WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (128)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nonet, M. L.
Right arrow Articles by Wei, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nonet, M. L.
Right arrow Articles by Wei, L.

 Previous Article  |  Next Article 

The Journal of Neuroscience, January 1, 1998, 18(1):70-80

Synaptic Transmission Deficits in Caenorhabditis elegans Synaptobrevin Mutants

Michael L. Nonet1, Owais Saifee1, Hongjuan Zhao1, James B. Rand2, and Liping Wei1

1 Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri 63110, and 2 Program in Molecular and Cell Biology, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Synaptobrevins are vesicle-associated proteins implicated in neurotransmitter release by both biochemical studies and perturbation experiments that use botulinum toxins. To test these models in vivo, we have isolated and characterized the first synaptobrevin mutants in metazoans and show that neurotransmission is severely disrupted in mutant animals. Mutants lacking snb-1 die just after completing embryogenesis. The dying animals retain some capability for movement, although they are extremely uncoordinated and incapable of feeding. We also have isolated and characterized several hypomorphic snb-1 mutants. Although fully viable, these mutants exhibit a variety of behavioral abnormalities that are consistent with a general defect in the efficacy of synaptic transmission. The viable mutants are resistant to the acetylcholinesterase inhibitor aldicarb, indicating that cholinergic transmission is impaired. Extracellular recordings from pharyngeal muscle also demonstrate severe defects in synaptic transmission in the mutants. The molecular lesions in the hypomorphic alleles reside on the hydrophobic face of a proposed amphipathic-helical region implicated biochemically in interacting with the t-SNAREs syntaxin and SNAP-25. Finally, we demonstrate that double mutants lacking both the v-SNAREs synaptotagmin and snb-1 are phenotypically similar to snb-1 mutants and less severe than syntaxin mutants. Our work demonstrates that synaptobrevin is essential for viability and is required for functional synaptic transmission. However, our analysis also suggests that transmitter release is not completely eliminated by removal of either one or both v-SNAREs.

Key words: synaptobrevin; VAMP; exocytosis; synaptic vesicle protein; mutants; Caenorhabditis elegans; v-SNARE

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Synaptic transmission is a calcium-regulated secretory process that shares many similarities with other secretory mechanisms in eukaryotic cells. A growing number of molecular components of the synaptic machinery have been identified via both biochemical and genetic approaches (for review, see Bennett and Scheller, 1994; Sudhof, 1995). One class of molecules that participate in the fusion event is the SNAP receptors (SNAREs; Sollner et al., 1993a). Distinct, but homologous, members of the v- and t-SNARE families are thought to mediate trafficking events in different cellular compartments (for review, see Ferro-Novick and Jahn, 1994). In neurons the v-SNAREs synaptobrevin (also called VAMP) and synaptotagmin are found specifically associated with synaptic vesicles (Trimble et al., 1988; Perin et al., 1990), and the t-SNAREs syntaxin and SNAP-25 are localized primarily on the plasma membrane (Bennett et al., 1992; Garcia et al., 1995). Stable synaptobrevin/syntaxin/SNAP-25 biochemical complexes can be assembled and disassembled in vitro (Sollner et al., 1993b), and these biochemical reactions are proposed to mediate vesicular fusion.

Synaptobrevin was first identified as a protein associated with synaptic vesicles isolated from electric organs of the ray (Trimble et al., 1988). Subsequently, homologs have been isolated from a variety of organisms, including yeast, Drosophila, and human (Sudhof et al., 1989; Archer et al., 1990; Gerst et al., 1992; Protopopov et al., 1993). A variety of evidence suggests that synaptobrevin family members play an essential role in regulating fusion events. Saccharomyces cerevisiae snc1 snc2 double mutants lacking the yeast homologs of synaptobrevin have severe secretory defects (Gerst et al., 1992; Protopopov et al., 1993). Studies using several botulinum neurotoxins directly implicate synaptobrevin in the regulation of synaptic transmission (for review, see Tonello et al., 1996). These potent inhibitors of synaptic transmission are metalloproteases that cleave SNAREs. Tetanus toxin (TeTx) and several clostridial toxins cleave synaptobrevin at unique sites (Schiavo et al., 1992, 1993, 1994). In fact, expression of these toxins in neurons blocks synaptic transmission in vivo (Sweeney et al., 1995). Furthermore, in beta -islet cell lines, the TeTx-block in Ca2+-induced release of insulin can be overcome by introducing TeTx-resistant forms of synaptobrevin (Regazzi et al., 1997). However, these toxins also cleave other cellular homologs of synaptobrevin, such as cellubrevin, which are expressed in all cells (McMahon et al., 1993). Indeed, tetanus toxin can inhibit cell membrane repair in fibroblasts and Xenopus oocytes, suggesting that synaptobrevin-like molecules regulate other fusion events (Steinhardt et al., 1994). Thus, although TeTx toxin action suggests a requirement for synaptobrevin in synaptic release, the possibility remains that protease cleavage of other targets contributes to the transmission abnormalities in toxin-treated cells.

To examine the role of synaptobrevin in regulating synaptic transmission, we isolated and characterized Caenorhabditis elegans synaptobrevin mutants. SNB-1 was expressed in neurons and colocalized with other synaptic vesicle proteins. Mutants lacking synaptobrevin function died shortly after completing embryogenesis. Viable hypomorphic mutants exhibited a variety of behavioral, pharmacological, and physiological defects, indicating that functional synaptobrevin is required for normal synaptic transmission. Characterization of the molecular lesions in the hypomorphic mutants implicates a proposed amphipathic-helical region of SNB-1 in synaptobrevin function.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Growth and culture of C. elegans. C. elegans was grown at 22.5°C on solid medium, as described by Sulston and Hodgkin (1988). All mapping, complementation, and deficiency testing was performed by standard genetic methods (Herman and Horvitz, 1980). Aldicarb, 2-methyl-2-[methylthio]proprionaldehyde O-[methylcarbamoyl]oxime, was obtained from Chem Services (West Chester, PA) and was prepared as a 100 mM stock solution in 70% ethanol. Aldicarb was added to the agar growth medium after autoclaving.

DNA and RNA manipulations. C. elegans genomic DNA was isolated as described by (Sulston and Hodgkin, 1988). cDNA was made by reverse-transcribing RNA, using random hexanucleotide primers as described by Sambrook et al. (1989). Poly(A+)-selected RNA was isolated from a mixed-stage culture of the wild-type strain N2 as previously described (Nonet and Meyer, 1991). Manipulations of DNA and RNA, including electrophoresis, blotting, and probing of blots, were performed with standard procedures except where noted (Sambrook et al., 1989).

Cloning of C. elegans synaptobrevin gene. Degenerate oligonucleotides SB-1 (5' TNCARCARACNCARGC 3') and SB-2 (5' CCNARNATDATCATCAT 3'), corresponding to regions conserved among the bovine, Torpedo, and Drosophila synaptobrevin proteins (Trimble et al., 1988; Sudhof et al., 1989), were used to amplify the C. elegans gene specifically. PCR reactions were performed as described by Innis et al. (1990). SB-1/SB-2 products were gel-purified, cloned into pBluescript KS(-), and sequenced. Insert DNA was used to screen a lambda ZAP cDNA library (Lichtsteiner and Tjian, 1993). The inserts of two cDNA clones isolated were excised from lambda ZAP in vivo to create pSB100 and pSB101. pSB101 cDNA represents the full-length transcript because it contains a partial SL1 trans-spliced leader sequence and a 3' poly(A+) sequence and is of comparable size to the snb-1 message observed on Northern blots (see Fig. 3). Analysis of the DNA sequence and the deduced amino acid coding sequence of the gene were performed on a SPARC station with the Genetics Computer Group program package (Devereux et al., 1984). The snb-1 cDNA sequences was deposited into GenBank (accession number AF003281).

Production of antibodies and immunocytochemistry. The BamHI-BsaBI fragment of pSB101 was inserted into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pSB110. The plasmid encodes a fusion protein containing a six histidine tag and amino acids 13-88 of the C. elegans SNB-1 protein. The fusion protein was purified and used to immunize rabbits as described in Nonet et al. (1993). SNB-1 antiserum was immunoaffinity-purified by the method described in Pringle et al. (1991). Affinity-purified alpha -SNB-1 serum was used at 1:50 dilution. Immunocytochemistry was performed as previously described in Nonet et al. (1997).

