 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 1998, 18(16):6331-6339
Innervation and Target Tissue Interactions Induce Rab-GDP
Dissociation Inhibitor (GDI) Expression during Peripheral Synapse
Formation in Developing Chick Ciliary Ganglion Neurons In
Situ
Ognian C.
Ikonomov1,
Marianne C.
Kulesa1,
Assia
C.
Shisheva2, and
Michele H.
Jacob1
1 Worcester Foundation for Biomedical Research,
Shrewsbury, Massachusetts 01545, and 2 Program in Molecular
Medicine, Department of Biochemistry and Molecular Biology, University
of Massachusetts Medical Center, Worcester, Massachusetts 01605
 |
ABSTRACT |
Regulated exocytosis of neurotransmitter from synaptic vesicles
involves the function of a small GTP-binding protein, Rab3A. Rab-GDP dissociation inhibitor (GDI) is an important modulator of Rab
function and subcellular distribution. We have characterized the
respective roles of innervation and target tissue interactions in
regulating GDI expression during synapse formation in chick ciliary
ganglion (CG) neurons developing in situ. Here we report the first full-length chick GDI cDNA sequence. It is highly homologous to mammalian GDI isoforms and includes all of the sequence-conserved regions critical for Rab3A binding. This chick GDI mRNA is
predominantly expressed in neurons as judged by Northern blot analysis
of tissue distribution and by in situ hybridization of
CG sections. Developmental increases in CG GDI mRNA levels occur in two
phases as determined by reverse transcription (RT)-PCR and by
Northern analysis of both normal-developing and input- or target
tissue-deprived ganglia. The initial phase appears to be independent of
cell-cell interactions. In contrast, the second, larger increase is
induced by both presynaptic inputs and postganglionic target tissues
but does not occur until target tissue innervation. Synaptic
interaction with the target seems necessary for the regulatory response
to both inputs and target tissues. GDI protein levels show similar
changes. The developmentally delayed ability of inputs and targets to
influence GDI levels differs from the regulation of neurotransmitter
receptor expression in CG neurons. These results suggest that distinct
extrinsic regulatory signals influence the expression of
synapse-related components at the presynaptic axon terminal versus
postsynaptic membrane in an individual neuron.
Key words:
chick Rab-GDP dissociation inhibitor (GDI); embryonic
chick ciliary ganglion; neuronal synapse formation; neuron-specific
gene expression; induction; regulation; innervation; target tissue
interactions; presynaptic terminal differentiation; synaptic vesicle
exocytosis
 |
INTRODUCTION |
Synapses are specialized
contact sites between neurons and their targets that function in
intercellular communication. In vivo cellular and molecular
mechanisms that regulate neuronal synapse formation are primarily
undefined. Neurons engage in two distinct types of synaptic
interactions; they receive innervation and form synapses on target
tissues. An individual neuron must differentiate both postsynaptic and
presynaptic specializations that are composed of some similar, as well
as numerous distinct, proteins (Apel and Merlie, 1995 ; Burns and
Augustine, 1995 ; Sudhof, 1995 ). Synapse formation and maintenance
depend on appropriate developmental expression of multiple genes and
trafficking of the encoded proteins to the proper region, which is the
specialized postsynaptic membrane of the soma and dendrites or the
axonal presynaptic terminal. Expression of synapse-associated genes may be controlled by an intrinsic differentiation program as well as by
extrinsic signals derived from the pre- and postsynaptic tissues.
The chick parasympathetic ciliary ganglion (CG) is uniquely well-suited
for defining the separate roles of inputs and target tissues in
regulating neuronal gene expression during synaptogenesis in
vivo because of the feasibility of surgical manipulations that selectively prevent these interactions. Taking this approach, we have
shown that innervation and target tissues have unique, as well as
redundant, regulatory effects on the expression of a postsynaptic
membrane component, nicotinic acetylcholine receptor (nAChR) subunits
(Levey et al., 1995 ). nAChRs mediate excitatory synaptic transmission
in the CG.
Retrograde signals from the target tissues may also influence
presynaptic terminal differentiation. During normal development, increases in mRNA levels for several presynaptic proteins, including soluble N-ethyl maleimide-sensitive factor attachment
protein 25, synaptotagmin I, synaptophysin IIa and IIb,
Rab3A, and Rab-GDP dissociation inhibitor (GDI), correlate with
axon terminal differentiation and target tissue innervation (Catsicas
et al., 1991 ; Motoike et al., 1993 ; Lou and Bixby, 1995 ). These
proteins function in the regulated exocytosis of synaptic vesicles. For
example, GDI regulates the subcellular distribution and function of
Rabs, a family of GTPases that regulate vesicular membrane trafficking (Pfeffer et al., 1995 ; Schalk et al., 1996 ). Rabs cycle between an
active GTP-bound, specific membrane-associated form and an inactive
GDP-bound cytosolic state. GDI forms a stable soluble complex with
Rab-GDP. Thus, GDI plays an important role in recycling Rabs between
the cytoplasm and target membranes. In neurons, GDI recycles Rab3A,
which associates specifically with synaptic vesicles (Fischer von
Mollard et al., 1992 ). Rab3A regulates the efficiency of
Ca2+-triggered exocytotic fusion of synaptic
vesicles with the presynaptic terminal membrane (Castillo et al., 1997 ;
Geppert et al., 1997 ). Although mRNA levels of the indicated
presynaptic proteins increase during peripheral synaptogenesis, the
respective role of innervation and target tissues in regulating their
expression is not known.
In this paper, we define the in vivo regulatory
effects of inputs and target tissues on GDI expression in the embryonic
chick CG. We report the first chick GDI cDNA full-length sequence and establish that this isoform is predominantly expressed in neurons. We
show that both innervation and target tissues induce increases in GDI
mRNA and protein levels, but at a later developmental stage of synapse
formation than that at which the inductive effects on nAChRs, which
function in the postsynaptic membrane, are seen.
 |
MATERIALS AND METHODS |
Chick embryos, staging, and surgical manipulations.
White Leghorn embryonated chick eggs (Spafas, Norwich, CT) were
incubated at 37°C in a forced-draft turning incubator until use.
Embryos were staged according to the classification scheme of Hamburger and Hamilton (1951) . Surgical micromanipulations to prevent
preganglionic innervation or postganglionic target tissue interactions
were performed as described in detail previously (Arenella et al., 1993 ; Dourado et al., 1994 ). Briefly, the sole source of presynaptic input, the accessory oculomotor nucleus, was ablated at embryonic day 4 (E4), or the developing optic vesicle, which contains the target
muscles, was unilaterally removed at E2, all before synaptogenesis. To
obtain ganglia deprived of both innervation and target tissues, we
removed the developing eye at E2 and the preganglionic nucleus at E4 in
the same embryo (Levey et al., 1995 ). To ensure the complete removal of
pre- and postganglionic tissues, we dissected ganglia only from embryos
lacking visible preganglionic connections to the CG and residual eye
structures. The complete removal of all preganglionic neurons and the
absence of aberrant innervation from other sources or intraganglionic
contacts were established by paraffin histological examination of the
brain of operated embryos, by immunocytochemical labeling with
monoclonal antibodies to synaptic vesicle antigens, and by
ultrastructural analysis (Engisch and Fischbach, 1992 ; Arenella et al.,
1993 ). CGs from normal-developing, operated, and sham-operated embryos
were dissected at selected stages of synapse formation, ranging from
E4.5 to E19. CGs and other dissected tissues were immediately frozen on dry ice and stored at 80°C until use for reverse transcription (RT)-PCR or for Northern or Western blot analysis.
Isolation and sequencing of full-length chick GDI
cDNA. Mouse GDI-2 primers (Shisheva et al., 1994 ) that target the
coding region 5'-end were used to generate chick GDI cDNA by RT-PCR
amplification of CG total RNA. The identity of the PCR product as GDI
was confirmed by sequencing. Two cDNAs that are highly homologous to
mammalian GDIs were isolated, having sizes of 373 and 975 bp. The 975 bp GDI cDNA contained the smaller 373 bp sequence at its 5'-end. The
two products were obtained, instead of one, because of the unforeseen
ability of the mouse antisense primer to anneal to two regions in the
chick GDI sequence.
