness of HPA axis nonspecifically. Interestingly, the reductions in plasma ACTH concentration at 7.5 hr
after turpentine produced by either anti-TNF-
or the three different
doses of rhTNFR:Fc were similar (62-72% inhibition), suggesting that
this is a maximal inhibition and, by inference, that there is a small
component of the ACTH response that is independent of TNF-
acting
within the brain. Although anti-TNF-
treatment produced inhibition
of the ACTH response to local inflammation at all time points measured
(3-9 hr), the effects of rhTNFR:Fc, particularly at 9 hr, seemed to be
dose-dependent. The slight exacerbation of the ACTH response at this
time, which was apparent with the smallest dose (1 µg), is consistent
with previous reports demonstrating that at low doses rhTNFR:Fc acts as
a TNF-
carrier, resulting in enhanced rather than inhibited
responses to TNF-
once its binding capacity has been exceeded
(Mohler et al., 1993
). Intravenous administration of similar doses of
either antiserum or rhTNFR:Fc had no significant effect on plasma ACTH
levels during local inflammation, although it cannot be excluded that
higher doses of either of these TNF-
inhibitors may have an impact. Indeed peripheral administration of larger doses (80-fold) of the same
anti-TNF-
antiserum markedly attenuate the fever, hypermetabolism, and elevations in plasma IL-6 concentration produced by turpentine (Cooper et al., 1994a
). Whether or not complete inhibition of TNF-
action within the periphery significantly influences the HPA response
to local inflammation, the present work clearly indicates that TNF-
acting within the CNS is an important, although probably not the sole,
factor in the elaboration of elevated HPA activity caused by local
inflammation.
The present study also sought to determine the site (periphery or
brain) of production of cerebral TNF-
that influenced HPA activity
during local inflammation. We considered two possibilities: (1) that
TNF-
was generated in the periphery at the site of the inflammatory
insult and gained access to the CNS via circulation in blood and
subsequent transport across the blood-brain barrier (Gutierrez et al.,
1993
), and (2) that TNF-
production within the CNS was elevated
during the inflammatory insult, as has been demonstrated during
endotoxemia (Gatti and Bartfai, 1993
; Breder et al., 1994
; Laye et al.,
1994
; Liu et al., 1996
; Pitossi et al., 1997
).
Numerous studies have demonstrated that TNF-
concentrations are
markedly elevated at the site of local inflammation in rodents (e.g.,
Ford et al., 1989
; Ferrandiz and Foster, 1991
; Karalis et al., 1991
;
Smith-Oliver et al., 1993
; Sekut et al., 1994
); however, the
relationship between tissue and circulating levels of TNF-
is
controversial (Franks et al., 1991
; Remick, 1991
; Tracey and Cerami,
1992
; Sekut et al., 1994
). Although we found detectable levels of
bioactive TNF-
in the plasma of control intravenously cannulated
rats, there was no change in its concentration during acute local
inflammation over the time course that we showed to be relevant to the
cerebral TNF-
-mediated increases in HPA activity. This is consistent
with a number of studies that have demonstrated marked elevations in
inflamed tissue levels of TNF-
but no alteration in its blood
concentration (Ford et al., 1989
; Cooper et al., 1994a
; Sekut et al.,
1994
). Taken together with the observation of only limited transport of
TNF-
from blood to brain (Gutierrez et al., 1993
), these data
indicate that the effects we observed of inhibition of TNF-
action
within the CNS are unlikely to be attributable to inhibition of TNF-
of peripheral origin.
