 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 1998, 18(17):6723-6739
Transcriptional Regulation of the GluR2 Gene: Neural-Specific
Expression, Multiple Promoters, and Regulatory Elements
Scott J.
Myers1, 2,
Jeanne
Peters1,
Yunfei
Huang1,
Mary B.
Comer2,
Fabrice
Barthel3, and
Raymond
Dingledine1
1 Department of Pharmacology, Emory University,
Atlanta, Georgia 30322, 2 Department of Pharmacology,
University of North Carolina at Chapel Hill, Chapel Hill, North
Carolina 27599, 3 U 259 INSERM, Universite de
Bordeaux II, 33077 Bordeaux Cedex, France
 |
ABSTRACT |
To understand how neurons control the expression of the AMPA
receptor subunit GluR2, we cloned the 5' proximal region of the rat gene and investigated GluR2 promoter activity by transient transfection. RNase protection and primer extension of rat brain mRNA
revealed multiple transcription initiation sites from 340 to 481
bases upstream of the GluR2 AUG codon. The relative use of 5' start
sites was different in cortex and cerebellum, indicating complexity of
GluR2 transcript expression among different sets of neurons. When GluR2
promoter activity was investigated by plasmid transfection into
cultured cortical neurons, cortical glia, and C6 glioma cells, the
promoter construct with the strongest activity, per transfected cell,
was 29.4-fold (± 3.7) more active in neurons than in non-neural
cells. Immunostaining of cortical cultures showed that >97% of the
luciferase-positive cells also expressed the neuronal marker MAP-2.
Evaluation of internal deletion and substitution mutations identified a
functional repressor element I RE1-like silencer and
functional Sp1 and nuclear respiratory factor-1 (NRF-1) elements
within a GC-rich proximal GluR2 promoter region. The GluR2 silencer
reduced promoter activity in glia and non-neuronal cell lines by two-
to threefold, was without effect in cortical neurons, and could bind
the RE1-silencing transcription factor (REST) because
cotransfection of REST into neurons reduced GluR2 promoter activity in
a silencer-dependent manner. Substitution of the GluR2 silencer by the
homologous NaII RE1 silencer further reduced GluR2 promoter activity in
non-neuronal cells by 30-47%. Maximal positive GluR2 promoter
activity required both Sp1 and NRF-1 cis elements and an
interelement nucleotide bridge sequence. These results indicate that
GluR2 transcription initiates from multiple sites, is highly neuronal
selective, and is regulated by three regulatory elements in the 5'
proximal promoter region.
Key words:
AMPA; glutamate receptor; transcription; REST; NRF-1; primary culture; transfection; luciferase; neurons; promoter; Sp1; silencer; neuronal expression; repressor
 |
INTRODUCTION |
The AMPA subtypes of glutamate
receptors are assembled from combinations of GluR1, 2, 3 and 4 (GluRA,
B, C, D) subunits and mediate a large fraction of the postsynaptic
response at most fast excitatory synapses in the brain. Studies with
recombinant receptors indicate that different subunit combinations
produce functionally unique AMPA receptors (Boulter et al., 1990 ;
Sommer et al., 1990 ; Hollmann et al., 1991 ; Lomeli et al., 1994 ). In particular, three AMPA receptor properties are strongly influenced by
the level of edited GluR2 expression because of the positively charged
arginine present in the Q/R site of the M2 channel-lining domain. The presence of edited GluR2 reduces Ca2+
permeability (Hollmann et al., 1991 ; Geiger et al., 1995 ),
voltage-dependent channel block by cytosolic polyamines (Bowie and
Mayer, 1995 ; Donevan and Rogawski, 1995 ; Kamboj et al., 1995 ; Koh et
al., 1995 ), and single channel conductance (Swanson et al., 1997 ).
Thus, EPSPs mediated by GluR2-deficient receptors may be larger than
those mediated by GluR2-rich receptors, which should have significant physiological consequences.
The relative expression of AMPA receptor subunit mRNA and protein in
certain populations of neurons is not static but may be remodeled
during development (Pellegrini-Giampietro et al., 1992a ), after
seizures or ischemic insult (Pellegrini-Giampietro et al., 1992b , 1994 ;
Pollard et al., 1993 ; Freidman et al., 1994 ; Kamphuis et al., 1994 ;
Prince et al., 1995 ) and after administration of antipsychotics
(Fitzgerald et al., 1995 ), drugs of abuse (Ortiz et al., 1995 ;
Fitzgerald et al., 1996 ), or corticosteroids (Nair et al., 1998 ). After
ischemia, a drop in relative GluR2 expression in hippocampal CA1
pyramidal cells is associated with changes in AMPA receptor properties
consistent with an increase in GluR2-deficient receptors (Gorter et
al., 1997 ), although whether GluR2 selectively declines remains
controversial (see Frank et al., 1995 ). Recent work from our laboratory
indicates that the number of GluR2 subunits in a receptor is variable
and that the relative abundance of GluR2 affects
Ca2+ permeability and rectification differentially
(Washburn et al., 1997 ). Given that distinct populations of neurons are
known to be GluR2-deficient or GluR2-rich (Bochet et al., 1994 ; Jonas
et al., 1994 ; Geiger et al., 1995 ; Washburn et al., 1997 ), the
consequences of modulating GluR2 expression in these cells will depend
on pre-existent GluR2 levels.
These studies indicate that mechanisms controlling the level of GluR2
expression may be important regulatory determinants of AMPA receptor
phenotype. GluR2 expression in brain is primarily restricted to neurons
(Monyer et al., 1991 ; Petralia and Wenthold, 1992 ; Sato et al., 1993 ),
although AMPA receptor subunits are expressed by certain populations of
glia (Keinänen et al., 1990 ; Burnashev et al., 1992 ) and O-2A
progenitor cells (Patneau et al., 1994 ). Functional promoter studies of
NMDA and kainate receptor genes have been reported (Bai and Kusiak,
1995 ; Sasner and Buonanno, 1996 ; Huang and Gallo, 1997 ; Suchanek et
al., 1997 ), and the organization of the mouse GluR2 gene has been
described (Köhler et al., 1994 ), but no regulatory elements of
AMPA receptor subunits have yet been identified. We show here that the
GluR2 proximal promoter region contains a negative regulatory element
and a positive regulatory region and directs the neural-specific
expression of a luciferase reporter gene in transiently transfected
primary cortical cultures.
Parts of this paper have been published previously in abstract form
(Peters et al., 1995 ; Myers et al., 1996 ).
 |
MATERIALS AND METHODS |
Materials. Rat C6 glioma (CCL-107) cells were
obtained from American Type Culture Collection (Rockville, MD). HeLa
cells were a gift from Dr. T. J. Murphy (Emory University).
Timed-pregnant rats were purchased from Harlan Sprague Dawley
(Indianapolis, IN). DMEM and MEM tissue culture media,
L-glutamine, trypsin, and EDTA were obtained from Life
Technologies (Gaithersburg, MD). Poly-D-lysine (molecular
weight of > 60,000), fetal bovine serum, and tissue
culture supplements human transferrin, putrescine, tri-iodothyronine,
progesterone, estradiol, sodium selenite, insulin, L-glucose, and sodium bicarbonate were obtained from Sigma
(St. Louis, MO). Mouse monoclonal anti-MAP-2 (clone AP20) was purchased from Boehringer Mannheim (Indianapolis, IN), mouse monoclonal anti-GFAP
(clone G-A-5) was from Sigma, polyclonal rabbit anti-luciferase was
from Promega (Madison, WI), and Texas Red-conjugated
F(ab')2 donkey anti-rabbit IgG and FITC-conjugated
F(ab')2 donkey anti-mouse IgG were from Jackson
ImmunoResearch (West Grove, PA). Anti-Sp1 and anti-Krox-24
antibodies and Sp1 and Krox-24 double-stranded oligonucleotides were
purchased from Santa Cruz Biotechnology (Tebu, France).
Pfu polymerase and the DASH II genomic library
were from Stratagene (La Jolla, CA). Lipofectamine, Superscript II
reverse transcriptase, and RNAsin were obtained from Life Technologies. MMLV reverse transcriptase was from Stratagene. Restriction
enzymes were purchased from New England Biolabs (Beverly, MA) or Life Technologies. T4 DNA ligase, T4 DNA and Klenow polymerases, RNaseONE, luciferase vectors, and assay reagents were purchased from
Promega. pcDNA3 and TA cloning vectors were from
Invitrogen (San Diego, CA), and Sequenase 2.0 was purchased from United
States Biochemicals (Cleveland, OH). Geneclean kits were obtained from
BIO 101 (La Jolla, CA). All oligonucleotides were synthesized in house
on a MilliGen/Biosearch Cyclone Plus DNA Synthesizer using Expedite Chemistry (PerSeptive Biosystems). Radioisotopes were purchased from
Amersham (Arlington Heights, IL). Nylon-backed nitrocellulose membranes
were purchased from Bio-Rad (Hercules, CA). Other general salts and
supplies were purchased from Sigma or Fisher Scientific (Houston,
TX).
Isolation and characterization of genomic clones.
Approximately 0.7 × 106 plaques from a rat
genomic library in DASH II were hybridized on nylon membranes with
a 3505 bp EcoRI-XhoI restriction fragment containing the full coding sequence of the rat GluR2 cDNA, labeled with
[ -32P]dCTP by random priming. Three positive plaques
were purified and subjected to a second round of hybridization with an
end-labeled oligonucleotide (R2-1; GAGGACAGAAATATGCATAATCTTTTGCAT)
complementary to the first 10 codons of the GluR2 coding
sequence (Boulter et al., 1990 ). A single recombinant phage obtained
from this screen had an 18 kb insert that included a long, interspersed
repeat segment (LINE-1) at its immediate 5' end, ~9 kb upstream of
the 5' end of the GluR2 gene. A 1.64 kb
XbaI-HindIII fragment, which contained the GluR2
proximal promoter region, exon 1, and 288 bp of the first intron, has
been deposited in the GenBank database (accession number AF025917).
5' RACE, RNase protection, and primer extension and
Southern blot. For 5' RACE, poly(A+) mRNA
isolated from adult male Sprague Dawley rat brains by the method of
Chirgwin et al. (1979) was reverse transcribed by MMLV reverse
transcriptase from the R2-1 primer. After addition of an oligo-dC tail
with terminal deoxynucleotidyltransferase, PCR reactions were performed
using the anchor primer provided by the Life Technologies 5' RACE
system, plus the R2-race1 primer (AGTCCCGAGGACTGGCTGAA) complementary
to nucleotides 81-100 of the GluR2 cDNA sequence (Boulter et al.,
1990 ). PCR products were subcloned into the TA cloning vector and
selected by colony hybridization to the R2-20 oligonucleotide
complementary to bp 64-83 of the GluR2 cDNA (GAATGCAGTTTTTAGCTGAG). Ten clones were selected by size on agarose gels and sequenced through
the anchor-priming site to locate 5' ends of the mRNA.
For primer extension, an oligonucleotide (PER2-3;
TCCCAGTTGTAGCTGGTGGCTGTTGATGCC) complementary to bp 163 to 192 from
the coding AUG (see Fig. 1A) was end-labeled with
[ -32P]ATP (~4.8 × 105
cpm/pmol) and annealed to 30 µg of adult rat cortical and cerebellar total RNA in 20 mM HEPES, pH 7.0, 350 mM NaCl,
and 50% formamide at 50°C for 24 hr. Annealed samples were
precipitated and resuspended in 50 µl containing 50 mM
Tris-HCl, pH 8.3, 75 mM KCl, 3 mM
MgCl2, 2.5 mM dNTPs, 10 mM
DTT, 50 µg/ml actinomycin D, 20 units RNAsin, and 200 units
Superscript II reverse transcriptase and were incubated at 42°C for
90 min; then 1 µl of RNAsONE was added, and the incubation continued for an additional 35 min. Samples were recovered and loaded
onto a sequencing gel. Yeast total RNA (48 µg) and an in vitro synthesized full-length GluR2 sense RNA (10 ng) were used as
templates in negative and positive control reactions, respectively. The
in vitro GluR2 RNA includes 481 bases of GluR2
5'-untranslated region (UTR) sequence plus an additional 40 bp
of polylinker sequence. To confirm the specificity of the primer
extension reactions, we also prepared Southern blots of primer
extension products. For these experiments the reaction conditions were
identical to those described above except that the oligonucleotide
primer was unlabeled and, after gel resolution, reaction products were
electrotransferred to a nylon membrane. Southern blots were then
hybridized with a 32P-radiolabeled DNA probe
(>108 cpm/µg) made from bp 192 through 481
relative to the GluR2 AUG (see Fig. 2A, probe B).
Hybridized blots were washed under high-stringent conditions and
exposed to a Molecular Dynamics PhosphorImager plate (Sunnyvale, CA)
for visualization.
RNase protection experiments were conducted using an Ambion RPA
kit (Austin, TX) following the manufacturer's instructions. For
identification of mRNA 5' ends, an antisense riboprobe complementary to
nucleotides 192 through 481 relative to the GluR2 AUG (see Fig.
