QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (60) Citing Articles via Google Scholar Google Scholar Articles by Haley, J. E. Articles by Buckley, N. J. Search for Related Content PubMed PubMed Citation Articles by Haley, J. E. Articles by Buckley, N. J.

 Previous Article  |  Next Article 

The Journal of Neuroscience, June 15, 1998, 18(12):4521-4531

The  Subunit of G_q Contributes to Muscarinic Inhibition of the M-Type Potassium Current in Sympathetic Neurons

Jane E. Haley¹, Fe C. Abogadie¹, Patrick Delmas¹, Mariza Dayrell¹, Yvonne Vallis¹, Graeme Milligan³, Malcolm P. Caulfield², David A. Brown¹, and Noel J. Buckley¹

¹ Wellcome Laboratory for Molecular Pharmacology, Department of Pharmacology, University College London, London, WC1E 6BT, United Kingdom, ² Department of Pharmacology and Neuroscience, Neurosciences Institute, University of Dundee, Ninewells Hospital and Medical School, Dundee DD1 9SY, United Kingdom, and ³ Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, United Kingdom

	ABSTRACT

Top Abstract Introduction Materials & Methods Results Discussion References

Rat superior cervical ganglion (SCG) neurons express low-threshold noninactivating M-type potassium channels (I_K(M)), which can be inhibited by activation of M1 muscarinic receptors. This inhibition occurs via pertussis toxin-insensitive G-proteins belonging to the G_q family (Caulfield et al., 1994). We have used DNA plasmids encoding antisense sequences against the 3' untranslated regions of G subunits (antisense plasmids) to investigate the specific G-protein subunits involved in muscarinic inhibition of I_K(M). These antisense plasmids specifically reduced levels of the target G-protein 48 hr after intranuclear injection. In cells depleted of G_q, muscarinic inhibition of I_K(M) was attenuated compared both with uninjected neurons and with neurons injected with an inappropriate G_oA antisense plasmid. In contrast, depletion of G₁₁ protein did not alter I_K(M) inhibition. To determine whether the  or subunits of the G-protein mediated this inhibition, we have overexpressed the C terminus of  adrenergic receptor kinase 1 (ARK1), which binds free subunits. ARK1 did not reduce muscarinic inhibition of I_K(M) at a concentration of plasmid that can reduce -mediated inhibition of calcium current (Delmas et al., 1998a). Also, expression of ₁₂ dimers did not alter the I_K(M) density in SCG neurons. In contrast, I_K(M) was virtually abolished in cells expressing GTPase-deficient, constitutively active forms of G_q and G₁₁. These data suggest that G_q is the principal mediator of muscarinic I_K(M) inhibition in rat SCG neurons and that this more likely results from an effect of the  subunit than the subunits of the G_q heterotrimer.

Key words: M-current; G-protein; antisense; muscarinic receptor; superior cervical ganglion neuron; adrenergic receptor kinase

	INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The M-type potassium current (I_K(M)) is a noninactivating, voltage-gated potassium current found in various peripheral and central neurons, including rat superior cervical ganglion (SCG) neurons, and in some cell lines (for review, see Brown, 1988). It is activated in the subthreshold voltage range for action potentials and increases with membrane depolarization. Thus, cells remain clamped around rest, display spike adaptation, and have limited excitability. Inhibition of I_K(M) results in depolarization with increased action potential discharge (Brown and Selyanko, 1985) and provides a switch between phasic and tonic firing properties (Wang and McKinnon, 1995). I_K(M) in rat SCG neurons can be inhibited after activation of various receptors, including M₁ muscarinic receptors [M₁ mAChR (Marrion et al., 1989; Bernheim et al., 1992)] and bradykinin B₂ receptors (Jones et al., 1995), coupled through Bordetella pertussis toxin-insensitive GTP-binding proteins (G-proteins) (Brown et al., 1989; Caulfield et al., 1994; Jones et al., 1995).

Using antibodies raised against the C-terminal domain of different G subunits, we have previously obtained evidence to suggest that the G-protein  subunits involved in M₁ mAChR-mediated inhibition of I_K(M) in rat SCG neurons include G_q or G₁₁ or both (Caulfield et al., 1994). However, the antibodies that were used could not distinguish between G_q and G₁₁ because they have identical C-terminal sequences (Strathmann and Simon, 1990). Because the C terminus is thought to be a locus of G-protein GDP-bound  subunit/receptor and GTP-bound  subunit/phospholipase C-1 (PLC-1) interactions (Conklin and Bourne, 1993; Conklin et al., 1993; Arkinstall et al., 1995), G_q and G₁₁ can couple to the same receptors (Aragay et al., 1992; Wu et al., 1992b; Nakamura et al., 1995; Dippel et al., 1996), and the cloned subunits stimulate the different PLC- isoforms to a similar degree (Taylor et al., 1991; Hepler et al., 1993; Jhon et al., 1993). However, they are not invariably equivalent, because in rat portal vein myocytes, G_q and G₁₁ elevate intracellular calcium levels after ₁-adrenoceptor activation by coupling to very different mechanisms (Macrez-Leprêtre et al., 1997).

In the present experiments, we have therefore tried to find out whether either or both of these two G-proteins (G_q and G₁₁) were involved in muscarinic inhibition of I_K(M) in rat SCG neurons by using G antisense-generating plasmids to deplete cells of specific subunits. We have also sought evidence to determine whether the  subunit or the dimer of the activated dissociated heterotrimer acted as the primary intermediary (Wickman and Clapham, 1995; Clapham and Neer, 1997) by selectively overexpressing subunits or GTPase-deficient forms of the  subunits and by testing whether a -sequestering agent [C-terminal peptide of  adrenergic receptor kinase 1 (ARK1)] modified the effect of mAChR stimulation.

Our results suggest that G_q, but not G₁₁, couples the M1 mAChR to I_K(M) inhibition in SCG neurons and that , rather than , subunits are the mediators of this response.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Cell culture. Sympathetic neurons were isolated from SCG of 15- to 19-d-old Sprague Dawley rats and cultured using standard procedures as described previously (Delmas et al., 1998a).

DNA plasmids. The constructs used in this study were made by PCR-cloning using standard molecular techniques (Abogadie et al., 1997). These were designed antisense to sequences in the 3' untranslated (3'UT) regions of the rat target genes and subcloned into pCR3 or pCR3.1 (Invitrogen, San Diego, CA) unless stated otherwise. The cloned 3'UT sequences share no significant homology with any other rat G-protein  subunits. The nucleotide sequences reported in this paper have been submitted to the GenBank/EMBL Data Bank with accession numbers Y17161, Y17162, Y17163, and Y17164. The clones are as follows, in 5' to 3' orientation [nucleotide (nt); coding region (CR); numbers indicate position relative to stop or start codon]: G_oA (clone 207-8) 3'UT nt 2-169: CTCTTGTCCTGTATAGCAACCTATTTGACTGCTTCATGGACTCTTTGCTGTTGATGTTGATCTCCTGGTAGCATGACCTTTGGCCTTTGTAAGACACACAGCCTTTCTGTACCAAGCCCCTGTCTAACCTACGACCCCAGAGTGACTGACGGCTGTGTATTTCTGTA; G_{q/11 common} (clone 107-6 in pBK-CMV, Stratagene, La Jolla, CA) CR nt 484-741: ATGACTTGGACCGTGTAGCCGACCCTTCCTATCTGCCTACACAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATTGAGTACCCCTTCGACTTACAGAGTGTCATCTTCAGAATGGTCGATGTAGGAGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAACGTCACCTCGATCATGTTTCTGGTAGCGCTTAGCGAATACGATCAAGTTCTTGTGGAGTCAGACAATGAGAACCGCA; G₁₁ antisense clones: 243-7, 3'UT nt 4-104; C97-4, 3'UT nt 82-123. G_q antisense clones: C23-24, 3'UT nt 6-289; C6-6, 3'UT nt 6-129; C23-D7, 3'UT nt 193-289; C23-16, 3'UT nt 29-129. Targeted sequences are shown in Figure 1.

View larger version (32K): [in this window] [in a new window]   Figure 1.   DNA Sequences of Gq and G11 3' untranslated regions. Sequences of rat Gq and G11 in the 3' untranslated region immediately after the stop codon. Homology between the two proteins is very low in this region, with only 19% identity, although this rises to 31% when the two sequences are aligned for maximum homology. The underlined areas represent the sequences targeted by the G11 antisense plasmids; the closed arrowheads correspond to clone 243-7 and the open arrowheads to clone C97-4.