Chromosomal localization of the snb-1 gene. pSB101 insert DNA was used to probe an ordered grid of yeast artificial chromosome (YAC) clones representing most of the C. elegans genome. The snb-1 probe hybridized to three overlapping YAC clones: Y7E11, Y6G12, and Y44A7 (Coulson et al., 1988). The cosmid T10H9 was shown to contain snb-1 by Southern analysis (Coulson et al., 1986). A 5.2 kb HindIII fragment from cosmid T10H9 containing the complete snb-1 gene was cloned in both orientations into pBluescript KS(-) to create pSB102 and pSB103. Animals homozygous for nDf18, nDf32, and sDf20 deficiencies were analyzed for the presence of snb-1 and xol-1 sequences (Rhind et al., 1995) by using single-worm PCR (Williams et al., 1992). Deficiency animals were isolated as dead eggs segregating from Df/dpy-11(e224) animals. sDf20 and nDf32 removed snb-1, but not the control locus (xol-1). The snb-1:: lacZ fusion construct pSB111 was created by inserting a 3.2 kb HindIII-NaeI fragment of pSB102 into the MscI--HindIII fragment of pPD21.28 (Fire et al., 1990). Transgenic animals expressing the fusion construct were examined by using X-gal as a substrate for lacZ. The genomic region was sequenced (GenBank accession number AF 003282).

Isolation of snb-1 mutants. snb-1(md247) was isolated in a genetic screen for aldicarb-resistant mutants (Miller et al., 1996). Additional alleles were isolated in three noncomplementation screens. Wild-type males were mutagenized with ethyl methanesulfonate and crossed to dpy-11(e224) snb-1(md247) ric-4(md1088); xol-1(y9) flu-2(e1003) in the first screen, to dpy-11(e224) snb-1(md247); xol-1(y9) flu-2(e1003) in the second screen, and to dpy-11(e224) snb-1(js17); xol-1(y9) flu-2(e1003) in the last screen. In each case, animals resistant to aldicarb were selected by placing the cross-progeny on plates containing either 0.5 or 0.75 mM aldicarb. js17 was isolated from the first screen of ~30,000 cross-progeny, js43 and js44 from the second screen of 50,000 cross-progeny, and js124 from the third screen of 32,000 cross-progeny. The entire coding region of the snb-1 locus was sequenced from the mutants. js124 is a C to T transition at position 1 of codon 50, js17 and js43 result from C to T transitions at position 1 of codon 62, js44 results from a C to T transition at position 2 of codon 65, and md247 results from the duplication of the sequence CGCTATCGTCGTCATTCTTAT (encoding amino acids 92-99) and its insertion after the first base of codon 100. The lesion is a 20 bp duplication separated by a TA sequence and may be the result of a Tc1 transposition event (Mori et al., 1988; Plasterk, 1991). Introduction of the pSB103 genomic construct by germline transformation (Mello et al., 1991) rescued the behavioral phenotypes of md247 and js124. snb-1 was mapped genetically between dpy-11 and unc-68: from dpy-11(e224) unc-68(r1158)/snb-1(md247) animals, two of seven Dpy non-Unc recombinants carried the snb-1(md247) lesion. snb-1(md247) complements nDf18 and sDf36 but failed to complement nDf32, sDf20, and sDf30. All snb-1 alleles failed to complement nDf32.

Behavioral assays. Locomotion was assayed by imaging L4-staged animals shortly after they were deposited onto fresh agar plates containing an E. coli lawn. CCD camera images were collected for 1 min with an LG3 frame grabber (Scion) at 1 sec intervals at a magnification between 1.6 and 2.5×. Distances traveled were calculated by summing movements in the position of the tail by using the program Scion Image (Scion). Defecation was observed under a dissecting microscope, and cycles were recorded with a simple computer program (Liu and Thomas, 1994). Pharyngeal pumping of mutant animals with slow pumping rates was assayed by counting pumping for 1 min intervals. Pharyngeal pumping of animals with fast rates (>120 pumps/min) was assayed by counting pumps from digital images captured at 15 frames/sec for 20 sec intervals.

Resistance to aldicarb and levamisole. Mutants were assayed for acute exposure to aldicarb and levamisole. Aldicarb resistance was examined by transferring individual animals to plates containing aldicarb and assaying them for paralysis 4 hr after exposure. Animals were considered paralyzed if they failed to move even if prodded with a platinum wire. Levamisole resistance was examined by placing 25 worms in S-basal medium (Sulston and Hodgkin, 1988) with 100 µM levamisole and scoring them for movement by examining video images of the animals at different time points.

Electrophysiology. Electropharyngeograms (EPGs) were recorded with an AC preamplifier (designed by David Brumley, University of Oregon) and LabView Acquisition software as previously described (Avery et al., 1995). Bath solution consisted of M9 with 2.5-5 mM serotonin to stimulate pumping. Only recordings from young adult hermaphrodites with at least 10 pharyngeal pumps were used in analysis. Analysis of the records was performed as described in Iwasaki et al. (1997) except that amplitudes were calculated as peak-to-peak.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Isolation of a synaptobrevin homolog in C. elegans

We isolated partial cDNA clones encoding a C. elegans synaptobrevin molecule with PCR. A complete cDNA representing the transcript from the gene was isolated from an embryonic cDNA library (see Materials and Methods). The deduced transcript is predicted to encoded a protein product with 68% identity to human synaptobrevin-2 (Fig. 1). The predicted protein is most similar to neuronal synaptobrevin molecules from metazoans (60-68% identity) but also is very similar to the ubiquitously expressed rat cellubrevin (66% identity) and a Drosophila synaptobrevin expressed in gut (59% identity). The gene was named synaptobrevin (snb-1) because it represents the first characterized member of this family in C. elegans.


View larger version (18K):
[in this window]
[in a new window]
 
Figure 1.   Similarity among synaptobrevin molecules. Alignment of synaptobrevin family proteins from C. elegans (SNB-1 worm), Drosophila (n-syb fly; DiAntonio et al., 1993), rat (cellubrevin; McMahon et al., 1993) human (SYB1 and SYB2; Archer et al., 1990), and S. cerevisiae (SNC1 yeast; Gerst et al., 1992). The standard single letter amino acid code is used. Dots represent identity with the C. elegans sequence. Amino acid numbering appears at the right.

C. elegans synaptobrevin is expressed in the nervous system

To ascertain the expression pattern of the gene in the nematode, we raised antisera directed against a bacterially expressed SNB-1 fusion protein. An affinity-purified synaptobrevin antiserum was incubated with fixed whole adult C. elegans animals, and the antibodies were detected by FITC-conjugated secondary antisera. SNB-1 was detected in the nervous system. The majority of synaptobrevin immunoreactivity was restricted to the major process bundles of C. elegans. The nerve ring, ventral cord, and dorsal cord were highly immunoreactive (Fig. 2A-C). Faint fluorescence also was detected in some neuronal cell bodies. By contrast, synaptobrevin was not detected in most commissural and dendritic processes. Previously characterized C. elegans synaptic vesicle proteins RAB-3 (Fig. 2D) and synaptotagmin (data not shown) colocalized with synaptobrevin (Nonet et al., 1993, 1997). In addition, synaptobrevin immunoreactivity was mislocalized in cell bodies in unc-104, as would be expected of a synaptic vesicle-associated protein (Hall and Hedgecock, 1991; Nonet et al., 1993, 1997). unc-104 encodes a kinesin required for the transport of synaptic vesicles from the cell body to the synapse (Otsuka et al., 1991). Thus, C. elegans SNB-1 shows the expected distribution of a synaptic vesicle-associated protein.


View larger version (122K):
[in this window]
[in a new window]
 
Figure 2.   Expression of snb-1 in the C. elegans nervous system. A-F, Whole worms fixed and stained with alpha -SNB-1, alpha -RAB-3, and alpha -UNC-64 (syntaxin) primary antibodies and visualized with FITC- or Cy3-conjugated antibodies. A, Lateral view of the head region of a wild-type adult hermaphrodite showing SNB-1 immunoreactivity in the nerve ring, pharyngeal nervous system, and ventral and dorsal nerve cords. B, Ventral view of the tail region of a wild-type adult hermaphrodite showing SNB-1 immunoreactivity in the ventral nerve cord. C, D, Ventral view of the midsection of a wild-type adult hermaphrodite showing colocalization of SNB-1 (C) and RAB-3 (D) immunoreactivity in the ventral nerve cord. E, Ventral view of the head of SNB-1 immunoreactivity in an adult snb-1(md247) mutant. The SNB-1 mutant protein remains limited to the synaptic regions of the SAB neurons. F, Similar view of UNC-64 syntaxin immunoreactivity in a wild-type animal reveals all processes in the head. G, H, Transgenic jsEx96 animals expressing the psnb-1:: lacZ reporter construct pSB111 stained for beta -galactosidase activity, using X-gal. lacZ contains an SV40 nuclear localization signal. G, Lateral view of the head region of an adult hermaphrodite showing staining neurons in the head ganglia and pharynx. H, Lateral view of the vulval region of an adult hermaphrodite showing staining in the motor neurons in the ventral cord and two neurons in the deirid sensillum.