The larger GDI cDNA was used as a probe to screen a total of 500,000 plaques from a White Leghorn E18 chick CG cDNA library constructed in
gt10 (kindly provided by Dr. Tom Boyd, Ohio State University) by the
use of standard procedures (Sambrook et al., 1989 ). Seven positive
plaques were identified. They all showed the same insert size (2.3 kb)
after PCR amplification with primers recognizing the phage polylinker
sequence. The cDNA was subcloned (PCR 2.1 cloning vector; Invitrogen,
San Diego, CA) as a full-length sequence and as smaller clones by
taking advantage of convenient restriction sites. Sequence analysis was
performed by using the dideoxy chain-termination method with SP6 and T7
promoter primers [Sequenase Version 2.0 DNA sequencing kit (Sanger et
al., 1977 )]. A full-length chick GDI sequence, including 5'- and
3'-untranslated regions (UTRs) (2.3 kb), was isolated (see Fig.
1).
To test for GDI isoforms, we rescreened the embryonic chick CG cDNA
library at lower stringency (50°C as opposed to a washing temperature
of 60°C) with a coding region probe [nucleotides (nt) 111-1457 of the chick GDI sequence]. The filters were then stripped and hybridized to a radiolabeled chick GDI 3'-UTR probe (nt
1555-1994). Nucleotide and predicted amino acid sequences were tested
for homology to known sequences in the DNA and protein databases of the
National Center for Biotechnology Information by Blast search.
Northern blot analysis. Total CG RNA was extracted by three
different scaled-down guanidinium thiocyanate protocols (Feramisco et
al., 1982 ; Chomczynski, 1993 ; Levey et al., 1995 ), separated by agarose
gel electrophoresis (Sambrook et al., 1989 ), and transferred to nylon
membrane (Zeta-probe) by alkaline blotting. Filters were hybridized
with cDNA probes, which were labeled with [ -32P]dCTP
to high specific activity by random priming (Life Technologies, Gaithersburg, MD) and purified using Chroma Spin-100 columns (Clontech, Cambridge, UK). Hybridization and washing conditions were as specified by the membrane manufacturer (Bio-Rad, Hercules, CA). The coding region
and 3'-UTR probes were identical to those used for the cDNA library
screening. For quantitation, signals in the different lanes were
compared by densitometric scanning (PDI densitometer; Protein DNA Image
Ware Systems, Huntington Station, NY) and normalized to the
signal obtained after stripping the filter and rehybridizing it with a
chick 18S ribosomal cDNA (375 bp) probe.
Relative RT-PCR. In addition to Northern blot analysis,
relative RT-PCR was used to measure GDI mRNA levels in total RNA
extracted from CGs of normal-developing, operated, and sham-operated
embryos, using an amount of RNA equivalent to that present in a single CG. Two different sets of specific primers were used to amplify different segments of the GDI coding sequence. The first specific pair
(5'-primer, atgaatgaggagtacgacgtg; 3'-primer, CTGcagtggaaggaactttg) amplified a 367 bp sequence from the beginning of the coding region (nt
111-477). The second pair [5'-primer, CCGgatatctacgtctgcatg; 3'-primer, CCGTCTAGAttactgctgctcctcctc (with the sequence in capital letters improving primer efficiency and/or providing a convenient restriction site for cloning)] amplified a 357 bp sequence from the
end of the coding sequence (nt 1101-1457). RT-PCR was done as
described previously (Levey et al., 1995 ; Ikonomov and Jacob, 1996 )
with the exception of two modifications that were introduced to improve
priming specificity. First, reverse transcription was performed using
Superscript II RNase H-reverse transcriptase (Life Technologies) and a
higher temperature (50°C instead of 42°C). Second, the
PCR-annealing temperature was increased to 63°C. This optimized
protocol resulted in a single band corresponding to the targeted-GDI
sequence with either set of primer pairs. Amplification products were
separated by agarose gel electrophoresis and stained with ethidium
bromide. The identity of the PCR product as GDI was confirmed by
restriction endonuclease mapping and by the sequencing of six
minipreps.
To account for changes in neuron number caused by the surgical
manipulations, we normalized GDI mRNA levels per CG to those of
c 4-tubulin mRNA. The levels of this neuron-specific transcript are
not significantly affected by the absence of synaptic interactions (Levey et al., 1995 ). Aliquots of the same CG total RNA were
simultaneously amplified with c 4-tubulin-specific primers. Care was
taken to remain in the linear phase of amplification for both
sequences. Usually, 20 cycles were used for c 4-tubulin, whereas 30 cycles were used to amplify GDI mRNA. For quantitation, PCR was
performed in the presence of [ -32P]dCTP, and the
radiolabeled PCR products were separated on a 2% agarose gel. Visible
bands, as well as corresponding areas of gel from control lanes
(samples minus reverse transcriptase), were excised and transferred
into liquid scintillator (5 ml), and their radioactivity was counted in
a liquid scintillation analyzer (Tri-carb 2250CA; Packard, Meridian,
CT). The ratio between the amount of GDI cDNA in the test versus
control sample for chick GDI was normalized to the ratio for
c 4-tubulin.
In situ hybridization. To establish the cellular
distribution of GDI mRNA in the CG, we processed E14-E19 ganglia for
in situ hybridization as described previously (Boyd et al.,
1988 , 1991 ). The only modification is the use of digoxigenin-labeled
cRNA probes instead of 35S-labeled probes. Briefly, CGs
were fixed with 4% paraformaldehyde in 0.1 M PBS, pH 7.4, overnight at 4°C and were embedded in paraffin. Sections (8 µm
thick) were cut on a Reichert-Jung Biocut microtome and mounted on
glass slides coated with 2% 3-aminopropyltriethoxy-silane (Sigma, St.
Louis, MO). Sections were treated with proteinase K, acetylated with
0.25% acetic anhydride, dehydrated with ethanol, prehybridized,
hybridized with probe at a concentration of 1-2 µg/ml, treated with
RNase, and washed with SSC. Digoxigenin-labeled sense and antisense
cRNA probes corresponding to either 213 bp of the 3'-UTR (nt
1555-1767) or 367 bp of coding region (nt 111-477) were
synthesized using a linearized cloning vector containing the
appropriate insert and SP6 or T7 RNA polymerase binding sites, respectively, according to the recommended manufacturer's protocol (Genius 4 RNA labeling kit; Boehringer Mannheim, Indianapolis, IN).
After RNase treatment and SSC washing, CG sections were preincubated with 10% normal goat serum (Sigma) for 1 hr and then incubated in
anti-digoxigenin antibody conjugated with alkaline phosphatase (Boehringer Manheim) at a 1:500 dilution for 1 hr. To localize the
bound alkaline phosphatase, we incubated sections overnight in
nitroblue tetrazolium chloride (0.33 mg/ml) and
5-bromo-4-chloro-3-indolylphosphate 4-toluidine salt (0.16 mg/ml) in
0.1 M Tris buffer, pH 9.5, containing 0.1 M
NaCl and 5 mM MgCl2 (Fields-Berry et al.,
1992 ), rinsed the sections with 0.1 M PBS, followed by 0.01 M Tris and 0.02 M EDTA buffer, mounted the
sections with coverslips, and viewed them by bright-field microscopy
(Zeiss Axioskop).
