 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 1998, 18(11):4166-4176
Rapsyn Clusters Neuronal Acetylcholine Receptors But Is
Inessential for Formation of an Interneuronal Cholinergic Synapse
Guoping
Feng1,
Joe
Henry
Steinbach2, and
Joshua R.
Sanes1
Departments of 1 Anatomy and Neurobiology and
2 Anesthesiology, Washington University School of
Medicine, St. Louis, Missouri 63110
 |
ABSTRACT |
Nicotinic acetylcholine receptors (AChRs) are clustered at high
density in the postsynaptic membranes of skeletal neuromuscular junctions and cholinergic interneuronal synapses. A cytoplasmic protein, rapsyn, is essential for AChR clustering in muscle. Here, we
asked whether rapsyn mediates neuronal AChR clustering at cholinergic synapses in a mammalian sympathetic ganglion, the superior cervical ganglion (SCG). Several observations supported this possibility: (1)
AChR clusters containing the 3-5 and 2 subunits, homologs of the
muscle AChR subunits, are present at SCG synapses; (2) rapsyn RNA is
readily detectable in the SCG; and (3) expression of recombinant rapsyn
in heterologous cells induces aggregation of coexpressed neuronal AChR
subunits. However, rapsyn protein was undetectable at ganglionic
synaptic sites. Moreover, aggregates of neuronal AChRs induced in
heterologous cells by full-length rapsyn remained intracellular,
whereas rapsyn-induced clusters of muscle AChRs reached the cell
surface. Additional studies revealed a second rapsyn RNA species in SCG
generated by alternative splicing and competent to encode a novel short
rapsyn isoform. However, this isoform clustered neither neuronal nor
muscle AChRs in heterologous cells. Most telling, the number, size, and
density of AChR clusters in SCG did not differ significantly between
neonatal mice bearing a targeted mutation of the rapsyn gene and
littermate controls. Thus, rapsyn is dispensable for clustering of
ganglionic neuronal nicotinic AChRs.
Key words:
acetylcholine receptor; knock-out; mouse; postsynaptic; rapsyn; superior cervical ganglion; synaptogenesis
 |
INTRODUCTION |
Neurotransmitter receptors are
clustered in the postsynaptic membrane at many, if not all, chemical
synapses. The high density of receptors is crucial for synaptic
function, and regulation of receptor density may underlie some forms of
synaptic plasticity. Proteins have now been identified that interact
with the cytoplasmic domains of various receptors and appear to play
roles in the clustering process. These include gephyrin for glycinergic
receptors (Kirsch et al., 1996 ), the PSD/SAP proteins (PSD95/SAP90,
PSD93/chapsyn-110, SAP97, and SAP102) for NMDA-type glutamate receptors
(Cho et al., 1992 ; Kistner et al., 1993 ; Niethammer et al., 1996 ;
Kornau et al., 1997 ), Glutamate Receptor Interacting Protein (GRIP) for AMPA-type glutamate receptors (Dong et al., 1997 ), Homer for
metabotropic glutamate receptors (Brakeman et al., 1997 ), and rapsyn
for nicotinic acetylcholine receptors (AChRs) at the skeletal
neuromuscular junction.
Rapsyn, on which we focus here, is a 43 kDa cytoplasmic protein that
was originally identified by virtue of its close association with the
AChRs of Torpedo electric organ (Sobel et al., 1977 ; Neubig
et al., 1979 ). Rapsyn is also codistributed with AChRs at the
neuromuscular junction; rapsyn and AChRs appear together at the
earliest stages of synaptogenesis and are present at 1:1 stoichiometry
at adult synapses (Froehner et al., 1981 ; LaRochelle and Froehner,
1986 ; Noakes et al., 1993 ). That rapsyn is sufficient to cluster AChRs
was shown by coexpression of recombinant protein in nonmuscle cells:
AChRs are diffusely distributed when expressed on their own but become
aggregated into high-density clusters when coexpressed with rapsyn
(Froehner et al., 1990 ; Phillips et al., 1991a ). That rapsyn is
necessary for synaptogenesis was shown genetically in mice: no AChR
clusters form at neuromuscular junctions of mice bearing a targeted
mutation of the rapsyn gene, and homozygous mutants die of respiratory
failure within a few hours of birth (Gautam et al., 1995 ).
To date, no information is available on the mechanisms that induce
clustering of nicotinic AChRs at interneuronal synapses. We have
undertaken to address this issue at the relatively accessible synapse
formed by autonomic preganglionic axons on sympathetic neurons in the
superior cervical ganglion (SCG) of the mouse. Because neuronal and
muscle nicotinic AChR subunits are similar in primary sequence
(Lindstrom, 1996 ), we began by testing the possibility that rapsyn
might play a crucial role in neurons as it does in muscle. We show here
that sympathetic neurons express RNAs encoding both full-length rapsyn
and a novel shorter isoform generated by alternative splicing.
Moreover, rapsyn can induce aggregation of neuronal AChRs coexpressed
in heterologous cells. However, three lines of evidence indicate that
rapsyn is not a critical mediator of AChR clustering at ganglionic
synapses. First, rapsyn protein is undetectable at AChR clusters in the
SCG. Second, although rapsyn formed clusters with both muscle and
neuronal AChRs in heterologous cells, only the former were transported to the plasma membrane. Third, and most telling, both synaptic and
nonsynaptic AChR clusters formed in SCGs of rapsyn-deficient mutant
mice.
 |
MATERIALS AND METHODS |
Animals. Sympathetic ganglia, skeletal muscles, and
brains were dissected from timed embryonic or postnatal mice. Mice
bearing a targeted mutation of the rapsyn gene have been described
previously (Gautam et al. 1995 ) and were maintained on a 129SV × C57BL6 hybrid background. Homozygous mutants were readily identified
because they died within a few hours of birth, but their genotype was confirmed by PCR. Littermates of the rapsyn mutants or wild-type C57BL6
(The Jackson Laboratory, Bar Harbor, ME) or ICR mice (Harlan Sprague
Dawley, Indianapolis, IN) were used as controls.
Antibodies. Four rat monoclonal antibodies to AChR subunits
were obtained from Jon Lindstrom (University of Pennsylvania) and from
the Developmental Studies Hybridoma Bank (Iowa City, IA). Monoclonal
antibody (mAb) 35 recognizes mouse AChR ( 1) subunit; mAb 210 recognizes mouse AChR 1 and 5 subunits; mAb 299 recognizes mouse
AChR 4 subunit; and mAb 270 recognizes mouse AChR 2 subunit
(Lindstrom, 1996 ). Two additional mouse monoclonal antibodies against
subunits (mAb 398 and mAb 399; Chemicon, Temecula, CA) and a
polyclonal antibody to 3 subunit (AChR 3; Santa Cruz
Biotechnology, Santa Cruz, CA) were also tested but did not detectably
stain SCG. Monoclonal antibody to the synaptic vesicle protein SV2 was
a gift from Kathleen Buckley (Harvard Medical School, Boston, MA)
(Buckley and Kelly, 1985 ). mAb 7a to gephyrin was a gift from Heinrich
Betz (Max-Planck-Institute for Brain Research) (Kirsch and Betz, 1993 ).