The constitutively active, GTPase-deficient form of hamster G_q (Q209L) (Wu et al., 1992a) was subcloned into the pCMV5 vector, the GTPase-deficient G₁₁ (Q209L, also known as 11QL) (Wu et al., 1992a; from S. Offermanns) was provided in the pCIS vector, and the GTPase-deficient G_oA (Q205L) (Wong et al., 1992; from B. R. Conklin) was provided in the pCDNA1 vector. Bovine ₁ and ₂ subunits were subcloned into pCDNA3 (Invitrogen). The C-terminal Gly495 to Leu689 of human ARK1 (also called GRK2) (Koch et al., 1994; from C. Scorer and C. Harris) was supplied in the vector pCIN1 engineered with new NotI and EcoRI sites. All plasmids were propagated in either XL-1 blue or DH5 Escherichia coli and purified using maxiprep columns (Qiagen, Hilden, Germany). All clones were verified by sequencing. RNA synthesis was driven by a strong viral promoter (cytomegalovirus) to ensure sustained high intracellular levels of transcripts after delivery of plasmids.

In situ hybridization. In situ hybridization was performed on 12 µm cryostat sections of 17-d-old rat SCGs using digoxigenin-labeled riboprobes, essentially as described previously (Schaeren-Wiemers and Gerfin-Moser, 1993). Sense and antisense cRNAs were transcribed from the same clones used in the electrophysiological experiments using SP6 and T7 polymerase according to standard protocols.

Microinjection. DNA plasmids were diluted to 400 µg/ml in calcium- and glucose-free Krebs' solution (290 mOsm/l, pH 7.3) containing 0.5% FITC-dextran and pressure-injected into the nucleus of SCG neurons 2 d in culture, either as described previously (Abogadie et al., 1997) or with a microinjector (Eppendorf, Hamburg, Germany). Cells were maintained in culture for an additional 2 d, and a survival rate of 75-85% was obtained.

Electrophysiology. M-currents were measured from SCG neurons cultured for 4 d, using the amphotericin-B perforated-patch technique (Horn and Marty, 1988; Rae et al., 1991). Patch electrodes (2-4 M) were filled by dipping the tip for 40 sec into a filtered internal solution containing (in mM): potassium acetate 80, KCl 30, HEPES 40, MgCl₂ 3 (adjusted to pH 7.3-7.4 with KOH and to 280 mOsm/l with potassium acetate). The pipette was then back-filled with the above solution containing 0.1 mg/ml amphotericin-B. High-resistance seals (>2 G) were initially achieved, and after amphotericin-B permeabilization, access resistances were <25 M. SCG neurons were perfused at 5-10 ml/min at 32°C with an external solution consisting of (in mM): NaCl 120, KCl 3, HEPES 5, NaHCO₃ 23, glucose 11, MgCl₂ 1.2, CaCl₂ 2.5, tetrodotoxin (TTX) 0.0005, pH 7.4. Cells were voltage-clamped at approximately 25 mV using either an Axopatch 200A amplifier (data sampling rate 4-10 kHz, filter 1 kHz) or a switching amplifier (Axoclamp-2A, switching frequencies 3-5 kHz, filter 0.1 kHz), both from Axon instruments (Foster City, CA). I_K(M) was measured as a slowly developing inward deactivation relaxation after a 1 sec jump to a command potential of approximately 55 mV (Caulfield et. al., 1994). Inhibition was measured as the fractional reduction in the amplitude of the I_K(M) deactivation relaxation in response to cumulative increases in concentrations of oxotremorine methiodide (Oxo-M) (Research Biochemicals International, Natick, MA) (see Fig. 4). Steady-state current-voltage relationships were obtained by applying slow (3.3 mV/sec) voltage ramps from 20 mV to 100 mV. For experiments with Bordetella pertussis toxin (PTX) (Speywood, Maidenhead, Berkshire, UK), SCG neurons were incubated with 1 µg/ml PTX in the culture medium for at least 24 hr before recording.

Data were collected and analyzed using PClamp6 software (Axon Instruments) and expressed as mean ± SEM. An estimate of the mean log IC₅₀ for each antisense plasmid treatment was obtained by fitting the data from each individual cell with a best-fit dose-response curve and determining the log IC₅₀ for each cell. I_K(M) deactivation relaxations were best-fit by a double exponential with fast (1) and slow (2) components. Statistics used the two-way ANOVA comparing plasmid treatments across four agonist concentrations for all antisense samples (including uninjected groups). If a significant effect of plasmid treatment was found overall, further analysis was performed using the two-way ANOVA to determine which treatments contributed to this significance. The constitutively active G_oA*, G_q*, G_11*, and ₁₂ expression data were analyzed with one-way ANOVA, as was the log IC₅₀ data, and if an overall significant effect of plasmid treatment was found, this was followed by Bonferroni's multiple comparison test. p values < 0.05 were considered significant.

Immunocytochemistry. SCG cells, cultured and injected as described above, were fixed in acetone and stained for G_oA+B, G_q, G₁₁, and C terminus of ARK1 using selective antibodies and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indoxyl phosphate and nitro blue tetrazolium chloride (BCIP/NBT) (Dako, Carpinteria, CA), as described by Abogadie et al., (1997). The polyclonal antibodies anti-G_oA+B (sc-387), anti-G₁₁ (sc-394), and anti-ARK1 C terminus (sc-562) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and the anti-G antibody (3B-200) was from Gramsch Laboratories (Schwabhausen, Germany). The specific polyclonal antibody anti-G_q (IQB2) was raised against a synthetic peptide fragment of G_q (Milligan et al., 1993). Specificity of the antibodies was determined by competing out the staining by preabsorbing the antibody with the relevant immunogenic peptide. All dishes of SCG neurons recorded in the electrophysiology experiments were subsequently fixed and stained. The BCIP/NBT purple/blue product was too dark to quantitate photometrically, so we assessed whether there was an overall qualitative reduction in staining by comparing each injected cell with its nearest uninjected neighbor and determining (by eye) whether the level of staining was equal to or less than that of the uninjected cell. Using this method we have therefore estimated the proportion of cells with a visible reduction in staining (regardless of the magnitude of this reduction) 48 hr after injection of the antisense plasmid.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

G_q and G₁₁ expression in SCG neurons

Both in situ hybridization and RT-PCR clearly showed the presence of G_q and G₁₁ mRNAs in rat SCG tissue where they were expressed mainly in neurons (Fig. 2). The specificity of the hybridization probes was confirmed when no signal was seen after competition with unlabeled probes (data not shown) or after use of sense, rather than antisense, probes (Fig. 2). Staining with specific antibodies against G_q and G₁₁ demonstrated the presence of G_q and G₁₁ protein in most cultured SCG neurons (see below). We have constructed plasmids encoding for RNA antisense (antisense plasmids) directed against the 3' untranslated region of these G-proteins to specifically deplete cells of each of the -subunits. G_q and G₁₁ share 81% homology in coding region sequence (based on mouse sequence), and this drops to a maximum of 31% (when rat sequences are aligned for maximum homology) in the first 200 bases of the 3' untranslated region in rat (Fig. 1).

View larger version (118K): [in this window] [in a new window]   Figure 2.   In situ hybridization and RT-PCR demonstrate the presence of Gq and G11 mRNA in rat SCG. In situ hybridization (ISH) and RT-PCR demonstrate the presence of Gq and G11 in rat SCG. ISH of Gq (B) and G11 (C) shows neuronal staining. GoA ISH (A) was used as a positive control. All probes used were against the 3' untranslated region (3' UTR) of the gene. The black arrows indicate representative individual SCG neurons expressing the relevant mRNA. D, RT-PCR using rat SCG DNA as a template. m, Marker lane; o, Go with primers 266s/849a; q, Gq with primers Gq u6s/u111a, where "u" denotes sequence in the 3' UTR; 11, G11 with primers G11 488s/u103a; bp, base pair.