Myc-tagged chick GDI protein expression in cos-7 cells. For
expression studies of chick GDI protein, cos-7 cells (kindly
provided by Dr. Alonzo Ross, Worcester Foundation for Biomedical
Research) were transfected with myc-tagged GDI coding sequence. A myc
tag (encoding the peptide epitope EQKLISEEDL) was attached to the 3'-end of the chick GDI coding sequence using PCR. PCR primers were
also used to add restriction sites (EcoRI and
XbaI to the 5'- and 3'-ends of the GDI-myc sequence,
respectively) for cloning in PCMV5 transfection vector. In addition,
the primers were designed to eliminate an EcoRV restriction
site at the 3'-end of GDI by changing a single bp (nt 1435) from T to
C, which does not create an amino acid change but reduces the number of
restriction digestion fragments generated during construction of the
myc-tagged GDI sequence. The presence of only the desired sequence
changes in the PCR product was verified by sequencing. The GDI 5'-end
fragment digested with EcoRI-HindIII and the
myc-tagged 3'-end fragment digested with
EcoRV-XbaI were ligated to the middle section of the chick GDI coding region, which was isolated by
HindIII-EcoRV digestion of full-length GDI. The
resulting construct was cloned into
EcoRI-XbaI-digested PCMV5 vector.
Cos-7 cells were maintained in DMEM supplemented with 10% fetal
bovine serum, 2 mM glutamine, and 100 µg/ml gentamycin,
in a humidified 5% CO2 incubator at 37°C. For
transfections, the cells, at a plating density of 1-2 × 105 per ml, were grown overnight in a six-well
culture plate and then incubated with either 2 µg of plasmid DNA
containing the chick GDI myc-tagged construct, chick GDI without the
myc tag, or mouse GDI-2 myc-tagged construct (Shisheva et al., 1994 )
or of PCMV5 plasmid-lacking insert, together with 2 or 20 µl
of Lipofectin Reagent (Life Technologies) in 1 ml of serum-free medium
for 6 hr, according to the manufacturer's instructions. The medium was then replaced with 2.0 ml of normal growth medium, and the cells were
harvested 60 hr later. The apparent electrophoretic mobility of the
protein encoded by the chick GDI sequence was determined by Western
blot analysis.
Western blot analysis. GDI protein levels in CGs from
operated and control embryos were compared by immunoblotting. Frozen CGs were homogenized at 4°C in 20 mM HEPES buffer, pH
7.4, containing 1 mM EDTA, 250 mM sucrose, and
a protease inhibitor cocktail (1 mM phenylmethylsulfonyl
fluoride, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 µg/ml
pepstatin), incubated for 5 min on ice, and centrifuged for 15 min at
16,000 × g. Aliquots of the cytosol fraction, set to
correspond to an equal number of neurons (Levey et al., 1995 ), were
solubilized in Laemmli buffer (Laemmli, 1970 ) and separated on 10%
polyacrylamide gels by SDS-PAGE. After transfer to polyvinylidene fluoride membrane (Immobilon-P; Millipore, Bedford, MA), blots were saturated with blocking buffer using previously specified conditions (Shisheva et al., 1994 ) and were incubated with anti-mouse GDI or anti-myc antibodies. Anti-mouse GDI-2 rabbit polyclonal antibody
(Shisheva et al., 1994 ) was used at a 1:10,000 dilution to detect chick
GDI because 15 amino acids of the chick sequence are identical to the
mouse 18 amino acid peptide (amino acids 387-404) used to generate the
pAb. Mouse anti-myc mAb American Type Culture Collection (ATCC) 1729 (ATCC, Rockville, MD) (Munro and Pelham, 1988 ) was used to detect the
myc-tagged GDI protein. After washing the blots with Tris-buffered
saline containing 0.1% Tween-20, bound antibodies were detected using
horseradish peroxidase-conjugated secondary antibody (anti-rabbit or
anti-mouse IgG for GDI or myc primary antibody, respectively) and
chemiluminescence (Renaissance kit; DuPont, Billerica, MA).
Immunoreactivity was quantified by densitometric scanning of the
protein bands, after selecting exposure times within the linear range
of the x-ray film.
 |
RESULTS |
Chick GDI cDNA is highly homologous to mammalian GDI sequences in
the coding regions but has unique 5'- and 3'-UTRs
The full-length chick GDI cDNA clone was isolated from an E18
chick CG cDNA library constructed in gt10 (generously provided by
Dr. Tom Boyd, Ohio State University). The probe used to screen the
library was a 975 bp chick GDI cDNA generated by RT-PCR amplification of CG total RNA using mouse GDI-2 specific primers (see Materials and
Methods) (Shisheva et al., 1994 ). A 2.3 kb clone was obtained. Subcloning and DNA sequencing identified a contiguous open reading frame of 1345 nucleotides, which is flanked by 110 nucleotides of
5'-untranslated sequence and 831 nucleotides of 3'-untranslated sequence (Fig. 1). The initiation codon
is preceded by a consensus sequence that fulfills the criteria of a
eukaryotic translation start site (Kozak, 1987 ). The coding region
shows high homology (ranging from 75 to 82% identity at the nucleotide
level) to the coding sequences of mammalian GDI isoforms (Table
1). In contrast, the 5'- and 3'-UTRs of
chick GDI have no significant homology with the mammalian sequences.
GDI is a highly conserved protein in eukaryotes from yeast to human,
having been cloned and characterized in yeast, plants, nematode, fruit
fly, and several mammalian species, including bovine, rodent, and human
(Matsui et al., 1990 ; Zahner and Cheney, 1993 ; Garret et al.,
1994 ; Nishimura et al., 1994 , 1995 ; Sedlacek et al., 1994 ; Shisheva et
al., 1994 ; Yang et al., 1994 ; Araki et al., 1995 ; Bachner et al., 1995 ;
Janoueix-Lerosey et al., 1995 ; Zarsky et al., 1997 ). In mammals, up to
three GDI isoforms have been characterized; these are GDI-1/ , GDI-2,
and GDI- . The isoforms are encoded by highly homologous but distinct genes. For example, in the mouse, GDI- shows 75% sequence identity with GDI-1/ and 88% sequence identity with GDI-2 at the nucleotide level, but the isoforms have distinct 5'- and 3'-UTRs (Janoueix-Lerosey et al., 1995 ; D. Post and A. C. Shisheva, unpublished
observations). In comparison, there appears to be only one predominant
GDI isoform expressed in the embryonic chick CG. Using low-stringency
conditions, we isolated 32 additional plaques by screening the CG cDNA
library, and they all correspond to this isoform.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 1.
Nucleotide and protein sequences of chick GDI.
Full-length chick GDI cDNA has a contiguous open reading frame of 1345 nucleotides. The deduced amino acid sequence is indicated
below the codons. An asterisk denotes the
3'-terminal stop codon. The GDI cDNA encodes a protein of 448 residues,
with a calculated, unglycosylated molecular mass of 50,681 Da. Chick
GDI is one amino acid longer than mammalian GDI-1/ and three amino
acids longer than GDI-2 and GDI- at the 3'-end of the coding region.
The chick sequence has been identified as belonging to the GDI gene
family because of high homology with the coding regions of mammalian
GDI isoforms (see Table 1) and the presence of the conserved amino
acids essential for Rab3A binding [tyrosine, glutamate, arginine,
threonine, and methionine at positions 39, 233, 240, 248, and 250, respectively (Schalk et al., 1996 )]. In contrast, chick GDI 5'- and
3'-untranslated sequences (110 and 831 nucleotides, respectively) have
no significant homology with mammalian sequences.
|
|
The protein predicted from the open reading frame of chick GDI
consists of 448 amino acid residues, with a calculated molecular mass
of 50,681 Da. Chick GDI is one amino acid longer than mammalian GDI-1/ and three amino acids longer than GDI-2 or GDI- at the 3'-end of the coding region. At the amino acid level, chick GDI is
91-94% identical to mammalian GDI-2 and GDI- and 87%
identical to GDI-1/ (Table 1). Importantly, all of the amino acids
that are critical for binding Rab3A [tyrosine, glutamate, arginine, threonine, and methionine at positions 39, 233, 240, 248, and 250, respectively (Schalk et al., 1996 )] are conserved in chick GDI,
further confirming its identity as GDI.