Affinity-purified rabbit anti-rapsyn polyclonal antibody 5943 and mouse
anti-rapsyn mAb 1234 were described previously (Phillips et al.,
1991b ). Rabbit antibodies to mouse laminin 1 and rat neural cell
adhesion molecule (NCAM) were generated in our laboratory. Secondary
antibodies included FITC-goat anti-rat (Organon Teknika-Cappel, West
Chester, PA), Cy3-goat anti-rat and Cy3-goat anti-rabbit (Jackson
ImmunoResearch, West Grove, PA), and FITC-goat anti-mouse
IgG1 and FITC-goat anti-rabbit (Boehringer Mannheim, Indianapolis,
IN).
Reverse transcription-PCR. Total RNA was extracted using the
guanidinium-acid-phenol method (Chomczynski and Sacchi, 1987 ). Poly(A+) RNA was isolated by a single passage over
an oligo-dT-cellulose column. First-strand cDNA was synthesized using
avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI)
and 10 µg of total RNA or 2 µg of poly(A+) RNA
in a 50 µl reaction. For amplification of rapsyn, a forward primer
[J23; GGGCAGGACCAGACAAAGCAAC, nucleotides (nt) 110-131] and a
reverse primer (R5; CCGATGGATATCGGCAAAGC, nt 858-877) were designed.
For better separation of the splicing form from the original rapsyn, a
second forward primer was used (F2; GAGATGGGCCGCTACAAAGAGATGCT, nt
269-294). The 50 µl PCR mixture contained 5 µl of first-strand cDNA from total RNA (or 1 µl if synthesized from mRNA), 0.2 mM deoxynucleotide triphosphates, 10 mM
Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, a 0.1 µM concentration of each
primer, and 1.25 U of Taq polymerase (Life Technologies,
Gaithersburg, MD). The PCR was performed under the following
conditions: 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min
for 40 cycles, followed by a 10 min final extension at 72°C. PCR
products were purified from 1% agarose gels, subcloned into
pBluescript II SK+ (Stratagene, La Jolla, CA), and
sequenced using the dideoxy terminator method and an automated
sequencer.
Expression vectors. The cDNAs for the rat neuronal nicotinic
subunits were kindly provided by Dr. J. Patrick (Baylor College of
Medicine, Houston, TX). Those for the 4 subunit (HYA23-1E; Goldman
et al., 1987 ) and 2 subunit (PCX49; Deneris et al., 1988 ) were
transferred to pcDNA3 (Invitrogen, San Diego, CA) for expression. Keith
Isenberg (Washington University School of Medicine. St. Louis, MO)
kindly provided a construct containing the rat 3 subunit (PCA48E;
Boulter et al., 1986 ) in pRc-CMV (Invitrogen). Expression constructs
encoding mouse muscle AChR , , , and subunits and mouse
rapsyn were described previously (Phillips et al., 1991a ; Maimone and
Merlie, 1993 ; Apel et al., 1995 ). (We use generally accepted
nomenclature and refer to the muscle subunits as and rather
than 1 and 1.) An expression construct encoding a short form of
rapsyn was generated by replacing the 450 bp
BssHII-BstEII fragment of conventional rapsyn
with the 291 bp BssHII-BstEII fragment from the
short form that had been isolated by PCR, as described above.
Cell culture. For transfection, QT-6 fibroblasts [American
Type Culture Collection (ATCC), Manassas, VA] were plated onto 13-mm-diameter glass coverslips in 35 mm tissue culture dishes and
cultured until 50% confluent. Cells were transfected using the calcium
phosphate precipitation method (Chen and Okayama, 1987 ). For each 35 mm
dish, 2.5 µg of each plasmid was used, and pBluescript II
SK+ was added as necessary to bring the total amount
of DNA to 12.5 µg/35 mm dish to equalize transfection efficiency.
Cells were stained 40-48 hr after transfection.
HEK293 cells (CRL-1573; ATCC) were transfected by electroporation with
expression constructs for the rat 4 and 2 subunits. Transfected
cells were selected in medium containing G418 (450 µg/ml; Life
Technologies). Drug-resistant cells were maintained in G418 and then
repeatedly immunoselected (Chen et al., 1995 ) using mAb 270, which
binds to an epitope on the extracellular surface of the 2 subunit
(Whiting et al., 1987 ). The cells we used had been selected
sequentially eight times but had not been cloned. Membranes prepared
from these cells bind cytisine with high affinity (apparent
Kd, 0.1 nM), and binding can
be completely inhibited by nicotine (K. Burris and J. H. Steinbach, unpublished observations). Patch-clamp recordings
demonstrate that the cells produce conductance increases to nicotinic
agonists (acetylcholine, nicotine, and dimethylphenylpiperazinium) that
can be blocked by dihydro- -erythroidine (K. Burris, K. Paradiso, and
J. H. Steinbach, unpublished observations). For transient
expression of rapsyn, HEK293 cells were transfected as described for
QT-6 cells, except that the cells were plated on 0.1 mg/ml
poly-L-lysine-coated coverslips.
PC12 cells were cultured in DMEM with 10% fetal calf serum, 5% horse
serum, and 7% CO2. For neuronal differentiation, cells were treated with 50 ng/ml 2.5 S mouse NGF (a gift from Eugene Johnson,
Washington University) for 7 d, and then RNA was extracted as
described above.
Immunohistochemistry. Tissues from mutant or control mice
were embedded in Tissue-Tek OCT compound (Sakura Finetek USA, Torrance, CA), frozen in liquid nitrogen-cooled isopentane, and sectioned at 10 µm in a cryostat. Sections were blocked with 2% BSA and 10% normal
goat serum in PBS for 1 hr, incubated with primary antibody for 1-2
hr, rinsed, and then reincubated with secondary antibody for 1-2 hr.
Stained sections were mounted in 90% glycerol with 0.1%
p-phenylenediamine to retard fading.
Cultured cells on coverslips were fixed with 1% paraformaldehyde, 100 mM L-lysine, and 10 mM
m-periodate in PBS paraformaldehyde-lysine-periodate (PLP)
for 10 min at room temperature. For permeabilization, cells were fixed
with PLP plus 0.1% saponin, incubated with 1% Triton X-100 in PBS for
10 min, blocked with 2% BSA and 10% normal goat serum in PBS, and
stained as above.
 |
RESULTS |
AChR clusters at synaptic sites in mouse sympathetic ganglion
In muscle, nicotinic AChRs form high-density clusters in the
postsynaptic membrane precisely beneath motor nerve terminals. Clustering of neuronal nicotinic AChRs has also been documented in
chick and frog sympathetic ganglia (Jacob and Berg, 1983 ; Loring and
Zigmond, 1987 ; Sargent and Pang, 1989 ; Horch and Sargent, 1995 ,
1996 ; Wilson and Sargent, 1996 ) but not, to our knowledge, in mammalian
neurons. Accordingly, we began the present study by assessing the
distribution of AChRs in mouse SCG.
Molecular and electrophysiological studies have provided evidence that
rodent SCG expresses the neuronal AChR 3, 4, 5, 7, 2,
and 4 subunits (Mandelzys et al., 1994 , 1995 ; Rust et al., 1994 ;
McGehee and Role, 1995 ; Zoli et al., 1995 ). We stained sections of
mouse SCG with a panel of antibodies to these subunits (see Materials
and Methods). Two antibodies, mAb 210 and mAb 270, stained small
patches in the neuropil (Fig.