2A, probe C) was radiolabeled and annealed (5 × 105 cpm per reaction) to 30 µg of adult rat
cortical and cerebellar total RNA in 20 µl of hybridization solution
(Ambion kit) at 45°C overnight. Annealed samples were digested with
RNase A and RNaseT1, resolved on an RNA-sequencing gel, and exposed to
Kodak X-OMAT film for 12 hr. To quantify the relative use of
transcription initiation sites in cerebellum and cortex, an antisense
RNA probe complementary to bases 136 through 361 relative to the
GluR2 AUG (see Fig. 2A, probe D) was annealed to
total RNA as described above. This probe identifies the major short
transcription initiation site at 340 and also summates all
transcripts with 5' ends extending beyond 360 into a single
band on the gel. Total RNA used in these experiments was prepared
independently from four adult male Sprague Dawley rats.
Methylation sites in the promoter region. Adult rat genomic
DNA was isolated from lung, kidney, cortex, and cerebellum (40-50 µg) and digested with AccI to release a 1.3 kb promoter
fragment ( 731 to +603 bp relative to the +1 transcription initiation
site) and then was digested again with one of the methylation-sensitive restriction enzymes BssHII, SacII,
AvaI, or Eco47III. Southern blots of the genomic
fragments were prepared and hybridized with an
AccI-restricted 1.3 kb genomic fragment radiolabeled with
[ -32P]dCTP by random priming (>108
cpm/µg). All hybridizations and washes were conducted under
high-stringent conditions.
Cell culture. Primary rat cortical neuronal cultures were
prepared from embryonic day 18 fetal rat pups resected from pregnant Sprague Dawley rats. Briefly, cerebral cortices were minced in DMEM
supplemented with 1.1 gm/l glucose, 2.1 gm/l NaHCO3,
and 1.84 mM L-glutamine, pH 7.25 (FDMEM); 1 ml
of fetal bovine serum (FBS) was added; and tissue was dissociated by
trituration. Dissociated cells were rinsed in 8 ml of FDMEM media,
pelleted at low speed for 5 min, and then resuspended in FDMEM
supplemented with 100 µg/ml human apotransferrin and (in
µM): insulin 0.5, putrescine 60, tri-iodothyronine
1 × 10 3, -estradiol 1 × 10 6, progesterone 0.01, and sodium selenite 0.03 (termed TFDMEM). Cortical cells were plated at a density of
0.7-1.0 × 106 cells/well into Falcon 12-well
culture dishes precoated overnight with 180 µg/ml
poly-D-lysine and coated with 20% FBS in FDMEM for 2-3 hr
before plating. Cultures were grown for 3-6 d in vitro, without media change, in an humidified, 5% CO2,
37°C incubator. It should be noted that these cultures are a mixture
of neurons and glia with ~60% of cells MAP-2 positive on days 4-6
in culture.
Primary glial cultures were generated from the primary cortical
neuronal cultures by repeated washing of cells with FDMEM plus 10% FBS
over a period of 1-4 weeks after plating or by passage of cultures to
facilitate the elimination of neurons. Cortical glia and rat C6 glioma
cells were grown in FDMEM plus 10% FBS until use in transfections.
HeLa cells were grown in DMEM supplemented with 10% FBS and 2 mM glutamine. The non-neuronal cultures were grown in the
same incubator as the neurons.
Constructs and mutagenesis. To generate 5'- and 3'-GluR2
promoter deletion constructs, we amplified specific-length fragments of
the GluR2 promoter by PCR with Pfu polymerase using
oligonucleotides complementary to the GluR2 1.64 kb
XbaI-HindIII GluR2 fragment. 5'- and
3'-oligonucleotides contained NheI and BglII
restriction sites, respectively. Amplified DNA fragments were
restricted and cloned into the NheI and BglII
sites of the pGL2 basic vector upstream of the reporter gene firefly
luciferase. Recombinants were analyzed by restriction and sequence
analysis to confirm the location of the GluR2 promoter boundaries.
Throughout this report, construct boundaries [i.e.,
R2( 822/+320)luc] are defined relative to the 5'-most
major initiation site identified, 429 bases upstream from the
recognized GluR2 AUG.
To generate internal GluR2 silencer mutations in the context of the
R2( 302/+320)luc construct, we used a two-round PCR
mutagenesis protocol as described (Cormack, 1997 ). After the
second-round PCR reaction, the mutagenized DNA fragment was restricted
with NheI and BglII and cloned back into the pGL2
basic vector. To delete the GluR2 silencer, we replaced 25 bp spanning
the silencer element with an NsiI restriction site. This
construct is designated R2( 302/+320)luc- B. Substitution
mutations were introduced by replacing different 6 bp segments of the
silencer with either an EcoRI or an EcoRV
restriction site and were designated R2( RI)luc and
R2( RV)luc, respectively. Constructs that replaced the
GluR2 silencer with the Type II Na channel repressor element 1 (NaII-RE1) silencer in the context of the GluR2 promoter
[R2( NaII)luc], or likewise replaced the NaII-RE1
element with the GluR2 silencer in the context of the NaII promoter
[NaII( R2)luc], were also made using the two-round,
oligonucleotide-directed PCR mutagenesis protocol. The NaII promoter
construct without an RE1 element (pMB4) (Kraner et al., 1992 ) was
excised with EcoRI, blunted with Klenow, cloned into the
SmaI-digested pGL2 basic vector, and renamed
NaII( )luc. The NaII promoter construct retaining the RE1
silencer on a 118 bp fragment ( 1051 to 933) fused 5' of the NaII
minimal promoter region ( 134 to +177) as described (pSDK7) (Kraner et
al., 1992 ) and was cloned upstream of firefly luciferase by shuttling
it through the pBluescript HindIII-PstI
polylinker sites and into the pGL2 basic vector KpnI and
NheI sites. This construct was renamed NaIIluc.
All constructs described were confirmed by restriction and sequence
analysis and preserved the correct flanking sequences and silencer
orientations of their natural promoter contexts; e.g.,
R2( NaII)luc contains type II sodium channel RE1 silencer with GluR2 flanking sequence and the GluR2 antisense orientation. The
pairs of oligonucleotides used to introduce these mutations are the
following: to delete the silencer in GluR2,
R2( 302/+320)luc- B, sense TCCGACTATGCATCGGATGCGCAACAC
and antisense GCATCCGATGCATAGTCGGAGCTCTGG; the missense mutation
R2( RI)luc, sense AAAGCGCTGTGAATTCTGCTAAAATCGGATGCG and
antisense CCGATTTTAGCAGAATTCACAGCGCTTTAGTCGG; the missense mutation
R2( RV)luc, sense CTAAAGGATATCCCTCGGTGCTAAAATCGG and antisense CCGAGGGATATCCTTTAGTCGGAGCTC; to place the NaII RE1 silencer in the GluR2 promoter, R2( NaII)luc, sense
TGCTGTCCGTGGTTCTGAAATCGGAT and antisense AGAACCACGGACAGCACTTTAGTCG; to
place the GluR2 silencer in the NaII promoter,
NaII( R2)luc, sense GCACCGAGGACAGCGCTAGAGTCTCTGAAT and
antisense GCTGTCCTCGGTGCTAAAACCCAATTACAG.
A two-round PCR mutagenesis strategy was also used to introduce
systematically internal deletions of 25-30 bp in the
R2( 302/+320)luc construct to generate a "deletion
scan" of the proximal region of the GluR2 promoter. For each new
mutagenized construct, a unique 6 bp restriction (EcoRV,
NsiI, or StuI) site was introduced to allow easy
identification of recombinants. All mutant constructs were sequenced
for verification. The designations for the internal deletion mutants
are R2( 302/+320)luc- A through N, and the following GluR2 promoter regions are deleted: A, 227 to 197; B, 196 to 172; C, 171 to 147; D, 146 to 118; E, 117 to
90; F, 89 to 65; G, 64 to 40; H, 39 to 15; I,
14 to +14; J, +15 to +38; K, 3 to +74; L, +71 to +146;
M, +107 to +206; and N, +182 to +206. Oligonucleotide sequences
used to introduce internal mutations for the
R2( 302/+320)luc deletion scan are available on
request.
Transfections. Primary neurons were transfected on days 3-6
after plating. Primary glia were transfected either as confluent, unpassaged cells or at 90% confluency 2-3 d after passage, and C6
glioma cells were transfected similarly at 80-100% confluency. All
transfections were conducted in Falcon 12-well dishes with Lipofectamine according to the manufacturer's instructions. Per well,
1 µg of DNA, 50 µl of 150 mM NaCl, and 5 µl of
Lipofectamine were combined in 0.5 ml of TFDMEM media and incubated
with cells at 37°C for 5 hr. After transfection, the DNA and
Lipofectamine mixture was replaced with fresh TFDMEM (0.5 ml) for
primary neuronal cultures or with normal culture media for primary
glia, C6 glioma, and HeLa cells. Twenty-four hours later, cells were
rinsed with PBS and harvested by lysis. Cell lysates were cleared by
centrifugation and assayed for luciferase activity in a Turner TD-20e
luminometer. A preliminary time course study with the GluR2,
cytomegalovirus (CMV), and SV40 promoters in transfected cortical
cultures indicated that luciferase expression was maximal 24 hr after
transfection and decreased slowly by 48 and 72 hr.
For cotransfections, a similar protocol was used except the amount of
Lipofectamine was increased to 7.5 µl per well to accommodate the
additional DNA. The amount of the GluR2 promoter-firefly reporter construct was varied from 0.1 to 1.0 µg/well, and the amount of the
RE1-repressor factor plasmid (RESTexpress) (Chong et al., 1995 )
or the control plasmid pcDNA3 was held fixed at 0.25 or 0.75 µg/well,
and pBS vector was added to adjust the total DNA for all transfections
to a final concentration of 1.75 µg/well. Under these cotransfection
conditions, the amount of luciferase activity recovered in the cell
lysates varied linearly with the amount of pGL2 reporter plasmid DNA
transfected (data not shown). For nuclear respiratory factor-1
(NRF-1) cotransfections, 1 µg of pNRF-1 plasmid (Virbasius et
al., 1993 ) was mixed with 0.5 µg of the GluR2 promoter-reporter
construct .
All plasmid DNA preparations were prepared from 100 ml of 2xYT
cultures using Qiagen Maxi-DNA Prep columns. At least three independent
DNA preparations for each construct were transfected, in parallel, in
each experiment. Each individual DNA plasmid was transfected into
triplicate wells. For transfections into multiple cell types, a master
mix of the plasmid DNA, NaCl, Lipofectamine, and TFDMEM media was
prepared from which equal aliquots were delivered to the cells. In all
experiments, an SV40-luciferase or a CMV-luciferase control plasmid was
transfected into parallel wells to normalize GluR2 promoter activity
across multiple experiments and primary culture preparations. Where
indicated, luciferase activity was converted to moles of luciferase
(~2.2 Turner light units/10 18 mole) using a
standard curve generated with recombinant firefly luciferase under our
assay conditions.
Immunofluorescence. Primary neurons prepared as described
above were plated onto glass coverslips precoated with both
poly-D-lysine (overnight) and then fibronectin (20 µg/ml;
1-2 hr). Cultures were transfected with the
R2( 302/+320)luc or the R2( 134/+147)luc construct and fixed 24 hr later with 4% paraformaldehyde in PBS for 15 min. Cells were rinsed three times with PBS, permeabilized with 0.1%
w/v Triton X-100 in PBS for 5 min, washed, and then incubated in
staining buffer (2% horse serum in PBS) for 15 min. Cells were
incubated for 2 hr in staining buffer with rabbit anti-luciferase (1:200) and either mouse anti-GFAP (1:800) or mouse anti-MAP-2 (1:600)
and then rinsed four times for 5 min each with excess staining buffer
before incubation with the secondary antibodies, Texas Red-conjugated
donkey anti-mouse IgG (1:250) and FITC-conjugated donkey anti-rabbit
IgG (1:250), in staining buffer for 30 min. Cells were rinsed four
times for 5 min each as described above and mounted onto glass slides.
All washes and staining incubations were conducted at room temperature.
Fluorescence was visualized with a Zeiss Axioplan microscope using a
40× Plan-NEOFLUAR oil objective and appropriate fluorescent filters.
Cells positively identified for firefly luciferase expression were
counted and scored for positivity to either MAP-2 or GFAP
expression.
Nuclear extract and gel mobility shift assays. Nuclear
extracts were prepared from cultured cells according to the method of
Dignam et al. (1983) . For gel mobility shift assays, complementary oligonucleotides were purified by denaturing PAGE and then
annealed and 32P-labeled by Klenow fill-in of the 5'
overhangs for 25 min at room temperature. Labeled probes were
extracted, purified through a spin column, precipitated, and stored in
deionized water at 4°C until use.
In vitro binding reactions were conducted in 20 µl volumes
containing (final concentrations) 12 mM HEPES, pH 7.9, 4 mM Tris-HCl, pH 7.9, 60 mM KCl, 1 mM EDTA, 12% v/v glycerol, 1 mM DTT, 1 mM PMSF, 0.225 µg/µl BSA, 0.1 µg/ml poly dI:dC, and
5-10 µg of nuclear extract protein. Individual components of the
binding reaction were combined and incubated on ice for 15-30 min
before the addition of probe (~0.3 nM, final
concentration; 10-30 × 103 cpm) and then were
incubated at 22°C for 15 min. Where indicated, a 30-200-fold excess
of cold competitor oligonucleotides was added on ice 15-30 min before
addition of probe. After incubation, samples were separated on a 4%
polyacrylamide, Tris-glycine, glycerol gel. Dried gels were exposed to
Kodak X-OMAT film or to a Molecular Dynamics PhosphorImager plate for
visualization.