Direct intranuclear injection of SCG neurons with various antisense plasmids (G_q, G₁₁, and G_oA) resulted in a marked reduction in the respective G subunit staining 48-72 hr later (Fig. 3). This protein depletion was specific, with G_oA antisense not altering G_q or G₁₁ staining, G_{q/11 common} antisense not touching G_oA+B staining, G_q not altering G_oA+B or G₁₁ staining, and G₁₁ antisense leaving G_oA+B and G_q staining intact. The two G₁₁ antisense plasmids, however, were not equally effective. Thus, clone C97-4 reduced visible G₁₁ protein staining in 9 of 19 cells (47%; n = 7 dishes of cells) (see Materials and Methods) (Fig. 3C), whereas 243-7 reduced G₁₁ staining in only 18 of 63 cells (29%; n = 17 dishes). Similarly, the specific G_q antisense plasmids were not all effective. C6-6 and C23-24 reduced staining in 23 of 71 cells (32%; n = 8 dishes) and 8 of 32 cells (25%; n = 6 dishes), respectively (Fig. 3B), whereas C23-D7 and C23-16 were more effective, reducing staining in 31 of 65 cells (48%; n = 10 dishes) and 55 of 109 cells (50%; n = 21 dishes), respectively (Fig. 3B). The antisense plasmids were maximally effective in reducing G subunit staining 2 d after injection, and their effects on I_K(M) modulation were therefore assessed 2 d after injection.

View larger version (123K): [in this window] [in a new window]   Figure 3.   Reduction of G-protein  subunit staining in cells expressing antisense. Complementary fluorescence and G immunostaining photographs of cells intranuclearly injected with antisense plasmids and a fluorescent marker. A, Cells immunostained with GoA+B antibody and injected with (i) GoA antisense plasmid and (ii) Gq antisense plasmid (clone C23-D7). B, Cells immunostained with Gq antibody and neurons injected with (i) Gq antisense plasmid (C23-D7), (ii) GoA antisense plasmid, (iii) Gq antisense plasmid (C23-24), and (iv) G11 antisense plasmid (C97-4). C, Cells immunostained with G11 antibody and neurons injected with (i) G11 antisense plasmid (C97-4) and (ii) Gq antisense plasmid (C23-D7).

Effect of antisense plasmids on I_K(M) modulation by a muscarinic agonist

Injection of DNA plasmids encoding antisense to G_oA slightly reduced inhibition of I_K(M) by the muscarinic agonist Oxo-M. Thus, the inhibition of I_K(M) by 300 nM Oxo-M was 24.6 ± 5.0% (n = 6) in G_oA antisense-treated cells compared with 34.2 ± 2.6% (n = 7) in uninjected cells (p = 0.007 across all Oxo-M concentrations) (see Fig. 5B). To investigate further this effect of G_oA antisense, we pretreated several dishes of SCG neurons with 1 µg/ml PTX, which ADP-ribosylates and inactivates members of the G_o/i G-protein family. There was no significant difference in Oxo-M inhibition of I_K(M) between the treated and untreated cells (see Fig. 5D), confirming previous findings with other mAChR agonists (Brown et al., 1989). A comparable treatment strongly attenuated the G_o-mediated inhibition of the Ca²⁺ current by noradrenaline (Caulfield et al., 1994) and Oxo-M (Delmas et al., 1998b). Furthermore, overexpression of a constitutively active, GTPase-deficient form of G_oA (Wong et al., 1992) did not alter I_K(M) density (see Fig. 8 and below). It seems unlikely, therefore, that the G_oA antisense-induced reduction in I_K(M) inhibition results directly from the loss of G_oA or that G_oA participates in I_K(M) inhibition, a conclusion supported by previous studies using specific antibodies (Caulfield et al., 1994). This reduction is also unlikely to be caused by the plasmid injection per se, because cells injected with antisense constructs that were ineffective in reducing protein had no effect on the Oxo-M dose-response curves (see Fig. 5B,C and below). Hence, we do not yet understand why the G_oA antisense plasmid reduced I_K(M) inhibition. Nevertheless, because the most suitable control group for comparison with the G_q and G₁₁ antisense plasmids is the expression of an inappropriate antisense, we have taken the effect of the G_oA antisense as our baseline for assessing the effect of the G_q and G₁₁ antisense plasmids, because at the very least this would mitigate against any "nonspecific" effects of antisense plasmid injection. Thus, all p values quoted are compared against G_oA antisense-expressing neurons unless stated otherwise (in practice, the same outcome of the experiments below would be obtained if the comparison were with uninjected cells).

Injection of SCG neurons with the G_{q/11 common} antisense plasmid significantly reduced Oxo-M inhibition of I_K(M) when compared with G_oA antisense-expressing cells (G_oA antisense: 24.6 ± 5.0% inhibition with 300 nM Oxo-M, n = 6; G_q/11 antisense: 13.9 ± 2.2%, n = 6; p = 0.005 across all Oxo-M concentrations) (see Fig. 5B). This confirms previous observations, using functionally inactivating antibodies, that either G_q or G₁₁ or both mediate muscarinic inhibition of I_K(M) (Caulfield et al., 1994). To determine which (or whether both) of these G-protein  subunits is responsible for mediating this response, cells were injected with antisense plasmids that specifically reduced G_q and G₁₁ levels (see above). Four plasmids encoding different G_q antisense sequences were investigated (see Fig. 5A). Of these, two significantly reduced muscarinic inhibition of I_K(M) (C23-D7 and C23-16) (percentage inhibition with 300 nM Oxo-M: C23-D7: 15.5 ± 4.7%, n = 6, p = 0.004 compared with G_oA dose-response curve; C23-16: 15.7 ± 3.7%, n = 9, p = 0.001) (Figs. 4, 5C). This is in agreement with the immunocytochemical data where the clones C23-D7 and C23-16 selectively reduced immunocytochemical staining of G_q. The other two clones, C6-6 and C23-24, however, were less effective at reducing either G_q staining or muscarinic inhibition of I_K(M) (percentage inhibition of I_K(M) with 300 nM Oxo-M: C6-6: 24.3 ± 5.0%, n = 8; C23-24: 24.3 ± 3.0%, n = 5) (Fig. 5C). The attenuation of I_K(M) inhibition by the G_q antisense plasmids C23-D7 and C23-16 was reflected in an increase in the log IC₅₀ for these groups. Although the log IC₅₀ values for neurons injected with C6-6 (6.14 ± 0.09; n = 8) and C23-24 (6.07 ± 0.11; n = 5) were close to that for uninjected neurons (6.31 ± 0.06; n = 6), those for SCG neurons injected with the G_q antisense plasmids C23-D7 (5.64 ± 0.23; n = 6) and C23-16 (5.16 ± 0.37; n = 7; p < 0.05 compared with G₁₁ antisense-expressing neurons) were greater (Fig. 6). G_q depletion did not significantly change the maximum response or Hill slope. In contrast with the G_q antisense plasmids, I_K(M) inhibition in cells depleted of G₁₁ with C97-4 antisense plasmid (29.7 ± 4.1% inhibition at 300 nM Oxo-M; log IC₅₀ = 6.13 ± 0.09; n = 9) was no different from that seen in G_oA antisense-expressing neurons (Figs. 4, 5B, 6). In agreement with the time course of G subunit depletion, the reduction of Oxo-M inhibition was maximal at 48 hr for the concentration of the plasmid injected (400 µg/ml), because no further reduction was seen 72 hr after injection [e.g., at 72 hr, 300 nM Oxo-M produced 17.4 ± 2.7% (n = 9) inhibition of I_K(M) in G_q antisense (C23-16)-expressing cells)]. The resting membrane potential was not altered in neurons injected with the G_q or G₁₁ antisenses compared with G_oA antisense constructs (e.g., G_oA antisense: 63.5 ± 2.6 mV, n = 6; G_q antisense, C23-D7: 63.8 ± 1.1 mV, n = 5; G₁₁ antisense, C97-4: 62.0 ± 4.0 mV, n = 4).

View larger version (28K): [in this window] [in a new window]   Figure 4.   Time course of cumulative Oxo-M application; effect on IK(M) amplitude. A, IK(M) deactivation relaxation elicited by a 30 mV step for 1 sec from a holding potential of approximately 25 mV. Waveforms (average of 3 traces) are from cells injected with G11 (C97-4) or Gq (C23-16) antisense plasmids and whose time courses are shown in B. IK(M) relaxations are shown in the absence and presence of 1 µM and 10 µM Oxo-M. Dotted lines represent 0 pA. B, Time course of normalized IK(M) amplitude during application of increasing concentrations of Oxo-M, as indicated, for neurons injected with GoA, Gq, and G11 antisense plasmids. IK(M) was recorded every 10 sec, and each Oxo-M concentration was applied for 1 min.