Chick GDI mRNA is predominantly expressed in neurons
Analysis of the tissue distribution of this chick GDI mRNA
suggests it is a neuron-specific isoform. A single 2.3 kb band was
observed when total RNA from E19 chick CG and brain was analyzed by
Northern blotting with either a radiolabeled noncoding (3'-UTR) or
coding region probe under high-stringency conditions (Fig. 2). Only weak signals were detected when
the same amount of total RNA from E19 chick liver and skeletal muscle
were blotted with the same probes. In comparison, two GDI messages of
different sizes were detected in rat brain by blotting with a bovine
GDI coding region cDNA probe (Matsui et al., 1990 ; Nishimura et al., 1994 ).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 2.
Chick GDI mRNA is predominantly expressed in
neural tissue as established by Northern blot analyses. Duplicate
samples of total RNA (20 µg per lane) extracted from
E19 chick CG, brain, liver, and skeletal muscle were separated by gel
electrophoresis, blotted, and hybridized with a
[ -32P]dCTP-labeled GDI coding region probe (960 bp;
A) or 3'-UTR probe (440 bp; B) under
high-stringency conditions. A single 2.3 kb band was detected in the CG
and brain with both probes (lanes 1, 2, CG;
lanes 3, 4, brain). Only a weak signal was detected in
liver and skeletal muscle (lanes 5, 6, liver;
lanes 7, 8, skeletal muscle). Ribosomal RNA was used to
check that RNA levels were similar in all lanes (data
not shown).
|
|
In situ hybridization studies of the cellular localization
of chick GDI mRNA demonstrate that this isoform is expressed in neurons
of the embryonic CG (Fig. 3). Using
digoxigenin-labeled antisense and sense cRNA probes corresponding to
213 bp of 3'-UTR or 367 bp of coding sequence, we hybridized E14-E19
CG paraffin sections and washed the sections under high-stringency
conditions. For comparison, alternate serial sections were hybridized
with a neuron-specific nicotinic cholinergic receptor 7 subunit cRNA probe, corresponding to 400 bp of coding sequence (Jacob and Berg, 1983 ; Couturier et al., 1990 ; Vernallis et al., 1993 ). GDI and 7
mRNAs have a similar distribution, with specific labeling being confined to neuronal somata (Fig. 3). However, staining intensity is
weaker with GDI than with 7 antisense probes, as also observed with
Northern blot analysis (data not shown), suggesting that GDI mRNA is
less abundant than 7 mRNA in CG neurons. Altogether, these results
suggest that there is one major isoform of GDI mRNA expressed in
neurons of the avian CNS and PNS.

View larger version (152K):
[in this window]
[in a new window]
|
Figure 3.
Chick GDI mRNA is present in ciliary ganglion
neurons as determined by in situ hybridization. Paraffin
sections of CGs from E14-E19 chicks were hybridized with
digoxigenin-labeled antisense or sense cRNA probes, incubated with
anti-digoxigenin antibody conjugated with alkaline phosphatase, reacted
for alkaline phosphatase staining, and examined by bright-field light
microscopy. A, GDI coding region antisense cRNA probe.
B, GDI coding region sense cRNA probe; C,
GDI 3'-UTR antisense probe. D, GDI 3'-UTR sense probe.
E, 7 coding region antisense cRNA probe.
F, 7 coding region sense cRNA probe. The nicotinic
cholinergic receptor 7 subunit antisense cRNA probe is included as a
positive control for the localization of a neuron-specific mRNA in CG
alternate serial sections. GDI and 7 have a similar distribution,
with label being concentrated in neuronal cell bodies. 7 mRNA
staining is stronger, suggesting that GDI mRNA is less abundant than
7 mRNA in CG neurons. Nonspecific labeling is low with all three
sense probes (B, D,
F). Arrows indicate neuronal
somata. Scale bar, 20 µm.
|
|
Presynaptic inputs and retrograde signals from the target tissues
induce increases in GDI mRNA levels during, but not before, peripheral
synapse formation
GDI transcript levels increase during pre- and postganglionic
synapse formation in the embryonic chick CG, as determined by both
RT-PCR with specific primers to the chick GDI coding sequence and
Northern blot analysis with a 3'-UTR probe. For relative quantitation of GDI mRNA levels by RT-PCR, c 4-tubulin mRNA, a form of
-tubulin that is exclusively expressed in neurons (Sullivan et al.,
1986 ; Lee et al., 1990 ), was used as a standard. Both transcripts were amplified in the exponential range from aliquots of the same CG total
RNA sample (Ikonomov and Jacob, 1996 ). GDI mRNA levels were normalized
to that of c 4-tubulin to account for reductions in neuron number
during naturally occurring cell death and after surgical manipulations.
c 4-tubulin transcript levels are not altered in the absence as
compared with the presence of synaptic interactions in age-matched CGs,
as previously demonstrated (Levey et al., 1995 ).
During normal development, all ciliary ganglion neurons are
functionally innervated by E8, with innervation beginning at E4.5 (Landmesser and Pilar, 1972 ; Jacob, 1991 ). CG neurons establish synapses with their target muscle tissues from E8.5 to E14 (Meriney and
Pilar, 1987 ; Pilar et al., 1987 ).
GDI mRNA levels were barely detectable before synaptogenesis, at E4.5.
Transcript levels increase 5.6-fold during neuronal differentiation and
synapse formation, from E4.5 to E15, and then level off up to E19, the
latest age examined (Fig. 4). The mRNA levels rise twofold from E4.5 to E7 (data not shown). The greatest developmental increase in GDI mRNA levels, 2.8-fold, was observed between E8 and E10, coinciding with target tissue synapse formation and
maturational changes in synaptic efficacy and morphology of the
presynaptic inputs (Landmesser and Pilar, 1972 ). Similar results were
found by Northern blot analysis when the data were normalized per
neuron number (data not shown). Thus, innervation and target tissue
interactions both seem to regulate GDI transcript levels in developing
CG neurons.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4.
Histogram demonstrating developmental increases in
ciliary ganglion GDI mRNA levels during neuronal differentiation and
synapse formation. A histogram based on relative RT-PCR analyses of
GDI mRNA levels in the chick CG at selected developmental ages ranging
from E6 to E19 is shown. Two sets of specific primers that amplify
different segments of the chick GDI coding sequence were used to
measure GDI mRNA levels in total RNA equivalent to the amount present
in a single CG. PCR was performed in the presence of
[ -32P]dCTP, and the radiolabeled PCR products were
separated by agarose gel electrophoresis. The single band, which
corresponded to the targeted GDI sequence (see text), was excised, and
the level of radioactivity was established by liquid scintillation
counting. E6 CG GDI mRNA levels are arbitrarily set at 1. Values are
expressed as the mean ± SEM; n = 4-7
separate experiments for each age indicated. To account for changes in
neuron number during normal development and naturally occurring cell
death, we normalized GDI mRNA levels to transcript levels of
c 4-tubulin, a neuron-specific form of -tubulin, which is not
regulated by synaptic interactions (Levey et al., 1995 ). Similar
changes were observed by Northern blot analysis with a GDI 3'-UTR probe
after the amount of RNA was normalized for changes in neuron number
(data not shown). GDI transcript levels increase during the period of
synaptogenesis and then plateau.
|
|
To determine the respective roles of inputs and target tissues in
inducing these developmental increases, we measured GDI mRNA levels in
CG neurons deprived of synaptic interactions. To prevent innervation or
target tissue interactions, we surgically removed the sole source of
presynaptic inputs, the accessory oculomotor nucleus in the midbrain,
or the developing optic vesicle, which contains the target tissues,
respectively (Levey et al., 1995 ). Surgeries were performed before
synaptogenesis and cause no direct damage to the neurons or transection
of their processes. Neuron numbers are reduced because of the removal
of sources of trophic support (Landmesser and Pilar, 1974 ; Furber et
al., 1987 ). Importantly, surviving neurons are healthy based on
ultrastructural and electrophysiological criteria and the demonstration
of developmental increases in the levels of specific mRNAs and proteins
(Engisch and Fischbach 1990 , 1992 ; Arenella et al., 1993 ; Dourado et
al., 1994 ; Levey et al., 1995 ). Input-deprived CG neurons form synapses
on their target tissues, whereas innervation is established and
maintained on target-deprived neurons (Landmesser and Pilar, 1974 ;
Furber et al., 1987 ).