In response to the peripheral administration of LPS, the CNS expresses
elevated levels of TNF-
mRNA (Gatti and Bartfai, 1993
; Breder et
al., 1994
; Laye et al., 1994
; Liu et al., 1996
; Pitossi et al., 1997
),
as well as other inflammation-related cytokines such as IL-1 and IL-6
(Ban et al., 1992
; van Dam et al., 1992
, 1995
; Gatti and Bartfai, 1993
;
Muramami et al., 1993
; Laye et al., 1994
, 1995
; Quan et al., 1994
;
Buttini and Boddeke, 1995
; Gabellec et al., 1995
; Pitossi et al.,
1997
). Thus it has been proposed that the changes in CNS function
(e.g., fever, sickness, behavior, activation of the HPA axis) during
endotoxemia may be attributable to the influence of cytokines generated
within the CNS (Kakucska et al., 1993
; Klir et al., 1993
; Roth et al.,
1993
; Hopkins and Rothwell, 1995
; Laye et al., 1995
; Rothwell and
Hopkins, 1995
). The present study, however, suggests that previous
findings of increased cerebral cytokine expression during endotoxemia
cannot necessarily be extended to include all peripheral inflammatory insults. Acute local inflammation induced by turpentine did not result
in detectable increases in TNF-
protein in either hypothalamus, hippocampus, or cerebral cortex over the time course of study (5-8 hr
after turpentine injection). Furthermore, TNF-
mRNA could not be
detected in any brain region 5 or 7.5 hr after turpentine by using
nonradioactive in situ hybridization procedures. That these
approaches were able to detect elevations in TNF-
synthesis in brain
was demonstrated by the increases observed after cerebral administration of LPS. Even with use of the exquisitely sensitive technique of SQ-PCR [which detects as little as 1 molecule of cytokine
mRNA per 10 cells (Pitossi et al., 1997
)], no change in TNF-
mRNA
was demonstrable even at the peak of the HPA axis response to
turpentine. Similarly, no changes in either IL-1
mRNA by in
situ hybridization or IL-1
or IL-6 mRNAs by SQ-PCR were
apparent. It remains possible that we were unable to detect small
elevations in cerebral cytokine synthesis in very localized subregions
of the CNS. Furthermore, increases in cerebral cytokine synthesis may
occur at times other than those adopted in the present study. But since
the regions of the brain (hypothalamus, hippocampus, cortex) and
pituitary sampled by the most sensitive technique (SQ-PCR) are those
most implicated in the regulation of neuroendocrine functions, and many
of the APRs (e.g., fever, hypermetabolism, HPA activation) to local
inflammation induced by turpentine peak at ~8 hr (Cooper and
Rothwell, 1991
; Cooper et al., 1994a
; Turnbull et al., 1994
; Turnbull
and Rivier, 1996a
), we believe it highly unlikely that elevated
cytokine synthesis within the CNS contributes to the ensuing APRs. In
particular, the markedly suppressive effects of inhibition of TNF-
action within the brain that we demonstrate here seem not to be caused
by elevated TNF-
synthesis within the brain.
The apparent paradox of no change in brain levels of TNF-
but a key
physiological role of TNF-
within the brain in response to acute
inflammation indicates that basal cerebral synthesis of TNF-
is
sufficient to produce, or at least contribute to, the elevated HPA
activity. Although absolute levels of TNF-
protein or mRNA were not
altered measurably, elevated release of preexisting TNF-
from either
neurons or more likely from astrocytes or glial cells might be
sufficient to account for the activation of the HPA axis that is
apparent during acute local inflammation. Indeed, immunocytochemical
evidence indicates that TNF-
protein is distributed discretely in
the mouse CNS, particularly in areas involved in autonomic and
endocrine regulation, including the hypothalamus, amygdala, and bed
nucleus of the stria terminalis (Breder et al., 1993
). Whether a
similar distribution is apparent in the rat CNS is not known, although
clearly the levels of TNF-
protein are below the detection limits of
the methodology used in the present work (L929 bioassay of brain
homogenates). Alternatively, TNF-
may play a permissive or
synergistic role in the regulation of HPA activity during acute local
inflammation. Recent studies demonstrating that neutralization of
cytokine action in brain reduces the fever response to prostaglandin
E2 (PGE2) (Fernandez-Alonso et al., 1996
)
suggest a permissive action of cytokines within the brain in response
to PGs. Because local inflammation induced by turpentine produces
marked increases in brain concentrations of PGE2 (Cooper et
al., 1994b
), and the accompanying HPA axis response is completely reversed by the cyclo-oxygenase inhibitor ibuprofen (Turnbull and
Rivier, 1996a
), it seems plausible that TNF-
signaling within the
brain is necessary for the full expression of the HPA-activating effects of PGE2.
FOOTNOTES
Received Jan. 8, 1997; revised Feb. 6, 1997; accepted Feb. 10, 1997.
This work was supported by National Institutes of Health Grant DK26741
(C.R.) and the Foundation for Research (FFR). C.R. is an FFR
Investigator. We are grateful to Dr. Steve Kunkel (University of
Michigan) and Dr. Tony Troutt (Immunex Corporation, Seattle, WA) for
their generous gifts of reagents.
Correspondence should be addressed to Catherine Rivier, The Clayton
Foundation Laboratories for Peptide Biology, The Salk Institute, 10010 North Torrey Pines Road, La Jolla, CA 92037.
REFERENCES
-
Ban EM,
Haour F,
Lenstra R
(1992)
Brain interleukin-1 gene expression induced by peripheral lipopolysaccharide administration.
Cytokine
4:48-54[Web of Science][Medline].
-
Berkenbosch F,
Van Oers J,
del Rey A,
Tilders F,
Besedovsky H
(1987)
Corticotropin-releasing factor-producing neurons in the rat activated by interleukin-1.
Science
238:524-526[Abstract/Free Full Text].
-
Bernardini R,
Kamilaris TC,
Calogero AE,
Johnson EO,
Gomez MT,
Gold PW,
Chrousos GP
(1990)
Interactions between tumor necrosis factor-
, hypothalamic corticotropin-releasing hormone, and adrenocorticotropin secretion in the rat.