Because it was not feasible to determine whether all neurons expressed SNB-1 from the examination of immunohistochemical-stained samples, the expression pattern of the gene was examined by using a translational lacZ fusion (see Materials and Methods). Consistent with our immunohistochemistry data, SNB-1 was expressed in the vast majority of all neurons in the nerve ring ganglia (Fig. 2G) and the ventral cord (Fig. 2H). Moreover, the expression of snb-1 assayed by lacZ was restricted to neuronal tissue, although expression also has been observed in the spermatheca with green fluorescent protein (GFP) fusions (data not shown). We conclude that snb-1 encodes a neuronal synaptobrevin.

Isolation of synaptobrevin mutants

As a first step toward isolating mutations in snb-1, the gene was positioned on the physical map of C. elegans (Fig. 3; see Materials and Methods). The gene mapped to YAC clones containing DNA from the center of chromosome V. The genetic position was refined further by determining whether snb-1 was removed by a variety of deficiencies of the region (Fig. 3A). The mapping data positioned the gene in the 0.3 map unit interval between the dpy-11 and unc-68 loci. A genomic clone containing the entire coding region was isolated from a cosmid clone (Fig. 3B; Coulson et al., 1986), and the single intron of the gene was identified by sequencing of the genomic region (Fig. 3C).


View larger version (22K):
[in this window]
[in a new window]
 
Figure 3.   The snb-1 locus. A, Genetic map of the snb-1 region of chromosome V showing three deficiencies used to position the locus. B, Physical map of the snb-1 region showing cosmid and yeast artificial chromosome clones. The position of the unc-68 gene is shown also. C, Restriction map of the genomic snb-1 gene. Below the restriction map a schematic diagram shows the intron-exon structure of the snb-1 gene and the sequences contained in plasmid constructs used in this study. The pSB103 insert is identical to the pSB102 insert shown. E, EcoRI; X, XbaI; N, NaeI; H, HindIII restriction endonuclease sites. D, Autoradiograph of a Northern blot probed with a snb-1 cDNA fragment. Poly(A+) RNA (10 µg) isolated from a culture of mixed-stage hermaphrodites was loaded on the gel. Size standards, labeled in kilobases, are on the right.

A variety of mutants encoding C. elegans synaptic components share a common attribute; they are resistant to the acetylcholinesterase inhibitor aldicarb (Nonet et al., 1993, 1997; Nguyen et al., 1995; Miller et al., 1996; Iwasaki et al., 1997). The mutation ric(md247) was isolated in a selection for aldicarb-resistant mutants (Miller et al., 1996), and genetic mapping placed md247 close to the physical position of snb-1. md247 was demonstrated to be a lesion in the snb-1 gene by two criteria. First, md247 mutants transformed with a genomic clone of the synaptobrevin gene are rescued to wild type, as assayed by both behavioral and aldicarb resistance assays. Second, sequencing of the snb-1 coding region identified a mutation in md247 that could account for the gene defect.

Additional snb-1 mutations were isolated in noncomplementation screens. Wild-type males were mutagenized and crossed to marked snb-1 strains (see Materials and Methods). Cross-progeny were screened for behavioral defects, or aldicarb resistance was used to identify new snb-1 mutations. Four independent mutations, js17, js43, js44, and js124, were isolated in the three genetic screens. js17, js43, and js44 are all similar to snb-1(md247) in that homozygous mutant animals are viable and also viable in trans to a deficiency of the region. By contrast, the js124 mutation is homozygous lethal. These animals arrest development just after completing embryogenesis and hatching, and they tend to adopt a coiled position similar to that observed in lethal cha-1 choline acetyltransferase mutants (Rand, 1989). Animals heterozygous for js124 were not resistant to aldicarb and showed no behavioral abnormalities, indicating that the lesion had no dominant or gain-of-function characteristics. In addition, js124 in trans to a deficiency of the region phenotypically resembled the js124 homozygotes. Finally, the lethal phenotype of js124 was rescued to wild type by the introduction of a wild-type snb-1 genomic clone, thus confirming that this phenotype is solely the result of the lesion in the snb-1 locus.

Sequencing of the alleles revealed that the md247 lesion duplicates 20 bp and results in a shift in the reading frame at amino acid 100, midway in the transmembrane domain of SNB-1 (Fig. 4). js17 and js43 are independently isolated missense mutations resulting in an L62F substitution, whereas js44 consists of a missense change resulting in an A66G substitution (Fig. 4). None of the mutants, js17, js43, js44, nor md247, shows immunohistochemical abnormalities (Fig. 2E) (data not shown). js124 results in a Q50>STOP nonsense lesion (Fig. 4); hence the js124 phenotype likely represents the snb-1 null phenotype.


View larger version (10K):
[in this window]
[in a new window]
 
Figure 4.   Molecular lesions in snb-1 mutants. The carboxyl sequences of four synaptobrevin sequences are shown aligned. The standard single letter amino acid code is used. The hydrophobic transmembrane region of the proteins is indicated. Sequences forming an alpha -helical structure form a repeating seven-amino-acid unit. The amino acids of the helix are labeled a through g. a and d above the sequence alignment represent the amino acids on the hydrophobic face of a predicted amphipathic-helix structure that could be formed by the proteins. The lesions found in the four snb-1 mutations are labeled in bold. The molecular lesions are detailed in Materials and Methods.

Phenotypes of synaptobrevin mutants

The snb-1 mutants all exhibit a variety of behavioral abnormalities. The viable mutants all remain capable of coordinated movement. However, their movements are easily differentiated from the wild type (Table 1). The animals are lethargic and have a tendency to jerk, especially during backward motion. Synaptobrevin null js124 animals arrested as L1 larvae and often adopted a coiled position. These animals also remained capable of making some movements. To characterize the movements, we examined the animals via video microscopy. Time-lapse imaging (Fig. 5) demonstrated that these animals were capable of making semi-coordinated movements (Fig. 5). Additionally, pharyngeal pumping, which mediates feeding behavior, was depressed in all of the mutants (Table 1). Furthermore, the defecation cycle time was longer, and enteric muscle contraction step of the defecation cycle (Avery and Thomas, 1997) failed more frequently than in the wild type (Table 1). These behavioral defects presumably all represent manifestations of the underlying impairment of synaptic transmission. However, the movements of snb-1 null mutants, although much less vigorous than those of the wild type, are evidence that some neuromuscular transmission persists in the absence of synaptobrevin.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Behavioral defects of synaptobrevin mutants


View larger version (16K):
[in this window]
[in a new window]
 
Figure 5.   Locomotion of snb-1 mutants. Shown are bright-field images of wild-type and snb-1(js124) L1 larvae on an E. coli lawn at indicated time intervals (top right, in seconds). Scale bar, 100 µm.

Synaptic transmission defects in synaptobrevin mutants

To assess neurotransmission in snb-1 mutants, we examined their response to pharmacological agents. We quantified the resistance of snb-1 mutants to the acetylcholinesterase inhibitor aldicarb (Fig. 6). All three viable alleles were resistant to aldicarb, as was the acetylcholine receptor mutant unc-29 (Fleming et al., 1997) The aldicarb resistance suggests that cholinergic transmission is impaired in the mutants. We also examined the response of snb-1 mutants to the acetylcholine receptor agonist levamisole (Lewis et al., 1980a,b). snb-1 mutants and wild-type animals showed comparable sensitivity to the drug (Fig. 6). By contrast, the acetylcholine receptor mutant unc-29 was extremely resistant to the drug. Thus, the assay indicates that postsynaptic responses are fundamentally intact, suggesting that cholinergic transmission is impaired presynaptically in snb-1 mutants.


View larger version (14K):
[in this window]
[in a new window]
 
Figure 6.   Pharmacological properties of snb-1 mutants. A, Aldicarb sensitivities of snb-1 mutants and the wild type. Shown is the percentage of animals paralyzed after a 4 hr exposure to various concentrations of aldicarb on plates seeded with E. coli: wild type (bullet ), js17 (square ), js44 (triangle ), md247 (open circle ), and unc-29 (diamond ). B, Levamisole sensitivities of snb-1 mutants and the wild type. Shown is the percentage of animals paralyzed after exposure of adult animals to 100 µM levamisole for various times: wild type (bullet ), js17 (square ), js44 (triangle ), md247 (open circle ), and unc-29 (diamond ).