1a,b). The patches were approximately circular, had sharp borders, were ~0.2-1.0 µm
in diameter, and were not stained when control antibodies or preimmune
sera were substituted for anti-AChR (data not shown). mAb 270 recognizes the AChR 2 subunit in several species, and mAb 210 recognizes both 3 and 5 subunits of chicken and human AChR
(Lindstrom, 1996 ). However, the epitope to which it binds is not
conserved in the rodent 3 subunit (Boulter et al., 1986 ; Lindstrom,
1996 ), and mAb 210 did not recognize recombinant rat 3 (see below).
In mouse SCG, therefore, it probably recognizes only the 5 subunit.
Consistent with the finding that ganglionic neurons bear AChRs of
subunit composition 3 2 and 3 5 2 (Mandelzys et al., 1995 ),
staining by mAb 210 and mAb 270 was qualitatively similar but more
intense with the latter.

View larger version (79K):
[in this window]
[in a new window]
|
Figure 1.
Distribution of AChRs in mouse SCG. Sections of
P23-P25 SCG were double-stained with antibodies to neuronal AChR
subunits (a-e) plus anti-SV2 (a',
b', e') or anti-laminin
(c', d'). Both anti-AChR 2 (mAb 270;
a, c, e) and anti-AChR
5 (mAb 210; b, d) stained small
discrete patches, most of which were associated with nerve terminals
(a', b') and were clustered in the
neuropil rather than on the surface of somata
(c', d'). The section in e
and e' was from a ganglion that had been denervated
3 d earlier; SV2-positive nerve terminals had degenerated but AChR
clusters persisted, demonstrating that most, if not all, AChRs are
postsynaptic. Scale bar (in e'): a, b, 10 µm; c-e, 20 µm.
|
|
To assess the spatial relationship of the AChR clusters to
ganglion cells and nerve terminals, we performed a series of
double-labeling experiments. First, we used an antibody to a synaptic
vesicle protein, SV2, to mark presynaptic boutons. At least two-thirds of the mAb 270- and mAb 210-reactive puncta were directly apposed to
SV2-rich boutons (Fig. 1a',b'). Therefore, the
majority of AChR clusters in adult SCG are synaptic. On the other hand,
some SV2-positive terminals were unaccompanied by mAb 270- or mAb
210-positive puncta; this may result either from glancing sections or
from the predominance of other AChR subunits (e.g., 3 or 4) at
some synapses. Second, we stained for laminin, a component of the basal laminae that surround Schwann and satellite cells, which in turn ensheathe somata and processes (Fig. 1c',d').
Double-labeling with anti-laminin plus either mAb 270 or mAb 210 showed
that most AChR-rich puncta were located in process-rich regions,
presumably dendritic bundles, rather than on somata (Fig.
1c,d). Finally, we stained for NCAM, a
neuronal adhesion molecule widely expressed in neuronal processes and
cell-cell contacts. Again, double labeling showed that the majority of
mAb 270- and mAb 210-positive puncta were in process-rich regions (data
not shown).
In the brain, many AChRs are presynaptic (Swanson et al., 1987 ; Role
and Berg, 1996 ). Although double labeling with anti-SV2 and anti-AChR
showed that ganglionic receptors were synapse-associated, this method
was unable to distinguish presynaptic from postsynaptic sites. To
distinguish these alternatives, we denervated the SCG in adult mice by
cutting the cervical sympathetic trunk, waited 3 d for
preganglionic terminals to degenerate, and then double stained with mAb
270 and anti-SV2. Although SV2 staining was nearly eliminated after
denervation (Fig. 1e'), mAb 270-positive clusters persisted
(Fig. 1e). Thus, 2-containing AChRs in SCG are
predominantly postsynaptic.
Expression of rapsyn in sympathetic neurons
Using reverse transcription-PCR (RT-PCR), we readily detected
rapsyn RNA in samples of total RNA prepared from SCG (Fig.
2a). Transcript was also
detected in brain, consistent with a recent report by Yang et al.
(1997) . However, levels were extremely low compared with those in
muscle and SCG, and detection required use of
poly(A+) RNA as template (Fig. 2b).
Because most synapses in SCG, but only a small fraction of synapses in
the brain, are cholinergic, this result supports the notion that rapsyn
interacts selectively with neuronal AChRs at cholinergic synapses.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
Detection and characterization of rapsyn RNA.
a, RT-PCR of total RNA from muscle (lane
1) and SCG (lane 2), using rapsyn-specific
primers. A band of the predicted size of 609 nt was readily amplified
from both samples but was more abundant in muscle than in SCG. A band
of 450 nt was also detected in both samples but was a larger fraction
of the total product in SCG. b, RT-PCR of
poly(A+) RNA from muscle (lane 1),
PC12 cells (lane 2), and brain (lane 3)
using a second set of rapsyn-specific primers designed to amplify a 768 nt segment. Low levels of rapsyn RNA were detected in the brain sample,
and relatively high levels were detected in PC12 cells. As in
a, a band ~150 nt smaller than the predicted band was
also amplified. c, Part of the sequence of the 450 nt
band from a, lane 2 (bottom
line), aligned with sequence of full-length rapsyn (top
line). The shorter band encodes a protein that lacks a 53-amino
acid segment. d, The short form of rapsyn is likely to
be generated from an alternatively spliced mRNA that lacks exon 3. Top, structure of the rapsyn gene, from Gautam et al.
(1994) . Bottom, The alternatively spliced RNA that
encodes the short form.
|
|
To ask whether rapsyn is expressed by neurons, we turned to the PC12
cell line. These cells were derived from a pheochromocytoma but stop
dividing and acquire numerous features of sympathetic neurons when
treated with NGF (Greene and Tischler, 1976 ). The abundance of rapsyn
RNA was at least as high in NGF-treated PC12 cells as in sympathetic
ganglia (Fig. 2b) (data not shown). Thus, sympathetic
neuron-like cells and, by implication, sympathetic neurons express
rapsyn.
We attempted to detect additional genes related to rapsyn using
degenerate PCR with a variety of primers but obtained no evidence for
homologs. Likewise, no vertebrate rapsyn-like sequences other than
rapsyn itself were present in public databases as of March 1998. However, RT-PCR with both degenerate and specific primers generated an
additional product ~150 bp smaller than the predicted size. With the
primers used in Figure 2a, for example, the known sequence predicted a product of 609 bp, but products of ~600 and ~450 bp were detected. Likewise, the primers used in Figure
2b generated not only the predicted 768 bp band but also a
band of ~600 bp. Although we did not quantitate the levels of the two products, the smaller product was nearly as abundant as the larger product in RNA from SCG or PC12 cells but much less abundant in muscle
RNA. We therefore cloned the smaller product. Sequencing of 12 independent clones revealed a single product that was identical to
rapsyn at both ends and was therefore derived from the rapsyn gene
(Fig. 2c). Its short size reflected the deletion of a single block of 159 nt from the full-length RNA. Analysis of genomic structure
(Gautam et al., 1994 ) indicated that the deleted sequences corresponded
exactly to exon 3 of the rapsyn gene (Fig. 2d). Deletion of
this exon maintains the open reading frame. Thus, it is likely that the
rapsyn gene is alternatively spliced and that alternative splicing is
subject to tissue-specific regulation.
Although rapsyn RNA was readily detectable in SCG and PC12 cells, we
were unable to detect the cognate protein using either monoclonal or
affinity-purified polyclonal antibodies to rapsyn. Both antibodies
stained skeletal neuromuscular junctions intensely (Fig.