At E8, GDI mRNA levels are not significantly different in CGs deprived
of either input or target tissues as compared with normal-developing
control CGs (Fig. 5). In contrast, at
E10, GDI mRNA levels are twofold lower in either input- or
target-deprived neurons relative to age-matched control values.
Interestingly, decreases in GDI mRNA levels in target-deprived CGs are
already present at E9, whereas effects of input deprivation are delayed and not detectable until E10.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5.
Innervation and target tissue interactions induce
increases in ciliary ganglion GDI mRNA levels but only during
peripheral synapse formation, as established by RT-PCR and Northern
blot analyses. A, Histogram based on relative RT-PCR
analyses of GDI mRNA levels in individual CGs (see Fig. 4 legend)
developing in the absence versus the presence of pre- or postganglionic
synaptic interactions is shown. GDI mRNA levels in CGs deprived of
target tissue because of its removal unilaterally are compared with the
contralateral CG value that serves as an internal control.
Input-deprived CGs are compared with age-matched normal-developing
ganglia. GDI mRNA levels are not significantly different in
normal-developing CGs as compared with that in contralateral control
CGs. GDI transcript levels are normalized to c 4-tubulin mRNA levels
to control for decreases in neuron number caused by the surgeries. GDI
mRNA levels in the control CG are arbitrarily set at 100%. Values are
expressed as the mean ± SEM. The numbers in
parentheses above the bars indicate the
number of individual ganglia analyzed for each surgical manipulation.
An asterisk indicates a statistically significant
difference relative to controls based on Student's two-sided
t test, p < 0.05. Declines in GDI
mRNA levels in ganglia developing in the absence of the target tissue
are seen at E9 and E10 relative to levels in contralateral control
ganglia from the same embryo. Reductions in GDI mRNA levels in the
absence of innervation are seen at E10 but not earlier. The greatest
declines occur in the absence of both inputs and targets at E10,
suggesting additive effects. B, Similar declines in GDI
mRNA levels in E10 CGs from operated embryos were observed by
quantitative Northern blot analysis with a 3'-UTR cDNA probe (440 bp).
The amounts of total RNA loaded per lane were corrected
to compensate for changes in neuron number caused by the operations
(Levey et al., 1995 ). For normalization, the same filter was stripped
and reprobed with a [32P]dCTP-labeled 18S
ribosomal cDNA probe (375 bp). Left lane, Contralateral
control CGs; middle lane, target tissue-deprived CGs
from the same embryo; right lane, input-deprived CGs
from age-matched embryos.
|
|
To test for additive effects, we prevented both innervation and target
tissue interactions from forming in single embryos. GDI transcript
levels are reduced fourfold at E10 (Fig. 5). In support of these
quantitative RT-PCR results, similar declines in GDI mRNA levels were
observed in three separate Northern blot experiments. CG total RNA from
E10 normal-developing and operated embryos (n = 20-25
CGs per sample) was blotted with a GDI 3'-UTR probe, and the resulting
signals were normalized to 18S ribosomal RNA content (Fig. 5).
These findings suggest that the increase in GDI transcript levels is
independent of cell-cell interactions, up to E8. In contrast, the
subsequent larger increase from E8 to E10 is dependent on the
establishment of synaptic contact with the target tissue and the
maintenance of presynaptic inputs.
Regulatory changes in GDI protein levels correlate well with GDI
mRNA levels
The protein encoded by chick GDI mRNA seems to be the avian
homolog of mammalian GDI-2 or GDI- . At the amino acid level, chick
GDI mRNA is 93% identical to these two mammalian isoforms and
87% identical to GDI-1/ (Table 1). Heterologous expression of myc-tagged chick GDI coding sequence in cos-7 cells results in a
single band that has the same electrophoretic mobility as mouse
GDI-2-myc, as determined by Western blot analysis with an anti-mouse
GDI-2 polyclonal antibody (Fig.
6A) (Shisheva et al., 1994 ). Chick GDI and mammalian GDI-2 proteins have an apparent size of
46 kDa. In contrast, mammalian GDI-1 proteins are larger, 55 kDa,
despite the small difference in their deduced molecular mass compared
with that of GDI-2 proteins (Shisheva et al., 1994 ). Moreover, a single
band of the expected size (46 kDa) was detected in CG protein extracts
by Western blot analysis with the anti-mouse GDI-2 polyclonal antibody
(Fig. 6B).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 6.
Regulatory changes in GDI protein levels resemble
GDI mRNA levels in the ciliary ganglion as determined by Western blot
analysis. A, The identity of the chick GDI coding
sequence was further confirmed by Western blot analysis. Cos-7 cells
were transfected with either myc-tagged chick GDI cDNA or myc-tagged
mouse GDI-2 subcloned into pCMV5. Cytosolic fractions of the
transfected cells were separated by SDS-PAGE, transferred to
nitrocellulose, and immunoblotted with an anti-mouse GDI-2 polyclonal
antibody (Shisheva et al., 1994 ). For both constructs, a single 46 kDa
band was observed. Shown are extracts from cos-7 cells transfected with
chick GDI myc-tagged (lane 1), mouse GDI-2 myc-tagged
(lane 4), chick GDI lacking the myc tag
(lanes 2, 5), and pCMV5 transfection vector lacking
insert (lane 3). The lower band in all
lanes is the endogenous cos-7 cell GDI and shows similar
amounts of protein were loaded in all lanes. Myc-tagged
GDI (lanes 1, 4) runs slightly
higher than the endogenous GDI. A single band of the expected size
(lanes 6, 7) is detected by
immunoblotting with an anti-myc mAb (ATCC 1729); pCMV5
transfection vector lacking insert is shown in lane
8. B, Immunoblotting shows increases in
GDI protein levels in the normal-developing CG during synapse
formation. Protein extracts of CGs at selected developmental ages
ranging from E4 to E10, adjusted to correspond to equal numbers of
neurons, were analyzed by Western blotting with anti-GDI-2 antiserum
and chemiluminescence detection. C, GDI protein levels
are lower in CGs developing in the absence of input (lanes
3, 4) or targets (lanes 5,
6) compared with that in contralateral control
CGs (lanes 1, 2) at E10.
|
|
To compare regulatory changes in GDI protein and mRNA levels during
normal development and after surgical manipulations, we analyzed
aliquots of CG protein extracts corresponding to equal numbers of
neurons. GDI protein levels increase fourfold from E4.5 to E9-E10,
resembling the 5.6-fold increase in GDI mRNA levels (Fig.
6B). Moreover, GDI protein levels are decreased
twofold in E10 CGs that have developed in the absence of innervation or target tissues (Fig. 6C), correlating well with the twofold
declines observed in GDI mRNA levels by both RT-PCR and Northern blot
analysis. These quantitatively similar changes in GDI protein and mRNA
levels in developing CG neurons suggest that the regulation of GDI
expression occurs at the level of gene transcription.
 |
DISCUSSION |
Major findings reported here are (1) the identification of a chick
neuron-specific Rab GDI mRNA and (2) the regulation of expression of
this mRNA by both innervation and target tissues after the onset of
peripheral synapse formation in CG neurons. Developmental increases in
CG GDI mRNA levels occur in two phases. The first phase appears to be
independent of cell-cell interactions and occurs as the neurons
differentiate. The second larger increase is induced by synaptic
interactions. Innervation precedes target tissue synapse formation in
CG neurons (Landmesser and Pilar, 1972 ; Jacob, 1991 ). However, the
ability of inputs to regulate GDI expression is developmentally delayed
and correlates with the onset of target tissue innervation.