We also examined electrical activity in the pharynx, using an extracellular recording method devised by Raizen and Avery (1994). EPGs allow for the examination of currents intrinsic to pharyngeal muscle as well as for those resulting from synaptic input. We examined inhibitory currents elicited by the glutamatergic motor neuron M3, which shortens the length of the contraction of pharyngeal muscle (Avery, 1993). Wild-type animals exhibited three to five distinct M3-induced transients during each pharyngeal pump (Fig. 7A, Table 2). By contrast, M3 transients were usually completely absent or extremely small in recordings from snb-1(md247) mutants (Fig. 7B, Table 2). M3 transients of reduced amplitude also were observed in records of both js17 and js44 animals (Fig. 7C,D, Table 2). Consistent with a reduction in M3 activity, pharyngeal pump duration was increased in all of the mutants (Table 2). The activity of MC neurons, a pair of motor neurons that stimulate pharyngeal contractions (Raizen et al., 1995), also was altered in snb-1 mutants. Specifically, we noted an increase in MC transients among pumps that failed to elicit pharyngeal contractions (Fig. 7B-D). These subthreshold MC failures were observed rarely in wild-type animals (data not shown) (Iwasaki et al., 1997). In summary, our pharmacological and physiological assays demonstrate that both cholinergic and glutamatergic transmission are impaired in snb-1 hypomorphic mutants.


View larger version (14K):
[in this window]
[in a new window]
 
Figure 7.   Pharyngeal recordings from wild-type and snb-1 mutants. Shown are characteristic recordings of the wild-type strain N2 (A), snb-1(md247) (B), snb-1(js17) (C), and snb-1(js44) (D). Arrows indicate MC-induced transients, and the filled circles indicate M3-induced transients. All traces are millivolts versus time.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Summary of physiological defects in snb-1 mutants

v-SNARE double mutants remain capable of movement

Biochemical analysis that led to the SNARE hypothesis identified both synaptobrevin (Sollner et al., 1993a,b) and synaptotagmin (Schiavo et al., 1995) as v-SNARES of synaptic vesicles. To assess whether the residual behaviorally assessed neurotransmission was a consequence of synaptotagmin function, we constructed snt-1(md290); snb-1 (js124)/dpy-11(e224) animals and examined snt-1; snb-1 double mutants segregating from the parents. The double mutants were phenotypically very similar to snb-1(js124) animals. They were capable of some movement (Fig. 8) and arrested development in the first larval stage. By contrast, mutants lacking the t-SNARE unc-64 syntaxin were virtually completely paralyzed (Fig. 8). Behaviorally, the snb-1 and snt-1; snb-1 double mutants were distinguishable because pharyngeal pumping was reduced in the double mutant (snb-1, 11.7 ± 7.2 pumps/min; snt-1; snb-1, 0.5 ± 0.8 pumps/min; unc-64 0.15 ± 0.3 pumps/min). However, in contrast to unc-64 syntaxin mutants and cha-1 choline acetyltransferase mutants (Avery and Horvitz, 1990), pumping of the double mutant could still be markedly stimulated by the addition of exogenous serotonin (snt-1; snb-1 + 5HT, 12.1 ± 7.1; unc-64 + 5HT, 0.05 ± 0.15). In summary, mutants lacking both snb-1 and snt-1; snb-1 closely resemble the snb-1 mutant at a behavioral level; they remain capable of some neuromuscular signaling.


View larger version (53K):
[in this window]
[in a new window]
 
Figure 8.   Locomotion of snb-1 snt-1 double mutants. Shown are bright-field images of snb-1(js124), unc-64(js115), and snt-1(md290); snb-1(js124) L1 larvae on an E. coli lawn at indicated time intervals. Note the tracks in the E. coli lawn. Scale bar, 100 µm.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have isolated and characterized a gene encoding a C. elegans synaptobrevin that functions in the synaptic release pathway. SNB-1 is extremely likely the homolog of the synaptic vesicle-associated synaptobrevin-1 and -2 molecules expressed in the vertebrate nervous system. snb-1 is expressed in the nervous system, and SNB-1 protein colocalizes with C. elegans RAB-3 and synaptotagmin, suggesting that the protein is synaptic vesicle-associated. Furthermore, snb-1 mutants have synaptic transmission deficits, indicating that the molecule functions in neuronal exocytosis in C. elegans.

snb-1 joins a long list of C. elegans mutants that are resistant to the drug aldicarb (Rand and Nonet, 1997). These mutants include genes encoding products involved in acetylcholine synthesis and vesicular loading (Alfonso et al., 1993, 1994), regulation of vesicle trafficking and fusion (Maruyama and Brenner, 1991; Gengyo-Ando et al., 1993; Nonet et al., 1993, 1997), and acetylcholine reception (these are not resistant to chronic aldicarb exposure; Lewis et al., 1980a; Fleming et al., 1997). Thus, the drug resistance of the hypomorphic mutants suggests that synaptic transmission is impaired in snb-1 mutants. The pleiotropic behavioral abnormalities provide additional evidence for synaptic deficiencies. Finally, the electrophysiological abnormalities in M3 transmission in snb-1 mutants also support a requirement for synaptobrevin for synaptic transmission. Unfortunately, our simple physiological assay cannot be applied to first-larval-stage animals. Thus, we have not confirmed that M3 activity is absent in our lethal snb-1 mutant. However, M3 activity is often absent even in the viable snb-1(md247) mutants.

Our analysis of snb-1 mutants clearly demonstrates that synaptobrevin is essential for viability of C. elegans. Animals lacking snb-1 are able to complete embryogenesis but arrest development shortly after hatching and die several days later. This lethality is rescued by introduction of a transgene carrying wild-type snb-1 sequences. The mutant animals are extremely uncoordinated and rarely move far from where they hatch. However, the animals are capable of some movements, including head foraging movements. This arrest phenotype is very similar to the phenotype of mutants lacking the cha-1 choline acetyltransferase protein (Rand, 1989), the unc-17 vesicular ACh transporter (Alfonso et al., 1993), and the unc-104 synaptic vesicle kinesin motor protein (Hall and Hedgecock, 1991). However, the phenotype contrasts with that of mutants lacking syntaxin (unc-64), which are paralyzed on hatching (O. Saifee, L. Wei, and M. Nonet, unpublished data). Thus complete disruption of the v-SNARE synaptobrevin and corresponding t-SNARE syntaxin result in different defects in synaptic transmission.

Our analysis of the behavioral phenotypes of the snb-1 null mutant suggests that transmitter release is not abolished completely in the absence of synaptobrevin. First, snb-1 animals are still capable of some rudimentary movements. In fact, snb-1(js124) animals move better in the presence of aldicarb (data not shown), indicating that some ACh release is occurring at neuromuscular junctions in the absence of SNB-1. Additionally, pharyngeal pumping (10-20 pumps/min) is observed in snb-1 null mutants. By contrast, pharyngeal pumping is essentially absent in both syntaxin null mutants (0.15 pumps/min) (O. Saifee, L. Wei, and M. Nonet, unpublished data) and cha-1 choline acetyltransferase null mutants (<1 pump/min) (Avery and Horvitz, 1990). In Drosophila, expression of synaptobrevin-specific protease tetanus toxin in neurons blocks evoked release at the neuromuscular junction but does not eliminate spontaneous miniature release events (Broadie et al., 1995). It is possible that the movement and pumping in C. elegans snb-1 mutants are mediated by spontaneous fusion events that do not require snb-1. A more likely possibility is that the residual release events use another synaptobrevin-like molecule expressed in the nervous system. For example, both cellubrevin and synaptobrevin-2 can contribute to exocytosis of insulin from pancreatic beta -cells (Regazzi et al., 1997). A number of other synaptobrevin-related molecules apparently are expressed in C. elegans, because the Genome Sequencing Project has identified at least five genes with similarity to synaptobrevin. The most conserved of these sequences, F23H12.1, shares 47% identity with snb-1. However, this gene appears to be expressed primarily in the gut (L. Wei and M. Nonet, unpublished results). Despite this residual movement, which probably represents residual transmitter release, synaptobrevin is essential for the viability of C. elegans.

The finding of Broadie et al. (1995) that synaptic vesicles remained docked in Drosophila neurons expressing tetanus toxin and our finding that C. elegans snb-1 null mutants remain capable of movement both suggest that synaptobrevin is not essential for the docking of synaptic vesicles before release. An alternative interpretation is that synaptobrevin and synaptotagmin both participate in docking and that docking requires only one of the two molecules. Schiavo et al. (1997) provided biochemical support of such a hypothesis by demonstrating a physical interaction between synaptotagmin and SNAP-25 that could account for docking in the absence of synaptobrevin. The difference in the phenotype of C. elegans mutants lacking unc-64 syntaxin and double mutants lacking both synaptobrevin and synaptotagmin suggests that more release of transmitter occurs in the absence of both v-SNAREs than in the absence of the t-SNARE syntaxin. A likely explanation for this is that docking is still occurring in absence of the v-SNAREs. Because, in the absence of synaptobrevin in Drosophila, vesicle docking occurs at the ultrastructural level (Broadie et al., 1995), presumably one of the remaining vesicle proteins is involved in the docking of vesicles. rab-3 would seem to be an ideal candidate because C. elegans mutants lacking rab-3 result in a more diffuse distribution of vesicles around the synaptic release site, a phenotype that can be explained by a reduction in the efficiency of docking (Nonet et al., 1997). A combination of behavioral and morphological analyses of these and other double mutant and triple mutant combinations may help in the identification of these other required proteins.