Endocrinology
126:2876-2881[Abstract/Free Full Text]. -
Besedovsky HO,
del Rey A
(1996)
Immune-neuroendocrine interactions: facts and hypotheses.
Endocr Rev
17:64-102[Abstract/Free Full Text].
-
Besedovsky HO,
del Rey A,
Klusman I,
Furukawa H,
Arditi GM,
Kabiersch A
(1991)
Cytokines as modulators of the hypothalamus-pituitary-adrenal axis.
J Steroid Biochem Mol Biol
40:613-618[Web of Science][Medline].
-
Blalock JE
(1989)
A molecular basis for bidirectional communication between the immune and neuroendocrine systems.
Physiol Rev
69:1-32[Free Full Text].
-
Bouaboula M,
Legoux P,
Pessegue B,
Delpech B,
Dumont X,
Piechaczyk M,
Casellas P,
Shire D
(1992)
Standardization of mRNA titration using polymerase chain reaction method involving co-amplification with a multi-specific internal control.
J Biol Chem
267:21830-21838[Abstract/Free Full Text].
-
Breder CD,
Tsujimoto M,
Terano Y,
Scott DW,
Saper CB
(1993)
Distribution and characterization of tumor necrosis factor-
-like immunoreactivity in the murine central nervous system.
J Comp Neurol
337:543-567[Web of Science][Medline]. -
Breder CD,
Hazuka C,
Ghayur T,
Klug C,
Huginin M,
Yasuda K,
Teng M,
Saper CB
(1994)
Regional distribution of tumor necrosis factor
expression in the mouse brain after systemic lipopolysaccharide administration.
Proc Natl Acad Sci USA
91:11393-11397[Abstract/Free Full Text]. -
Buttini M,
Boddeke H
(1995)
Peripheral lipopolysaccharide stimulation induces interleukin-1
messenger RNA in rat brain microglial cells.
Neuroscience
65:523-530[Web of Science][Medline]. -
Chensue SW,
Remick DG,
Smyr-Forsch C,
Beals TF,
Kunkel SL
(1988)
Immunohistochemical demonstration of cytoplasmic and membrane-associated tumor necrosis factor in murine macrophages.
Am J Pathol
133:564-572[Abstract].
-
Colletti LM,
Remick DG,
Burtch GD,
Kunkel SL,
Strieter RM,
Campbell DA
(1990)
Role of tumor necrosis factor-
in the pathophysiologic alterations after hepatic ischemia/reperfusion injury in the rat.
J Clin Invest
85:1936-1943. -
Cooper AL,
Rothwell NJ
(1991)
Mechanisms of early and late hypermetabolism and fever after localized tissue injury in rats.
Am J Physiol
261:E698-E708[Abstract/Free Full Text].
-
Cooper AL,
Brouwer S,
Turnbull AV,
Luheshi GN,
Hopkins SJ,
Kunkel SL,
Rothwell NJ
(1994a)
Tumor necrosis factor-alpha and fever after peripheral inflammation in the rat.
Am J Physiol
267:R1431-R1436[Abstract/Free Full Text].
-
Cooper AL,
Turnbull AV,
Hopkins SJ,
Rothwell NJ
(1994b)
Dietary n-3 fatty acids inhibit fever induced by inflammation in the rat.
Mediat Inflamm
3:353-357.
-
Creasey AA,
Stevens P,
Kenney J,
Alison AC,
Warren K,
Catlett R,
Hinshaw L,
Taylor F
(1991)
Endotoxin and cytokine profile in plasma of baboons challenged with lethal and sublethal Escherichia coli.
Circ Shock
33:84-91[Web of Science][Medline].
-
DeForge LE,
Remick DG
(1991)
Kinetics of TNF, IL-6 and IL-8 gene expression in LPS-stimulated human whole blood.
Biochem Biophys Res Commun
174:18-24[Web of Science][Medline].
-
Dinarello CA,
Wolff SM
(1993)
The role of interleukin-1 in disease.
N Engl J Med
328:106-113[Free Full Text].
-
Doyle E,
Nolan PM,
Bell R,
Regan CM
(1992)
Intraventricular infusions of anti-neural cell adhesion molecules in a discrete posttraining period impair consolidation of a passive avoidance response in the rat.
J Neurochem
59:1570-1573[Web of Science][Medline].
-
Ebisui O,
Fukata J,
Murakami N,
Kobayashi H,
Segawa H,
Muro S,
Hanaoka I,
Naito Y,
Masui Y,
Ohmoto Y,
Imura H,
Nakao K
(1994)
Effect of IL-1 receptor antagonist and antiserum to TNF-
on LPS-induced plasma ACTH and corticosterone in rats.