Double-stranded oligonucleotide probes used in the binding reactions
are the following (top strand): probe G,
GGCGCTGTGCGGGGGAGGGGTAGGTGCGCGA; probe H,
CTAGAGCTCCCTGCCTGCCTTGAGTCGGATC; Sp1 consensus,
ATTCGATCGGGGCGGGGCGAGC; g1 mutant,
GGCGCTGTGCTCTAGAGGGGTAGGTGCGCGA; and Krox-24 consensus, GGATCCAGCGGGGGCGAGCGGGGGCGA.
Statistical analysis. For comparison of the promoter
activities between two or more constructs within a given cell type, at least three plasmid preparations for each construct were transfected in
the same experiment. The order in which individual plasmid DNA
preparations were added to the wells for transfection was randomized to
reduce bias attributable to handling of the cells during the procedure.
Raw luciferase activity was normalized to the activity of either the
SV40 promoter or a defined control construct measured in parallel
wells. Data from multiple experiments (culture preparations) were
combined and analyzed by ANOVA followed by post hoc
Dunnett's tests for significance between means or, when appropriate,
Student's t tests. Comparisons of the promoter activities
between constructs were made within, and not across, cell types.
 |
RESULTS |
Multiple tissue-specific transcription initiation sites and
DNA methylation
Exon 1 and the proximal 5'-flanking sequence of the rat GluR2 gene
are shown in Figure 1A,
along with a schematic identifying the salient features. To identify
transcription initiation sites, we first conducted 5' RACE analysis of
rat brain mRNA. Multiple potential initiation sites were identified
from 286 to 481 bases upstream from the GluR2 translation
AUG codon. Most RACE 5' ends mapped to one of two clusters, from 286
to 295 or from 419 to 427 bp, with one end residing at 481 bp
(Fig. 1A, open triangles). The sequence of each RACE PCR product matched that of the genomic DNA
up through the anchor-priming site, reducing the likelihood that an
intron resides in the GluR2 5'-UTR, in accordance with previous
observations for the mouse GluR2 gene (Köhler et al., 1994 ).

View larger version (54K):
[in this window]
[in a new window]
|
Figure 1.
Features of the rat GluR2 promoter and 5'-flanking
region. A, Schematic showing the salient features of the
GluR2 promoter region and partial nucleotide sequence of the GluR2 5'
proximal promoter region, exon 1, and part of intron 1. The exon 1 sequence is in uppercase with the 5' promoter and intron
1 sequences in lowercase letters. mRNA 5' ends
identified by 5' RACE analysis are indicated by open
triangles, and those identified by RNase protection and primer
extension are indicated by solid or gray
circles, respectively. The 5'-most prominent initiation site
has been designated as the +1 transcription initiation site, located
429 bases 5' of the GluR2 AUG (bent arrow). Consensus
cis element sequences for the GluR2 silencer element and
Sp1/Krox-24 and NRF-1 transcription factors are identified by name
adjacent to the corresponding boxed sequence. The
boundaries of the initiation site region and the location of the
methylated CpG dinucleotide (CpGm; filled
diamond) are indicated in the schematic. The location of the
antisense PER2-3 oligonucleotide used for primer extension reactions
is indicated by double underlining below the nucleotide
sequence. B, GC content of the GluR2 promoter and exon 1 and a methylation-sensitive Southern blot. The average GC content ± 10 bp surrounding a central nucleotide was calculated and plotted
along the length of the GluR2 promoter. The dashed line
represents the average GC content (49.7%) for the whole 1.35 kb GluR2
promoter sequence shown. Open triangles, solid
circles, and gray circles refer to RACE, RNase
protection, and primer extension sites, respectively, as described in
A. The solid and open horizontal
bars above the GC plot represent the location of the GluR2
silencer and the Sp1/Krox-24 and NRF-1 regions, respectively. Also
shown are the locations of CpG dinucleotides in the GluR2 promoter. The
methylation state of the CpG dinucleotides was evaluated by sensitivity
to SacII, Eco47III, and
BssHII restriction digestion and represented by
S, E, and B, respectively.
The filled diamond represents a methylated CpG
dinucleotide in kidney and lung but not in cortex and cerebellar DNA,
whereas open diamonds indicate unmethylated CpGs in the
DNA from all four tissues. The blot at
left is an example of an AccI- and
SacII-restricted Southern blot showing tissue-specific
SacII digestion in cortex (Ctx) but not
in kidney (Kid) DNA; lung and cerebellar Southern blots
are not shown. The 1.3 kb fragment between the two AccI
sites (A) was radiolabeled as probe.
|
|
To further identify potential sites of transcription initiation in the
GluR2 gene, we used both primer extension and RNase protection analysis
of adult rat brain RNA (Fig. 2). Primer
extension analysis on cortical RNA using an oligonucleotide, PER2-3
complementary to the GluR2 5'-UTR, revealed multiple reaction products
extending from 312 to 452 nucleotides upstream from the GluR2 AUG
(Fig. 2B). None of these cortical RNA primer
extension products appeared in parallel reactions conducted with an
in vitro synthesized genomic GluR2 RNA control
(Ctl) that includes putative 5'-UTR sequence from 1
through 481 bases; this positive control also includes an additional
40 bp of non-GluR2 polylinker sequence (Fig. 2B, left lane). This result indicates that the multiple
extension products observed in cortical RNA reactions are not the
result of RNA secondary structure preventing the processivity of
reverse transcriptase. To determine which PER2-3 primed
extension products from cortical RNA were derived from GluR2, a
parallel primer extension reaction was run using unlabeled PER2-3
oligonucleotide as primer. Products from this reaction were then
Southern blotted onto a nylon membrane and hybridized with probe B, DNA
complementary to bases 192 through 481 5' of the GluR2 AUG (Fig.
2A). The results of this Southern blot, depicted in
the right lane of Figure 2B, confirm
the identity of nine GluR2 primer extension products. A single reaction
product at 312 was not confirmed by the Southern blot and is
presumably an artifact caused by extension from a non-GluR2 transcript.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 2.
Differential use of transcription initiation sites
in rat cortex and cerebellum. A, Schematic of the 5'
region of the GluR2 gene. Base positions indicated are relative to the
GluR2 AUG codon, and identified transcription initiation sites are
indicated by gray and solid circles as
described in the Figure 1A legend. The location
of the PER2-3 oligonucleotide used for primer extension and probes B,
C, and D are shown. Probes B and C encode identical sequence except
probe B was a DNA probe used in the Southern blot and probe C was an
antisense RNA used for RNase protection. Probe D was an RNA probe used
for RNase protection experiments. B, Primer extension
(p.e.) of rat cortical RNA and Southern blot
(s.b.). The 32P-labeled PER2-3
oligonucleotide-primed extension products from 30 µg of cortical RNA
(middle lane) are shown. Multiple bands are observed in
cortical RNA (Ctx) reactions ranging from 312 to 452
bases 5' of the GluR2 AUG; none of these bands was observed in the
control GluR2 in vitro synthesized RNA reactions
(left lane), indicating that secondary structure does
not account for the multiple bands observed in cortical RNA reactions.
When the cortical primer extension products, derived from a separate
reaction that used unlabeled PER2-3 oligonucleotide as primer, were
Southern blotted and hybridized with probe B, all extension products,
except the shortest, were positively identified as GluR2 (right
lane). C, RNase protection of 30 µg of adult
cortical (Ctx) and cerebellar (Cb) RNA.
Probe C detected multiple GluR2 5' ends both in cerebellar
(middle lane) and cortical (right lane)
RNA. The banding pattern shown here is nearly identical to that
observed by primer extension. The 5'-most band at 481 relative to the
AUG represents full-length probe sequence; therefore this band is a
summation of all GluR2 transcripts 481 bases and longer. An RNase
protection reaction to in vitro synthesized GluR2 that
also extends to 481 bases is shown in the left lane
(Ctl, Control). D, Regional distribution
in brain of long and short GluR2 transcripts. The design of probe D,
used for RNase protection experiments against 30 µg of RNA isolated
from the cerebellum and cortex of each of four rats, allows for the
summation of all GluR2 transcripts 360 bases and longer into a single
band on the gel as well as the identification of short GluR2
transcripts that initiate at 340 bases. Results for all four rats are
shown at the top and are summarized in the graph at the
bottom. Lines in the graph connect the
ratios of long versus short transcripts in cerebellum
(CB) and cortex (CX) for each rat.
Bar graphs are the mean ± SEM of all data and are significantly
different from each other (p < 0.05, paired
t test).
|
|
We also conducted RNase protection assays on rat cortical and
cerebellar RNA to confirm the primer extension findings. Using an
antisense RNA probe ( 192 through 481 bp of the GluR2 leader, probe
C in Fig. 2A), we again detected multiple bands
predicting different GluR2 5' ends in the cortex and cerebellum, and
these bands were in agreement with results obtained by primer extension (Fig. 2C). Major RNase-protected 5' ends mapped to 340,
368, 399, and 429 bp 5' of the GluR2 AUG codon, with additional
minor ends mapping to 452 and 481 bp. Because the riboprobe in this experiment included GluR2 sequence only to position 481 bp, the 481
band observed at the top of the gel (Fig. 2C, Cb
and Ctx lanes) is a summation of all natural GluR2
transcripts with 5' leaders at least this long. Despite this, however,
the intensity of the 481 band was much weaker than that observed for
shorter, more dominant mRNA species, indicating that long transcripts
were few in number. From these analyses, it seems that GluR2 initiates transcription from multiple dominant sites between 340 and 429 bases upstream of the GluR2 AUG, with a minority of transcripts initiating at 452 and 481 bases. Therefore, depending on the site
of transcription initiation, GluR2 mRNAs will contain a variable-length and unusually long 5'-UTR leader sequence (Kozak, 1987 ), a GC-rich 5'
end, an imperfect GU repeat (40 nucleotides), and two to five upstream,
out-of-frame AUG codons (Fig. 1A).
Although the banding pattern observed in cerebellar RNA was similar to
that in cortical RNA in the RNase protection assays, longer transcripts
appeared to predominate in the cerebellum (Fig. 2C). To
address this further, an RNase protection probe, probe D (Fig.
2A), was designed that summates all transcripts 360
bases and longer into a single protected band. This probe is also
partially protected by the major 340 transcript population. By
hybridizing this RNA probe to total cortical and cerebellar RNA derived
from each of four rats in separate reactions, we quantified the amount of long GluR2 transcripts ( 360 and longer) relative to the amount of
short GluR2 transcripts ( 340) as shown in Figure
2D. The ratio of long to short GluR2 transcripts was
greater in the cerebellum than in the cortex in each of the four rats
tested (Fig. 2D; p < 0.05, paired
t test). These results indicate that GluR2 initiation site
usage differs between these two brain regions and in a strict sense
supports the conclusion that the GluR2 gene contains multiple promoters.
We have designated the 5'-most dominant transcription initiation site,
approximately 429 bases from the GluR2 AUG, the +1 initiation site.
All plasmid constructs used in evaluating GluR2 promoter activity by
transient transfections are defined relative to this site. Our
designated +1 nucleotide for the rat gene is in agreement with the
5'-most start site identified for the mouse GluR2 gene (Köhler et
al., 1994 ), but there is clear evidence of minor transcriptional
initiation sites further upstream and additional major sites
downstream; indeed, 5' initiation sites are dispersed over >141 bp of
the GluR2 promoter region.
The GluR2 promoter region displays several areas of high (86%) and low
(14%) GC content (Fig. 1B, right). The
region of highest GC content spans ~150 bp adjacent to the +1 site,
includes some of the identified transcription initiation sites, and
identifies a CpG island that could be subject to regulation by
methylation in vivo. Indeed, when genomic DNA isolated from
adult rat cortex, cerebellum, lung, and kidney was codigested with
AccI and one of the methylation-sensitive enzymes
SacII, Eco47III, or BssHII, only the
SacII site at 568 bp was found methylated in a
tissue-specific manner. This SacII site was fully methylated
in kidney (Fig. 1B, 1.3 kb band) and lung
(data not shown) genomic DNA but only partly methylated in DNA
extracted from the cortex (Fig. 1B) and cerebellum (data not shown). In contrast, Eco47III and
BssHII restriction sites were unmethylated in all four
tissues tested (data not shown). The SacII digestion pattern
in cortex may be attributable to a combination of methylated glial DNA
and unmethylated neuronal DNA in the sample, or it may reflect
methylation of a single GluR2 allele. Although methylation of CpG
dinucleotides increases the informational content of genes, the
biological significance of the tissue-specific methylation of the GluR2
promoter remains to be addressed.
The GC-rich proximal area also contains consensus recognition sequences
for Sp1/Krox-24 and the NRF-1 transcription factors (Fig.
1A, box areas). The regulatory role
of these cis elements is evaluated below. Regions more
distal from the +1 site exhibit a low GC content, minimal at consensus
TATA box sequences at 760 and 361 bp and also at the GluR2
initiation AUG codon (Fig. 1). No TATA box element is near any of the
transcriptional initiation sites identified. A weak consensus sequence
for the pyrimidine-rich initiator element lies near the major 5'
initiation site cluster at bp +3 to +11 (Javahery et al., 1994 ). The
absence of a TATA box near transcription initiation sites is a common
feature in mammalian genes, including glutamate receptor genes such as
NR1, NR2B, NR2C, and KA-2 (Bai and Kusiak, 1993 ; Suchanek et
al., 1995 ; Sasner and Buonanno, 1996 ; Huang and Gallo, 1997 ), and mouse
GluR2 (Köhler et al., 1994 ). Overall, the nucleotide sequence
similarity between the mouse and rat GluR2 promoter regions is high
with a 90-95% sequence identity over 1.2 kb of the proximal promoter region, including 0.8 kb 5' of the +1 transcription initiation site.