View larger version (24K): [in this window] [in a new window]   Figure 5.   Dose-response curves for Oxo-M inhibition of IK(M) in antisense plasmid-injected SCG neurons. A, Schematic diagram demonstrating length [in base pairs (bp)] and relative positions of the four antisense sequences targeted at the 3' untranslated region of rat Gq. Only C23-D7 and C23-16 consistently reduced Gq protein levels in immunocytochemical staining with a Gq antibody. B, Dose-response curves (mean ± SEM, plus best-fit curve) for uninjected neurons compared with GoA antisense, G11 antisense, and Gq/11 antisense plasmid-injected cells. The dose-response curve for GoA (n = 6) antisense is significantly different from the uninjected dose-response curve (n = 6; p = 0.007) but not the G11 antisense plasmid curve (n = 9). The dose-response curve for cells injected with the Gq/11 common antisense plasmid (n = 6) is significantly different from those of cells injected with GoA and G11 antisense plasmids (p = 0.005 and p < 0.0001, respectively). C, Oxo-M dose-response curves for neurons injected with G11 antisense plasmid and four different antisense plasmids against Gq. The dose-response curves for C6-6 (n = 8) and C23-24 (n = 5) are not significantly different from the dose-response curves for GoA antisense-expressing (B) or G11 antisense-expressing neurons. C23-D7 (n = 6) and C23-16 (n = 9) dose-response curves are both significantly different from GoA antisense-expressing neurons (p = 0.004 and p = 0.001, respectively) and from G11 antisense-expressing neurons (p < 0.0001 and p < 0.0001, respectively). D, Oxo-M inhibition of IK(M) is not altered by pretreatment with 1 µg/ml PTX (n = 6; n = 4 for untreated neurons).

View larger version (13K): [in this window] [in a new window]   Figure 6.   Gq antisense plasmids increase the log IC50 for Oxo-M inhibition of IK(M). Scatter-plot is shown of the log IC50 for each neuron included in the mean dose-response curves in Figure 5. Log IC50 was calculated from the best-fit curve for Oxo-M inhibition of IK(M) for every neuron recorded with the injected antisense sequences indicated. Horizontal lines represent the mean of each group. The Gq antisense plasmid C23-16 significantly increased the log IC50 compared with uninjected neurons (p < 0.01), G11 antisense plasmid injected cells (p < 0.05), and cells injected with the Gq antisense plasmid C6-6 (p < 0.05).

Expression of the C-terminal ARK1 peptide in SCG neurons

The above results suggest that G_q is primarily responsible for M1 mAChR-induced inhibition of I_K(M), but they do not indicate which subunit(s) of the heterotrimer mediates the inhibition. To determine the role of endogenous G_q-linked dimers, we overexpressed the C-terminal domain of ARK1, which has been shown to sequester free subunits (Koch et al., 1994). Expression of the peptide was routinely detected 24-48 hr after injection as a strong increase in ARK1 peptide immunoreactivity. Injection of the ARK1 construct at 200 µg/ml, a concentration that has been found to be effective at attenuating noradrenergic inhibition of the calcium current (Delmas et al., 1998a), a presumed -mediated pathway (Herlitze et al., 1996; Ikeda, 1996), did not alter inhibition of I_K(M) (300 nM Oxo-M produced 21.8 ± 3.2% inhibition in ARK1-expressing cells; n = 8) (Fig. 7). Increasing the plasmid concentration to 400 µg/ml, however, resulted in a reduction of M1 mAChR inhibition of I_K(M) (300 nM Oxo-M resulted in 17.7 ± 2.4% inhibition, n = 7, p = 0.0002, compared with G_oA antisense plasmid cells, across all concentrations of Oxo-M) (Fig. 7). This effect was not a result of a use-dependent sequestration of subunits by ARK1 peptide, because repetitive application of 1 µM Oxo-M did not result in an accumulated loss of inhibition in neurons injected with 400 µg/ml ARK1-encoding plasmid (first application, 40.5 ± 4.0% inhibition; fourth application, 37.7 ± 4.1%; n = 3). Furthermore, neither I_K(M) current density (G_oA antisense: 2.8 ± 0.4 pA/pF, n = 7; 400 µg/ml ARK1: 4.7 ± 1.1 pA/pF, n = 7) nor I_K(M) deactivation relaxation (G_oA antisense: ₁ 40.3 ± 2.3 msec, ₂ 263 ± 21 msec, n = 9; 400 µg/ml ARK1: ₁ 37.2 ± 2.2 msec, ₂ 248 ± 30 msec, n = 10) was significantly altered by the ARK1-encoding plasmid.

View larger version (22K): [in this window] [in a new window]   Figure 7.   ARK1-injected cells show some attenuation of IK(M) inhibition by Oxo-M. Dose-response curves for Oxo-M inhibition of IK(M) in cells injected with either GoA antisense plasmid (n = 6) or C-terminal ARK1 plasmid at 200 µg/ml (n = 8) or 400 µg/ml (n = 7) are shown. Only the ARK1 400 µg/ml dose-response curve is significantly different from the GoA antisense dose-response curve (p = 0.0002).

Expression of GTPase-deficient forms of G_q and G₁₁ subunits, but not ₁₂ dimers, inhibits I_K(M)

The above experiments with ARK1 peptide expression suggest that , rather than , subunits mediate M1 mAChR inhibition of I_K(M). To test this further, we overexpressed GTPase-deficient, constitutively active forms of G_oA (G_oA*, Q205L), G_q (G_q*, Q209L), G₁₁ (G_11*, Q209L), and ₁₂ dimers. Overexpression of G_q* and G_11* resulted in a dramatic decrease in I_K(M) current density 24-48 hr after injection, compared with cells injected with G_oA antisense plasmid or G_oA* (Fig. 8A,C) (G_oA antisense: 2.8 ± 0.4 pA/pF, n = 7; G_oA*: 4.0 ± 0.6 pA/pF, n = 6; G_q*: 0.2 ± 0.02 pA/pF, n = 13, p < 0.001, compared with either G_oA antisense or G_oA*; G_11*: 0.1 ± 0.02 pA/pF, n = 8, p < 0.001, compared with either G_oA antisense or G_oA*). This loss of I_K(M) was also clear in the steady-state current-voltage relationships by the absence of outward rectification positive to 60 mV in G_q*- and G_11*-expressing cells (Fig. 8B). Consistent with the suppression of I_K(M), the resting membrane potential of these cells was more depolarized than in cells injected with G_oA antisense and G_oA* plasmids (G_oA antisense: 63.5 ± 2.6 mV, n = 6; G_oA*: 62.7 ± 0.7 mV, n = 6; G_q*: 48.4 ± 1.7 mV, n = 13, p < 0.001, compared with either G_oA antisense or G_oA*; G_11*: 50.3 ± 2.7 mV, n = 8, p < 0.01, compared with G_oA antisense or G_oA*). In contrast, overexpression of free subunits, by coexpressing ₁ and ₂ subunits, had no significant effect on either I_K(M) current density (2.03 ± 0.4 pA/pF, n = 6; p > 0.05 compared with G_oA antisense) (Fig. 8C) or resting membrane potential (59.2 ± 1.8, n = 6; p > 0.05, compared with G_oA antisense).