Target-induced increases in GDI expression also occur at this time,
slightly preceding the regulatory response to input. These results
demonstrate that retrograde signals from the targets initiate a
sequence of molecular events that are required to achieve mature levels
of functionally important presynaptic terminal components. Thus, target
tissue plays a major role in controlling the differentiation and
function of the presynaptic inputs that drive it.
Neuron-specific GDI is the predominant isoform expressed in the
chick ciliary ganglion
The chick GDI clone we have isolated and characterized has similar
features to all three mammalian GDI isoforms. The mammalian isoforms
differ from one another in their apparent size and distribution. GDI-1/ , a 55 kDa protein, is predominantly expressed in the nervous system, whereas GDI-2 and GDI- , 46 kDa proteins, are ubiquitously expressed (Nishimura et al., 1994 ; Bachner et al., 1995 ). Based on size
and sequence, chick GDI closely resembles GDI-2 and GDI- , having an
apparent electrophoretic size of 46 kDa and sharing 93%
sequence identity with these isoforms, compared with 87% identity with
GDI-1/ at the amino acid level (Table 1). However, similar to
GDI-1/ , chick GDI mRNA is predominantly expressed in neurons, based
on in situ hybridization and Northern blotting. Moreover, the chick GDI sequence includes all of the amino acids that are essential for binding Rab3A, a neuron-specific protein that is associated with synaptic vesicles (Fig. 1) (Schalk et al., 1996 ).
Based on the existence of multiple mammalian GDI isoforms, we looked
for additional GDI isoforms in the chick CG. This is an important issue
for our studies on the regulation of GDI expression in these neurons.
All of the data suggest that we are studying the expression of a single
gene. All 33 GDI clones isolated by low-stringency screening of
the embryonic CG cDNA library correspond to this isoform. Northern
blotting with two different GDI probes from the coding region and a
unique 3'-UTR has revealed a single band of identical size and similar
tissue distribution, showing a strong signal in the chick CG and brain
but only a weak signal in skeletal muscle and liver. There is a strong
correlation between quantitative measurements of GDI mRNA levels in the
CG using RT-PCR with specific primers to the coding sequence compared
with Northern analysis with a GDI 3'-UTR probe. GDI coding and
noncoding region cRNA probes show a similar neuron-specific
distribution in in situ hybridization. Finally, a single
protein band is observed in CG extracts by immunoblotting. Taken
together, these results show that there is only one major GDI isoform
expressed in embryonic CG neurons.
Preliminary data suggest the presence of a distinct GDI isoform in
other chick tissues. Southern blotting of chick genomic DNA with a cDNA
probe (370 bp) from the chick GDI coding sequence 5'-end revealed the
existence of another hybridizing band. RT-PCR amplification of liver
RNA with chick GDI specific primers produced a cDNA fragment that has
83% sequence identity to the neuronal GDI isoform. Thus, at least two
GDI isoforms exist in chick.
GDI expression in ciliary ganglion neurons is regulated by synaptic
interactions but only after the onset of target tissue innervation
Developmental increases in GDI expression in the CG occur in two
phases. The first increase occurs during neuronal differentiation, from
E4 to E8, and is independent of synaptic interactions. In contrast, the
subsequent larger increase is induced by both inputs and target tissues
during peripheral synapse formation, from E8 to E14. Similarly, GDI-
mRNA is not detectable in proliferating neuronal precursor cells of the
mouse embryo, as determined by in situ hybridization
(Bachner et al., 1995 ). GDI- mRNA is expressed later in
differentiated neurons of the embryonic and adult mouse CNS and PNS,
with the highest levels present in regions of greatest synaptic
activity. We report in this paper the separate role of innervation and
target tissues in regulating GDI expression in neurons.
GDI mRNA and protein levels are not altered in CGs, up to E8, when
surgical manipulations are used to prevent presynaptic innervation or
retrograde signaling from the immature target tissues. However, after
E8, GDI mRNA and protein levels are reduced to a similar extent when
the neurons are prevented from establishing synaptic contact with their
targets. Declines in GDI levels in the absence of inputs occur slightly
later, at E10. The greatest decrease in GDI expression occurs in CG
neurons deprived of both types of synaptic interaction.
These results demonstrate that the physiological target tissue is
necessary, but not sufficient, to induce mature GDI levels in neurons.
Regulatory signals from the presynaptic input are also needed. However,
inductive effects of the inputs are developmentally delayed and seem to
require innervation of the postganglionic targets and/or maturation of
the preganglionic inputs. Synaptic contact with the peripheral target
tissues may provide retrograde signals that induce the expression or
release of unique regulatory factors from the presynaptic inputs.
Alternatively, changes in the CG neurons after peripheral synapse
formation may be necessary for the cells to respond to regulatory
signals from the inputs. Precedence exists for CG neuron dependence on
a target-derived factor before response to other regulatory
signals. A 50 kDa factor from the eye, which contains the CG target
tissues, is required for the neurons to respond to cAMP, which, in
turn, causes an increase in the number of functional nAChRs (Margiotta
et al., 1987 ; Halvorsen et al., 1991 ). Interestingly, responsiveness to cAMP is seen only after E10, coinciding with the time when inputs regulate GDI expression (Margiotta and Gurantz, 1989 ). Synaptic activity is a candidate for a presynaptic signal that regulates GDI
mRNA levels. Greater synaptic activity is likely in CG neurons at the
later embryonic stages, from E10 and up, because of cAMP-induced increases in the number of functional nAChRs, as well as increases in
the number of synaptic vesicles in presynaptic terminals, in the number
of nAChRs in the postsynaptic membrane, and in the relative abundance
of high conductance to low conductance nAChRs (Margiotta and Gurantz,
1989 ; Jacob, 1991 ). Based on its time course, the regulatory effect of
the target tissue on GDI expression seems to be contact-mediated or
attributable to a factor released by synaptic transmission. The
specific factors that mediate the regulatory effects of inputs and
targets on GDI levels and the molecular mechanisms of their action
remain to be determined. Our results demonstrate that both inputs and
target tissues have important inductive effects on GDI expression, and
these regulatory changes occur during peripheral synapse formation.
The expression of presynaptic terminal proteins is regulated
differently from that of postsynaptic membrane components within a
single neuron
Similar to expression of GDI, the expression of other presynaptic
terminal proteins seems to be regulated by target tissue synapse
formation. Increases in mRNA levels of SNAP-25, synapsin I,
synaptotagmin I, and synaptophysin IIa and IIb correlate well with the
time of target tissue synaptogenesis (Catsicas et al., 1991 ; Zurmohle
et al., 1994 ; Lou and Bixby, 1995 ). A direct demonstration of the
regulatory role of the target was obtained by showing specific declines
in synaptotagmin I mRNA in chick spinal motoneurons deprived of their
targets by limb bud removal (Campagna et al., 1997 ). Together with our
findings, these data suggest that there is a program of presynaptic
terminal differentiation that is stimulated by target tissues during
peripheral synapse formation, thereby coordinating the expression of
particular presynaptic terminal proteins. Our results demonstrate that
inputs also induce the expression of synaptic terminal proteins in the
neurons being contacted, but only after the innervated neurons have
established connections with their own peripheral targets. Thus, target
tissue plays a major role in activating molecular events that are
required to achieve the mature functional state of its innervating
presynaptic terminals.
Importantly, the regulation of GDI expression differs from that of
nicotinic cholinergic receptors in CG neurons. Increases in receptor
subunit mRNA levels induced by inputs and target tissues occur earlier,
during preganglionic innervation, and before, as well as during,
synapse formation with target tissues (Brumwell et al., 1995 ; Levey et
al., 1995 ). These temporal differences in the induction of GDI and
nicotinic cholinergic receptors suggest that distinct extrinsic factors
and/or intracellular mechanisms regulate the differentiation of the two
types of synaptic specializations formed within an individual neuron,
the axonal presynaptic terminal and the somatodendritic postsynaptic
membrane.