Identification of a minimal promoter region
We generated a series of 5'- and 3'-GluR2 promoter deletion
constructs and transfected these into primary cortical and primary glial cultures to define the boundaries of a minimal GluR2 promoter region and to identify cis elements that govern the
cell-specific expression of GluR2. These constructs were also used to
evaluate the role of consensus TATA and CAAT box sequences residing
upstream in the GluR2 5' promoter. Whether deletions were made from the 5' or the 3' side, substantial luciferase expression was observed in
primary cortical cultures when the region delimited by all transcription initiation sites ( 52 to +144; Fig.
3A, vertical dashed lines) was included in the promoter construct
(Fig. 3B). A similar pattern of promoter activity was
observed when these same constructs were transfected into primary glia
(Fig. 3C) or HeLa cells (data not shown), with the exception
that changes in promoter activity were generally less marked and,
overall, promoter strength relative to SV40 was much lower than that
observed in neurons. From these experiments it seems that GluR2
promoter activity is strongly dependent on cis elements
positioned between 134 and +320 bp (Fig.
3A,B).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 3.
5' and 3' deletion analysis of the GluR2 promoter.
A, A series of 5' and 3' deletion constructs was
generated by PCR and cloned into the NheI and
BglII sites of the pGL2 basic vector, upstream of
firefly luciferase, for transfection into cultured cells. The
boundaries of the promoter constructs are defined relative to the +1
transcriptional initiation site (Fig. 1A) and are
indicated on the left, as are the relative locations of
TATA and CAAT box sequences and the GluR2 AUG codon (A;
bottom). The area spanning all identified transcription
initiation sites is indicated by the vertical dashed
lines, and the +1 initiation site is marked with an
arrow. B, Independent constructs were
transfected into cortical neurons, and the promoter activity was
normalized to that of SV40 to allow pooling of data from multiple
experiments. When a deletion construct eliminated part of the
transcription initiation site region, a significant drop in GluR2
promoter activity was observed. However, no single initiation site was
essential for promoter activity. Note that these cortical neuronal
cultures are a mixture of neurons (~60%) and glia (~40%).
C, When constructs were transfected into pure cultures
of primary glial cells, similar results were observed except that GluR2
promoter activity was very weak compared with that in neurons. Note the
different scales of the x-axes in B and
C. D, Short promoter fragments were made
by PCR to identify the minimal boundaries of the GluR2 promoter region
necessary for strong neuronal expression. The locations of identified
transcription initiation sites are shown with the same
symbols used in Figure 1A.
E, Transfection of minimal constructs into cultured
cortical neurons shows again that elimination of part of the
transcription initiation site region (dashed lines
in D) significantly reduced promoter
activity. F, Similar results were observed in parallel
transfections into cultured glia, and again, promoter activity was weak
compared with that in the neurons. In these glial transfections, the
SV40 construct had unusually low promoter activity, resulting in an
artificially high ratio of GluR2 to SV40 activity on the
x-axis. Results shown are the mean ± SEM for
12-33 plasmid transfections in 47 neuronal cultures in
B, for 3-9 plasmid transfections in 17 primary glial
cultures in C, for 7-20 plasmid transfections in 20 neuronal cultures in E, and for 7-20 plasmid
transfections in 9 glial cultures in F.
*p < 0.05 from the
R2( 134/+147)luc construct by ANOVA and post
hoc Dunnett's tests. Statistical analysis was not conducted on
data in B and C. The average raw
luciferase activity for the R2( 302/+320)luc construct
in neurons and glia was 1610 ± 160 and 4.1 ± 1.2 attomoles
of luciferase per µg of DNA per well, respectively.
|
|
To define this region of the GluR2 promoter further, we designed
shorter constructs that eliminated portions of this central promoter
area ( 134 to +320 bp), from either the 5' or the 3' side, and
transfected these constructs into primary cortical neurons and glia.
Among these, R2( 134/+147)luc, which spanned all identified initiation sites, possessed more than twice the promoter activity of
any of the shorter constructs (Fig.
3D,E). For example, when 44 bp were
removed from the 3' end of R2( 134/+147)luc to generate R2( 134/+103)luc, promoter activity was reduced by 53% in
neurons, and likewise, when 124 bp were removed from the 5' end to make R2( 10/+147)luc, promoter activity was reduced by 86% in
neurons (Fig. 3E). Similar effects of these deletions on
promoter strength were observed in primary glia (Fig.
3F) and C6 glioma cells (data not shown), except
promoter activity in glia was again much weaker than that in primary
cortical cultures. The promoter activity of the R2( 169/+103)
construct was identical to that of R2( 98/+103) (Fig.
3D,E), indicating that the sequence
between 169 and 98 bp plays no role in expression under our
conditions. Judging from the activities of the constructs depicted in
Figure 3, it appears that dual regions within the GluR2 central
promoter area may be needed for optimum expression in both cortical
neuronal and glial cells. The upstream region, from 98 to 10 bp,
consists of a GC-rich sequence that includes the putative Sp1/Krox-24
and NRF-1 elements and minor initiation sites. The downstream region,
from +103 to +147 bp, includes a cluster of RACE 5' ends (Fig.
1A) and a consensus sequence for metal element
protein-1 (MEP-1) at bp +127 to +133 on the antisense strand. From
these short constructs, we provisionally identify the entire 98 to
+147 sequence as a minimal GluR2 promoter region that appears
sufficient for strong expression in cortical cultures.
We also evaluated the functional role of upstream TATA box elements
using constructs R2( 822/ 743)luc and
R2( 822/ 332)luc. Both of these constructs produced little
or no activity in both neurons or glia (Fig.
3B,C), eliminating a major role for
the upstream TATA boxes. Similarly, inclusion of the tandem CAAT boxes at bp 317 and 324 in the R2( 822/ 134)luc construct
also produced very low activity in neurons and glia. These functional
results support our RACE, RNase protection, and primer extension
findings that failed to demonstrate an association between
transcription initiation sites and upstream TATA boxes and indicate
that the GluR2 gene functions as a TATA-less promoter, as suggested by Köhler et al. (1994) . A construct, R2( 822/+832)luc,
which contained 0.77 kb of 5' promoter sequence, all of exon 1, and
part of the GluR2 intron 1, also showed no significant change in
promoter activity in cortical cultures or primary glia (data not
shown), indicating that in transiently transfected cortical cultures, the first GluR2 intron does not appear to harbor promoter regulatory elements.
Neural specificity of the GluR2 promoter
We transfected primary cortical neuronal and primary glial
cultures, as well as C6 glioma and HeLa cell lines, with the
R2( 302/+320)luc construct to evaluate the neural
specificity of the GluR2 promoter. Judged by the percentage of stained
cells after transfection with a Rous sarcoma virus
(RSV)- -galactosidase expression plasmid, typical
transfection efficiencies were 0.5-1% for primary neurons, 6-8% for
primary glia, and 10-20% for the transformed cell lines (Table
1). Even though transfection efficiencies
in the cultured neurons were low, the total raw firefly luciferase
activity of the R2( 302/+320)luc construct was quite strong
in these cultures, on the order of 3000 Turner light units (TLU) per
µg of transfected DNA per well (background, ~0.10 TLU/well). This
signal corresponds to 1.42 ± 0.01 fmols of luciferase per µg of
DNA (n = 80). We estimate that in each transfection up
to 9000 neurons contribute to the total signal, based on transfection
into triplicate wells, 1 × 106 cells/well
plated, an RSV-lacZ transfection efficiency of 0.5%, and a
60% fractional neuronal cell population in the culture.
When luciferase activities were normalized to SV40- or the CMV-promoter
activity in each experiment and the average relative activity was
calculated in neurons, primary glia, C6 glioma, and HeLa cells, the
R2( 302/+320)luc construct appeared to be 37-400-fold neuronal-selective. These values, however, are overestimates caused by
the preferred activities of the SV40 and CMV viral promoters in the
non-neuronal cells (Table 1). Nonetheless, when viral promoter cell
preferences are accounted for, the R2( 302/+320)luc construct still exhibited a neuronal selectivity of up to 72-fold.
We also analyzed our data on a per-transfected-cell basis by counting
the actual number of RSV-lacZ transfected cells in parallel wells stained with
5-bromo-4-chloro-3-indolyl- -galactopyranoside. Over four
experiments, the average R2( 302/+320)luc promoter
activity, per transfected cell, was 0.661 ± 0.138 TLU in cortical
cultures, 0.022 ± 0.002 TLU/cell in cultured glia, and 0.034 ± 0.019 TLU/cell in C6 glioma cells. The average ratio of cortical
neuronal to glial and C6 glioma promoter activities, per cell, from all
experiments, showed that GluR2 promoter activity was 32.5 ± 3.9- and
26.6 ± 8.6-fold more active in the cortical neurons than in cortical glia and C6 glioma cells, respectively.
To provide another estimate of cell selectivity, transfected cortical
neuronal cultures were costained with an anti-firefly luciferase
antibody and either anti-MAP-2 or anti-GFAP antibodies 1 d after
R2( 302/+320)luc transfection. Of 923 luciferase-positive cells counted, >97% also expressed the neuron-specific marker MAP-2
(Fig.
4A,B).
When immunostainings were conducted in parallel cultures to identify
expression in glial cells, only 6 of 645 luciferase-positive cells
costained for the glial specific marker GFAP (data not shown). In these
six copositive cells, luciferase expression was marginally discernible
above background fluorescence, indicating that even in these glial
cells GluR2 promoter activity was weak. On the other hand, when
cortical cultures were transfected with the CMV-luc
construct, strong anti-luciferase staining in GFAP-positive cells was
observed, indicating that transfected glial cells in the primary
neuronal cultures were capable of strong luciferase expression (data
not shown). These results together demonstrate that the GluR2 promoter
is a strong, neuron-selective promoter that is ~30-fold stronger in
primary neurons than in primary glia.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 4.
Minimal GluR2 promoters restrict luciferase
expression to neurons. The GluR2 promoter constructs
R2( 302/+320)luc (A, B)
or R2( 134/+147)luc (C,
D) were transfected into day 5 primary cortical neuronal
cultures and double-immunostained 24 hr later with rabbit
anti-luciferase (anti-luc) (A,
C) and mouse anti-MAP-2
(B, D) primary antibodies as described in
Materials and Methods. A, A cell with neuronal
morphology stained positive for luciferase expression, as detected by
the goat anti-rabbit FITC-conjugated secondary antibody.
B, The same cell in A is also positive
for the neuronal-specific antigen MAP-2 (arrow),
detected with a donkey anti-mouse Texas Red-conjugated secondary
antibody. From five R2( 302/+320)luc transfections in
which 923 luciferase-positive cells were counted, >97% were clearly
positive for the MAP-2 antigen. C, Another cell with
neuronal morphology was positive for luciferase expression, as
described in A, except the culture was transfected with
the R2( 134/+147)luc minimal promoter construct.
D, The same field as in C identified the
transfected cell as MAP-2-positive (arrow). From two
R2( 134/+147)luc transfections in which 146 luciferase-positive cells were counted, >93% were clearly
MAP-2-positive. Scale bar: A-D, 50 µm.
|
|
Because the GluR2 minimal promoter region also showed strong activity
in neurons, we were interested in determining, by immunofluorescence, whether a minimal promoter construct could regulate
cell-type-selective GluR2 expression in the mixed neuron-glia
cortical cultures. When cortical cultures were transfected with
R2( 134/+147)luc, >93% of 146 luciferase-positive cells
costained positive for MAP-2 (Fig. 4C,D),
indicating that elements in this region of the promoter appear
sufficient to guide selective luciferase expression in transfected
primary cortical neurons.
Deletion scan of the GluR2 promoter identifies a silencer element
and a positive regulatory region
To identify elements more precisely within the proximal promoter
that regulate GluR2 expression, we made internal deletions in the
R2( 302/+320)luc construct and analyzed these by
transfection into cortical neuronal and glial cultures, in parallel, as
above. Most constructs substituted a unique 6 bp restriction enzyme
site for 25-30 bp of GluR2 promoter sequence; the deletions in K, L, and M were larger (Fig.
5B). For each experiment,
three or more independent plasmid DNA preparations for each construct
were transfected into the cells. By this analysis, we identified a 25 bp region that, when deleted in the R2( 302/+320)luc- B
construct, resulted in a significant increase in expression in glial
cells but not in neurons (Fig. 5B).
R2( 302/+320)luc- D, which eliminated the 146 to 118
region, resulted in a 47% increase in promoter activity in neurons but
not in glia, suggesting that this region of the GluR2 promoter may
negatively regulate expression in neurons. Three other 25-30 bp
deletion constructs, G, H, and I, caused a significant
reduction in luciferase expression in both neurons and glial cells. In
these cases, promoter activity in each cell type dropped by 35-65%
compared with that of the parent R2( 302/+320)luc construct, even though the basal promoter activity differed ~35-fold in the two cultures (Fig. 5A). Results found in transfected
C6 glioma cells were similar to those in glia (data not shown). The G, H, and I internal deletion constructs span the region from 64 to +14 bp and include the consensus sequences for Sp1/Krox-24 and
NRF-1. The L deletion (+71 to +146) also resulted in a reduction in
promoter activity that was marginally greater in glia than in the
neuronal cultures. This deletion mutant eliminated the most 3'
initiation site identified by primer extension and RNase protection
(Fig. 2A,B, 340 band), the 3'
cluster of RACE 5' ends, and a putative MEP-1 element. In contrast, the
deletion of other major transcription initiation sites in the J,
K, and M constructs did not reduce luciferase expression.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Mutation sensitive scan of the proximal GluR2
promoter identifies both positive and negative regulatory regions.