Am J Physiol
266:E986-E992[Abstract/Free Full Text]. -
Fan L,
Knoblach SM,
Yakovlev AG,
Faden AI
(1996)
Involvement of tumor necrosis factor-alpha in the pathophysiology of experimental brain injury.
Soc Neurosci Abstr
2:465.14.
-
Fernandez-Alonso A,
Benamar K,
Sanchibrian M,
Lopez-Valupuesta FJ,
Minano FJ
(1996)
Role of interleukin-1
, interleukin-6 and macrophage inflammatory protein-1
in prostaglandin E2-induced hyperthermia in rats.
Life Sci
59:PL185-190[Web of Science][Medline]. -
Ferrandiz ML,
Foster SJ
(1991)
Tumor necrosis factor production in a rat airpouch model of inflammation: role of eicosanoids.
Agents Actions
32:289-294[Web of Science][Medline].
-
Fong Y,
Tracey KJ,
Moldawer LL,
Hesse DG,
Manogue KB,
Kenney JS,
Lee AT,
Kuo GC,
Allison AC,
Lowry SF,
Cerami A
(1989)
Antibodies to cachectin/tumor necrosis factor reduce interleukin-1 beta and interleukin-6 appearance during lethal bacteremia.
J Exp Med
170:1627-1633[Abstract/Free Full Text].
-
Fontana A,
Weber E,
Dayer J-M
(1984)
Synthesis of interleukin-1/endogenous pyrogen in the brain of endotoxin-treated mice: a step in fever induction?
J Immunol
133:1696-1698[Web of Science][Medline].
-
Ford HR,
Hoffman RA,
Wing EJ,
Magee DM,
McIntyre L,
Simmons RL
(1989)
Characterization of wound cytokines in the sponge matrix model.
Arch Surg
124:1422-1428[Abstract/Free Full Text].
-
Franks AK,
Kujawa KI,
Yaffe LJ
(1991)
Experimental elimination of tumor necrosis factor in low dose endotoxin models has variable effects on survival.
Infect Immun
59:2609-2614[Abstract/Free Full Text].
-
Gabellec M-M,
Griffais R,
Fillion G,
Haour F
(1995)
Expression of interleukin 1
, interleukin 1
and interleukin 1 receptor antagonist mRNA in mouse brain: regulation by bacterial lipopolysaccharide (LPS) treatment.
Mol Brain Res
31:122-130[Medline]. -
Galasso JM,
Wang P,
Martin D,
Silverstein FS
(1996)
Inhibition of tumor necrosis factor-
(TNF-
) attenuates NMDA-induced striatal neurotoxicity in perinatal rats.
Soc Neurosci Abstr
1:318.5. -
Gatti S,
Bartfai T
(1993)
Induction of tumor necrosis factor-alpha mRNA in the brain after peripheral endotoxin treatment: comparison with interleukin-1 family and interleukin-6.
Brain Res
624:291-294[Web of Science][Medline].
-
Givalois L,
Dornand J,
Mekaouche M,
Solier MD,
Bristow AF,
Ixart G,
Siaud I,
Assenmacher I,
Barbanel G
(1994)
Temporal cascade of plasma level surges in ACTH, corticosterone, and cytokines in endotoxin-challenged rats.
Am J Physiol
267:R164-R170[Abstract/Free Full Text].
-
Gutierrez EG,
Banks WA,
Kastin AJ
(1993)
Murine tumor necrosis factor alpha is transported from blood to brain in the mouse.
J Neuroimmunol
47:169-176[Web of Science][Medline].
-
Hagan P,
Poole S,
Bristow AF
(1993)
Endotoxin-stimulated production of rat hypothalamic interleukin-1
in vivo and in vitro, measured by specific immunoradiometric assay.
J Mol Endocrinol
11:31-36[Abstract/Free Full Text]. -
Heller RA,
Song K,
Fan N,
Chang DJ
(1992)
The p70 tumor necrosis factor receptor mediates cytotoxicity.
Cell
70:47-56[Web of Science][Medline].
-
Hopkins SJ,
Rothwell NJ
(1995)
Cytokines and the nervous system. I. Expression and regulation.
Trends Neurosci
18:83-88[Web of Science][Medline].
-
Kakucska I,
Qi Y,
Clark BD,
Lechan RM
(1993)
Endotoxin-induced corticotropin-releasing hormone gene expression in the hypothalamic paraventricular nucleus is mediated centrally by interleukin-1.
Endocrinology
133:815-821[Abstract/Free Full Text].
-
Karalis K,
Sano H,
Redwine J,
Listwak S,
Wilder RL,
Chrousos GP
(1991)
Autocrine or paracrine inflammatory actions of corticotropin-releasing hormone in vivo.
Science
254:421-423[Abstract/Free Full Text].
-
Klir JJ,
Roth J,
Szelenyi Z,
McClellan JL,
Kluger MJ
(1993)
Role of hypothalamic interleukin-6 and tumor necrosis factor-
in LPS fever in rat.