3b,c), and both
recognized epitopes outside of the segment deleted in the short rapsyn
isoform (see below). However, no signal above background was detectable
in sections of adult or neonatal SCG stained with either antibody (Fig.
3e,f). Moreover, neither antibody
stained PC12 cells detectably (data not shown). One possible explanation for this failure is that AChRs are less densely clustered at ganglionic than at neuromuscular synapses; if rapsyn were equimolar with AChR in ganglia as it is at neuromuscular junctions (LaRochelle and Froehner, 1986 ), then it might be difficult to detect in the former. To test this possibility, we used conditions in which (1)
anti-rapsyn fluorescence was as bright as anti-AChR fluorescence in
muscle, and (2) AChR clusters were clearly detectable in both muscle
and ganglia. Even when both tissues were stained in parallel under
these conditions, no rapsyn was detectable in ganglia (Fig. 3). Thus,
even if rapsyn is present in SCG, the mole ratio of rapsyn/AChR is far
lower at ganglionic synapses than at neuromuscular junctions.

View larger version (83K):
[in this window]
[in a new window]
|
Figure 3.
Rapsyn protein is undetectable at AChR clusters in
SCG. Sections of mouse skeletal muscle (a-c) or SCG
(d-f) were labeled with mAb 210, which
recognizes the muscle AChR subunit and the neuronal AChR 5
subunit (a, d), plus either polyclonal
antibodies to the N terminus of rapsyn (b,
e) or a monoclonal antibody to the C terminus of rapsyn
(c, f). Concentrations were
adjusted so that staining was more intense by anti-rapsyn than by
anti-AChR in muscle. Although muscle and SCG were stained under
identical conditions, no staining by anti-rapsyn was detectable in SCG.
Thus, if rapsyn is present at synaptic sites in SCG, it is not present
at the 1:1 ratio with AChRs found in muscle. Because mAb 210 stains all
AChRs in muscle but only a subset of AChRs in SCG, the difference in
the AChR/rapsyn ratio between the two tissues is even greater than it
appears to be in these micrographs. Scale bar (in
f): a-c, 50 µm;
d-f, 6 µm.
|
|
Interaction of rapsyn and AChRs in heterologous cells
The ability of rapsyn to cluster muscle AChRs was initially
demonstrated by coexpression in heterologous cells (Froehner et al.,
1990 ; Phillips et al., 1991a ). Here, we used QT-6 fibroblasts to test
whether rapsyn interacts with neuronal AChRs. A major advantage of this
cell type is that transfection efficiency is routinely >50%.
First, we transfected QT-6 cells with expression vectors encoding AChR
subunits and then stained nonpermeabilized cells with subunit-specific
antibodies to AChRs. When only a single subunit ( 4 or 2) was
transfected, no staining was visible on the surface of the transfected
cells (Fig. 4a) (data not
shown). In contrast, cotransfection of 2 with either 3 or 4
resulted in significant surface expression of receptors (Fig.
4b,c). To test the possibility that failure to
detect surface-associated single subunits reflected failure of
expression, we stained permeabilized cells and showed that single
subunits and pairs of subunits were expressed at similar levels (Fig.
4e-g). Thus, consistent with results from biochemical studies (Wang et al., 1996 ), these data suggest that assembly of
appropriate multimers is necessary for the surface appearance of
neuronal AChRs.

View larger version (84K):
[in this window]
[in a new window]
|
Figure 4.
Rapsyn-induced clustering of AChRs in transiently
transfected cells. QT-6 cells were transfected with expression vectors
encoding the AChR 2 (a, e,
i, m), 3 plus 2 (b,
f, j, n), 4 plus 2
(c, g, k,
o), or plus plus plus (d,
h, l, p) subunits, either without
(a-h) or with (i-p) an expression
vector encoding mouse rapsyn. Two days later, the cultures were stained
with antibodies to the AChR 2 (a-c,
e-g, i-k, m-o) or subunit (d, h, l,
p), either without (NP) or after
permeabilization (P) to reveal cell surface or
all AChRs, respectively. Cultures in m-p were
double-stained with anti-rapsyn (m'-p'). Rapsyn induces
clustering of muscle and neuronal receptors, but clusters of neuronal
AChRs are retained intracellularly. Scale bar, 10 µm.
|
|
Next, we cotransfected neuronal AChR subunits ( 4 or 2) or pairs
of subunits ( 3 plus 2 or 4 plus 2) with rapsyn and then stained unpermeabilized cells to assess the distribution of surface AChRs. No AChR clusters appeared on the surface of the cotransfected cells. Instead, levels of surface AChRs were lower in the presence of
rapsyn than in their absence (Fig. 4i-k). Surprisingly,
however, when cells were permeabilized before staining, clusters of
AChRs were readily detectable in ~50% of all cells (Fig.
4m-o), and these clusters were precisely colocalized with
high-density aggregates of rapsyn (Fig. 4m'-o'). Thus,
although rapsyn can interact with neuronal AChRs, rapsyn-induced
aggregates are trapped intracellularly.
These results differed greatly from those previously reported for
rapsyn-clustered muscle AChRs that reach the cell surface in
heterologous cells (Froehner et al., 1990 ; Phillips et al., 1991a ;
Brennan et al., 1992 ; Maimone and Merlie, 1993 ; Ramarao and Cohen,
1997 ) as they do in muscle. We therefore repeated the transfections in
QT-6 cells using expression vectors encoding the muscle , , ,
and AChR subunits. As expected, muscle AChRs were diffusely
distributed on the surface of QT-6 cells in the absence of rapsyn (Fig.
4d) and formed high-density surface clusters in the presence
of rapsyn (Fig. 4l). It appeared that some
rapsyn-induced muscle AChR clusters remained intracellular because
there were generally more clusters per cell and more cluster-bearing
cells in cultures stained after permeabilization than in cultures
stained without permeabilization (Fig.
4l,p). Nonetheless, the difference in
behavior between muscle and neuronal AChRs was qualitative and
clear-cut; numerous rapsyn-induced clusters of muscle AChRs appeared on
the cell surface, whereas rapsyn-induced clusters of neuronal AChRs
were always intracellular.
As an additional control, we expressed rapsyn in a clone of HEK293
cells that had been stably transfected with the AChR 4 and 2
subunits. Ramarao and Cohen (1997) have shown that muscle AChRs
expressed alone are diffusely distributed on the surface of these
cells, whereas cotransfection with rapsyn leads to formation of AChR
clusters on the cell surface. In the 4 plus 2-expressing cell
line, functional receptors were detectable on the cell surface by
electrophysiological methods (data not shown), and antibodies to either
the 4 or 2 subunits stained the cell surface diffusely (Fig.
5a,b). As in QT-6
cells, expression of rapsyn along with 4 plus 2 led to formation
of intracellular AChR-rapsyn aggregates but not to surface-associated
aggregates (Fig. 5c,c') (data not shown). Thus,
the differing ability of rapsyn to cluster surface-associated muscle
and neuronal AChRs is not peculiar to avian cells (because HEK 293 cells are of human origin), to fibroblasts (because HEK 293 cells are
epithelial), or to transiently expressed AChRs.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 5.