A, The promoter activity of the base construct
R2( 302/+320)luc in cultured neurons (N;
n = 63) and glia (G;
n = 46), relative to SV40luc
activity, is shown. Data are the mean ± SEM combined from all
experiments. The average raw luciferase activity recovered from neurons
and glia for the unmutated R2( 302/+320)luc control was
1320 ± 120 and 31 ± 14 attomoles per µg of DNA per well,
respectively. B, A series of short internal deletions
( A through N, typically 24-31 bp long, except K, L, and
M) were generated by replacement with unique 6 bp restriction sites
in the R2( 302/+320)luc GluR2 context. All deletions
were generated by PCR and are shown schematically at the
top. Dashed lines indicate the sequence
deleted for the indicated construct (uppercase letters).
Gray and solid circles and open
triangles on the line indicate the locations of
primer extension, RNase protection, and RACE 5' ends, respectively.
Open boxes identify the locations of Sp1/Krox-24 and
NRF-1 consensus sequences; the black box identifies the
GluR2 silencer that is homologous with the RE1/NRSE silencers. The
effect of each internal mutation on promoter activity in cultured
cortical neurons and glia is shown. Luciferase activity was normalized
to that of the unmutated R2( 302/+320)luc control
construct. Note the log scale on the y-axis. The
R2( 302/+320)luc- B construct resulted in a
significant twofold increase in promoter activity in glia. Likewise the
R2( 302/+320)luc- D deletion resulted in a
significant increase in promoter activity in neurons. Three other
deletions, R2( 302/+320)luc- G, - H, and - I,
resulted in significant decreases in promoter activity in both glia and
neurons. This internal deletion scan identified both a silencer region
that negatively regulates GluR2 promoter activity in glia and a larger
78 bp region that positively regulates promoter activity in both
neurons and glia. Data shown are the mean ± SEM for 6-18 plasmid
transfections in 21 cultured neuronal preparations and for 6-8
transfections in 18 cultured glial preparations. lucif,
Luciferase. *p < 0.05 and **p < 0.01 indicate significance from the control construct by ANOVA and
post hoc Dunnett's tests.
|
|
The pattern of expression from these internal deletion constructs
complements our findings from the external 5' and 3' deletion series
(Fig. 3) and allowed us to provisionally eliminate up to 364 bases of
the GluR2 promoter from further consideration. We focused our attention
on the non-neural silencer element identified in deletion
R2( 302/+320)luc- B and the positive regulatory region identified in deletions R2( 302/+320)luc- G, - H, and
- I.
The GluR2 silencer is a cell-specific modulator of expression, not
a switch
Inspection of the GluR2 promoter sequence revealed a 21 base
element with 71% identity to both the rat NaII-RE1 (Maue et
al., 1990 ; Kraner et al., 1992 ) (Fig.
6A) and the rat SCG10
gene neuron-restrictive silencer element (NRSE) (Mori et al., 1992 ).
This RE1/NRSE-like element in the GluR2 promoter is located on the
antisense strand at bp 174 to 194 (Fig. 1A) and
had been deleted entirely in the R2( 302/+320)luc- B
construct (Fig. 5B). Given the sequence similarity, we
investigated the role of the putative GluR2 silencer in regulating
R2( 302/+320)luc promoter activity in neuronal and non-neuronal cells. When the entire GluR2 silencer was replaced with an
NsiI restriction site (Fig. 6A, B) or
different 6 bp stretches were substituted by 6 bp EcoRI or
EcoRV restriction sites (Fig. 6A,
RI, RV), significant two- to
threefold increases in R2( 302/+320)luc activity were
observed in glia and C6 gliomas (Fig. 6B). Similar
results were observed when these same mutations were introduced into
the context of a larger R2( 822/+320)luc promoter construct
(data not shown). No changes in neuronal expression were observed by
any of these mutations (Fig. 6B), demonstrating that
silencing activity was specific to non-neuronal cells alone. These
results are consistent with known RE1/NRSE silencers in other genes, in
which short internal missense mutations are sufficient to disrupt
silencing activity in non-neuronal cells (Kraner et al., 1992 ; Mori et
al., 1992 ; Li et al., 1993 ; Mieda et al., 1997 ).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
A weak GluR2 silencer interacts with the repressor
REST. A, Schematic showing the location and antisense
orientation of the silencer in the GluR2 promoter. The native (GluR2)
and mutagenized silencer elements introduced into the
R2( 302/+320)luc promoter construct are listed.
Dashes represent deleted sequence, and
lowercase, boldface type represents
substitution mutations. The B mutation is the same mutation as the
internal deletion construct depicted in Figure 5. The NaII-RE1 sequence
shown is the Type II Na channel RE1 silencer (Kraner et al., 1992 ),
which differs from GluR2 in six positions. B, Functional
analysis of silencer mutations on GluR2 promoter activity in primary
cortical neurons, primary cortical glia, and C6 glioma cells. In
neurons, no mutation resulted in a significant change in promoter
activity from that of the R2( 302/+320)luc control. In
primary glia and C6 glioma cells, all three silencer mutations resulted
in two- to threefold increases in GluR2 promoter activity. Data shown
are the mean ± SEM for 12-24 plasmid transfections in neurons,
14-22 plasmid transfections in glia, and 6-34 plasmid transfections
in C6 gliomas from 10, 9, and 7 culture preparations, respectively.
*p < 0.05 from the control by ANOVA and
post hoc Dunnett's test. The error bar for the control
(R2) represents the average SE among control
plasmids. C, Promoter context independence of the GluR2
silencer. The GluR2 silencer was replaced by the NaII-RE1 silencer (see
A) in the context of the
R2( 302/+320)luc promoter. Likewise, the NaII-RE1
silencer was replaced by the GluR2 silencer in the context of the NaII
promoter construct. These constructs were transfected into primary
neurons, glia, and C6 glioma cells. The NaII-RE1 silencer in the
context of the GluR2 promoter (black bars) reduced
promoter activity by 30-47% relative to that of the unmutated
R2( 302/+320)luc control (open bars
defined as 100%) in glia and C6 glioma cells. In contrast, the GluR2
silencer in the context of the NaII promoter (gray
bars) increased promoter activity by 54-61% relative to that
of the unmutated NaII minimal promoter control (open
bars also) in glia and C6 glioma cells. The effect of the
alternative silencer in each of the promoters was significant from
their respective controls; *p < 0.05, Student's
t test. Data shown are the mean ± SEM for 8-9
plasmid transfections in neurons and 8-15 transfections in glia and C6
gliomas, all from three to five culture preparations for each cell
type. D, Cotransfection of REST represses GluR2 promoter
activity in neurons. The GluR2 silencer in the context of
R2( 302/+320)luc was either unchanged
(gray circles), deleted (open
circles), replaced by the NaII silencer (black
circles), or replaced by tandem GluR2 silencers (hatched
circles) and then cotransfected into cultured cortical neurons
with 0.75 µg of pCMV-RESTexpress per well or the pcDNA3 empty vector.
The amount of R2( 302/+320)luc reporter plasmid was
varied from 0.1 to 1.0 µg/well, and all tubes were balanced to 1.75 µg of total DNA/well with carrier DNA (pBluescript). REST
cotransfection reduced GluR2 promoter activity by 20-42% from that of
the pcDNA3 control in neurons in a silencer-dependent manner. This
effect by REST was observed at all concentrations of input GluR2
promoter DNA tested (D, left). When
luciferase activities were normalized to those of the
silencer-deficient construct R2( 302/+320)luc- B and
pooled (right, open bar), REST coexpression reduced
GluR2 promoter activity in neurons by an average of 37% (right,
gray bar). Results are the mean ± SEM for 3-14
cotransfections in 14 culture preparations. Identical results were
obtained using two independent preparations of pCMV-RESTexpress, pcDNA,
and pBluescript plasmid DNA. *p < 0.05 or better
from all other groups at the designated amount of input DNA
(left, ANOVA and post hoc Dunnett's) or
from the silencer-deficient construct (right, Student's
t test).
|
|
Because the GluR2 silencer was only 71% identical with the NaII-RE1
element and the effect of deleting this element was moderate (two- to
threefold) when compared with homologous RE1/NRSE silencers (Kraner et
al., 1992 ; Mori et al., 1992 ; Li et al., 1993 ; Wood et al., 1996 ; Mieda
et al., 1997 ), we compared the ability of the GluR2 and the NaII-RE1
silencers to repress both GluR2 and NaII promoter (NaIIluc)
activities in glia, C6 glioma, and neuronal cells. When the GluR2
silencer was mutated to that of the NaII-RE1 sequence in the context of
the GluR2 promoter, this substitution resulted in a 30-47% decrease
in promoter activity in non-neuronal cells (Fig. 6C,
black bars) relative to that of the unmutated R2( 302/+320)luc control. Conversely, when the NaII
silencer in the context of the NaII promoter was mutated to that of the
GluR2 silencer sequence, promoter activity was increased by 54-61% in non-neuronal cells (Fig. 6C, gray bars),
indicating that repression by the NaII silencer was lessened by
substitution with the GluR2 silencer. The effect of swapping these
silencer elements was specific to the non-neuronal cells because no
changes in neuronal expression were observed. For all of these
constructs, the flanking nucleotide sequences and the orientation of
the silencer element in each minimal promoter context were carefully
preserved (Fig. 6C, top). Together, these results
demonstrate that the NaII-RE1 silencer is more effective than the GluR2
silencer and indicate that their relative strengths are because of
differences in their nucleotide sequence rather than differences in
silencer orientation or in the context of the promoters in which they
reside. This conclusion is further supported by the observation that
both the NaII and the GluR2 minimal promoter constructs used for these
experiments, in the absence of either silencer, had similar promoter
activities in glia (2.0 and 3.5% of SV40, respectively) and C6 glioma
cells (16.5 and 18.1%, respectively).
We also investigated whether the GluR2 silencer could interact with a
known repressor factor, REST (Chong et al., 1995 ), also known as
neuron-restrictive silencer factor (NRSF) (Schoenherr and
Anderson, 1995 ) or X2 box repressor (XBR) (Scholl et al., 1996 ), by cotransfecting the pCMV-RESTexpress plasmid with GluR2 promoter constructs into cultured neurons (Fig. 6D).
There are three important considerations in the design of this
cotransfection experiment. First, it is important to compare the effect
of REST on normal and mutated GluR2 silencers to eliminate indirect
effects of REST on other regions of the GluR2 promoter or on the
expression of other endogenous genes. Second, it is necessary to
cotransfect with an empty CMV vector, pcDNA3, as a control for indirect
effects of the CMV promoter on luciferase expression. Third, it is
necessary to demonstrate that simple inclusion of additional DNA in the transfection mix does not change transfection efficiency. Regarding the
latter, luciferase activity was found to be linearly related to the
amount of input R2luc DNA between 0.1 and 1.5 µg/well, and
luciferase activity was not influenced by adding carrier pBluescript DNA (data not shown). The cotransfection experiments are summarized in
Figure 6D. The RESTexpress plasmid in the
transfection cocktail was fixed at 0.75 µg/well, the GluR2 promoter
construct was varied from 0.1 to 1.0 µg/well, and all tubes were
balanced with carrier DNA (pBluescript) to a final mass of 1.75 µg of
DNA per transfected well. Compared with the pcDNA3 control, the
pCMV-RESTexpress cotransfections resulted in a consistent 20-42%
reduction in neuronal R2( 302/+320)luc promoter activity
when the reporter construct contained an intact GluR2 or NaII-RE1/NRSE
silencer element (Fig. 6D, left). REST coexpression actually increased GluR2 promoter activity in neurons transfected with the GluR2 construct lacking a silencer, presumably because of an action of REST on other genes. Thus, when the data across
all input DNA amounts were pooled and normalized to the activity of the
construct lacking the GluR2 silencer, a significant 37% REST-mediated
reduction in GluR2 promoter activity was observed (Fig.
6D, right). The addition of an extra GluR2
silencer element, or the substitution of the GluR2 silencer by the
NaII-RE1 silencer, did not significantly enhance the effect of REST.
Presumably the NaII-RE1 element was no more effective than the GluR2
silencer because 0.75 µg of pCMV-RESTexpress was saturating in both
cotransfections. The consistent ability of REST to reduce GluR2
promoter activity in neurons in a silencer-dependent manner indicates
that in intact cells the REST repressor can bind the GluR2 silencer to
modify GluR2 promoter activity.