Am J Physiol
265:R512-R517[Abstract/Free Full Text]. -
Kopf M,
Baumann H,
Freer G,
Freudenberg M,
Lamers M,
Kishimoto T,
Zingernagel R,
Bluethmann H,
Kohler G
(1994)
Impaired immune and acute-phase responses in interleukin-6 deficient mice.
Nature
368:339-342[Medline].
-
Laye S,
Parnet P,
Goujon E,
Dantzer R
(1994)
Peripheral administration of lipopolysaccharide induces the expression of cytokine transcripts in the brain and pituitaries of mice.
Mol Brain Res
27:157-162[Medline].
-
Laye S,
Bluthe RM,
Kent S,
Combe C,
Medina C,
Parnet P,
Kelley K,
Dantzer R
(1995)
Subdiaphragmatic vagotomy blocks induction of IL-1 beta mRNA in mice brain in response to peripheral LPS.
Am J Physiol
37:R1327-R1331.
-
Le Contel C,
Vinit MA,
Parant FJ,
Parant MA
(1990)
Differential priming for endotoxin-induced circulating cytokine production by tumor necrosis factor and interleukin-1
.
Cytokine
2:375-380[Medline]. -
Lewis M,
Tartaglia LA,
Lee A,
Bennet GL,
Rice GC,
Wong GHW,
Chen EY,
Goeddel DV
(1991)
Cloning and expression of cDNAs for two distinct murine tumor necrosis factor receptors demonstrate one receptor is species specific.
Proc Natl Acad Sci USA
88:2830-2834[Abstract/Free Full Text].
-
Liu L,
Kita T,
Tanaka N,
Kinoshita Y
(1996)
The expression of tumor necrosis factor in the hypothalamus after treatment with lipopolysaccharide.
Int J Exp Pathol
77:37-44[Web of Science][Medline].
-
Long NC,
Kunkel SL,
Vander AJ,
Kluger MJ
(1990)
Antiserum against TNF enhances LPS fever in the rat.
Am J Physiol
258:R332-R337[Abstract/Free Full Text].
-
Mackay F,
Rothe J,
Bluethmann H,
Loetscher H,
Lesslauer W
(1994)
Differential responses of fibroblasts from wild-type and TNF-R55-deficient mice to mouse and human TNF-
activation.
J Immunol
153:5274-5284[Abstract]. -
Meltzer JC, Sanders V, Grim PC, Stern E, Rivier C, Lee S, Rennie SL,
Gietz RD, Hole A, Watson PH, Greenberg AH, Nance
DM (1997) Detection of cytokine mRNA in rat spleen and brain
by in situ hybridization with digoxigenin-labelled riboprobes. J
Histochem Cytochem, in press.
-
Mohler KM,
Torrance DS,
Smith CA,
Goodwin RG,
Stremler KE,
Fung VP,
Madani H,
Widmer MB
(1993)
Soluble tumor necrosis factor (TNF) receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously as both TNF carriers and TNF antagonists.
J Immunol
151:1548-1561[Abstract].
-
Muramami N,
Fukata J,
Tsukada T,
Kobayashi H,
Ebisui O,
Segawa H,
Muro S,
Imura H,
Nakao K
(1993)
Bacterial lipopolysaccharide-induced expression of interleukin-6 messenger ribonucleic acid in the rat hypothalamus, pituitary, adrenal gland, and spleen.
Endocrinology
133:2574-2578[Abstract/Free Full Text].
-
Naitoh Y,
Fukata J,
Tominaga T,
Nakai Y,
Tamai S,
Mori K,
Imura H
(1988)
Interleukin-6 stimulates the secretion of adrenocorticotropic hormone in conscious, freely moving rats.
Biochem Biophys Res Commun
155:1459-1463[Web of Science][Medline].
-
Navarra P,
Tsagarakis S,
Faria M,
Rees LH,
Besser GM,
Grossman AB
(1991)
Interleukins-1 and -6 stimulate the release of corticotropin-releasing hormone-41 from rat hypothalamus in vitro via the eicosanoid cyclooxygenase pathway.
Endocrinology
128:37-44[Abstract/Free Full Text].
-
Norris JG,
Tang L,
Sparacio SM,
Benveniste E
(1994)
Signal transduction pathways mediating astrocyte IL-6 induction by IL-1 beta and tumor necrosis factor.
J Immunol
152:841-850[Abstract].
-
Oldenburg HSA,
Rogy MA,
Lazarus DD,
Van Zee KJ,
Keeler BP,
Chizzonite RA,
Lowry SF,
Moldawer LL
(1993)
Cachexia and the acute-phase protein response in inflammation are regulated by interleukin-6.
Eur J Immunol
23:1889-1894[Web of Science][Medline].
-
Peppel P,
Crawford D,
Beutler B
(1991)
A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity.