The hypomorphic lesions we characterized provide some insight into the function of synaptobrevin. The md247 mutation is the most unusual lesion we characterized. This lesion shifts the reading frame of SNB-1 half-way through the transmembrane domain, leaving only 13 amino acids of the native transmembrane domain to act as a membrane anchor (see Fig. 4). Because the mutant SNB-1 protein remains specifically localized to synaptic regions in md247 animals (see Fig. 2), the mutant protein is probably still associated with vesicles. Consistent with this hypothesis, Whitley et al. (1996) have demonstrated that 12 hydrophobic residues are sufficient to anchor synaptobrevin into microsomal membranes. Synaptobrevin probably does not remain associated with the vesicle via interactions with other proteins, because deletion of the transmembrane domain of a GFP-tagged SNB-1 results in a ubiquitous distribution of this fusion protein in neurons (M. Nonet, unpublished results). Presently, we are characterizing the transmembrane sequences required for snb-1 function by site-directed mutagenesis of this domain.

SNARE complex formation is proposed to be mediated by the assembly of a coiled-coil structure composed of hypothetical amphipathic-helical domains within the syntaxin, synaptobrevin, and SNAP-25 proteins (Chapman et al., 1994; Hayashi et al., 1994). The lesions in the hypomorphic js17 and js44 alleles lie on the hydrophobic faces of the proposed amphipathic-helix region of synaptobrevin that could mediate formation of a coiled-coil structure. Because protein levels are not altered dramatically in these mutants, the lesions probably do not affect snb-1 function simply by altering the stability of the protein. Rather, they probably affect the interactions of synaptobrevin with the t-SNAREs or with other molecules. Further supporting this interpretation, these snb-1 lesions exhibit allele-specific synergism with lesions in the amphipathic-helix domain of syntaxin (O. Saifee, L. Wei, and M. Nonet, unpublished data). Although synaptobrevin binds to syntaxin and SNAP-25, only a few specific amino acids of the protein have been implicated directly in SNARE complex formation. Hao et al. (1997) recently have examined the ability of point mutations and small deletions of synaptobrevin to form functional complexes with syntaxin and SNAP-25. Although deletions of most of the protein blocked interactions with syntaxin in an in vitro binding assay, a deletion of the region (corresponding to amino acids 63-73 in SNB-1) encompassing the js44 lesion increased the affinity of synaptobrevin for syntaxin. However, in a yeast two-hybrid assay the same deletion failed to interact with syntaxin (Hao et al., 1997). The different behavior of lesions in this region in vitro and in vivo illustrates the need to correlate in vivo function and in vitro biochemistry to dissect the role of synaptobrevin in vesicle fusion efficiently. Our mutants provide the first in vivo evidence that the helical domain is important for synaptobrevin function.

    FOOTNOTES

Received May 13, 1997; revised Oct. 1, 1997; accepted Oct. 14, 1997.

This work was supported by Grants NS33535 (to M.L.N.) and NS33187 (to J.B.R.) from National Institutes of Health and to Barbara J. Meyer from the Muscular Dystrophy Association. M.L.N. was supported during portions of this work by a public service award from the United States Public Health Service. We thank Barbara J. Meyer in whose lab the initial stages of this work were completed, Larry Salkoff and Arthur Loewy for recording equipment, A. Schaefer for characterizing nDf18/md247 animals, Erik Jorgensen for comments on this manuscript, and Allison Potter and Felisha Starkey for technical assistance. Several C. elegans strains were obtained from the Caenorhabditis Genetics Center (St. Paul, MN).

Correspondence should be addressed to Dr. Michael L. Nonet, Department of Anatomy and Neurobiology, Campus Box 8108, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. 