Functional NRF-1 and Sp1 cis elements in the
GluR2-positive regulatory region
Based on the internal deletion scan, it was concluded that
elements within the R2( 302/+320)luc- G, - H, and - I
deletions must contribute to GluR2 promoter activity. As shown in
Figures 1A and 5B, these regions harbor
consensus sequences for Sp1/Krox-24 and NRF-1 elements and, within the
H deletion, an element with 75% identity with the partial dyad
(Patankar et al., 1997 ). We introduced substitution mutations
into or near these elements to determine specifically whether these
elements were necessary for GluR2 promoter activity in neurons. When
six bases of the NRF-1 element were substituted with a BglII
site (AGATCT) to generate the R2( 302/+320)luc- i1
construct (Fig. 7A), a 46 and
26% drop in promoter activity was observed in cortical neurons and
cortical glia, respectively (Fig. 7B, gray
bars). The effect of this mutation approaches the effect
observed for the larger R2( 302/+320)luc- I deletion in
neurons and is consistent with the effect of mutations introduced into
other NRF-1 elements (Virbasius et al., 1993 ; Seelan et al., 1996 ). The
R2( 302/+320)luc- K deletion, generated by excising the
sequence between two natural BssHII sites, eliminated all of
the sequence in the I deletion except for the NRF-1 consensus element, and yet this construct did not decrease but, instead, slightly
elevated promoter activity in neurons and glia (Fig. 7B,
black bars). This result strongly suggests that the
consensus NRF-1 sequence is a functional regulatory element in the
GluR2 promoter. However, because the NRF-1 element is GC-rich and might therefore interact with factors other than NRF-1 (e.g., Sp1), we
cotransfected the NRF-1 transcription factor (under the CMV promoter)
with the unmutated R2( 302/+320)luc control construct and
the mutated R2( 302/+320)luc- I and - i1 constructs
into neurons (Fig. 7C). NRF-1 cotransfection increased GluR2
promoter activity approximately twofold, but only when the GluR2
promoter construct contained an unmutated NRF-1 cis element
(Fig. 7C). The lack of a larger effect by the cotransfected
NRF-1 may be attributable to the presence of endogenous NRF-1 or some
other transcription factor in the cortical neurons. These results
indicate that the NRF-1 cis element sequence supports
positive GluR2 promoter activity in neurons and suggests, but does not
prove, that the NRF-1 transcription factor is a component of the
transcriptional complex in vivo.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 7.
Contribution of the NRF-1 element to GluR2
promoter activity. A, Schematic of the positive
regulatory domain, 64 to +38 bp, of the GluR2 promoter region is
shown with regulatory cis elements as shaded
bars above the sequence;
gray and solid circles and
triangles signify some of the transcription initiation
sites described in the Figure 1A legend. Internal
deletion and substitution mutations introduced into the
R2( 302/+320)luc construct are shown by open
bars below the sequence and identified. Deletion mutants are
signified by " ," and base-for-base substitution mutations are
signified by " ." Deletion constructs are the same as those in
Figure 5. B, Multiple plasmid DNA preparations for each
construct were transfected into cultured cortical neurons or cortical
glia, and luciferase activity was measured 1 d later. Promoter
activity of the mutated constructs was compared with that of the
R2( 302/+320)luc control construct
(Con). The h1, h2, and h3 substitution
mutations had no effect on GluR2 promoter activity in neurons and glia
and did not replicate the effect of the larger H deletion construct,
indicating that the effect of the H deletion is not dependent on
nucleotide sequence (i.e., the partial dyad). In contrast, both the
I and i1 mutations resulted in a reduction in promoter activity
in neurons and glia, whereas the K and h3 constructs that modify
the sequence immediately adjacent to the NRF-1 element were without
effect. Together these results identify the consensus NRF-1 as a
positive regulator of GluR2 promoter activity. Results shown are the
mean ± SEM for 8-12 plasmid transfections into four to five
cultures. *p < 0.05 from the control group by
ANOVA and post hoc Dunnett's tests. C,
One microgram of a plasmid expressing the NRF-1 transcription factor
(black bars) or an empty pcDNA3 vector
(cross-hatched bars) was cotransfected
with 0.5 µg of R2( 302/+320)luc (Con)
or the i1 or the I mutation constructs into neurons. Data were
normalized to the activity of a parallel SV40-luc
transfection in each experiment. The NRF-1 cotransfection increased
promoter activity in the control construct but not in those constructs
with a compromised NRF-1 cis element. Results are the
mean ± SEM in five neuronal cultures. *p < 0.05 from the pcDNA3- (no NRF-1) transfected group, Student's
t test.
|
|
The NRF-1 element partially overlapped the
R2( 302/+320)luc- H deletion construct (Fig.
7A), and also because the nucleotide sequence within the
H deletion resembled the partial dyad motif described previously
(Patankar et al., 1997 ), we introduced additional short substitution
mutations into this portion of the GluR2 promoter, again in the context
of R2( 302/+320)luc (Fig. 7A). All three substitution mutations, R2( 302/+320)luc- h1 (TCTAGAT),
- h2 (CGAGT), and - h3 (AGATC), were without significant effect on
GluR2 promoter activity in both neurons and glia (Fig. 7B,
hatched bars), indicating that neither the partial dyad nor
another unidentified element in this region of the promoter contributed
to GluR2 promoter activity. The strong effect of the large H
deletion may be caused by disruption of a single base of the NRF-1
element or, more likely, caused by disruption of an appropriate
architectural distance between the functional NRF-1 and Sp1/Krox-24
(see below) elements.
A third consensus element within the GluR2-positive regulatory region
that we investigated by mutation analysis was the consensus Sp1 and
Krox-24 sequence at 47 to 60 bp. This sequence was entirely deleted
in the internal deletion R2( 302/+320)luc- G construct, resulting in a significant 35-50% reduction in promoter activity in
both neurons and glia (Fig. 5B). When four bases of the
consensus element were mutated (TCTA) by base substitution to generate
R2( 302/+320)luc- g1, a nearly identical reduction in
GluR2 promoter activity was observed (Fig.
8A,B),
suggesting that it is the consensus Sp1/Krox-24 sequence, and not the
immediate flanking sequence within the larger G deletion construct,
that is important for GluR2 promoter activity. To differentiate between
an Sp1 and Krox-24 component for GluR2 expression in neurons, we
prepared nuclear extracts from cultured cortical neurons and combined
these extracts with 32P-end-labeled double-stranded
oligonucleotide probes in vitro. Oligonucleotide probes
consisting of the G and H sequences shown in Figure
8A produced different protein-DNA complexes in
nondenaturing gel mobility shift experiments (Fig. 8C).
Probe G formed three major complexes that were effectively competed
away by 200-fold molar excess of cold probe (compare Fig.
8C, lanes 2-3). Excess Sp1 oligonucleotide
competed away bands 1a and 1b but was less effective on band 1c (Fig.
8C, lane 4), and addition of an anti-Sp1 antibody
to the incubations supershifted the complex, indicating that Sp1 is
part of the protein complex recruited by probe G (Fig. 8C,
arrow, lane 5). The addition of anti-Krox-24
antibody (Fig. 8C, lane 6) or competing Krox-24
oligonucleotides (Fig. 8C, lane 7) to the
incubations had no effect on complex formation with probe G. The mutant
g1 oligonucleotide was a poor competitor of Sp1 binding in
vitro because 30-200-fold excess oligonucleotide only weakly
decreased protein binding to probe G (Fig. 8C,
lanes 18-20), compared with competition by 30-200-fold
excess cold probe G DNA (Fig. 8C, lanes 15-17),
consistent with the conclusion that the Sp1 element in Figure
8A is the Sp1-binding site required for functional
promoter activity.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 8.
Identification of an Sp1 element required for
GluR2 promoter activity. A, Schematic of the positive
regulatory domain, 64 to +38 bp, of the GluR2 promoter is shown with
identified cis elements as shaded bars
above the sequence; gray and solid
circles and triangles signify some of the
transcription initiation sites described in the Figure
1A legend. Internal deletion and substitution
mutations introduced into the R2( 302/+320)luc
construct are identified by open bars below the
sequence. Deletion mutants are signified by " ," and substitution
mutations are signified by " ." Deletion constructs are the same
as those in Figure 5. B, Multiple plasmid transfections
were made into cortical neurons or cortical glia, and promoter activity
was measured 1 d later. Both the G deletion and the g1
substitution mutation resulted in significant reductions in GluR2
promoter activity in both cell types. These results suggest that the
Sp1/Krox-24 consensus element from 47 to 60 positively regulates
GluR2 promoter activity. Results shown are the mean ± SEM for
eight to nine plasmid transfections in three cultures.
*p < 0.05 from the control group by ANOVA and
post hoc Dunnett's tests. C, Nuclear
extracts (8 µg/lane; Extr) were prepared from cultured
cortical neurons and incubated with 32P-end-labeled
double-stranded oligonucleotide probes (~0.3 nM) at room
temperature for 15 min. Probe G (lanes 1-7 and 13-20;
same sequence as G in A) resulted in the formation of
three DNA-protein complexes (1a, 1b, and
1c), which were effectively competed away with 200-fold
excess (Comp) unlabeled probe G oligonucleotide
(lane 3). Excess competitor Sp1 oligonucleotides also
competed for probe G binding (lane 4), and an anti-Sp1
antibody supershifted part of the complex (lane 5). A
Krox-24 oligonucleotide (Kx; lane 7) and
an anti-Krox-24 antibody (lane 6) had no effect. When
the H sequence was used as probe H (lanes 8-12), a
different protein-DNA complex was resolved. This complex was competed
away with excess cold probe H DNA (lane 10) but not
excess cold probe G (lane 11), nor was it supershifted
by anti-Sp1 (lane 12) antibodies. In a separate
experiment, 30-200-fold excess competitor oligonucleotides were added
to similar probe G-binding incubations (lanes 13-20).
Here, excess cold probe G (lanes 15-17) was an
effective competitor at displacing the protein from the complex,
whereas excess g1 (lanes 18-20) was not. These
results demonstrate that the Sp1/Krox-24 consensus element identified
in A is important for GluR2 promoter activity and for
Sp1 binding.
|
|
Similar in vitro binding experiments with probe H resulted
in the formation of a single complex that was competed away with excess
unlabeled probe H DNA (Fig. 8C, lane 10). This
protein-DNA complex was not disrupted by competing unlabeled probe G
(Fig. 8C, lane 11) or Krox-24 DNA (data not
shown), nor was it part of the complex supershifted by coincubation
with anti-Sp1 (Fig. 8C, lane 12) or anti-Krox-24
antibodies (data not shown). The different banding patterns observed
for the G and H probes as well as the nonoverlapping competition
between the two probes indicate that the protein complex recruited by
sequence contained within G of the GluR2 minimal promoter region
includes Sp1.
 |
DISCUSSION |
We cloned the proximal promoter region of the rat GluR2 gene and
identified three regulatory elements that govern GluR2 promoter activity in transfected cortical cultures, and we confirm the location
of a major transcription initiation site 429/ 430 nucleotides from
the AUG codon, as described previously (Köhler et al., 1994 ). The
new conclusions of this study are (1) GluR2 transcription initiates
from multiple major sites spread over >141 bp, (2) initiation sites
are used differentially in adult cortical and cerebellar neurons, (3)
GluR2 promoter activity is 30-fold stronger in cultured cortical
neurons than in primary glia or C6 glioma, (4) promoter activity is
regulated by both an RE1/NRSE-like silencer element and two positive
regulatory elements (NRF-1 and Sp1) separated by a nucleotide bridge
sequence, and (5) the GluR2 silencer is a weak silencer relative to the
NaII RE1 silencer but still contributes to the neuronal specificity of
the GluR2 promoter. These findings identify the first functional
regulatory elements in the GluR2 promoter and point to a complex
transcriptional control region for GluR2 expression in neurons.
Functional implications of multiple GluR2 promoters
Our primer extension and RNase protection results identified
multiple transcription initiation sites resulting in lengthy (340-481
bases) GluR2 mRNA leader sequences. These, and additional results (Fig.
2), suggest the existence of multiple GluR2 promoters. First, the
observed wide distribution of transcriptional start sites (>141 bp) is
uncommon even for TATA-less promoters but is shared by other CNS genes
in which multiple promoters choreograph appropriate developmental or
tissue-specific gene expression (Timmusk et al., 1993 ; Pathak
et al., 1994 ) or increase the complexity of mRNA transcripts within the
same tissue type (Liu and Fischer, 1996 ). Second, we found that
the number and relative use of major GluR2 transcription initiation
sites in cortex were different from that in cerebellum (Fig.
2C,D). These regional differences in
initiation site usage perhaps reflect the greater variety of neuronal
cell types found in cerebral cortex versus cerebellum and that distinct
subpopulations of cortical neurons may transcribe GluR2 from different
initiation sites. Alternatively, transcription initiation could occur
at multiple sites in each cortical neuron, thereby increasing the
variety of GluR2 transcripts expressed per cell. In either case, the
usage of the upstream transcriptional start sites is cell-selective,
consistent with multiple promoters. Thirdly, no single initiation site
was completely essential for GluR2 promoter activity based on our
internal deletion scan (Fig. 5), indicating that RNA polymerase can
initiate GluR2 transcription from multiple, independent sites.
Depending on the site of transcription initiation, GluR2 mRNAs will
contain variably long GC-rich 5'-UTR leaders, an imperfect GU repeat
(40 nucleotides), and from two to five upstream out-of-frame AUG
codons. Unusually long 5'-UTR sequences (Kozak, 1987 ) with high GC
content and upstream AUG codons can interfere with appropriate mRNA
translation (see Geballe and Morris, 1994 ). Indeed, we have found that
sequences in the 5' ends of the longest GluR2 transcripts profoundly
impair translation in oocytes and in a cell-free translation assay
(Myers et al., 1997 ), further emphasizing the importance of determining
the cell types and conditions under which the various upstream start
sites are used. Thus, whether the GluR2 mRNA is translationally
suppressed is determined in part by transcriptional regulation.