J Exp Med
174:1483-1489[Abstract/Free Full Text].
-
Perlstein RS,
Whitnall MH,
Abrams JS,
Moughey EH,
Neta R
(1993)
Synergistic roles of interleukin-6, interleukin-1, and tumor necrosis factor in the adrenocorticotropin response to bacterial lipopolysaccharide in vivo.
Endocrinology
132:946-952[Abstract/Free Full Text].
-
Pitossi FJ,
Besedovsky HO
(1996)
A multispecific internal control (pRat6) for the analysis of rat cytokine mRNA levels by quantitative RT-PCR.
Eur Cytokine Netw
7:377-379[Web of Science][Medline].
-
Pitossi F, del Rey A, Kabiersch A, Besedovsky
H (1997) Induction of cytokine transcripts in the CNS and
pituitary following peripheral administration of endotoxin to mice.
J Neurosci Res, in press.
-
Quan N,
Sundar SK,
Weiss JM
(1994)
Induction of interleukin-1 in various brain regions after peripheral and central injections of lipopolysaccharide.
J Neuroimmunol
49:125-134[Web of Science][Medline].
-
Quan N,
Zhang Z,
Emery M,
Lai E,
Bonsall R,
Kalyanaraman VS,
Weiss JM
(1996)
In vivo induction of interleukin-1 bioactivity in brain tissue after intracerebral infusion of native gp120 and gp160.
Neuroimmunomodulation
3:56-61[Web of Science][Medline].
-
Remick DG
(1991)
Significance of in vivo detection of tumor necrosis factor.
Lab Invest
65:259-261[Web of Science][Medline].
-
Remick DG,
Strieter R,
Eskandari MK,
Nguyen DT,
Genord MA,
Raiford CL,
Kunkel SL
(1990)
Role of tumor necrosis factor-
in lipopolysaccharide-induced pathologic alterations.
Am J Pathol
136:49-60[Abstract]. -
Rivier C,
Shen GH
(1994)
In the rat, endogenous nitric oxide modulates the response of the hypothalamo-pituitary-adrenal axis to interleukin-1
, vasopressin, and oxytocin.
J Neurosci
14:1985-1993[Abstract]. -
Rivier C,
Chizzonite R,
Vale W
(1989)
In the mouse, the activation of the hypothalamic-pituitary-adrenal axis by a lipopolysaccharide (endotoxin) is mediated through interleukin-1.
Endocrinology
125:2800-2805[Abstract/Free Full Text].
-
Romero LI,
Schettini G,
Lechan RM,
Dinarello CA,
Reichlin S
(1993)
Bacterial lipopolysaccharide induction of IL-6 in rat telencephalic cells is mediated in part by IL-1.
Neuroendocrinology
57:892-897[Web of Science][Medline].
-
Roth J,
Conn CA,
Kluger MJ,
Zeisberger E
(1993)
Kinetics of systemic and intrahypothalamic IL-6 and tumor necrosis factor during endotoxin fever in guinea pigs.
Am J Physiol
265:R653-R658[Abstract/Free Full Text].
-
Rothwell NJ,
Hopkins SJ
(1995)
Cytokines and the central nervous system II: actions and mechanism of action.
Trends Neurosci
18:130-136[Web of Science][Medline].
-
Rothwell NJ,
Luheshi G,
Toulmond S
(1996)
Cytokines and their receptors in the central nervous system: physiology, pharmacology, and pathology.
Pharmacol Ther
69:85-95[Web of Science][Medline].
-
Sapolsky R,
Rivier C,
Yamamoto G,
Plotsky P,
Vale W
(1987)
Interleukin-1 stimulates the secretion of hypothalamic corticotropin-releasing factor.
Science
238:522-524[Abstract/Free Full Text].
-
Schobitz B,
de Kloet ER,
Holsboer F
(1994)
Gene expression and function of interleukin 1, interleukin 6 and tumor necrosis factor in the brain.
Prog Neurobiol
44:397-432[Web of Science][Medline].
-
Schotanus K,
Tilders FJ,
Berkenbosch F
(1993)
Human recombinant interleukin-1 receptor antagonist prevents adrenocorticotropin, but not interleukin-6 responses to bacterial endotoxin.
Endocrinology
133:2461-2468[Abstract/Free Full Text].
-
Sekut L,
Menius JA,
Brackeen MF,
Connolly KM
(1994)
Evaluation of the significance of elevated levels of systemic and localized tumor necrosis factor in different animal models of inflammation.
J Lab Clin Med
124:813-820[Web of Science][Medline].
-
Sharp BM,
Matta SG
(1993)
Prostaglandins mediate the adrenocorticotropin response to tumor necrosis factor in rats.
Endocrinology
132:269-274[Abstract/Free Full Text].