Rapsyn-induced clustering of AChRs in stably
transfected human cells. HEK 293 cells stably transfected with AChR
4 plus 2 expression vectors were stained with antibodies to 4
(a) or 2 (b). AChRs were
diffusely distributed on the cell surface. Sister cultures were
transiently transfected with rapsyn and then permeabilized and
double-stained with anti- 2 (c) and anti-rapsyn
(c'). Rapsyn induced clustering of AChRs. No clusters
were detected in nonpermeabilized cells (data not shown), indicating
that in HEK 293 cells as in QT-6 cells, clusters of neuronal AChRs are
retained intracellularly. Scale bar, 10 µm.
|
|
Finally, we considered the possibility that the short form of rapsyn
found in SCG might interact with neuronal AChRs. This seemed plausible
because the deletion of exon 3 (Fig. 2) leaves intact both N-terminal
sequences necessary for self-aggregation of rapsyn and C-terminal
sequences necessary for interaction of rapsyn with muscle AChRs in
HEK293 cells (Ramarao and Cohen, 1997 ). We therefore constructed an
expression vector that encoded the short form and tested it in QT-6
cells. Unlike the full-length rapsyn, the short-rapsyn isoform did not
form aggregates on its own and did not induce surface-associated or
intracellular clusters of either muscle (   ) or neuronal
( 3 plus 2 or 4 plus 2) AChRs (Fig.
6).

View larger version (90K):
[in this window]
[in a new window]
|
Figure 6.
The short isoform of rapsyn cannot cluster AChRs.
QT-6 cells were transiently transfected with an expression vector
encoding the short form of rapsyn shown in Figure 2c, in
addition to AChR plus plus plus (a), 3 plus 2 (b), or
4 plus 2 (c) subunits. Two days later,
cells were permeabilized and stained with anti-AChR
(a-c) plus anti-rapsyn (a'-c').
Antibodies to both the C terminus (a'-c') and N
terminus (data not shown) (Fig. 3) recognized the short isoform. Both
AChRs and the short form of rapsyn were diffusely distributed. Scale
bar, 10 µm.
|
|
Clustering of ganglionic AChRs in the absence of rapsyn
As a genetic test of whether neuronal AChR clustering requires
rapsyn, we examined SCG from rapsyn-deficient mutant mice. Because
homozygous rapsyn mutant mice die at postnatal day 0 (P0) (Gautam et
al., 1995 ), we first stained SCG from control neonates with mAb 210 and
mAb 270, which revealed 5- and 2-containing AChR clusters in
older mice (see above). AChR clusters were present by P0, although they
were both fewer in number and smaller in size than those seen at P20
(compare Figs. 1, 7a,c).
Moreover, double staining with SV2 revealed that many AChR clusters
were not apposed to SV2-positive nerve terminals at P0 (Fig.
7a',c').

View larger version (38K):
[in this window]
[in a new window]
|
Figure 7.
AChR clusters in SCG of
rapsyn / mice. Sections of SCG from E18
rapsyn+/ (a, c) or
rapsyn / (b,
d) littermates were double-stained with anti-AChR 2
(a, b) or 5 (c,
d) plus anti-SV2 (a'-d'). AChRs clusters
were present at both synaptic and extrasynaptic sites in perinatal
ganglia from both mutants and controls. e, Numbers of
AChR-rich clusters in mutant and control ganglia. Scale bar, 10 µm.
|
|
Qualitatively AChR clusters in rapsyn / SCG
resembled those in littermate controls. Clusters were stained by mAb
210 and mAb 270, indicating that both 5- and 2-containing AChRs
were present (Fig. 7b,d). Double staining with
anti-SV2 showed that synaptic and extrasynaptic clusters were present
in mutants (Fig. 7b',d'). Neither the intensity
of staining nor the size of clusters differed noticeably between mutant
homozygotes and littermates. We also counted mAb 210- and mAb
270-positive clusters in sections. As shown in Figure 7e,
the number of mAb 210- and mAb 270-positive clusters was similar in
mutants and controls. Thus, rapsyn does not greatly affect the size,
location, density, or number of AChR clusters in the SCG.
Gephyrin in SCG
AChR subunits are distantly related to subunits of glycine and
GABAA receptors. The cytoplasmic protein gephyrin has been implicated in clustering of these receptors (Kirsch et al., 1995 , 1996 ). Recently, Yang et al. (1997) showed that rapsyn, which has no
significant homology to gephyrin, can cluster GABAA
receptors in QT-6 cells. In light of these results, the persistence of
neuronal AChR clustering in rapsyn / mice raised
the possibility that gephyrin might be involved in clustering
ganglionic AChRs. We therefore used a well characterized monoclonal
antibody (Kirsch and Betz, 1993 ; Kirsch et al., 1995 ) to assess the
distribution of gephyrin in SCG. As previously described, this antibody
stains synapse-like puncta in the brain (Fig.
8a). However, we detected no
significant staining in embryonic day 18 (E18) SCG of mutant or control
mice (Fig. 8b,c), nor did we detect any signal in
adult SCG (data not shown).

View larger version (66K):
[in this window]
[in a new window]
|
Figure 8.
Immunostaining of gephyrin in brain and SCG.
Sections of control adult brain (a), control E18
SCG (b), and rapsyn / SCG
(c) were stained with anti-gephyrin. Gephyrin
showed punctate staining in brain but no staining in SCG. Scale bar, 10 µm.
|
|
 |
DISCUSSION |
We have initiated a study of interneuronal synaptogenesis in the
mouse SCG. This preparation is advantageous for several reasons. First,
the synapse made by autonomic preganglionic axons on ganglionic neurons
is relatively accessible to molecular, physiological, and structural
analyses. Second, it comprises the vast majority of all synapses in the
ganglion, making it straightforward to correlate structural,
functional, and molecular results. Third, the structure, function, and
development of this synapse have been studied in detail, so a great
deal of background information is available. Fourth, and perhaps most
important, the ganglionic synapse resembles the best studied of all
synapses, the skeletal neuromuscular junction, in several respects: (1)
both are cholinergic; (2) autonomic preganglionic neurons are clonally
and molecularly related to skeletal motoneurons (Leber et al., 1990 ;
Tsuchida et al., 1994 ); and (3) the nicotinic AChRs of the SCGs are
similar in sequence and biophysical properties to the AChRs of the
neuromuscular junction (Lindstrom, 1996 ). Thus, knowledge derived from
studies of the neuromuscular junction may be more directly applicable to synapses in the SCG than to the predominantly noncholinergic synapses of the brain. Finally, the choice of mouse permits us to make
use of molecular genetic approaches, beginning with the impressive
number of mutant and transgenic strains already available (Sanes,
1997 ).
Here, we have focused on the clustering of neuronal nicotinic AChRs in
the membrane of SCG neurons. Eleven neuronal nicotinic AChR subunits
have been identified to date ( 2-9 and 2-4; Lindstrom, 1996 ), of
which at least six are expressed in rodent sympathetic ganglia:
3-5, 7, 2, and 4 (Rust et al., 1994 ; Zoli et al., 1995 ).