View larger version (16K): [in this window] [in a new window]   Figure 8.   Expression of GTPase-deficient forms of Gq and G11 tonically inhibits IK(M), whereas 12 dimers have no effect. A, Representative waveforms from cells in C. Neurons expressing constitutively active Gq* or G11* have very little holding current at 20 mV and no IK(M) deactivation relaxation in response to a 30 mV voltage step (bottom trace). IK(M) is normal in cells expressing 12 dimers compared with injected neurons (e.g., GoA antisense-expressing cells). Waveforms are the average of three traces, and the dotted line represents 0 pA. B, Current-voltage curves in response to a voltage ramp from 20 to 100 mV at 3.3 mV/sec (displayed in insert) in GoA antisense-expressing cells and neurons expressing Gq* or G11*. I-V plot is in reverse direction from the ramp applied, and the dotted line represents 0 pA. These traces have not been leak-subtracted; leak current in the Gq* and G11* cells is less than in the GoA antisense-expressing neurons. C, Scatter-plot of IK(M) densities in GoA antisense-expressing cells and cells expressing GoA*, Gq*, G11*, and 12 dimers. Horizontal lines represent means of each group. Gq* (n = 13) and G11* (n = 8) are significantly different from GoA antisense-expressing neurons (n = 7) (p < 0.001 and p < 0.001, respectively), GoA*-expressing neurons (n = 6) (p < 0.001 and p < 0.001, respectively), and 12 dimer-expressing neurons (n = 6) (p < 0.01 and p < 0.01, respectively).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Our data clearly demonstrate that direct intranuclear injection of antisense-generating plasmids is an effective method for reducing levels of G-protein subunits in neurons (Fig. 3). These antisense sequences, designed against the 3' UTR for increased specificity, are thought to bind to their target regions and destabilize the whole mRNA (Phillips and Gyurko, 1997), resulting in a reduced level of expression of the target protein. It is interesting to note that not all G 3' UTR antisense sequences were effective in reducing protein expression. Of four G_q antisense sequences tested, only two were effective (C23-D7 and C23-16). Similarly, of two G₁₁ antisense sequences tested, only one (C97-4) consistently reduced G₁₁ protein levels. This difference in effectiveness of the antisense sequences could perhaps arise from some unknown secondary structure in the target mRNA transcript (Phillips and Gyurko, 1997). Such structures may determine how accessible the target region is for binding by antisense transcripts. The two less effective G_q antisenses include a short region between nt 6 and 28 in the 3' UTR not covered by the other antisense sequences (Fig. 5). It is therefore tempting to speculate that this particular region or sequence might not be amenable to antisense action.

Using these specific antisense plasmids, we have shown that depletion of G_q, but not G₁₁, subunits significantly reduced muscarinic inhibition of I_K(M) (Figs. 4, 5). Indeed, although both in situ hybridization and immunocytochemical experiments clearly demonstrated the presence of G₁₁ in SCG neurons (Figs. 2, 3), muscarinic inhibition of I_K(M) was not altered in cells specifically depleted of G₁₁ by the antisense plasmid (Figs. 3-6). This suggests that G_q rather than G₁₁ preferentially mediates M1 mAChR inhibition of I_K(M). This idea is supported by the finding that the common G_q/11 antisense plasmid produced no greater reduction in I_K(M) inhibition than the specific G_q antisense plasmids. Although G_q antisense plasmids clearly shifted the dose-response curve for Oxo-M inhibition of I_K(M), they did not completely prevent inhibition by this mAChR agonist. This partly results from the variable response between neurons expressing the G_q antisense: some cells display very little inhibition when Oxo-M is applied, whereas others resemble uninjected neurons and robust inhibitions are observed (Fig. 6). This finding mirrors the results obtained when antibodies directed against G_q/11 were directly injected into SCG neurons. In these neurons there was an overall reduction in mean inhibition but a wide range of responses, from no reduction to total suppression in individual cells (Caulfield et al., 1994; Brown et al., 1995). The variability seen with the G_q antisense plasmids may most reasonably be attributed to a variable reduction in endogenous G_q protein. Although the participation of additional G-proteins cannot be totally excluded, this seems less likely because one would then have to postulate that the component of inhibition mediated by G_q varied greatly from one cell to another in an apparently arbitrary manner. Certainly, if another G-protein is involved, it must be insensitive to PTX (Fig. 5D), and it cannot be G₁₁ because (1) G₁₁ antisense plasmids were unable to alter I_K(M) inhibition and (2) the G_{q/11 common} antisense had no more effect than the specific G_q antisense plasmids (Figs. 5B,C, 6).

The inequality between G_q and G₁₁ function in these cells is somewhat surprising, because the bulk of evidence implies that G_q and G₁₁ are indistinguishable in both receptor-coupling and effector-coupling preference. These studies have been based mainly on purified protein in cell-free systems (Taylor et al., 1991) or cloned wild-type and constitutively active proteins expressed in cell lines (Aragay et al., 1992; Wu et al., 1992a,b; Hepler et al., 1993). Studies using antisense oligonucleotides, however, have implicated (1) both G_q and G₁₁ in M1 mAChR activation of PLC- in RBL-2H3 cells (Dippel et al., 1996) but( 2) neuromedin B receptor activation of PLC occurring via G_q, and not G₁₁, in Xenopus oocytes (Shapira et al., 1994). Furthermore, in both rat myocytes and Xenopus oocytes, endogenous G_q and G₁₁ appear to have distinctly different functions after thyrotropin-releasing hormone or ₁-adrenergic receptor activation (Lipinsky et al., 1992; Macrez-Leprêtre et al., 1997). These studies, and our results, suggest that the coupling preferences suggested by in vitro and overexpression studies may not reflect those found in native cells.

The lack of involvement of G₁₁ in mediating I_K(M) inhibition does not seem to arise from an inability of the subunit to couple to appropriate effector systems, because both G_11* and G_q* virtually abolished I_K(M). It is more likely, therefore, that the M1 muscarinic receptor preferentially links to G_q, rather than G₁₁, in these neurons. Because studies with recombinant G_q and G₁₁ have demonstrated that both of these subunits are capable of coupling to M1 receptors (Nakamura et al., 1995), differential receptor coupling might arise from a greater abundance of G_q relative to G₁₁. Lower levels of G₁₁, relative to G_q, have been observed in most cell lines (Milligan et al., 1993) and all regions of brain examined (Milligan, 1993), and Western blots from whole ganglia indicate that these proteins may not be equally expressed in SCG (Caulfield et al., 1994). Alternatively, differences in membrane compartmentalization of G_q and G₁₁ could result in differential access to the receptor, as has been suggested for G_i and G_o (Neubig, 1994; Gudermann et al., 1996). Membrane association of G_q and G₁₁ is primarily determined by their N-terminal regions where the palmitoylation sites and the regions essential for subunit interaction are situated (Conklin and Bourne, 1993; Milligan et al., 1995; Hepler et al., 1996). Because this region also contains the greatest amino acid diversity between G_q and G₁₁ (Strathmann and Simon, 1990), it is possible that they may differ in their membrane association or distribution. Recent work by Umemori et al. (1997) indicates that G_q and G₁₁ can undergo phosphorylation by tyrosine kinase after M1 mAChR activation and that this is required for activation of the subunits and leads to disassociation of the receptor-G-protein complex. A final possibility, therefore, could be that the phosphorylation states of G_q and G₁₁ in SCGs may differ, thereby altering their ability to interact with the receptor. Nevertheless, the effectiveness with which the GTPase-resistant G₁₁ inhibits I_K(M) leaves open the possibility that G₁₁ may mediate PTX-insensitive inhibition of I_K(M) via other receptors such as angiotensin II (Shapiro et al., 1994) or bradykinin (the effect of which is also inhibited by the G_q/11 antibody) (Jones et al., 1995).

The strong suppression of I_K(M) after overexpression of GTPase-resistant _q (and ₁₁), but not _oA, suggests that inhibition might well be mediated by dissociated GTP-bound _q subunits but does not, of itself, exclude the possibility that subunits released from the endogenous heterotrimer might be the physiological mediator of inhibition. However, this possibility seems unlikely for two reasons. First, co-overexpression of ₁ with ₂ subunits did not significantly reduce I_K(M) (Fig. 8). In parallel experiments, this procedure effectively inhibited the N-type voltage-gated Ca²⁺ current in these neurons (Delmas et al., 1998a), an inhibitory process considered from previous work to be driven by free subunits (Ikeda, 1996; Herlitze et al., 1996). Second, muscarinic inhibition of I_K(M) was unaffected in neurons injected with 200 µg/ml of a construct expressing the C-terminal sequence of ARK1 (also known as GRK2), which binds and sequesters free subunits (Koch et al., 1994) (Fig. 7). Again, in parallel experiments, this concentration of the ARK1 construct reduced I_Ca inhibition by noradrenaline and Oxo-M (Delmas et al., 1998a,b). Although increasing the plasmid concentration (to 400 µg/ml) did attenuate I_K(M), this might be a nonspecific effect. We cannot exclude the possibility that the dimer associated with G_q might have a low affinity for the ARK1 -binding domain [for instance, ₃ subunits cannot interact with ARK1 (Daaka et al., 1997)]. However, G_q and G₁₁ can form heterotrimers with ₁₂ dimers (Nakamura et al., 1995), and ARK1 abolishes muscarinic-activated calcium release in Xenopus oocytes, a response involving both G_q and G₁₁ (Stehno-Bittel et al., 1995).