-
Sharp BM,
Matta SG,
Peterson PK,
Newton R,
Chao C,
McAllen K
(1989)
Tumor necrosis factor-
is a potent ACTH secretagogue: comparison with interleukin-1
.
Endocrinology
124:3131-3133[Abstract/Free Full Text]. -
Smith-Oliver T,
Noel LS,
Stimpson SA,
Yarnall DP,
Connolly KM
(1993)
Elevated levels of TNF in the joints of adjuvant arthritic rats.
Cytokine
5:298-305[Web of Science][Medline].
-
Stefferl A,
Hopkins SJ,
Rothwell NJ,
Luheshi GN
(1996)
The role of TNF-
in fever: opposing actions of human and murine TNF-
and interactions with IL-1
in the rat.
Br J Pharmacol
118:1919-1924[Web of Science][Medline]. -
Taupin V,
Toulmond S,
Serrano A,
Benavides J,
Zavala F
(1993)
Increase in IL-6, IL-1 and TNF levels in rat brain following traumatic lesion. Influence of pre- and post-traumatic treatment with Ro5 4864: a peripheral-type (p site) benzodiazepine ligand.
J Neuroimmunol
42:177-186[Web of Science][Medline].
-
Thomas LB,
Book AA,
Schweitzer JB
(1991)
Immunohistochemical detection of a monoclonal antibody directed against the NGF receptor in basal forebrain neurons following intraventricular injection.
J Neurosci Res
37:37-45.
-
Tilders FJH,
De Rijk RH,
Van Dam A-M,
Vincent VA,
Schotanus K,
Persoons JHA
(1994)
Activation of the hypothalamus-pituitary-adrenal axis by bacterial endotoxins: routes and intermediate signals.
Psychoneuroendocrinology
19:209-232[Web of Science][Medline].
-
Tracey KJ,
Cerami A
(1992)
Tumor necrosis factor and regulation of metabolism in infection: role of systemic versus tissue levels.
Proc Soc Exp Biol Med
200:233-239[Medline].
-
Tsagarakis S,
Gillies G,
Rees LH,
Besser M,
Grossman A
(1989)
Interleukin-1 directly stimulates the release of corticotrophin releasing factor from rat hypothalamus.
Neuroendocrinology
49:98-101[Web of Science][Medline].
-
Turnbull AV,
Rivier C
(1995)
Regulation of the HPA axis by cytokines.
Brain Behav Immun
9:253-275[Web of Science][Medline].
-
Turnbull AV,
Rivier C
(1996a)
Corticotropin-releasing factor, vasopressin and prostaglandins mediate, and nitric oxide restrains, the HPA axis response to acute local inflammation in the rat.
Endocrinology
137:455-463[Abstract].
-
Turnbull AV,
Rivier C
(1996b)
Cytokines within the neuroendocrine system.
Curr Opinion Endocrinol Diabetes
3:149-156.
-
Turnbull AV,
Rivier C
(1996c)
Selective inhibitors of nitric oxide synthase (NOS) implicate a constitutive isoform of NOS in the regulation of interleukin-1-induced ACTH secretion in rats.
Endocrine
5:135-145.
-
Turnbull AV,
Dow RC,
Hopkins SJ,
White A,
Fink G,
Rothwell NJ
(1994)
Mechanism of the activation of the pituitary-adrenal axis by tissue injury in the rat.
Psychoneuroendocrinology
19:165-178[Web of Science][Medline].
-
Uehara A,
Gottschall PE,
Dahl RR,
Arimura A
(1987)
Interleukin-1 stimulates ACTH release by an indirect action which requires endogenous corticotropin-releasing factor.
Endocrinology
121:1580-1582[Abstract/Free Full Text].
-
van Dam A-M,
Brouns M,
Louisse S,
Berkenbosch F
(1992)
Appearance of interleukin-1 in macrophages and in ramified microglia in the brain of endotoxin-treated rats: a pathway for the induction of non-specific symptoms of sickness?
Brain Res
588:291-296[Web of Science][Medline].
-
van Dam A-M,
Bauer J,
Tilders FJH,
Berkenbosch F
(1995)
Endotoxin-induced appearance of immunoreactive interleukin-1
in ramified microglia in rat brain: a light and electron microscopic study.
Neuroscience
65:815-826[Web of Science][Medline]. -
van de Meer MJM,
Sweep CGJ,
Rijnkels CEM,
Pesman GJ,
Tilders FJH,
Kloppenborg PWC,
Hermus ARMM
(1996)
Acute stimulation of the hypothalamic-pituitary-adrenal axis by IL-1
, TNF
and IL-6: a dose response study.
J Endocrinol Invest
19:175-182[Web of Science][Medline]. -
Van der Zee CEEM,
Fawcett J,
Diamond J
(1992)
Antibody to NGF inhibits collateral sprouting of septohippocampal fibers following entorhinal cortex lesion in adult rats.