Our data demonstrate the complexity of regulatory events that influence
neuronal synapse formation and the impressive responsiveness of neurons
to signals provided by their synaptic partners. Innervation and target
tissues act in a developmentally regulated, combinatorial manner to
control the expression of synapse-related genes in neurons developing
in vivo.
 |
FOOTNOTES |
Received Jan. 15, 1998; revised May 26, 1998; accepted May 29, 1998.
This work was supported by National Institutes of Health Grants
NS-21725 to M.H.J. and P30DK32520 to A.C.S., by Juvenile Diabetes Foundation International Research Grant 196114 to A.C.S., and by a
Sigma Xi grant-in-aid of research to M.C.K. We thank Brian Williams for
expert technical assistance in preparing the figures.
Correspondence should be addressed to Dr. Michele Jacob, Department of
Neuroscience, Tufts University, School of Medicine, 136 Harrison
Avenue, Boston, MA 02111.
Dr. Ikonomov's present address: Department of Psychiatry, Wayne State
University, Medical Center, 540 East Canfield Street, Detroit, MI,
48201.
M. C. Kulesa's present address: Department of Neuroscience, Johns
Hopkins University, School of Medicine, 725 North Wolfe Street,
Baltimore, MD 21205.
Dr. Shisheva's present address: Department of Physiology, Wayne State
University, Medical Center, 540 East Canfield Street, Detroit, MI,
48201.
 |
REFERENCES |
-
Apel ED,
Merlie JP
(1995)
Assembly of the postsynaptic apparatus.
Curr Opin Neurobiol
5:62-67[Medline].
-
Araki K,
Nakanishi H,
Hirano H,
Kato M,
Sasaki T,
Takai Y
(1995)
Purification and characterization of Rab GDI beta from rat brain.
Biochem Biophys Res Commun
211:296-305[Web of Science][Medline].
-
Arenella LS,
Oliva JM,
Jacob MH
(1993)
Reduced levels of acetylcholine receptor expression in chick ciliary ganglion neurons developing in the absence of innervation.
J Neurosci
13:4525-4537[Abstract].
-
Bachner D,
Sedlacek Z,
Korn B,
Hameister H,
Poustka A
(1995)
Expression patterns of two human genes coding for different rab GDP-dissociation inhibitors (GDIs), extremely conserved proteins involved in cellular transport.
Hum Mol Genet
4:701-708[Abstract/Free Full Text].
-
Boyd RT,
Jacob MH,
Couturier S,
Ballivet M,
Berg DK
(1988)
Expression and regulation of neuronal acetylcholine receptor mRNA in chick ciliary ganglia.
Neuron
1:495-502[Web of Science][Medline].
-
Boyd RT,
Jacob MH,
McEachern AE,
Caron S,
Berg DK
(1991)
Nicotinic acetylcholine receptor mRNA in dorsal root ganglion neurons.
J Neurobiol
22:1-14[Web of Science][Medline].
-
Brumwell C,
Levey MS,
Ikonomov OC,
Jacob MH
(1995)
Regulation of
-bungarotoxin receptor expression in developing neurons.
Soc Neurosci Abstr
21:1336. -
Burns ME,
Augustine GJ
(1995)
Synaptic structure and function: dynamic organization yields architectural precision.
Cell
83:187-194[Web of Science][Medline].
-
Campagna JA,
Prevette D,
Oppenheim RW,
Bixby JL
(1997)
Target contact regulates expression of synaptotagmin genes in spinal motor neurons in vivo.
Mol Cell Neurosci
8:377-388[Web of Science][Medline].
-
Castillo PE,
Janz R,
Sudhof TC,
Tzounopoulos T,
Malenka RC,
Nicoll RA
(1997)
Rab3A is essential for mossy fibre long-term potentiation in the hippocampus.
Nature
388:590-593[Medline].
-
Catsicas S,
Larhammar D,
Blomqvist A,
Sanna PP,
Milner RJ,
Wilson MC
(1991)
Expression of a conserved cell-type specific protein in nerve terminals coincides with synaptogenesis.
Proc Natl Acad Sci USA
88:785-789[Abstract/Free Full Text].
-
Chomczynski P
(1993)
A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples.
Biotechniques
15:532-535[Web of Science][Medline].
-
Couturier S,
Bertrand D,
Matter JM,
Hernandez MC,
Bertrand S,
Millar N,
Valera S,
Barkas T,
Ballivet M
(1990)
A neuronal nicotinic acetylcholine receptor subunit (
7) is developmentally regulated and forms a homo-oligomeric channel blocked by -BTX.
Neuron
5:847-856[Web of Science][Medline]. -
Dourado MM,
Brumwell C,
Wisgirda ME,
Jacob MH,
Dryer SE
(1994)
Target tissues and innervation regulate the characteristics of K+ currents in chick ciliary ganglion neurons developing in situ.
J Neurosci
14:3156-3165[Abstract].
-
Engisch KL,
Fischbach GD
(1990)
The development of ACh- and GABA-activated currents in normal and target-deprived embryonic chick ciliary ganglia.
Dev Biol
139:417-426[Web of Science][Medline].
-
Engisch KL,
Fischbach GD
(1992)
The development of ACh- and GABA-activated currents in embryonic chick ciliary ganglion neurons in the absence of innervation in vivo.
J Neurosci
12:1115-1125[Abstract].
-
Feramisco JR,
Smart JE,
Burridge K,
Helfman DM,
Thomas GP
(1982)
Co-existence of vinculin-like protein of higher molecular weight in smooth muscle.
J Biol Chem
257:11024-11031[Abstract/Free Full Text].
-
Fields-Berry SC,
Halliday AL,
Cepko CL
(1992)
A recombinant retrovirus encoding alkaline phosphatase confirms clonal boundary assignment in lineage assignment of murine retina.
Proc Natl Acad Sci USA
89:693-697[Abstract/Free Full Text].
-
Fischer von Mollard G,
Mignery GA,
Baumert M,
Perrin MS,
Hanson TJ,
Burger PM,
Jahn R,
Sudhof TC
(1992)
Rab3 is a small GTP-binding protein exclusively localized to synaptic vesicles.
Proc Natl Acad Sci USA
87:1988-1992[Abstract/Free Full Text].
-
Furber S,
Oppenheim RW,
Prevette D
(1987)
Naturally-occurring neuron death in the ciliary ganglion of the chick embryo following removal of preganglionic input: evidence for the role of afferents in ganglion cell survival.
J Neurosci
7:1816-1832[Abstract].
-
Garret MD,
Zahner JE,
Cheney CM,
Novick PJ
(1994)
GDI1 encodes a GDP dissociation inhibitor that plays an essential role in the yeast secretory pathway.
EMBO J
13:1718-1728[Web of Science][Medline].
-
Geppert M,
Goda Y,
Stevens CF,
Sudhof TC
(1997)
Rab3A regulates a late step in synaptic vesicle fusion.
Nature
387:810-814[Medline].
-
Halvorsen SW,
Schmid HA,
McEachern AE,
Berg DK
(1991)
Regulation of acetylcholine receptors on chick ciliary ganglion neurons by components from the synaptic target tissue.
J Neurosci
11:2177-2186[Abstract].
-
Hamburger V,
Hamilton HL
(1951)
A series of normal stages in the development of the chick embryo.
J Morphol
88:49-92[Web of Science].
-
Ikonomov OC,
Jacob MH
(1996)
Differential display protocol with selected primers that preferentially isolates mRNAs of moderate-to-low abundance in a microscopic system.
Biotechniques
20:1030-1042[Web of Science][Medline].
-
Jacob MH
(1991)
Acetylcholine receptor expression in developing chick ciliary ganglion neurons.
J Neurosci
11:1701-1712[Abstract].
-
Jacob MH,
Berg DK
(1983)
The ultrastructural localization of
-bungarotoxin binding sites in relation to synapses on chick ciliary ganglion neurons.
J Neurosci
3:260-271[Abstract]. -
Janoueix-Lerosey I,
Jollivet F,
Camonis J,
Marche PN,
Goud B
(1995)
Two-hybrid system screen with the small GTP-binding protein Rab6.