Hence, and in conclusion, our results suggest that the pathway involved in muscarinic inhibition of I_K(M) in rat SCG neurons requires G_q but not G₁₁ and that it is the  subunit of the heterotrimer G_q, rather than the dimer, that acts as the primary transducer. To this extent, they also provide further evidence that coupling between receptors and G-proteins in neurons is highly specific and more subtle than experiments with reconstituted subunits might indicate.

	FOOTNOTES

Received Dec. 4, 1997; revised March 31, 1998; accepted April 3, 1998.

We thank Drs. C. Scorer and C. Harris, Receptor Systems, Glaxo Wellcome, for the gift of ARK1 plasmid; Dr. S. Offermanns, Institut für Pharmakologie, Freie Universität Berlin, for the gift of constitutively active G₁₁ plasmid; Dr. B. R. Conklin, The Gladstone Institute of Cardiovascular Disease, Departments of Medicine and Pharmacology, University of California San Francisco, for the gift of constitutively active G_oA cDNA; and Professor C. Hopkins for allowing us to use the Eppendorf microinjector in the Medical Research Council Laboratory for Molecular and Cellular Biology, University College London. This work was supported by the Wellcome Trust and the U.K. Medical Research Council.

Correspondence should be addressed to Jane Haley, Laboratory for Molecular Pharmacology, Department of Pharmacology, University College London, Gower Street, London WC1E 6BT, United Kingdom.

Ms. Vallis's present address: Laboratory for Molecular Biology, Medical Research Council Centre, Hills Road, Cambridge CB2 2QH, United Kingdom.

	REFERENCES

Top Abstract Introduction Materials & Methods Results Discussion References

• Abogadie FC, Vallis Y, Buckley NJ, Caulfield MP (1997) Use of antisense-generating plasmids to probe the function of signal transduction proteins in primary neurons. In: Methods in molecular biology, Vol 83: Receptor signal transduction protocols (Challiss RAJ, ed), pp 217-225. Totowa, NJ: Humana Press.
• Aragay AM, Katz A, Simon MI (1992) The G_q and G₁₁ proteins couple the thyrotropin-releasing hormone receptor to phospholipase C in GH₃ rat pituitary cells. J Biol Chem 267:24983-24988[Abstract/Free Full Text].
• Arkinstall S, Chabert C, Maundrell K, Peitsch M (1995) Mapping regions of G_q interacting with PLC1 using multiple overlapping synthetic peptides. FEBS Lett 364:45-50[Web of Science][Medline].
• Bernheim L, Mathie A, Hille B (1992) Characterization of muscarinic receptor subtypes inhibiting Ca²⁺ current and M current in rat sympathetic neurons. Proc Natl Acad Sci USA 89:9544-9548[Abstract/Free Full Text].
• Brown DA (1988) M-current. In: Ion channels (Narahashi T, ed), pp 55-99. New York: Plenum.
• Brown DA, Selyanko AA (1985) Membrane currents underlying the cholinergic slow excitatory post-synaptic potential in the rat sympathetic ganglion. J Physiol (Lond) 365:365-387[Abstract/Free Full Text].
• Brown DA, Marrion NV, Smart TG (1989) On the transduction mechanism for muscarine-induced inhibition of M-current in cultured rat sympathetic neurons. J Physiol (Lond) 413:469-488[Abstract/Free Full Text].
• Brown DA, Buckley NJ, Caulfield MP, Duffy SM, Jones S, Lamas JA, Marsh SJ, Robbins J, Selyanko AA (1995) Coupling of muscarinic acetylcholine receptors to neural ion channels: Closure of K⁺ channels. In: Molecular mechanisms of muscarinic acetylcholine receptor function (Wess J, ed), pp 165-182. Austin, TX: RG Landes.
• Caulfield MP, Jones S, Vallis Y, Buckley NJ, Kim G-D, Milligan G, Brown DA (1994) Muscarinic M-current inhibition via G_q/11 and -adrenoceptor inhibition of Ca²⁺ current via G_o in rat sympathetic neurones. J Physiol (Lond) 477:415-422[Abstract/Free Full Text].
• Clapham DE, Neer EJ (1997) G protein subunits. Annu Rev Pharmacol Toxicol 37:167-203[Web of Science][Medline].
• Conklin BR, Bourne HR (1993) Structural elements of G subunits that interact with G, receptors, and effectors. Cell 73:631-641[Web of Science][Medline].
• Conklin BR, Farfel Z, Lustig KD, Julius D, Bourne HR (1993) Substitution of three amino acids switches receptor specificity of G_q to that of G_i. Nature 363:274-276[Medline].
• Daaka Y, Pitcher JA, Richardson M, Stoffel RH, Robishaw JD, Lefkowitz RJ (1997) Receptor and G isoform-specific interactions with G protein-coupled receptor kinases. Proc Natl Acad Sci USA 94:2180-2185[Abstract/Free Full Text].
• Delmas P, Brown DA, Dayrell M, Abogadie FC, Caulfield MP, Buckley NJ (1998a) On the role of endogenous G-protein subunits in N-type Ca²⁺ current inhibition by neurotransmitters in rat sympathetic neurones. J Physiol (Lond) 506:319-329[Abstract/Free Full Text].
• Delmas P, Abogadie FC, Dayrell M, Haley JE, Milligan G, Caulfield MP, Brown DA, Buckley NJ (1998b) G-proteins and G-protein subunits mediating cholinergic inhibition of N-type calcium currents in sympathetic neurons. Eur J Neurosci 10:1654-1666[Web of Science][Medline].
• Dippel E, Kalkbrenner F, Wittig B, Schultz G (1996) A heterotrimeric G protein complex couples the muscarinic m1 receptor to phospholipase C-. Proc Natl Acad Sci USA 93:1391-1396[Abstract/Free Full Text].
• Gudermann T, Kalkbrenner F, Schultz G (1996) Diversity and selectivity of receptor-G protein interaction. Annu Rev Pharmacol Toxicol 36:429-459[Web of Science][Medline].
• Hepler JR, Kozasa T, Smrcka AV, Simon MI, Rhee SG, Sternweis PC, Gilman AG (1993) Purification from Sf9 cells and characterization of recombinant G_q and G₁₁. J Biol Chem 268:14367-14375[Abstract/Free Full Text].
• Hepler JR, Biddlecome GH, Kleuss C, Camp LA, Hofmann SL, Ross EM, Gilman AG (1996) Functional importance of the amino terminus of G_q. J Biol Chem 271:496-504[Abstract/Free Full Text].
• Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca²⁺ channels by G-protein subunits. Nature 380:258-262[Medline].
• Horn R, Marty A (1988) Muscarinic activation of ionic currents measured by a new whole-cell recording method. J Gen Physiol 92:145-159[Abstract/Free Full Text].
• Ikeda SR (1996) Voltage-dependent modulation of N-type calcium channels by G-protein subunits. Nature 380:255-258[Medline].
• Jhon D-Y, Lee H-H, Park D, Lee C-W, Lee K-H, Yoo OJ, Rhee SG (1993) Cloning, sequencing, purification, and G_q-dependent activation of phospholipase C-3. J Biol Chem 268:6654-6661[Abstract/Free Full Text].
• Jones S, Brown DA, Milligan G, Willer E, Buckley NJ, Caulfield MP (1995) Bradykinin excites rat sympathetic neurons by inhibition of M current through a mechanism involving B₂ receptors and G_q/11. Neuron 14:399-405[Web of Science][Medline].
• Koch WJ, Hawes BE, Inglese J, Luttrell LM, Lefkowitz RJ (1994) Cellular expression of the carboxyl terminus of a G protein-coupled receptor kinase attenuates G-mediated signaling. J Biol Chem 269:6193-6197[Abstract/Free Full Text].
• Lipinsky D, Gershengorn MC, Oron Y (1992) G₁₁ and G_q guanine nucleotide regulatory proteins differentially modulate the response to thyrotropin-releasing hormone in Xenopus oocytes. FEBS Lett 307:237-240[Web of Science][Medline].
• Macrez-Leprêtre N, Kalkbrenner F, Schultz G, Mironneau J (1997) Distinct functions of G_q and G₁₁ proteins in coupling ₁-adrenoreceptors to Ca²⁺ release and Ca²⁺ entry in rat portal vein myocytes. J Biol Chem 272:5261-5268[Abstract/Free Full Text].
• Marrion NV, Smart TG, Marsh SJ, Brown DA (1989) Muscarinic suppression of the M-current in the rat sympathetic ganglion is mediated by receptors of the M₁-subtype. Br J Pharmacol 98:557-573[Web of Science][Medline].
• Milligan G (1993) Regional distribution and quantitative measurement of the phosphoinositidase C-linked guanine nucleotide binding proteins G₁₁ and G_q in rat brain. J Neurochem 61:845-851[Web of Science][Medline].
• Milligan G, Mullaney I, McCallum JF (1993) Distribution and relative levels of expression of the phosphoinositidase-C-linked G-proteins G_q and G₁₁: absence of G₁₁ in human platelets and haemopoietically derived cell lines. Biochim Biophys Acta 1179:208-212[Medline].
• Milligan G, Parenti M, Magee AI (1995) The dynamic role of palmitoylation in signal transduction. Trends Biol Sci 20:181-186.
• Nakamura F, Kato M, Kameyama K, Nukada T, Haga T, Kato H, Takenawa T, Kikkawa U (1995) Characterization of G_q family G proteins G_L1 (G₁₄), G_L2 (G₁₁), and G_q expressed in the baculovirus-insect cell system. J Biol Chem 270:6246-6253[Abstract/Free Full Text].
• Neubig RR (1994) Membrane organization in G-protein mechanisms. FASEB J 8:939-946[Abstract].
• Phillips MI, Gyurko R (1997) Antisense oligonucleotides: new tools for physiology. News Physiol Sci 12:99-105.[Abstract/Free Full Text]
• Rae J, Cooper K, Gates P, Watsky M (1991) Low access resistance perforated patch recordings using amphotericin B. J Neurosci Methods 37:15-26[Web of Science][Medline].
• Schaeren-Wiemers N, Gerfin-Moser A (1993) A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry 100:431-440[Web of Science][Medline].
• Shapira H, Way J, Lipinsky D, Oron Y, Battey JF (1994) Neuromedin B receptor, expressed in Xenopus laevis oocytes, selectively couples to G_q and not G₁₁. FEBS Lett 348:89-92[Web of Science][Medline].
• Shapiro MS, Wollmuth LP, Hille B (1994) Angiotensin II inhibits calcium and M current channels in rat sympathetic neurons via G proteins. Neuron 12:1319-1329[Web of Science][Medline].
• Stehno-Bittel L, Krapivinsky G, Krapivinsky L, Perez-terzic C, Clapham DE (1995) The G protein subunit transduces the muscarinic receptor signal for Ca²⁺ release in Xenopus oocytes. J Biol Chem 270:30068-30074[Abstract/Free Full Text].
• Strathmann M, Simon MI (1990) G protein diversity: a distinct class of  subunits is present in vertebrates and invertebrates. Proc Natl Acad Sci USA 87:9113-9117[Abstract/Free Full Text].
• Taylor SJ, Chae HZ, Rhee SG, Exton JH (1991) Activation of the 1 isozyme of phospholipase C by  subunits of the G_q class of G proteins. Nature 350:516-518[Medline].
• Umemori H, Inoue T, Kume S, Sekiyama N, Nagao M, Itoh H, Nakanishi S, Mikoshiba K, Yamamoto T (1997) Activation of the G protein Gq/11 through tyrosine phosphorylation of the  subunit. Science 276:1878-1881[Abstract/Free Full Text].
• Wang H-S, McKinnon D (1995) Potassium currents in rat prevertebral and paravertebral sympathetic neurones: control of firing properties. J Physiol (Lond) 485:319-335[Abstract/Free Full Text].
• Wickman K, Clapham DE (1995) Ion channel regulation by G proteins. Physiol Rev 75:865-885[Abstract/Free Full Text].
• Wong YH, Conklin BR, Bourne HR (1992) G_Z-mediated hormonal inhibition of cyclic AMP accumulation. Science 255:339-342[Abstract/Free Full Text].
• Wu D, Lee C-H, Rhee SG, Simon MI (1992a) Activation of phospholipase C by the  subunits of the G_q and G₁₁ proteins in transfected Cos-7 cells. J Biol Chem 267:1811-1817[Abstract/Free Full Text].
• Wu D, Katz A, Lee C-H, Simon MI (1992b) Activation of phospholipase C by ₁-adrenergic receptors is mediated by the  subunits of Gq family. J Biol Chem 267:25798-25802[Abstract/Free Full Text].