Clusters of AChRs have been described in autonomic ganglia of frogs and
chicks (Jacob and Berg, 1983 ; Loring and Zigmond, 1987 ; Sargent and
Pang, 1989 ; Horch and Sargent, 1995 , 1996 ; Wilson and Sargent, 1996 ),
so we anticipated that at least some subunits would be clustered at
synaptic sites in mouse SCG. Using monoclonal antibodies, we showed
that 5- and 2-containing AChRs are concentrated at postsynaptic
sites in the mature SCG. Based on physiological studies, we expect that
the ganglionic AChRs are heterogeneous and include pentamers in which
3, 4, and 5 subunits are combined with 2 and/or 4
(Mandelzys et al., 1994 , 1995 ). Unfortunately, antibodies that reacted
with mouse 3, 4, or 4 subunits were not available to assess
the full complement of ganglionic AChRs. (Note that the anti- 4
antibody used in Fig. 5 did not stain sections.) Our results also
showed that some synaptic AChR clusters were present in perinatal SCG,
consistent with earlier electrophysiological and electron microscopic
studies (Smolen and Raisman, 1980 ; Rubin, 1985 ). Interestingly, some
clusters were not obviously associated with nerve terminals at this
stage. Additional studies will be required to determine whether
nonsynaptic AChR clusters are eventually lost or whether they become
innervated.
Having shown that synaptic AChR clusters are present in the SCG, we
asked whether rapsyn was involved in clustering. As noted in the
introductory remarks, rapsyn is both necessary and sufficient for
clustering of AChRs at the neuromuscular junction. Rapsyn was
originally thought to be restricted to muscle and electric organ, but
lower levels of expression were reported in other tissues by Musil et
al. (1989) . Recently, Burns et al. (1997) and Yang et al. (1977)
documented the presence of rapsyn RNA in avian ciliary ganglion and
mouse brain, respectively, and suggested that rapsyn may be involved in
neuronal synaptogenesis. Moreover, we found that rapsyn RNA was more
abundant in the SCG than in brain as a whole, that a novel isoform of
rapsyn RNA was selectively expressed in ganglia, and that rapsyn can
induce clustering of neuronal AChRs in heterologous cells. However,
three lines of evidence suggest that rapsyn is not, in fact, crucial
for clustering of ganglionic AChRs.
First, although rapsyn RNA is readily detectable in SCG, we were unable
to detect rapsyn protein in these ganglia. Initially, this was
unsurprising; levels of rapsyn are low even in muscle, and AChR density
is considerably lower at interneuronal than at neuromuscular synapses.
Thus, low levels of ganglionic rapsyn might be difficult to detect.
However, we were able to ask whether rapsyn and AChRs are present at a
1:1 ratio at synaptic sites in ganglia, as they are in muscle
(LaRochelle and Froehner, 1986 ). To this end, we stained muscle and SCG
under identical conditions, adjusted so that anti-rapsyn and anti-AChR
generated equally bright signals in muscle. Under these conditions AChR
clusters were clearly visible in the SCG, but rapsyn remained
undetectable. From this result we conclude that if rapsyn is present at
ganglionic synapses, it interacts with AChRs in a different way than it
does in muscle.
Second, although rapsyn can aggregate both muscle and neuronal AChRs in
heterologous cells, only muscle AChR-containing clusters are
transported to the plasma membrane. Several groups have demonstrated that rapsyn can cluster muscle AChRs in a variety of nonmuscle cells
(Xenopus oocytes, Froehner et al., 1990 ; QT-6, Phillips et
al., 1991a ,b ; COS cells, Brennan et al., 1992 ; HEK293 cells, Ramaroa
and Cohen, 1997 ), and in each case, labeling of live cells has shown
that at least some clusters reach the cell surface. Here, we have shown
that rapsyn can cluster neuronal and muscle AChRs to a similar extent.
In both QT-6 and HEK293 cells, however, the aggregates of neuronal
AChRs are retained intracellularly. Thus, we suspect, but have not
proven, that rapsyn interacts differently with muscle and neuronal
AChRs, aggregating both but permitting only the former to reach the
cell surface. Although the mechanistic basis for this difference awaits
a better understanding of how rapsyn interacts with muscle AChRs, one
possibility is that surface clustering of receptors by rapsyn involves
two separable steps: aggregation with rapsyn intracellularly followed
by export of the rapsyn-receptor complex to the cell surface. If this
is so, then it might be that requirements for the second step (export) are more stringent than those for the first (aggregation), with both
neuronal and muscle AChRs meeting the criteria for the first interaction but only muscle AChRs meeting the criteria for the second.
Indeed, clustering and externalization have been shown to be separable
processes for glycine and GABAA receptors (Kirch et al.,
1995 ; Wan et al., 1997 ). In this light, it will be interesting to use
chimeras between muscle and neuronal AChRs to dissect rapsyn-AChR interactions.
The final and most important piece of evidence that rapsyn is
dispensable for neuronal AChR clustering came from the study of
rapsyn-deficient mice. No AChR clusters have been detected in muscle of
rapsyn / mice or in myotubes cultured from the
mutants (Gautam et al., 1995 ; Apel et al., 1997 ). In contrast, neuronal
AChR clusters are normal in size, shape, and number in
rapsyn / SCG. Because
rapsyn / mice die within a few hours of birth, it
remains possible that rapsyn plays a role in the maturation or
maintenance of ganglionic synapses. However, it seems highly likely
that other molecules, functional if not structural homologs of rapsyn,
are required for the initial clustering of AChRs at ganglionic
synapses. Recent discoveries of such molecules at glutamatergic and
glycinergic synapses (see introductory remarks) suggest strategies for
seeking their counterparts in the SCG.
 |
FOOTNOTES |
Received Feb. 11, 1998; revised March 17, 1998; accepted March 19, 1998.
This work was supported by grants from National Institutes of Health to
J.R.S. and J.H.S. and a McKnight Scholar Award to J.R.S. G.F. is a
Fellow of the Jane Coffin Childs Memorial Fund for Medical Research. We
thank Elizabeth Apel and Bruce Patton for advice, Kathy Buckley and Jon
Lindstrom for antibodies, Jim Patrick and Keith Isenberg for nicotinic
subunit cDNA clones, Renate Lewis, Carrie Kopta, and Jessie Zhang for
assistance, and Monica McCullough for initial studies of receptor
distribution on the stably transfected cell line.
Correspondence should be addressed to Dr. Joshua R. Sanes, Department
of Anatomy and Neurobiology, Washington University School of Medicine,
660 South Euclid Avenue, Box 8108, St. Louis, MO 63110.
 |
REFERENCES |
-
Apel ED,
Roberds SL,
Campbell KP,
Merlie JP
(1995)
Rapsyn may function as a link between the acetylcholine receptor and the agrin-binding dystrophin-associated glycoprotein complex.
Neuron
15:115-126[Web of Science][Medline].
-
Apel ED,
Glass DJ,
Moscoso LM,
Yancopoulos GD,
Sanes JR
(1997)
Rapsyn is required for MuSK signaling and recruits synaptic components to a MuSK-containing scaffold.
Neuron
18:623-635[Web of Science][Medline].
-
Boulter J,
Evans K,
Goldman D,
Martin G,
Treco D,
Heinemann S,
Patrick J
(1986)
Isolation of a cDNA clone coding for a possible neural nicotinic acetylcholine receptor alpha-subunit.
Nature
319:368-374[Medline].
-
Brakeman PR,
Lanahan AA,
O'Brien R,
Roche K,
Barnes CA,
Huganir RL,
Worley PF
(1997)
Homer: a protein that selectively binds metabotropic glutamate receptors.
Nature
386:284-288[Medline].