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

  • Alfonso A, Grundahl K, Duerr JS, Han HP, Rand JB (1993) The Caenorhabditis elegans unc-17 gene: a putative vesicular acetylcholine transporter. Science 261:617-619[Abstract/Free Full Text].
  • Alfonso A, Grundahl K, McManus JR, Rand JB (1994) Cloning and characterization of the choline acetyltransferase structural gene (cha-1) from C. elegans. J Neurosci 14:2290-2300[Abstract].
  • Archer BI, Ozcelik T, Jahn R, Francke U, Sudhof TC (1990) Structures and chromosomal localizations of two human genes encoding synaptobrevins 1 and 2. J Biol Chem 265:17267-17273[Abstract/Free Full Text].
  • Avery L (1993) Motor neuron M3 controls pharyngeal muscle relaxation timing in Caenorhabditis elegans. J Exp Biol 175:283-297[Abstract].
  • Avery L, Horvitz HR (1990) Effects of starvation and neuroactive drugs on feeding in Caenorhabditis elegans. J Exp Zool 253:263-270[Web of Science][Medline].
  • Avery L, Thomas J (1997) Feeding and defecation. In: C. elegans II (Riddle DL, Blumenthal T, Meyer BJ, Priess JR, eds), pp 679-716. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
  • Avery L, Raizen D, Lockery S (1995) Electrophysiological methods. In: Methods in cell biology, Vol 48, Caenorhabditis elegans: modern biological analysis of an organism (Epstein HF, Shakes DC, eds), pp 251-269. San Diego: Academic.
  • Bennett MK, Scheller RH (1994) A molecular description of synaptic vesicle membrane trafficking. Annu Rev Biochem 63:63-100[Web of Science][Medline].
  • Bennett MK, Calakos N, Scheller RH (1992) Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at presynaptic active zones. Science 257:255-259[Abstract/Free Full Text].
  • Broadie K, Prokop A, Bellen HJ, O'Kane CJ, Schulze KL, Sweeney ST (1995) Syntaxin and synaptobrevin function downstream of vesicle docking in Drosophila. Neuron 15:663-673[Web of Science][Medline].
  • Chapman ER, An S, Barton N, Jahn R (1994) SNAP-25, a t-SNARE which binds to both syntaxin and synaptobrevin via domains that may form coiled coils. J Biol Chem 269:27427-27432[Abstract/Free Full Text].
  • Coulson A, Sulston J, Brenner S, Karn J (1986) Toward a physical map of the Caenorhabditis elegans genome. Proc Natl Acad Sci USA 83:7821-7825[Abstract/Free Full Text].
  • Coulson A, Waterston R, Kiff J, Sulston J, Kohara Y (1988) Genome linking with yeast artificial chromosomes. Nature 335:184-186[Medline].
  • Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12:387-395.
  • DiAntonio A, Burgess RW, Chin AC, Deitcher DL, Scheller RH, Schwarz TL (1993) Identification and characterization of Drosophila genes for synaptic vesicle proteins. J Neurosci 13:4924-4935[Abstract].
  • Ferro-Novick S, Jahn R (1994) Vesicle fusion from yeast to man. Nature 370:191-193[Medline].
  • Fire A, Harrison SW, Dixon D (1990) A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93:189-198[Web of Science][Medline].
  • Fleming JT, Squire MD, Barnes TM, Tornoe C, Matsuda K, Ahnn J, Fire A, Sulston JE, Barnard EA, Sattelle DB, Lewis JA (1997) Caenorhabditis elegans levamisole resistance genes lev-1, unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits. J Neurosci 17:5843-5857[Abstract/Free Full Text].
  • Garcia EP, McPherson PS, Chilcote TJ, Takei K, De Camilli P (1995) rbSec1A and B colocalize with syntaxin 1 and SNAP-25 throughout the axon, but are not in a stable complex with syntaxin. J Cell Biol 129:105-120[Abstract/Free Full Text].
  • Gengyo-Ando K, Kamiya Y, Yamakawa A, Kodaira K, Nishiwaki K, Miwa J, Hori I, Hosono R (1993) The C. elegans unc-18 gene encodes a protein expressed in motor neurons. Neuron 11:703-711[Web of Science][Medline].
  • Gerst JE, Rodgers L, Riggs M, Wigler M (1992) SNC1, a yeast homolog of the synaptic vesicle-associated membrane protein/synaptobrevin gene family: genetic interactions with the RAS and CAP genes. Proc Natl Acad Sci USA 89:4338-4342[Abstract/Free Full Text].
  • Hall DH, Hedgecock EM (1991) Kinesin-related gene unc-104 is required for axonal transport of synaptic vesicles in C. elegans. Cell 65:837-847[Web of Science][Medline].
  • Hao JC, Salem N, Peng X-R, Kelly RB, Bennett MK (1997) Effect of mutations in vesicle-associated membrane protein (VAMP) on the assembly of multimeric protein complexes. J Neurosci 17:1596-1603[Abstract/Free Full Text].
  • Hayashi T, McMahon H, Yamasaki S, Binz T, Hata Y, Sudhof TC, Niemann H (1994) Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on assembly. EMBO J 13:5051-5061[Web of Science][Medline].
  • Herman RK, Horvitz HR (1980) Genetic analysis of Caenorhabditis elegans. In: Nematodes as biological models, Vol 1, Behavioral and developmental models (Zuckerman BM, ed), pp 227-262. New York: Academic.
  • Innis MA Gelfand DH Sninsky JJ White TJ editors (1990) In: PCR protocols: a guide to methods and applications. San Diego: Academic.
  • Iwasaki K, Staunton J, Saifee O, Nonet ML, Thomas J (1997) aex-3 encodes a novel gene product that regulates presynaptic activity in C. elegans. Neuron 18:613-622[Web of Science][Medline].
  • Lewis JA, Wu CH, Berg H, Levine JH (1980a) The genetics of levamisole resistance in the nematode Caenorhabditis elegans. Genetics 95:905-928[Abstract/Free Full Text].
  • Lewis JA, Wu CH, Levine JH, Berg H (1980b) Levamisole-resistant mutants of the nematode Caenorhabditis elegans appear to lack pharmacological acetylcholine receptors. Neuroscience 5:967-989[Web of Science][Medline].
  • Lichtsteiner S, Tjian R (1993) Cloning and properties of the Caenorhabditis elegans TATA box-binding protein. Proc Natl Acad Sci USA 90:9673-9677[Abstract/Free Full Text].
  • Liu DW, Thomas JH (1994) Regulation of a periodic motor program in C. elegans. J Neurosci 14:1953-1962[Abstract].
  • Maruyama IN, Brenner S (1991) A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc Natl Acad Sci USA 88:5729-5733[Abstract/Free Full Text].
  • McMahon HT, Ushkaryov YA, Edelmann L, Link E, Binz T, Niemann H, Jahn R, Sudhof TC (1993) Cellubrevin is a ubiquitous tetanus-toxin substrate homologous to a putative synaptic vesicle fusion protein. Nature 364:346-349[Medline].
  • Mello CC, Kramer JM, Stinchcomb D, Ambros V (1991) Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10:3959-3970[Web of Science][Medline].
  • Miller KG, Alfonso A, Nguyen M, Crowell JA, Johnson CD, Rand JD (1996) A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc Natl Acad Sci USA 93:12593-12598[Abstract/Free Full Text].
  • Mori I, Benian GM, Moerman DG, Waterston RH (1988) Transposable element Tc1 of Caenorhabditis elegans recognizes specific target sequences for integration. Proc Natl Acad Sci USA 85:861-864[Abstract/Free Full Text].
  • Nguyen M, Alfonso A, Johnson CD, Rand JB (1995) Caenorhabditis elegans mutants resistant to inhibitors of acetylcholinesterase. Genetics 140:527-535[Abstract].
  • Nonet ML, Meyer BJ (1991) Early aspects of Caenorhabditis elegans sex determination and dosage compensation are regulated by a zinc-finger protein. Nature 351:65-68[Medline].
  • Nonet ML, Grundahl K, Meyer BJ, Rand JB (1993) Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73:1291-1305[Web of Science][Medline].
  • Nonet ML, Staunton J, Kilgard MP, Fergestad T, Hartweig E, Horvitz HR, Jorgensen E, Meyer BJ (1997) C. elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J Neurosci 17:8061-8073[Abstract/Free Full Text].
  • Otsuka AJ, Jeyaprakash A, Garcia-Anoveros J, Tang LZ, Fisk G, Hartshorne T, Franco R, Born T (1991) The C. elegans unc-104 gene encodes a putative kinesin heavy chain-like protein. Neuron 6:113-122[Web of Science][Medline].
  • Perin MS, Fried VA, Mignery GA, Jahn R, Sudhof TC (1990) Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature 345:260-263[Medline].
  • Plasterk RH (1991) The origin of footprints of the Tc1 transposon of Caenorhabditis elegans. EMBO J 10:1919-1925[Web of Science][Medline].
  • Pringle JR, Adams EM, Drubin DG, Haarer BK (1991) Immunofluorescence methods for yeast. In: Guide to yeast genetics and molecular biology, Vol 194 (Guthrie C, Fink GR, eds), pp 565-602. New York: Academic.
  • Protopopov V, Govindan B, Novick P, Gerst JE (1993) Homologs of the synaptobrevin/VAMP family of synaptic vesicle proteins function on the late secretory pathway in S. cerevisiae. Cell 74:855-861[Web of Science][Medline].
  • Raizen DM, Avery L (1994) Electrical activity and behavior in the pharynx of Caenorhabditis elegans. Neuron 12:483-495[Web of Science][Medline].
  • Raizen DM, Lee RYN, Avery L (1995) Interacting genes required for pharyngeal excitation by motor neuron MC in Caenorhabditis elegans. Genetics 141:1365-1382[Abstract].
  • Rand JB (1989) Genetic analysis of the cha-1-unc-17 gene complex in Caenorhabditis. Genetics 122:73-80[Abstract/Free Full Text].
  • Rand JB, Nonet ML (1997) Synaptic transmission. In: C. elegans II (Riddle DL, Blumenthal T, Meyer BJ, Priess JR, eds), pp 611-644. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
  • Regazzi R, Sadoul K, Meda P, Kelly RB, Halban PA, Wollheim CB (1997) Mutational analysis of VAMP domains implicated in Ca2+-induced insulin secretion. EMBO J 15:6951-6959[Web of Science][Medline].
  • Rhind NR, Miller LM, Kopczynski JB, Meyer BJ (1995) xol-1 acts as an early switch in the C. elegans male/hermaphrodite decision. Cell 80:71-82[Web of Science][Medline].
  • Sambrook J, Fritsch EF, Maniatis T (1989) In: Molecular cloning: a laboratory manual, 2nd Ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
  • Schiavo G, Benfenati F, Poulain B, Rossetto O, Polverino de Laureto P, DasGupta BR, Montecucco C (1992) Tetanus and botulinum B neurotoxins block neurotransmitter release by proteolytic cleavage of synaptobrevin. Nature 359:832-835[Medline].
  • Schiavo G, Shone CC, Rossetto O, Alexander FC, Montecucco C (1993) Botulinum neurotoxin serotype F is a zinc endopeptidase specific for VAMP/synaptobrevin. J Biol Chem 268:11516-11519[Abstract/Free Full Text].
  • Schiavo G, Malizio C, Trimble WS, Polverino de Laureto P, Milan G, Sugiyama H, Johnson EA, Montecucco C (1994) Botulinum G neurotoxin cleaves VAMP/synaptobrevin at a single Ala-Ala peptide bond. J Biol Chem 269:20213-20216[Abstract/Free Full Text].
  • Schiavo G, Gmachi MJS, Stenbeck G, Sollner TH, Rothman JE (1995) A possible docking and fusion particle for synaptic transmission. Nature 378:733-736[Medline].
  • Schiavo G, Stenbeck G, Rothman JE, Sollner TH (1997) Binding of the synaptic vesicle v-SNARE, synaptotagmin, to the plasma membrane t-SNARE, SNAP-25, can explain docked vesicles at neurotoxin-treated synapses. Proc Natl Acad Sci USA 94:997-1001[Abstract/Free Full Text].
  • Sollner T, Whiteheart SW, Brunner M, Erdjument-Bromage H, Geromanos S, Tempst P, Rothman JE (1993a) SNAP receptors implicated in vesicle targeting and fusion. Nature 362:318-324[Medline].
  • Sollner T, Bennett MK, Whiteheart SW, Scheller RH, Rothman JE (1993b) A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75:409-418[Web of Science][Medline].
  • Steinhardt RA, Bi G, Alderton JM (1994) Cell membrane resealing by a vesicular mechanism similar to neurotransmitter release. Science 263:390-393[Abstract/Free Full Text].
  • Sudhof T (1995) The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375:645-653[Medline].
  • Sudhof TC, Baumert M, Perin MS, Jahn R (1989) A synaptic vesicle membrane protein is conserved from mammals to Drosophila. Neuron 2:1475-1481[Web of Science][Medline].
  • Sulston J, Hodgkin J (1988) Methods. In: The nematode Caenorhabditis elegans (Wood WB, ed), pp 587-606. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
  • Sweeney ST, Broadie K, Keane J, Neimann H, O'Kane CJ (1995) Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates synaptic transmission and causes behavioral defects. Neuron 14:341-351[Web of Science][Medline].
  • Tonello F, Morante S, Rossetto O, Schiavo G, Montecucco C (1996) Tetanus and botulism neurotoxins: a novel group of zinc-endopeptidases. Adv Exp Med Biol 389:251-260[Medline].
  • Trimble WS, Cowan DM, Scheller RH (1988) VAMP-1: a synaptic vesicle-associated integral membrane protein. Proc Natl Acad Sci USA 85:4538-4542[Abstract/Free Full Text].
  • Whitley P, Grahn E, Kutay U, Rapoport TA, von Heijne G (1996) A 12-residue-long polyleucine tail is sufficient to anchor synaptobrevin to the endoplasmic reticulum membrane. J Biol Chem 271:7583-7586[Abstract/Free Full Text].
  • Williams BD, Schrank B, Huynh C, Shownkeen R, Waterston RH (1992) A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131:609-624[Abstract].