---

Copyright © 1998 Society for Neuroscience  0270-6474/98/18124521-11$05.00/0

This article has been cited by other articles:

				J. E. Lauckner, J. B. Jensen, H.-Y. Chen, H.-C. Lu, B. Hille, and K. Mackie GPR55 is a cannabinoid receptor that increases intracellular calcium and inhibits M current PNAS, February 19, 2008; 105(7): 2699 - 2704. [Abstract] [Full Text] [PDF]

				A. Yaradanakul, S. Feng, C. Shen, V. Lariccia, M.-J. Lin, J. Yang, Kang T. M., P. Dong, H. L. Yin, J. P. Albanesi, et al. Dual control of cardiac Na+ Ca2+ exchange by PIP2: electrophysiological analysis of direct and indirect mechanisms J. Physiol., August 1, 2007; 582(3): 991 - 1010. [Abstract] [Full Text] [PDF]

				O. Zaika, L. S. Lara, N. Gamper, D. W. Hilgemann, D. B. Jaffe, and M. S. Shapiro Angiotensin II regulates neuronal excitability via phosphatidylinositol 4,5-bisphosphate-dependent modulation of Kv7 (M-type) K+ channels J. Physiol., August 15, 2006; 575(1): 49 - 67. [Abstract] [Full Text] [PDF]

				J. Robbins, S. J. Marsh, and D. A. Brown Probing the regulation of M (Kv7) potassium channels in intact neurons with membrane-targeted peptides. J. Neurosci., July 26, 2006; 26(30): 7950 - 7961. [Abstract] [Full Text] [PDF]

				P. J. Atkinson, K. W. Young, S. J. Ennion, J. N. C. Kew, S. R. Nahorski, and R. A. J. Challiss Altered Expression of Gq/11{alpha} Protein Shapes mGlu1 and mGlu5 Receptor-Mediated Single Cell Inositol 1,4,5-Trisphosphate and Ca2+ Signaling Mol. Pharmacol., January 1, 2006; 69(1): 174 - 184. [Abstract] [Full Text] [PDF]

				K. Nakajo and Y. Kubo Protein kinase C shifts the voltage dependence of KCNQ/M channels expressed in Xenopus oocytes J. Physiol., November 15, 2005; 569(1): 59 - 74. [Abstract] [Full Text] [PDF]

				J. S. Winks, S. Hughes, A. K. Filippov, L. Tatulian, F. C. Abogadie, D. A. Brown, and S. J. Marsh Relationship between Membrane Phosphatidylinositol-4,5-Bisphosphate and Receptor-Mediated Inhibition of Native Neuronal M Channels J. Neurosci., March 30, 2005; 25(13): 3400 - 3413. [Abstract] [Full Text] [PDF]

				A. K. Filippov, J. M. Fernandez-Fernandez, S. J. Marsh, J. Simon, E. A. Barnard, and D. A. Brown Activation and Inhibition of Neuronal G Protein-Gated Inwardly Rectifying K+ Channels by P2Y Nucleotide Receptors Mol. Pharmacol., September 1, 2004; 66(3): 468 - 477. [Abstract] [Full Text] [PDF]

				W. Hirdes, L. F. Horowitz, and B. Hille Muscarinic modulation of erg potassium current J. Physiol., August 15, 2004; 559(1): 67 - 84. [Abstract] [Full Text] [PDF]

				M. S. Shapiro Why Biophysicists Make Models: Quantifying Modulation of the M Current J. Gen. Physiol., June 1, 2004; 123(6): 657 - 662. [Full Text] [PDF]

				B.-C. Suh, L. F. Horowitz, W. Hirdes, K. Mackie, and B. Hille Regulation of KCNQ2/KCNQ3 Current by G Protein Cycling: The Kinetics of Receptor-mediated Signaling by Gq J. Gen. Physiol., June 1, 2004; 123(6): 663 - 683. [Abstract] [Full Text] [PDF]

				S. G Lechner, M. Mayer, and S. Boehm Activation of M1 muscarinic receptors triggers transmitter release from rat sympathetic neurons through an inhibition of M-type K+ channels J. Physiol., December 15, 2003; 553(3): 789 - 802. [Abstract] [Full Text] [PDF]