Modulation of GluR2 expression by an RE1/NRSE-like silencer
The neural-specific expression of the type II sodium channel and
SCG10 genes is controlled primarily by a multizinc finger repressor,
termed REST or NRSF, that binds to RE1/NRSE silencer elements in their
5' promoter regions. REST/NRSF expression is expressed in non-neural
cells (Kraner et al., 1992 , Chong et al., 1995 ; Schoenherr and
Anderson, 1995 ) but also has been detected by in situ
hybridization in neurons in brain including cortex (Palm et al., 1998 ).
We have shown that the GluR2 5' promoter region contains a functional
RE1/NRSE-like silencer that similarly represses GluR2 promoter activity
specifically in non-neural cells (Fig. 6). However, in contrast to
initial descriptions of dominant RE1/NRSE silencers that suppress
expression by 10-fold or more (Maue et al., 1990 ; Kraner et al., 1992 ;
Li et al., 1993 ), the GluR2 silencer only moderately represses promoter
activity by less than threefold. Consistent with a previous report that
compared silencers from multiple genes relating silencer activity with sequence homology to the consensus element (Schoenherr et al., 1996 ),
our silencer-swapping experiments between GluR2 and sodium channel
promoters (Fig. 6C) showed that enervation of the GluR2 silencer is attributable to nucleotide sequence differences rather than
to contextual effects such as orientation, distance from initiation
sites, or 5'- and 3'-flanking sequences.
Thus the GluR2 silencer operates more like a modulator of expression
than like a dominant switch as indicated for other genes (Kraner et
al., 1992 ; Mori et al., 1992 ; Li et al., 1993 ). Under the conditions of
our experiments, the GluR2 silencer plays little or no role in
regulating GluR2 expression in cortical neurons because
deletion of the silencer does not alter promoter activity in cultured
cortical neurons. However, the GluR2 silencer remains a potential
target for REST, REST-like transcription factors, or REST splice
variants that are expressed in neurons basally or after seizure (Palm
et al., 1998 ). Indeed, we have shown that REST can decrease GluR2
promoter activity in neurons when introduced by cotransfection (Fig.
6D). A recent report showed that an homologous sequence in the rat nicotinic 2 subunit gene can operate either as
an enhancer or as a silencer depending on its position in the promoter
(Bessis et al., 1997 ), raising additional potential roles for
RE1/NRSE-like elements in regulating transcription.
Positive regulatory elements define a GluR2 minimal
promoter region
By transient transfection, the GluR2 promoter is 30-fold stronger
in primary cortical neuronal cultures than in cortical glial cultures
or C6 glioma cells. As judged by luciferase activity measurements in
transfected cells, the GluR2 silencer contributes up to threefold
neuronal selectivity, but shorter constructs lacking the silencer still
show up to a 10-fold neuronal preference after normalization to SV40
(Fig. 3D-F). When cortical cultures were transfected
with the minimal R2( 134/+147)luc construct, ~93% of the
luciferase-immunopositive cells were MAP-2-positive neurons, further indicating that the minimal promoter region exhibits strong neuronal selectivity (Fig. 4). We identified positive-acting Sp1 and
NRF-1 elements in the GluR2 minimal promoter region by internal deletion and substitution mutation of candidate sites (Figs. 7, 8).
Functional Sp1 elements are commonly found in TATA-less, GC-rich promoter regions and have been shown in other genes to interact with an
NRF-1 element to coordinate promoter activity (Seelan et al., 1996 ).
Sequence between the Sp1 and NRF-1 elements (labeled H in Figs. 7,
8) may serve as a spatial linker or interelement bridge to align
transcription factors bound to the Sp1 and NRF-1 cis
elements on the GluR2 gene, because deletion of the entire sequence
reduced promoter activity by ~75%, but short substitution mutations
designed to identify regulatory elements had no effect (Fig.
7B).
Functional NRF-1 elements are positioned near transcription initiation
sites of genes for several rate-limiting enzymes (Chau et al., 1992 ;
Virbasius et al., 1993 ) and mitochondrial genes (Virbasius et al.,
1993 ; Seelan et al., 1996 ), suggesting that NRF-1 may serve to
coordinate a variety of cellular processes by upregulating the
expression of key proteins in metabolic pathways. In the GluR2 gene,
Sp1 and NRF-1 elements also reside near major transcription initiation
sites and contribute significantly to GluR2 promoter activity. Despite
these findings, however, neither element showed cell-type selectivity
in transient expression assays (Figs. 5, 7, 8). Because Sp1 and NRF-1
transcription factors are expressed in a variety of tissues including
brain (Hagen et al., 1992 ; Gopalakrishnan and Scarpulla, 1995 ), the
lack of neural specificity observed in these assays may not be
unexpected. A functional element in the promoter of the brain-specific
aldolase C gene has been shown to bind non-neural transcription factors in vitro yet was still able to mediate brain-specific
expression in transgenic mice (Thomas et al., 1995 ).
Minimal promoter regions are generally defined as short sequences that
are sufficient for basal promoter activity but do not regulate
expression in a cell-specific manner. However, minimal promoters of
GluR2, GAP-43, MAP-1B, and brain-specific aldolase C genes seem to
direct neural-specific expression in primary neurons, neuronal cell
lines, and transgenic mice (Nedivi et al., 1992 ; Thomas et al., 1995 ;
Liu and Fischer, 1996 ; Weber and Skene, 1997 ). Two major
mechanisms conferring neural-specific gene expression have been
proposed. First, neural specificity can be achieved by the actions of a
distant and dominant silencer, such as the RE1/NRSE, on an unselective
basal promoter (Kraner et al., 1992 ; Mori et al., 1992 ), or second,
neural specificity can be conferred by elements near initiation sites
within a minimal promoter region (Nedivi et al., 1992 ; Thomas et al.,
1995 ; Liu and Fischer, 1996 ; Weber and Skene, 1997 ). The GluR2
gene seems to use both proposed mechanisms, although the minimal
promoter region seems to dominate.
How can the minimal promoter sequence consisting of 245 bp show
strong neuronal preference without a clear contribution from individual
elements (Fig. 5)? One explanation may be that the gain for promoter
activity is higher in neurons than in glia because of the presence of a
neural-specific transcription factor, or adaptor protein, that can bind
either common cis regulatory elements or the general
transcription factors. For example, Sp3 and Sp4 are additional members
of the Sp1 transcription factor family that bind sequence elements
identical to those that Sp1 binds but are expressed predominantly in
brain (Hagen et al., 1992 ). An alternative explanation could be that
transcripts are initiated from different sites in glia than in neurons
and that the translation rate or stability of GluR2 mRNA in glia is
significantly reduced compared with that in neurons. These latter
interpretations are, however, unlikely because even the short
constructs lacking specific 5' initiation sites still showed neuronal
preference (Fig. 3D-F). Finally, a neural-specific
element in the GluR2 promoter may exist but reside outside the region
analyzed by our internal deletion scan.
Findings from this study provide a necessary foundation for
understanding the transcriptional regulation of GluR2 expression in
neurons. In particular, it will be of interest to determine the
biological roles of the identified Sp1, NRF-1, and silencer regulatory
elements in mediating changes in GluR2 levels after ischemia and
status epilepticus. These results also suggest a strategy to determine
why some CNS interneurons express low levels of GluR2, affecting the
properties of AMPA receptor-mediated synaptic transmission. One
approach would be to determine whether appropriate neuronal expression
of the NRF-1, Sp1, Sp3, Sp4, and/or REST transcription factors
correlates with the GluR2 expression level in different cell
populations.
 |
FOOTNOTES |
Received Feb. 13, 1998; revised June 17, 1998; accepted June 19, 1998.
This work was supported by a National Institutes of Health (NIH) grant
(R.D.), an NIH individual predoctoral fellowship (S.J.M.), and an
unrestricted grant from Bristol-Myers Squibb (R.D.). We are indebted to
Dr. Gail Mandel for the generous gift of the Type II Na channel
promoter and RESTexpress vectors and Dr. Richard Scarpulla for the
NRF-1 expression vector. We thank Sunan Zhang for excellent technical
assistance with the neuronal cultures and Warren Hauk and Nell Birkhahn
for assistance in DNA sequencing.
Correspondence should be addressed to Dr. Scott J. Myers, Department of
Pharmacology, Emory University School of Medicine, Atlanta, GA 30322.
 |
REFERENCES |
-
Bai G,
Kusiak JW
(1993)
Cloning and analysis of the 5'flanking sequence of the rat N-methyl-D-aspartate receptor 1 (NMDAR1) gene.
Biochim Biophys Acta
1152:197-200[Medline].
-
Bai G,
Kusiak JW
(1995)
Functional analysis of the proximal 5'-flanking region of the N-methyl-D-aspartate receptor subunit gene, NMDAR1.
J Biol Chem
270:7737-7744[Abstract/Free Full Text].
-
Bessis A,
Champtiaux N,
Chatelin L,
Changeux JP
(1997)
The neuron-restrictive silencer element: a dual enhancer/silencer crucial for patterned expression of a nicotinic receptor gene in the brain.
Proc Natl Acad Sci USA
94:5906-5911[Abstract/Free Full Text].
-
Bochet P,
Audinat E,
Lambolez B,
Crépel F,
Rossier J,
Iino M,
Tsuzuki K,
Ozawa S
(1994)
Subunit composition at the single-cell level explains functional properties of a glutamate-gated channel.
Neuron
12:383-388[Web of Science][Medline].
-
Boulter J,
Hollmann M,
O'Shea-Greenfield A,
Hartley M,
Deneris E,
Maron C,
Heinemann S
(1990)
Molecular cloning and functional expression of glutamate receptor subunit genes.
Science
249:1033-1037[Abstract/Free Full Text].
-
Bowie D,
Mayer ML
(1995)
Inward rectification of both AMPA and kainate subtype glutamate receptors generated by polyamine-mediated ion channel block.
Neuron
15:453-462[Web of Science][Medline].
-
Burnashev N,
Khodorova A,
Jonas P,
Helm PJ,
Wisden W,
Monyer H,
Seeburg PH,
Sakmann B
(1992)
Calcium-permeable AMPA-kainate receptors in fusiform cerebellar glial cells.
Science
256:1566-1570[Abstract/Free Full Text].
-
Chau CA,
Evans MJ,
Scarpulla RC
(1992)
Nuclear respiratory factor 1 activation sites in genes encoding the
-subunit of ATP synthase, eukaryotic initiation factor 2 , and tyrosine aminotransferase: specific interaction of purified NRF-1 with multiple target genes.
J Biol Chem
267:6999-7006[Abstract/Free Full Text]. -
Chirgwin JM,
Przybyla AE,
MacDonald RJ,
Rutter WJ
(1979)
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
18:5294-5299[Medline].
-
Chong JA,
Tapia-Ramirez J,
Kim S,
Toledo-Aral JJ,
Zheng Y,
Boutros MC,
Altshuller YM,
Frohman MA,
Kraner SD,
Mandel G
(1995)
REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons.
Cell
80:949-957[Web of Science][Medline].
-
Cormack B
(1997)
Directed mutagenesis using the polymerase chain reaction.
In: Current protocols in molecular biology (Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K,
eds), pp 8.5.1-8.5.10. New York: Wiley.
-
Dignam JD,
Lebovitz RM,
Roeder RG
(1983)
Accurate transcription by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res
11:1475-1489[Abstract/Free Full Text].
-
Donevan SD,
Rogawski MA
(1995)
Intracellular polyamines mediate inward rectification of Ca2+-permeable
-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors.
Proc Natl Acad Sci USA
92:9298-9302[Abstract/Free Full Text]. -
Fitzgerald LW,
Deutch AY,
Gasic G,
Heinemann SF,
Nestler EJ
(1995)
Regulation of cortical and subcortical glutamate receptor subunit expression by antipsychotic drugs.
J Neurosci
15:2453-2461[Abstract].
-
Fitzgerald LW,
Ortiz J,
Hamedani AG,
Nestler EJ
(1996)
Drugs of abuse and stress increase the expression of GluR1 and NMDAR1 glutamate receptor subunits in the rat ventral tegmental area: common adaptations among cross-desensitizing agents.
J Neurosci
16:274-282[Abstract/Free Full Text].
-
Frank L,
Diemer NH,
Kaiser F,
Sheardown M,
Rasmussen JS,
Kristensen P
(1995)
Unchanged balance between levels of mRNA encoding AMPA glutamate receptor subtypes following global cerebral ischemia in the rat.
Acta Neurol Scand
92:337-343[Web of Science][Medline].
-
Friedman LK,
Pellegrini-Giampietro DE,
Sperber EF,
Bennett MV,
Moshe SL,
Zukin RS
(1994)
Kainate-induced status epilepticus alters glutamate and GABAA receptor gene expression in adult rat hippocampus: an in situ hybridization study.
J Neurosci
14:2697-2707[Abstract].
-
Geballe AP,
Morris DR
(1994)
Initiation codons within 5'-leaders of RNAs as regulators of translation.
Trends Biochem Sci
19:159-163[Web of Science][Medline].
-
Geiger JRP,
Melcher T,
Koh D-S,
Sakmann B,
Seeburg PH,
Jonas P,
Monyer H
(1995)
Relative abundance of subunit mRNAs determines gating and Ca2+ permeability of AMPA receptors in principle neurons and interneurons in rat CNS.
Neuron
15:193-204[Web of Science][Medline].
-
Gopalakrishnan L,
Scarpulla RC
(1995)
Structure, expression, and chromosomal assignment of the human gene encoding nuclear respiratory factor 1.