-
Brennan C,
Scotland PB,
Froehner SC,
Henderson LP
(1992)
Functional properties of acetylcholine receptors coexpressed with the 43K protein in heterologous cell systems.
Dev Biol
149:100-111[Web of Science][Medline].
-
Buckley K,
Kelly RB
(1985)
Identification of a transmembrane glycoprotein specific for secretory vesicles of neural and endocrine cells.
J Cell Biol
100:1284-1294[Abstract/Free Full Text].
-
Burns AL,
Benson D,
Howard MJ,
Margiotta JF
(1997)
Chick ciliary ganglion neurons contain transcripts coding for acetylcholine receptor-associated protein at synapses (rapsyn).
J Neurosci
17:5016-5026[Abstract/Free Full Text].
-
Chen C,
Okayama H
(1987)
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol Cell Biol
7:2745-2752[Abstract/Free Full Text].
-
Chen Q,
Fletcher GH,
Steinbach JH
(1995)
Selection of stably transfected cells expressing a high level of fetal muscle nicotinic receptors.
J Neurosci Res
40:606-612[Web of Science][Medline].
-
Cho KO,
Hunt CA,
Kennedy MB
(1992)
The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein.
Neuron
9:929-942[Web of Science][Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Deneris ES,
Connolly J,
Boulter J,
Wada E,
Wada K,
Swanson LW,
Patrick J,
Heinemann S
(1988)
Primary structure and expression of beta 2: a novel subunit of neuronal nicotinic acetylcholine receptors.
Neuron
1:45-54[Web of Science][Medline].
-
Dong H,
O'Brien RJ,
Fung ET,
Lanahan AA,
Worley PF,
Huganir RL
(1997)
GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors.
Nature
386:279-284[Medline].
-
Froehner SC,
Gulbrandsen V,
Hyman C,
Jeng AY,
Neubig RR,
Cohen JB
(1981)
Immunofluorescence localization at the mammalian neuromuscular junction of the Mr 43,000 protein of Torpedo postsynaptic membranes.
Proc Natl Acad Sci USA
78:5230-5234[Abstract/Free Full Text].
-
Froehner SC,
Luetje CW,
Scotland PB,
Patrick J
(1990)
The postsynaptic 43K protein clusters muscle nicotinic acetylcholine receptors in Xenopus oocytes.
Neuron
5:403-410[Web of Science][Medline].
-
Gautam M,
Mudd J,
Copeland NG,
Gilbert DJ,
Jenkins NA,
Merlie JP
(1994)
Characterization and mapping of the Rapsyn gene encoding the 43 kDa acetylcholine receptor-associated protein.
Genomics
24:366-369[Web of Science][Medline].
-
Gautam M,
Noakes PG,
Mudd J,
Nichol M,
Chu GC,
Sanes JR,
Merlie JP
(1995)
Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice.
Nature
377:232-236[Medline].
-
Goldman D,
Deneris E,
Luyten W,
Kochhar A,
Patrick J,
Heinemann S
(1987)
Members of a nicotinic acetylcholine receptor gene family are expressed in different regions of the mammalian central nervous system.
Cell
48:965-973[Web of Science][Medline].
-
Greene LA,
Tischler AS
(1976)
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor.
Proc Natl Acad Sci USA
73:2424-2428[Abstract/Free Full Text].
-
Horch HL,
Sargent PB
(1995)
Perisynaptic surface distribution of multiple classes of nicotinic acetylcholine receptors on neurons in the chicken ciliary ganglion.
J Neurosci
15:7778-7795[Abstract].
-
Horch HL,
Sargent PB
(1996)
Effects of denervation on acetylcholine receptor clusters on frog cardiac ganglion neurons as revealed by quantitative laser scanning confocal microscopy.
J Neurosci
16:1720-1729[Abstract/Free Full Text].
-
Jacob MH,
Berg DK
(1983)
The ultrastructural localization of alpha-bungarotoxin binding sites in relation to synapses on chick ciliary ganglion neurons.
J Neurosci
3:260-271[Abstract].
-
Kirsch J,
Betz H
(1993)
Widespread expression of gephyrin, a putative glycine receptor-tubulin linker protein, in rat brain.
Brain Res
621:301-310[Web of Science][Medline].
-
Kirsch J,
Kuhse J,
Betz H
(1995)
Targeting of glycine receptor subunits to gephyrin-rich domains in transfected human embryonic kidney cells.
Mol Cell Neurosci
6:450-461[Web of Science][Medline].
-
Kirsch J,
Meyer G,
Betz H
(1996)
Synaptic targeting of ionotropic neurotransmitter receptors.
Mol Cell Neurosci
8:93-98[Web of Science][Medline].
-
Kistner U,
Wenzel BM,
Veh RW,
Cases LC,
Garner AM,
Appeltauer U,
Voss B,
Gundelfinger ED,
Garner CC
(1993)
SAP90, a rat presynaptic protein related to the product of the Drosophila tumor suppressor gene dlg-A.
J Biol Chem
268:4580-4583[Abstract/Free Full Text].
-
Kornau HC,
Seeburg PH,
Kennedy MB
(1997)
Interaction of ion channels and receptors with PDZ domain proteins.
Curr Opin Neurobiol
7:368-373[Web of Science][Medline].
-
LaRochelle WJ,
Froehner SC
(1986)
Determination of the tissue distributions and relative concentrations of the postsynaptic 43 kDa protein and the acetylcholine receptor in Torpedo.
J Biol Chem
261:5270-5274[Abstract/Free Full Text].
-
Leber SM,
Breedlove SM,
Sanes JR
(1990)
Lineage, arrangement, and death of clonally related motoneurons in chick spinal cord.
J Neurosci
10:2451-2462[Abstract].
-
Lindstrom J
(1996)
Neuronal nicotinic acetylcholine receptors.
Ion Channels
4:377-450[Medline].
-
Loring RH,
Zigmond RE
(1987)
Ultrastructural distribution of 125I-toxin F binding sites on chick ciliary neurons: synaptic localization of a toxin that blocks ganglionic nicotinic receptors.
J Neurosci
7:2153-2162[Abstract].
-
Maimone MM,
Merlie JP
(1993)
Interaction of the 43 kd postsynaptic protein with all subunits of the muscle nicotinic acetylcholine receptor.
Neuron
11:53-66[Web of Science][Medline].
-
Mandelzys A,
Pie B,
Deneris ES,
Cooper E
(1994)
The developmental increase in ACh current densities on rat sympathetic neurons correlates with changes in nicotinic ACh receptor
-subunit gene expression and occurs independent of innervation.
J Neurosci
14:2357-2364[Abstract]. -
Mandelzys A,
De Koninck P,
Cooper E
(1995)
Agonist and toxin sensitivities of ACh-evoked currents on neurons expressing multiple nicotinic ACh receptor subunits.
J Neurophysiol
74:1212-1221[Abstract/Free Full Text].
-
McGehee DS,
Role LW
(1995)
Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons.
Annu Rev Physiol
57:521-546[Web of Science][Medline].
-
Musil LS,
Frail DE,
Merlie JP
(1989)
The mammalian 43 kDa acetylcholine receptor-associated protein (RAPsyn) is expressed in some nonmuscle cells.
J Cell Biol
108:1833-1840[Abstract/Free Full Text].