J Comp Neurol
326:91-100[Web of Science][Medline].
-
Van der Zee CEEM,
Lourenssen S,
Stanisz J,
Diamond J
(1995)
NGF deprivation of adult rat brain results in cholinergic hypofunction and selective impairments in spatial learning.
Eur J Neurosci
7:160-168[Web of Science][Medline].
-
Watanobe H,
Takebe K
(1992)
Intravenous administration of tumor necrosis factor-
stimulates corticotropin-releasing hormone secretion in the push-pull cannulated median eminence of freely moving rats.
Neuropeptides
22:81-84[Web of Science][Medline]. -
Watanobe H,
Sasaki S,
Takebe K
(1991)
Evidence that intravenous administration of interleukin-1 stimulates corticotropin releasing hormone secretion in the median eminence of freely moving rats: estimation by push pull perfusion.
Neurosci Lett
133:7-10[Web of Science][Medline].
-
Wooley PH,
Dutcher J,
Widmer MB,
Gillis S
(1993)
Influence of a recombinant human soluble tumor necrosis factor receptor FC fusion protein on Type II collagen-induced arthritis in mice.
J Immunol
151:6602-6607[Abstract].
-
Zanetti G,
Heumann D,
Gerain J,
Kohler J,
Abbet P,
Barras C,
Lucas R,
Glauser M-P,
Baumgartner J-D
(1992)
Cytokine production after intravenous or peritoneal gram-negative bacterial challenge in mice.
J Immunol
148:1890-1897[Abstract].
-
Zheng H,
Fletcher D,
Kozak W,
Jiang M,
Hofman KJ,
Conn CA,
Soszynski D,
Grabiec C,
Trumbauer ME,
Shaw A,
Kostura MJ,
Stevens K,
Rosen H,
North RJ,
Chen HY,
Tocci MJ,
Kluger MJ,
Van der Ploeg LHT
(1995)
Resistance to fever induction and impaired acute-phase response in interleukin-1
-deficient mice.
Immunity
3:9-19[Web of Science][Medline].
This article has been cited by other articles:

|
 |

|
 |
 
I. V. Mikhaylova, T. Kuulasmaa, J. Jaaskelainen, and R. Voutilainen
Tumor Necrosis Factor-{alpha} Regulates Steroidogenesis, Apoptosis, and Cell Viability in the Human Adrenocortical Cell Line NCI-H295R
Endocrinology,
January 1, 2007;
148(1):
386 - 392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rossi-George, D. Urbach, D. Colas, Y. Goldfarb, and A. W. Kusnecov
Neuronal, Endocrine, and Anorexic Responses to the T-Cell Superantigen Staphylococcal Enterotoxin A: Dependence on Tumor Necrosis Factor-{alpha}
J. Neurosci.,
June 1, 2005;
25(22):
5314 - 5322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Turnbull, S. Prehar, A. R. Kennedy, R. A. Little, and S. J. Hopkins
Interleukin-6 Is an Afferent Signal to the Hypothalamo-Pituitary-Adrenal Axis during Local Inflammation in Mice
Endocrinology,
May 1, 2003;
144(5):
1894 - 1906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Hermann, C. A. Tovar, and R. C. Rogers
LPS-induced suppression of gastric motility relieved by TNFR:Fc construct in dorsal vagal complex
Am J Physiol Gastrointest Liver Physiol,
September 1, 2002;
283(3):
G634 - G639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rivest, S. Lacroix, L. Vallières, S. Nadeau, J. Zhang, and N. Laflamme
How the Blood Talks to the Brain Parenchyma and the Paraventricular Nucleus of the Hypothalamus During Systemic Inflammatory and Infectious Stimuli
Experimental Biology and Medicine,
January 1, 2000;
223(1):
22 - 38.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. V. Turnbull, J. Vaughan, J. E. Rivier, W. W. Vale, and C. Rivier
Urocortin Is Not a Significant Regulator of Intermittent Electrofootshock-Induced Adrenocorticotropin Secretion in the Intact Male Rat
Endocrinology,
January 1, 1999;
140(1):
71 - 78.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. V. Turnbull and C. L. Rivier
Intracerebroventricular Passive Immunization. I. The Effect of Intracerebroventricular Administration of an Antiserum to Tumor Necrosis Factor-{alpha} on the Plasma Adrenocorticotropin Response to Lipopolysaccharide in Rats
Endocrinology,
January 1, 1998;
139(1):
119 - 127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Turnbull and C. L. Rivier
Intracerebroventricular Passive Immunization. II. Intracerebroventricular Infusion of Neuropeptide Antisera Can Inhibit Neuropeptide Signaling in Peripheral Tissues
Endocrinology,
January 1, 1998;
139(1):
128 - 136.
[Abstract]
[Full Text]
[PDF]
|
 |
|