				N. Gamper and M. S. Shapiro Calmodulin Mediates Ca2+-dependent Modulation of M-type K+ Channels J. Gen. Physiol., June 30, 2003; 122(1): 17 - 31. [Abstract] [Full Text] [PDF]

				C. P. Ford, P. L. Stemkowski, P. E. Light, and P. A. Smith Experiments to Test the Role of Phosphatidylinositol 4,5-Bisphosphate in Neurotransmitter-Induced M-Channel Closure in Bullfrog Sympathetic Neurons J. Neurosci., June 15, 2003; 23(12): 4931 - 4941. [Abstract] [Full Text] [PDF]

				P. J. Kammermeier, M. I. Davis, and S. R. Ikeda Specificity of Metabotropic Glutamate Receptor 2 Coupling to G Proteins Mol. Pharmacol., January 1, 2003; 63(1): 183 - 191. [Abstract] [Full Text] [PDF]

				J. Guo and G. G Schofield Activation of a PTX-insensitive G protein is involved in histamine-induced recombinant M-channel modulation J. Physiol., December 15, 2002; 545(3): 767 - 781. [Abstract] [Full Text] [PDF]

				J. Simon, A. K. Filippov, S. Goransson, Y. H. Wong, C. Frelin, A. D. Michel, D. A. Brown, and E. A. Barnard Characterization and Channel Coupling of the P2Y12 Nucleotide Receptor of Brain Capillary Endothelial Cells J. Biol. Chem., August 23, 2002; 277(35): 31390 - 31400. [Abstract] [Full Text] [PDF]

				N. J. Brandon, J. N. Jovanovic, T. G. Smart, and S. J. Moss Receptor for Activated C Kinase-1 Facilitates Protein Kinase C-Dependent Phosphorylation and Functional Modulation of GABAA Receptors with the Activation of G-Protein-Coupled Receptors J. Neurosci., August 1, 2002; 22(15): 6353 - 6361. [Abstract] [Full Text] [PDF]

				T. Scholze, E. Moskvina, M. Mayer, H. Just, H. Kubista, and S. Boehm Sympathoexcitation by Bradykinin Involves Ca2+-Independent Protein Kinase C J. Neurosci., July 15, 2002; 22(14): 5823 - 5832. [Abstract] [Full Text] [PDF]

				P. L. Stemkowski, F. W. Tse, V. Peuckmann, C. P. Ford, W. F. Colmers, and P. A. Smith ATP-Inhibition of M Current in Frog Sympathetic Neurons Involves Phospholipase C But Not Ins P3, Ca2+, PKC, or Ras J Neurophysiol, July 1, 2002; 88(1): 277 - 288. [Abstract] [Full Text] [PDF]

				P. Delmas, H. Nomura, X. Li, M. Lakkis, Y. Luo, Y. Segal, J. M. Fernandez-Fernandez, P. Harris, A.-M. Frischauf, D. A. Brown, et al. Constitutive Activation of G-proteins by Polycystin-1 Is Antagonized by Polycystin-2 J. Biol. Chem., March 22, 2002; 277(13): 11276 - 11283. [Abstract] [Full Text] [PDF]

				M. Krause, S. Offermanns, M. Stocker, and P. Pedarzani Functional Specificity of Galpha q and Galpha 11 in the Cholinergic and Glutamatergic Modulation of Potassium Currents and Excitability in Hippocampal Neurons J. Neurosci., February 1, 2002; 22(3): 666 - 673. [Abstract] [Full Text] [PDF]

				K. Melliti, U. Meza, and B. A Adams RGS2 blocks slow muscarinic inhibition of N-type Ca2+ channels reconstituted in a human cell line J. Physiol., April 15, 2001; 532(2): 337 - 347. [Abstract] [Full Text] [PDF]

				A. H. Li, H.-M. Hwang, P. P. Tan, T. Wu, and H.-L. Wang Neurotensin Excites Periaqueductal Gray Neurons Projecting to the Rostral Ventromedial Medulla J Neurophysiol, April 1, 2001; 85(4): 1479 - 1488. [Abstract] [Full Text] [PDF]

				D. F Boyd, J. A Millar, C. S Watkins, and A. Mathie The role of Ca2+ stores in the muscarinic inhibition of the K+ current IK(SO) in neonatal rat cerebellar granule cells J. Physiol., December 1, 2000; 529(2): 321 - 331. [Abstract] [Full Text] [PDF]

				P. J. Kammermeier, B. Xiao, J. C. Tu, P. F. Worley, and S. R. Ikeda Homer Proteins Regulate Coupling of Group I Metabotropic Glutamate Receptors to N-Type Calcium and M-Type Potassium Channels J. Neurosci., October 1, 2000; 20(19): 7238 - 7245. [Abstract] [Full Text] [PDF]

				J. E. Haley, P. Delmas, S. Offermanns, F. C. Abogadie, M. I. Simon, N. J. Buckley, and D. A. Brown Muscarinic Inhibition of Calcium Current and M Current in Galpha q-Deficient Mice J. Neurosci., June 1, 2000; 20(11): 3973 - 3979. [Abstract] [Full Text] [PDF]

				E. Bofill-Cardona, N. Vartian, C. Nanoff, M. Freissmuth, and S. Boehm Two Different Signaling Mechanisms Involved in the Excitation of Rat Sympathetic Neurons by Uridine Nucleotides Mol. Pharmacol., June 1, 2000; 57(6): 1165 - 1172. [Abstract] [Full Text]

				M. S. Shapiro, J. P. Roche, E. J. Kaftan, H. Cruzblanca, K. Mackie, and B. Hille Reconstitution of Muscarinic Modulation of the KCNQ2/KCNQ3 K+ Channels That Underlie the Neuronal M Current J. Neurosci., March 1, 2000; 20(5): 1710 - 1721. [Abstract] [Full Text] [PDF]

				A A Selyanko, J K Hadley, I C Wood, F C Abogadie, T J Jentsch, and D A Brown Inhibition of KCNQ1-4 potassium channels expressed in mammalian cells via M1 muscarinic acetylcholine receptors J. Physiol., February 1, 2000; 522(3): 349 - 355. [Abstract] [Full Text] [PDF]

				E. del Rio, J. A Bevilacqua, S. J Marsh, P. Halley, and M. P Caulfield Muscarinic M1 receptors activate phosphoinositide turnover and Ca2+ mobilisation in rat sympathetic neurones, but this signalling pathway does not mediate M-current inhibition J. Physiol., October 1, 1999; 520(1): 101 - 111. [Abstract] [Full Text] [PDF]

				M. S. Shapiro, M. D. Loose, S. E. Hamilton, N. M. Nathanson, J. Gomeza, J. Wess, and B. Hille Assignment of muscarinic receptor subtypes mediating G-protein modulation of Ca2+ channels by using knockout mice PNAS, September 14, 1999; 96(19): 10899 - 10904. [Abstract] [Full Text] [PDF]

				P. Delmas, F. C Abogadie, G. Milligan, N. J Buckley, and D. A Brown {beta}{gamma} dimers derived from Go and Gi proteins contribute different components of adrenergic inhibition of Ca2+ channels in rat sympathetic neurones J. Physiol., July 1, 1999; 518(1): 23 - 36. [Abstract] [Full Text] [PDF]

				S.-W. Jeong and S. R. Ikeda Sequestration of G-Protein beta gamma Subunits by Different G-Protein alpha  Subunits Blocks Voltage-Dependent Modulation of Ca2+ Channels in Rat Sympathetic Neurons J. Neurosci., June 15, 1999; 19(12): 4755 - 4761. [Abstract] [Full Text] [PDF]

				J. E. Haley, F. C. Abogadie, J. M. Fernandez-Fernandez, M. Dayrell, Y. Vallis, N. J. Buckley, and D. A. Brown Bradykinin, But Not Muscarinic, Inhibition of M-Current in Rat Sympathetic Ganglion Neurons Involves Phospholipase C-beta 4 J. Neurosci., November 1, 2000; 20(21): RC105 - RC105. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (60) Citing Articles via Google Scholar Google Scholar Articles by Haley, J. E. Articles by Buckley, N. J. Search for Related Content PubMed PubMed Citation Articles by Haley, J. E. Articles by Buckley, N. J.

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help