-
Neubig RR,
Krodel EK,
Boyd ND,
Cohen JB
(1979)
Acetylcholine and local anesthetic binding to Torpedo nicotinic postsynaptic membranes after removal of nonreceptor peptides.
Proc Natl Acad Sci USA
76:690-694[Abstract/Free Full Text].
-
Niethammer M,
Kim E,
Sheng M
(1996)
Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases.
J Neurosci
16:2157-2163[Abstract/Free Full Text].
-
Noakes PG,
Phillips WD,
Hanley TA,
Sanes JR,
Merlie JP
(1993)
43K protein and acetylcholine receptors colocalize during the initial stages of neuromuscular synapse formation in vivo.
Dev Biol
155:275-280[Web of Science][Medline].
-
Phillips WD,
Kopta C,
Blount P,
Gardner PD,
Steinbach JH,
Merlie JP
(1991a)
ACh receptor-rich membrane domains organized in fibroblasts by recombinant 43-kilodalton protein.
Science
251:568-570[Abstract/Free Full Text].
-
Phillips WD,
Maimone MM,
Merlie JP
(1991b)
Mutagenesis of the 43 kDa postsynaptic protein defines domains involved in plasma membrane targeting and AChR clustering.
J Cell Biol
115:1713-1723[Abstract/Free Full Text].
-
Ramarao MK,
Cohen JB
(1997)
Distinct structural domains within rapsyn are involved in self association and nicotinic acetylcholine receptor clustering.
Soc Neursci Abstr
154:3.
-
Role LW,
Berg DK
(1996)
Nicotinic receptors in the development and modulation of CNS synapses.
Neuron
16:1077-1085[Web of Science][Medline].
-
Rubin E
(1985)
Development of the rat superior cervical ganglion: initial stages of synapse formation.
J Neurosci
5:697-704[Abstract].
-
Rust G,
Burgunder JM,
Lauterburg TE,
Cachelin AB
(1994)
Expression of neuronal nicotinic acetylcholine receptor subunit genes in the rat autonomic nervous system.
Eur J Neurosci
6:478-485[Web of Science][Medline].
-
Sanes JR
(1997)
Genetic analysis of postsynaptic differentiation at the vertebrate neuromuscular junction.
Curr Opin Neurobiol
7:93-100[Web of Science][Medline].
-
Sargent PB,
Pang DZ
(1989)
Acetylcholine receptor-like molecules are found in both synaptic and extrasynaptic clusters on the surface of neurons in the frog cardiac ganglion.
J Neurosci
9:1062-1072[Abstract].
-
Smolen A,
Raisman G
(1980)
Synapse formation in the rat superior cervical ganglion during normal development and after neonatal deafferentation.
Brain Res
181:315-323[Web of Science][Medline].
-
Sobel A,
Weber M,
Changeux JP
(1977)
Large-scale purification of the acetylcholine-receptor protein in its membrane-bound and detergent-extracted forms from Torpedo marmorata electric organ.
Eur J Biochem
80:215-224[Web of Science][Medline].
-
Swanson LW,
Simmons DM,
Whiting PJ,
Lindstrom J
(1987)
Immunohistochemical localization of neuronal nicotinic receptors in the rodent CNS.
J Neurosci
7:3334-3342[Abstract].
-
Tsuchida T,
Ensini M,
Morton SB,
Baldassare M,
Edlund T,
Jessell TM,
Pfaff SL
(1994)
Topographic organization of embryonic motor neurons defined by expression of LIM homeobox genes.
Cell
79:957-970[Web of Science][Medline].
-
Wan Q,
Xiong ZG,
Man HY,
Ackerley CA,
Braunton J,
Lu WY,
Becker LE,
MacDonald JF,
Wang YT
(1997)
Recruitment of functional GABAA receptors to postsynaptic domains by insulin.
Nature
388:686-690[Medline].
-
Wang F,
Gerzanich V,
Wells GB,
Anand R,
Peng X,
Keyser K,
Lindstrom J
(1996)
Assembly of human neuronal nicotinic receptor alpha5 subunits with alpha3, beta2, and beta4 subunits.
J Biol Chem
271:17656-17665[Abstract/Free Full Text].
-
Whiting PJ,
Liu R,
Morley BJ,
Lindstrom JM
(1987)
Structurally different neuronal nicotinic acetylcholine receptor subtypes purified and characterized using monoclonal antibodies.
J Neurosci
7:4005-4016[Abstract].
-
Wilson HH,
Sargent PB
(1996)
Synaptic and extrasynaptic distribution of two distinct populations of nicotinic acetylcholine receptor clusters in the frog cardiac ganglion.
J Neurocytol
25:67-77[Web of Science][Medline].
-
Yang SH,
Armson PF,
Cha J,
Phillips WD
(1997)
Clustering of GABAA receptors by rapsyn/43 kDa protein in vitro.
Mol Cell Neurosci
8:430-438[Web of Science][Medline].
-
Zoli M,
Le NN,
Hill JJ,
Changeux JP
(1995)
Developmental regulation of nicotinic ACh receptor subunit mRNAs in the rat central and peripheral nervous systems.
J Neurosci
15:1912-1939[Abstract].
Copyright © 1998 Society for Neuroscience 0270-6474/98/18114166-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Kumari, V. Borroni, A. Chaudhry, B. Chanda, R. Massol, S. Mayor, and F. J. Barrantes
Nicotinic acetylcholine receptor is internalized via a Rac-dependent, dynamin-independent endocytic pathway
J. Cell Biol.,
October 22, 2008;
181(7):
1179 - 1193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Ficklin, S. Zhao, and G. Feng
Ubiquilin-1 Regulates Nicotine-induced Up-regulation of Neuronal Nicotinic Acetylcholine Receptors
J. Biol. Chem.,
October 7, 2005;
280(40):
34088 - 34095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Parker, S. Zhao, D. S. Bredt, J. R. Sanes, and G. Feng
PSD93 Regulates Synaptic Stability at Neuronal Cholinergic Synapses
J. Neurosci.,
January 14, 2004;
24(2):
378 - 388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Levy and C. Aoki
alpha 7 Nicotinic Acetylcholine Receptors Occur at Postsynaptic Densities of AMPA Receptor-Positive and -Negative Excitatory Synapses in Rat Sensory Cortex
J. Neurosci.,
June 15, 2002;
22(12):
5001 - 5015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Bruses, N. Chauvet, and U. Rutishauser
Membrane Lipid Rafts Are Necessary for the Maintenance of the {alpha}7 Nicotinic Acetylcholine Receptor in Somatic Spines of Ciliary Neurons
J. Neurosci.,
January 15, 2001;
21(2):
504 - 512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Shoop, N. Yamada, and D. K. Berg
Cytoskeletal Links of Neuronal Acetylcholine Receptors Containing alpha 7 Subunits
J. Neurosci.,
June 1, 2000;
20(11):
4021 - 4029.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Temburni, R. C Blitzblau, and M. H Jacob
Receptor targeting and heterogeneity at interneuronal nicotinic cholinergic synapses in vivo
J. Physiol.,
May 15, 2000;
525(1):
21 - 29.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Meier, C Meunier-Durmort, C Forest, A Triller, and C Vannier
Formation of glycine receptor clusters and their accumulation at synapses
J. Cell Sci.,
January 8, 2000;
113(15):
2783 - 2795.
[Abstract]
[PDF]
|
 |
|
|