Copyright © 1998 Society for Neuroscience  0270-6474/98/18170-11$05.00/0


This article has been cited by other articles:


Home page
J. Physiol.Home page
V. Montana, W. Liu, U. Mohideen, and V. Parpura
Single molecule measurements of mechanical interactions within ternary SNARE complexes and dynamics of their disassembly: SNAP25 vs. SNAP23
J. Physiol., May 1, 2009; 587(9): 1943 - 1960.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. Senti and P. Swoboda
Distinct Isoforms of the RFX Transcription Factor DAF-19 Regulate Ciliogenesis and Maintenance of Synaptic Activity
Mol. Biol. Cell, December 1, 2008; 19(12): 5517 - 5528.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Pajonk, C. Kwon, N. Clemens, R. Panstruga, and P. Schulze-Lefert
Activity Determinants and Functional Specialization of Arabidopsis PEN1 Syntaxin in Innate Immunity
J. Biol. Chem., October 3, 2008; 283(40): 26974 - 26984.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Sato, B. D. Grant, A. Harada, and K. Sato
Rab11 is required for synchronous secretion of chondroitin proteoglycans after fertilization in Caenorhabditis elegans
J. Cell Sci., October 1, 2008; 121(19): 3177 - 3186.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. M. McEwen and J. M. Kaplan
UNC-18 Promotes Both the Anterograde Trafficking and Synaptic Function of Syntaxin
Mol. Biol. Cell, September 1, 2008; 19(9): 3836 - 3846.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. W. McDonald, S. L. Hardie, T. N. Jessen, L. Carvelli, D. S. Matthies, and R. D. Blakely
Vigorous Motor Activity in Caenorhabditis elegans Requires Efficient Clearance of Dopamine Mediated by Synaptic Localization of the Dopamine Transporter DAT-1
J. Neurosci., December 19, 2007; 27(51): 14216 - 14227.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Rose, M. G. Malabarba, C. Krag, A. Schultz, H. Tsushima, P. P. Di Fiore, and A. E. Salcini
Caenorhabditis elegans Intersectin: A Synaptic Protein Regulating Neurotransmission
Mol. Biol. Cell, December 1, 2007; 18(12): 5091 - 5099.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. L. Green, T. Inoue, and P. W. Sternberg
The C. elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously inhibits the Wnt pathway
Development, November 15, 2007; 134(22): 4053 - 4062.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. R. Glodowski, C. C.-H. Chen, H. Schaefer, B. D. Grant, and C. Rongo
RAB-10 Regulates Glutamate Receptor Recycling in a Cholesterol-dependent Endocytosis Pathway
Mol. Biol. Cell, November 1, 2007; 18(11): 4387 - 4396.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
P. Bronk, F. Deak, M. C. Wilson, X. Liu, T. C. Sudhof, and E. T. Kavalali
Differential Effects of SNAP-25 Deletion on Ca2+-Dependent and Ca2+-Independent Neurotransmission
J Neurophysiol, August 1, 2007; 98(2): 794 - 806.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Hornsten, J. Lieberthal, S. Fadia, R. Malins, L. Ha, X. Xu, I. Daigle, M. Markowitz, G. O'Connor, R. Plasterk, et al.
APL-1, a Caenorhabditis elegans protein related to the human beta-amyloid precursor protein, is essential for viability
PNAS, February 6, 2007; 104(6): 1971 - 1976.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. S. Dittman and J. M. Kaplan
Factors regulating the abundance and localization of synaptobrevin in the plasma membrane
PNAS, July 25, 2006; 103(30): 11399 - 11404.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Lauer, S. Dalal, K. E. Marz, M. L. Nonet, and P. I. Hanson
SNARE Complex Zero Layer Residues Are Not Critical for N-Ethylmaleimide-sensitive Factor-mediated Disassembly
J. Biol. Chem., May 26, 2006; 281(21): 14823 - 14832.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J.-T. A. Chiang, M. Steciuk, B. Shtonda, and L. Avery
Evolution of pharyngeal behaviors and neuronal functions in free-living soil nematodes
J. Exp. Biol., May 15, 2006; 209(10): 1859 - 1873.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. A. Chesney, A. R. Kidd III, and J. Kimble
gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans
Genetics, February 1, 2006; 172(2): 915 - 928.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Seino and T. Shibasaki
PKA-Dependent and PKA-Independent Pathways for cAMP-Regulated Exocytosis
Physiol Rev, October 1, 2005; 85(4): 1303 - 1342.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. L. Deken, R. Vincent, G. Hadwiger, Q. Liu, Z.-W. Wang, and M. L. Nonet
Redundant Localization Mechanisms of RIM and ELKS in Caenorhabditis elegans
J. Neurosci., June 22, 2005; 25(25): 5975 - 5983.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. C.-H. Chang and C. Rongo
Cytosolic tail sequences and subunit interactions are critical for synaptic localization of glutamate receptors
J. Cell Sci., May 1, 2005; 118(9): 1945 - 1956.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
C.-F. Chuang and C. I. Bargmann
A Toll-interleukin 1 repeat protein at the synapse specifies asymmetric odorant receptor expression via ASK1 MAPKKK signaling
Genes & Dev., January 15, 2005; 19(2): 270 - 281.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Shim, T. Umemura, E. Nothstein, and C. Rongo
The Unfolded Protein Response Regulates Glutamate Receptor Export from the Endoplasmic Reticulum
Mol. Biol. Cell, November 1, 2004; 15(11): 4818 - 4828.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. N. Williams, C. J. Locke, A. L. Braden, K. A. Caldwell, and G. A. Caldwell
Epileptic-like convulsions associated with LIS-1 in the cytoskeletal control of neurotransmitter signaling in Caenorhabditis elegans
Hum. Mol. Genet., September 15, 2004; 13(18): 2043 - 2059.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. Huang and M. J. Stern
FGF signaling functions in the hypodermis to regulate fluid balance in C. elegans
Development, June 1, 2004; 131(11): 2595 - 2604.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. P. Koushika, A. M. Schaefer, R. Vincent, J. H. Willis, B. Bowerman, and M. L. Nonet
Mutations in Caenorhabditis elegans Cytoplasmic Dynein Components Reveal Specificity of Neuronal Retrograde Cargo
J. Neurosci., April 21, 2004; 24(16): 3907 - 3916.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
G. M. Lesa, M. Palfreyman, D. H. Hall, M. T. Clandinin, C. Rudolph, E. M. Jorgensen, and G. Schiavo
Long chain polyunsaturated fatty acids are required for efficient neurotransmission in C. elegans
J. Cell Sci., December 15, 2003; 116(24): 4965 - 4975.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. R. Coorssen, P. S. Blank, F. Albertorio, L. Bezrukov, I. Kolosova, X. Chen, P. S. Backlund Jr, and J. Zimmerberg
Regulated secretion: SNARE density, vesicle fusion and calcium dependence
J. Cell Sci., May 15, 2003; 116(10): 2087 - 2097.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. C. Schafer, C. J. Haycraft, J. H. Thomas, B. K. Yoder, and P. Swoboda
XBX-1 Encodes a Dynein Light Intermediate Chain Required for Retrograde Intraflagellar Transport and Cilia Assembly in Caenorhabditis elegans
Mol. Biol. Cell, May 1, 2003; 14(5): 2057 - 2070.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. D. Burgoyne and A. Morgan
Secretory Granule Exocytosis
Physiol Rev, April 1, 2003; 83(2): 581 - 632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Rohde, L. Dietrich, D. Langosch, and C. Ungermann
The Transmembrane Domain of Vam3 Affects the Composition of cis- and trans-SNARE Complexes to Promote Homotypic Vacuole Fusion
J. Biol. Chem., January 10, 2003; 278(3): 1656 - 1662.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Xue and B. Zhang
Do SNARE proteins confer specificity for vesicle fusion?
PNAS, October 15, 2002; 99(21): 13359 - 13361.
[Full Text] [PDF]