J Biol Chem
270:14801-14808[Abstract/Free Full Text].
-
Kozak M
(1987)
An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs.
Nucleic Acids Res
15:8125-8131[Abstract/Free Full Text].
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
-
Landmesser L,
Pilar G
(1972)
The onset and development of transmission in the chick ciliary ganglion.
J Physiol (Lond)
222:691-713[Abstract/Free Full Text].
-
Landmesser L,
Pilar G
(1974)
Synapse formation during embryogenesis on ganglion cells lacking a periphery.
J Physiol (Lond)
241:715-736[Abstract/Free Full Text].
-
Lee MK,
Tuttle JB,
Rebhun LI,
Cleveland DW,
Frankfurter A
(1990)
The expression and posttranslational modification of a neuron-specific
-tubulin isotype during chick embryogenesis.
Cell Motil Cytoskeleton
17:118-132[Web of Science][Medline]. -
Levey MS,
Brumwell CL,
Dryer SE,
Jacob MH
(1995)
Innervation and target tissue interactions differentially regulate acetylcholine receptor subunit mRNA levels in developing neurons in situ.
Neuron
14:153-162[Web of Science][Medline].
-
Lou XJ,
Bixby JL
(1995)
Patterns of presynaptic gene expression define two stages of synaptic differentiation.
Mol Cell Neurosci
6:252-262[Web of Science][Medline].
-
Margiotta JF,
Gurantz D
(1989)
Changes in the number, function, and regulation of nicotinic acetylcholine receptors during neuronal development.
Dev Biol
135:326-339[Web of Science][Medline].
-
Margiotta JF,
Berg DK,
Dionne VE
(1987)
Cyclic AMP regulates the proportion of functional acetylcholine receptors on chick ciliary ganglion neurons.
Proc Natl Acad Sci USA
84:8155-8159[Abstract/Free Full Text].
-
Matsui Y,
Kikuchi A,
Araki S,
Hata Y,
Kondo J,
Teranishi Y,
Takai Y
(1990)
Molecular cloning and characterization of a novel type of regulatory protein (GDI) for smg p25A, a ras-like GTP binding protein.
Mol Cell Biol
10:4116-4122[Abstract/Free Full Text].
-
Meriney SD,
Pilar G
(1987)
Cholinergic innervation of the smooth muscle cells in the choroid coat of the chick eye and its development.
J Neurosci
7:3827-3839[Abstract].
-
Motoike T,
Sano K,
Nakamura H,
Takai Y
(1993)
Expression of smg p25A/rab3A guanine nucleotide dissociation inhibitor (GDI) in neurons and glial cells from rat brain.
Neurosci Lett
156:87-90[Web of Science][Medline].
-
Munro S,
Pelham HRB
(1988)
An Hsp70-like protein in the ER: identity with the 78 kd glucose regulated protein and immunoglobulin heavy chain binding protein.
Cell
48:291-300.
-
Nishimura N,
Nakamura H,
Takai Y,
Sano K
(1994)
Molecular cloning and characterization of two rab GDI species from rat brain: brain specific and ubiquitous types.
J Biol Chem
269:14191-14198[Abstract/Free Full Text].
-
Nishimura N,
Goji J,
Nakamura H,
Orita S,
Takai Y,
Sano K
(1995)
Cloning of a brain-type isoform of human rab GDI and its expression in human neuroblastoma cell lines and tumor specimens.
Cancer Res
55:5445-5450[Abstract/Free Full Text].
-
Pfeffer SR,
Dirac-Svejstrup AB,
Soldati T
(1995)
Rab GDP dissociation inhibitor: putting rab GTPases in the right place.
J Biol Chem
270:17057-17059[Free Full Text].
-
Pilar G,
Nunez R,
McLennan IS,
Meriney SD
(1987)
Muscarinic and nicotinic synaptic activation of the developing chicken iris.
J Neurosci
7:3813-3826[Abstract].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual. New York: Cold Spring Harbor.
-
Sanger F,
Nicklen S,
Coulson AR
(1977)
DNA sequencing with chain-termination inhibitors.
Proc Natl Acad Sci USA
74:5463-5467[Abstract/Free Full Text].
-
Schalk I,
Zeng K,
Wu SK,
Stura EA,
Matteson J,
Huang M,
Tandon A,
Wilson IA,
Balch WE
(1996)
Structure and mutational analysis of Rab GDP-dissociation inhibitor.
Nature
381:42-48[Medline].
-
Sedlacek Z,
Konecki DS,
Korn B,
Klauck SM,
Poustka A
(1994)
Evolutionary conservation and genomic organization of XAP-4, an Xq28 located gene coding for a human rab GDP dissociation inhibitor (GDI).
Mamm Genome
5:633-639[Web of Science][Medline].
-
Shisheva A,
Sudhof TC,
Czech MP
(1994)
Cloning, characterization and expression of a novel GDP dissociation inhibitor isoform from skeletal muscle.
Mol Cell Biol
14:3458-3468.
-
Sudhof TC
(1995)
The synaptic vesicle cycle: a cascade of protein-protein interactions.
Nature
375:645-653[Medline].
-
Sullivan KF,
Havercroft JC,
Machlin PS,
Cleveland DW
(1986)
Sequence and expression of the chicken
5- and 4-tubulin genes define a pair of divergent -tubulins with complimentary patterns of expression.
Mol Cell Biol
6:4409-4418[Abstract/Free Full Text]. -
Vernallis AB,
Conroy WG,
Berg DK
(1993)
Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor subtypes.
Neuron
10:451-464[Web of Science][Medline].
-
Yang C,
Slepnev VL,
Goud B
(1994)
Rab proteins form in vitro complexes with two isoforms of the GDP-dissociation inhibitor protein (GDI).
J Biol Chem
269:31891-31899[Abstract/Free Full Text].
-
Zahner JE,
Cheney CM
(1993)
A Drosophila homolog of bovine smg p25A GDP dissociation inhibitor undergoes a shift in isoelectric point in the developmental mutant quartet.
Mol Cell Biol
13:217-227[Abstract/Free Full Text].
-
Zarsky V,
Cvrckova F,
Bischoff F,
Palme K
(1997)
At-GDI1 from Arabidopsis thaliana encodes a rab specific GDP dissociation inhibitor that complements the sec19 mutation of Saccharomyces cerevisiae.
FEBS Lett
403:303-308[Web of Science][Medline].
-
Zurmohle UM,
Herms J,
Schlingensiepen R,
Schlingensiepen KH,
Brysch W
(1994)
Changes of synapsin I messenger RNA expression during rat brain development.
Exp Brain Res
99:17-24[Web of Science][Medline].
Copyright © 1998 Society for Neuroscience 0270-6474/98/18166331-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. K. Temburni, M. M. Rosenberg, N. Pathak, R. McConnell, and M. H. Jacob
Neuronal Nicotinic Synapse Assembly Requires the Adenomatous Polyposis Coli Tumor Suppressor Protein
J. Neurosci.,
July 28, 2004;
24(30):
6776 - 6784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Bao, A. S. Prasad, F. W. J. Beck, and M. Godmere
Zinc modulates mRNA levels of cytokines
Am J Physiol Endocrinol Metab,
November 1, 2003;
285(5):
E1095 - E1102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Brumwell, J. L. Johnson, and M. H. Jacob
Extrasynaptic alpha 7-Nicotinic Acetylcholine Receptor Expression in Developing Neurons Is Regulated by Inputs, Targets, and Activity
J. Neurosci.,
September 15, 2002;
22(18):
8101 - 8109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Harada, B. Furuta, K.-i. Takeuchi, M. Itakura, M. Takahashi, and M. Umeda
Nadrin, a Novel Neuron-specific GTPase-activating Protein Involved in Regulated Exocytosis
J. Biol. Chem.,
November 17, 2000;
275(47):
36885 - 36891.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|