Home page
GeneticsHome page
I. Vilinsky, B. A. Stewart, J. Drummond, I. Robinson, and D. L. Deitcher
A Drosophila SNAP-25 Null Mutant Reveals Context-Dependent Redundancy With SNAP-24 in Neurotransmission
Genetics, September 1, 2002; 162(1): 259 - 271.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Liu and C. Barlowe
Analysis of Sec22p in Endoplasmic Reticulum/Golgi Transport Reveals Cellular Redundancy in SNARE Protein Function
Mol. Biol. Cell, September 1, 2002; 13(9): 3314 - 3324.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. A. Humphrey, M. M. Sedensky, and P. G. Morgan
Understanding anesthesia: making genetic sense of the absence of senses
Hum. Mol. Genet., May 15, 2002; 11(10): 1241 - 1249.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. van Swinderen, L. B. Metz, L. D. Shebester, and C. M. Crowder
A Caenorhabditis elegans Pheromone Antagonizes Volatile Anesthetic Action Through a Go-Coupled Pathway
Genetics, May 1, 2002; 161(1): 109 - 119.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Zambrano, M. Bimonte, S. Arbucci, D. Gianni, T. Russo, and P. Bazzicalupo
feh-1 and apl-1, the Caenorhabditis elegans orthologues of mammalian Fe65 and {beta}-amyloid precursor protein genes, are involved in the same pathway that controls nematode pharyngeal pumping
J. Cell Sci., January 4, 2002; 115(7): 1411 - 1422.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Staunton, B. Ganetzky, and M. L. Nonet
Rabphilin Potentiates Soluble N-Ethylmaleimide Sensitive Factor Attachment Protein Receptor Function Independently of rab3
J. Neurosci., December 1, 2001; 21(23): 9255 - 9264.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. Schoch, F. Deak, A. Konigstorfer, M. Mozhayeva, Y. Sara, T. C. Sudhof, and E. T. Kavalali
SNARE Function Analyzed in Synaptobrevin/VAMP Knockout Mice
Science, November 2, 2001; 294(5544): 1117 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Zhao and M. L. Nonet
A Conserved Mechanism of Synaptogyrin Localization
Mol. Biol. Cell, August 1, 2001; 12(8): 2275 - 2289.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
R. A. Maselli, D. Z. Kong, C. M. Bowe, C. M. McDonald, W. G. Ellis, M. A. Agius, C. M. Gomez, D. P. Richman, and R. L. Wollmann
Presynaptic congenital myasthenic syndrome due to quantal release deficiency
Neurology, July 24, 2001; 57(2): 279 - 289.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. J. Yook, S. R. Proulx, and E. M. Jorgensen
Rules of Nonallelic Noncomplementation at the Synapse in Caenorhabditis elegans
Genetics, May 1, 2001; 158(1): 209 - 220.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
K. M. Lickteig, J. S. Duerr, D. L. Frisby, D. H. Hall, J. B. Rand, and D. M. Miller III
Regulation of Neurotransmitter Vesicles by the Homeodomain Protein UNC-4 and Its Transcriptional Corepressor UNC-37/Groucho in Caenorhabditis elegans Cholinergic Motor Neurons
J. Neurosci., March 15, 2001; 21(6): 2001 - 2014.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Pilon, X.-R. Peng, A. M. Spence, R. H.A. Plasterk, and H.-M. Dosch
The Diabetes Autoantigen ICA69 and Its Caenorhabditis elegans Homologue, ric-19, Are Conserved Regulators of Neuroendocrine Secretion
Mol. Biol. Cell, October 1, 2000; 11(10): 3277 - 3288.
[Abstract] [Full Text]


Home page
Mol. Biol. CellHome page
R. E. Kohn, J. S. Duerr, J. R. McManus, A. Duke, T. L. Rakow, H. Maruyama, G. Moulder, I. N. Maruyama, R. J. Barstead, and J. B. Rand
Expression of Multiple UNC-13 Proteins in the Caenorhabditis elegans Nervous System
Mol. Biol. Cell, October 1, 2000; 11(10): 3441 - 3452.
[Abstract] [Full Text]


Home page
JCBHome page
S. Martinez-Arca, P. Alberts, A. Zahraoui, D. Louvard, and T. Galli
Role of Tetanus Neurotoxin Insensitive Vesicle-Associated Membrane Protein (Ti-Vamp) in Vesicular Transport Mediating Neurite Outgrowth
J. Cell Biol., May 15, 2000; 149(4): 889 - 900.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Schiavo, M. Matteoli, and C. Montecucco
Neurotoxins Affecting Neuroexocytosis
Physiol Rev, April 1, 2000; 80(2): 717 - 766.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Araque, N. Li, R. T. Doyle, and P. G. Haydon
SNARE Protein-Dependent Glutamate Release from Astrocytes
J. Neurosci., January 15, 2000; 20(2): 666 - 673.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H Zhao and M. Nonet
A retrograde signal is involved in activity-dependent remodeling at a C. elegans neuromuscular junction
Development, January 3, 2000; 127(6): 1253 - 1266.
[Abstract] [PDF]


Home page
Mol. Biol. CellHome page
M. L. Nonet, A. M. Holgado, F. Brewer, C. J. Serpe, B. A. Norbeck, J. Holleran, L. Wei, E. Hartwieg, E. M. Jorgensen, and A. Alfonso
UNC-11, a Caenorhabditis elegans AP180 Homologue, Regulates the Size and Protein Composition of Synaptic Vesicles
Mol. Biol. Cell, July 1, 1999; 10(7): 2343 - 2360.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Ailion, T. Inoue, C. I. Weaver, R. W. Holdcraft, and J. H. Thomas
Neurosecretory control of aging in Caenorhabditis elegans
PNAS, June 22, 1999; 96(13): 7394 - 7397.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Sassa, S.-i. Harada, H. Ogawa, J. B. Rand, I. N. Maruyama, and R. Hosono
Regulation of the UNC-18-Caenorhabditis elegans Syntaxin Complex by UNC-13
J. Neurosci., June 15, 1999; 19(12): 4772 - 4777.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. van Swinderen, O. Saifee, L. Shebester, R. Roberson, M. L. Nonet, and C. M. Crowder
A neomorphic syntaxin mutation blocks volatile-anesthetic action in Caenorhabditis elegans
PNAS, March 2, 1999; 96(5): 2479 - 2484.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Jin, E. Jorgensen, E. Hartwieg, and H. R. Horvitz
The Caenorhabditis elegans Gene unc-25 Encodes Glutamic Acid Decarboxylase and Is Required for Synaptic Transmission But Not Synaptic Development
J. Neurosci., January 15, 1999; 19(2): 539 - 548.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. S. Duerr, D. L. Frisby, J. Gaskin, A. Duke, K. Asermely, D. Huddleston, L. E. Eiden, and J. B. Rand
The cat-1 Gene of Caenorhabditis elegans Encodes a Vesicular Monoamine Transporter Required for Specific Monoamine-Dependent Behaviors
J. Neurosci., January 1, 1999; 19(1): 72 - 84.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. R. Coorssen, P. S. Blank, M. Tahara, and J. Zimmerberg
Biochemical and Functional Studies of Cortical Vesicle Fusion: The SNARE Complex and Ca2+ Sensitivity
J. Cell Biol., December 28, 1998; 143(7): 1845 - 1857.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
F. Kawasaki, A. M. Mattiuz, and R. W. Ordway
Synaptic Physiology and Ultrastructure in comatose Mutants Define an In Vivo Role for NSF in Neurotransmitter Release
J. Neurosci., December 15, 1998; 18(24): 10241 - 10249.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. A. Tolar and L. Pallanck
NSF Function in Neurotransmitter Release Involves Rearrangement of the SNARE Complex Downstream of Synaptic Vesicle Docking
J. Neurosci., December 15, 1998; 18(24): 10250 - 10256.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. M. Labrousse, D.-L. Shurland, and A. M. van der Bliek
Contribution of the GTPase Domain to the Subcellular Localization of Dynamin in the Nematode Caenorhabditis elegans
Mol. Biol. Cell, November 1, 1998; 9(11): 3227 - 3239.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Laage, J. Rohde, B. Brosig, and D. Langosch
A Conserved Membrane-spanning Amino Acid Motif Drives Homomeric and Supports Heteromeric Assembly of Presynaptic SNARE Proteins
J. Biol. Chem., June 2, 2000; 275(23): 17481 - 17487.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (128)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nonet, M. L.
Right arrow Articles by Wei, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nonet, M. L.
Right arrow Articles by Wei, L.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-