J Biol Chem
270:18019-18025[Abstract/Free Full Text].
-
Gorter JA,
Petrozzino JJ,
Aronica EM,
Rosenbaum DM,
Opitz T,
Bennett MVL,
Conner JA,
Zukin RS
(1997)
Global ischemia induces downregulation of GluR2 mRNA and increases AMPA receptor-mediated Ca2+ influx in hippocampal CA1 neurons of gerbil.
J Neurosci
17:6179-6188[Abstract/Free Full Text].
-
Hagen G,
Muller S,
Beato G,
Suske G
(1992)
Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes.
Nucleic Acids Res
20:5519-5525[Abstract/Free Full Text].
-
Hollmann M,
Hartley M,
Heinemann S
(1991)
Ca2+ permeability of KA-AMPA gated glutamate receptor channels depends on subunit composition.
Science
252:851-853[Abstract/Free Full Text].
-
Huang F,
Gallo V
(1997)
Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.
J Biol Chem
272:8618-8627[Abstract/Free Full Text].
-
Javahery R,
Khachi A,
Lo K,
Zenzie-Gregory B,
Smale ST
(1994)
DNA sequence requirements for transcriptional initiator activity in mammalian cells.
Mol Cell Biol
14:116-127[Abstract/Free Full Text].
-
Jonas P,
Racca C,
Sakmann B,
Seeburg P,
Monyer H
(1994)
Differences in Ca2+ permeability of AMPA-type glutamate receptor channels in neocortical neurons caused by differential GluR-B subunit expression.
Neuron
12:1281-1289[Web of Science][Medline].
-
Kamboj SK,
Swanson GT,
Cull-Candy SG
(1995)
Intracellular spermine confers rectification on rat calcium-permeable AMPA and kainate receptors.
J Physiol (Lond)
486:297-303[Abstract/Free Full Text].
-
Kamphuis W,
De Rijk TC,
Talamini LM,
Lopes da Silva FH
(1994)
Rat hippocampal kindling induces changes in the glutamate receptor mRNA expression patterns in dentate granule neurons.
Eur J Neurosci
6:1119-1127[Web of Science][Medline].
-
Keinänen K,
Wisden W,
Sommer B,
Werner P,
Herb A,
Verdoorn TA,
Sakmann B,
Seeburg PH
(1990)
A family of AMPA-selective glutamate receptors.
Science
249:556-560[Abstract/Free Full Text].
-
Koh D-S,
Burnashev N,
Jonas P
(1995)
Block of native Ca2+-permeable AMPA receptors in rat brain by intracellular polyamines generates double rectification.
J Physiol (Lond)
486:305-312[Abstract/Free Full Text].
-
Köhler M,
Kornau H-C,
Seeburg PH
(1994)
The organization of the gene for the functionally dominant
-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor subunit GluR-B.
J Biol Chem
269:17367-17370[Abstract/Free Full Text]. -
Kozak M
(1987)
An analysis of 5'-noncoding sequences from 699 vertebrate messenger mRNAs.
Nucleic Acids Res
15:8125-8148[Abstract/Free Full Text].
-
Kraner SD,
Chong JA,
Tsay HJ,
Mandel G
(1992)
Silencing the Type II sodium channel gene: a model for neural-specific gene regulation.
Neuron
9:37-44[Web of Science][Medline].
-
Li L,
Suzuki T,
Mori N,
Greengard P
(1993)
Identification of a functional silencer element involved in neuron-specific expression of the synapsin I gene.
Proc Natl Acad Sci USA
90:1460-1464[Abstract/Free Full Text].
-
Liu D,
Fischer I
(1996)
Two alternative promoters direct neuron-specific expression of the rat microtubule-associated protein 1B gene.
J Neurosci
16:5026-5036[Abstract/Free Full Text].
-
Lomeli H,
Mosbacher J,
Melcher T,
Höger T,
Geiger JRP,
Kuner T,
Monyer H,
Higuchi M,
Bach A,
Seeburg P
(1994)
Control of kinetic properties of AMPA receptor channels by nuclear editing.
Science
266:1709-1713[Abstract/Free Full Text].
-
Maue RA,
Kraner SD,
Goodman RH,
Mandel G
(1990)
Neuron-specific expression of the rat brain Type II sodium channel gene is directed by upstream regulatory elements.
Neuron
4:223-231[Web of Science][Medline].
-
Mieda M,
Haga T,
Saffen DW
(1997)
Expression of the rat m4 muscarinic acetylcholine receptor gene is regulated by the neuron-restrictive silencer element/repressor element 1.
J Biol Chem
272:5854-5860[Abstract/Free Full Text].
-
Monyer H,
Seeburg PH,
Wisden W
(1991)
Glutamate-operated channels: developmentally early and mature forms arise by alternative splicing.
Neuron
6:799-810[Web of Science][Medline].
-
Mori N,
Schoenherr C,
Vandenbergh DJ,
Anderson DJ
(1992)
A common silencer element in the SCG10 and Type II Na+ channel genes binds a factor present in nonneuronal cells but not in neuronal cells.
Neuron
9:45-54[Web of Science][Medline].
-
Myers SJ,
Peters JP,
Dingledine R
(1996)
Identification of transcriptional control elements in the neuron-selective GluR2 promoter.
Soc Neurosci Abstr
22:597.
-
Myers SJ,
Revennaugh JB,
Dingledine R
(1997)
A translational inhibitory motif resides in the GluR2 5'-untranslated leader.
Soc Neurosci Abstr
23:923.
-
Nair SM,
Werkman TR,
Craig J,
Finnell R,
Joels M,
Eberwine JH
(1998)
Corticosteroid regulation of ion channel conductances and mRNA levels in individual hippocampal CA1 neurons.
J Neurosci
18:2685-2696[Abstract/Free Full Text].
-
Nedivi E,
Basi GS,
Akey IV,
Skene JHP
(1992)
A neural-specific GAP-43 core promoter located between unusual DNA elements that interact to regulate its activity.
J Neurosci
12:691-704[Abstract].
-
Ortiz J,
Fitzgerald LW,
Charlton M,
Lane S,
Trevisan L,
Guitart X,
Shoemaker W,
Duman RS,
Nestler EJ
(1995)
Biochemical actions of chronic ethanol exposure in the mesolimbic dopamine system.
Synapse
21:289-298[Web of Science][Medline].
-
Palm K,
Belluardo N,
Metsis M,
Timmusk T
(1998)
Neuronal expression of zinc finger transcription factor REST/NRSF/XBR gene.
J Neurosci
18:1280-1296[Abstract/Free Full Text].
-
Patankar S,
Lazaroff M,
Yoon SO,
Chikaraishi DM
(1997)
A novel basal promoter element is required for expression of the rat tyrosine hydroxylase gene.
J Neurosci
17:4076-4086[Abstract/Free Full Text].
-
Pathak BG,
Neumann JC,
Croyle ML,
Lingrel JB
(1994)
The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase
3 subunit gene are required for brain expression in transgenic mice.
Nucleic Acids Res
22:4748-4755[Abstract/Free Full Text]. -
Patneau DK,
Wright PW,
Winters C,
Mayer ML,
Gallo V
(1994)
Glial cells of the oligodendrocyte lineage express both kainate- and AMPA-preferring subtypes of glutamate receptor.
Neuron
12:357-371[Web of Science][Medline].
-
Pellegrini-Giampietro DE,
Bennett MVL,
Zukin RS
(1992a)
Are Ca2+-permeable kainate/AMPA receptors more abundant in immature brain?
Neurosci Lett
144:65-69[Web of Science][Medline].
-
Pellegrini-Giampietro DE,
Zukin RS,
Bennett MVL,
Cho S,
Pulsinelli WA
(1992b)
Switch in glutamate receptor subunit gene expression in CA1 subfield of hippocampus following global ischemia in rats.
Proc Natl Acad Sci USA
144:65-69.
-
Pellegrini-Giampietro DE,
Pulsinelli WA,
Zukin RS
(1994)
NMDA and non-NMDA receptor gene expression following global brain ischemia in rats: effect of NMDA and non-NMDA receptor antagonists.
J Neurochem
67:1067-1073.
-
Peters J,
Myers SJ,
Comer M,
Barthel F,
Dingledine R
(1995)
Neuron-selective DNA elements in the rat GluR2 gene.
Soc Neurosci Abstr
21:81.
-
Petralia RS,
Wenthold RJ
(1992)
Light and electron immunocytochemical localization of AMPA-selective glutamate receptors in the rat brain.
J Comp Neurol
318:329-354[Web of Science][Medline].
-
Pollard H,
Hèron A,
Moreau J,
Ben-Ari Y,
Krestchatisky M
(1993)
Alterations of the GluR-B AMPA receptor subunit flip/flop expression in kainate-induced epilepsy and ischemia.
Neuroscience
57:545-554[Web of Science][Medline].
-
Prince HK,
Conn PJ,
Blackstone CD,
Huganir RL,
Levey AI
(1995)
Down regulation of AMPA receptor subunit GluR2 in amygdaloid kindling.
J Neurochem
64:462-465[Web of Science][Medline].
-
Sasner M,
Buonanno A
(1996)
Distinct N-methyl-D-aspartate receptor 2B subunit gene sequences confer neural and developmental specific expression.
J Biol Chem
271:21316-21322[Abstract/Free Full Text].
-
Sato K,
Kiyama H,
Tohyama M
(1993)
The differential expression patterns of messenger RNAs encoding non-N-methyl-D-aspartate glutamate receptor subunits (GluR1-4) in the rat brain.
Neuroscience
52:515-539[Web of Science][Medline].
-
Schoenherr CJ,
Anderson DJ
(1995)
The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes.
Science
267:1360-1363[Abstract/Free Full Text].
-
Schoenherr CJ,
Paquette AJ,
Anderson DJ
(1996)
Identification of potential target genes for the neuron-restrictive silencer factor.
Proc Natl Acad Sci USA
93:9881-9886[Abstract/Free Full Text].
-
Scholl T,
Stevens MB,
Mahanta S,
Strominger JL
(1996)
A zinc finger protein that represses transcription of the human MHC class II gene, DPA.
J Immunol
156:1448-1457[Abstract].
-
Seelan RS,
Gopalakrishnan L,
Scarpulla RC,
Grossman LI
(1996)
Cytochrome c oxidase subunit VIIa liver isoform: characterization and identification of promoter elements in the bovine gene.
J Biol Chem
271:2112-2120[Abstract/Free Full Text].
-
Sommer B,
Keinänen K,
Verdoorn T,
Wisden W,
Burnashev N,
Herb A,
Köhler M,
Takagi T,
Sakmann B,
Seeburg PH
(1990)
Flip and flop: a cell specific functional switch in glutamate-operated channels of the CNS.
Science
249:1580-1585[Abstract/Free Full Text].
-
Suchanek B,
Seeburg PH,
Sprengel R
(1995)
Gene structure of the murine N-methyl-D-aspartate receptor subunit NR2C.
J Biol Chem
270:41-44[Abstract/Free Full Text].
-
Suchanek B,
Seeburg PH,
Sprengel R
(1997)
Tissue specific control regions of the N-methyl-D-aspartate receptor subunit NR2C promoter.
Biol Chem
378:929-934[Web of Science][Medline].
-
Swanson GT,
Kamboj SK,
Cull-Candy SG
(1997)
Single-channel properties of recombinant AMPA receptors depend on RNA editing, splice variation and subunit composition.
J Neurosci
17:58-69[Abstract/Free Full Text].
-
Thomas M,
Skala H,
Kahn A,
Tuy FPD
(1995)
Functional dissection of the brain-specific rat aldolase C gene promoter in transgenic mice.
J Biol Chem
270:20316-20321[Abstract/Free Full Text].
-
Timmusk T,
Palm K,
Metsis M,
Reintam T,
Paalme V,
Saarma M,
Persson H
(1993)
Multiple promoters direct tissue-specific expression of the rat BDNF gene.
Neuron
10:475-489[Web of Science][Medline].
-
Virbasius CA,
Virbasius JV,
Scarpulla RC
(1993)
NRF-1, an activator involved in nuclear-mitochondrial interactions utilizes a new DNA-binding domain conserved in a family of developmental regulators.
Genes Dev
7:2431-2445[Abstract/Free Full Text].
-
Washburn MS,
Numberger M,
Zhang S,
Dingledine R
(1997)
Differential dependence on GluR2 expression of three characteristic features of AMPA receptors.
J Neurosci
17:9393-9406[Abstract/Free Full Text].
-
Weber JRM,
Skene JHP
(1997)
Identification of a novel repressive element that contributes to neuron-specific gene expression.
J Neurosci
17:7583-7593[Abstract/Free Full Text].
-
Wood IC,
Roopra A,
Buckley NJ
(1996)
Neural specific expression of the m4 muscarinic acetylcholine receptor gene is mediated by a RE1/NRSE-type silencing element.
J Biol Chem
271:14221-14225[Abstract/Free Full Text].
Copyright © 1998 Society for Neuroscience 0270-6474/98/18176723-17$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Z. Liu, M. Liu, G. Niu, Y. Cheng, and J. Fei
Genome-wide identification of target genes repressed by the zinc finger transcription factor REST/NRSF in the HEK 293 cell line
Acta Biochim Biophys Sin,
December 1, 2009;
41(12):
1008 - 1017.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Irier, Y. Quan, J. Yoo, and R. Dingledine
Control of Glutamate Receptor 2 (GluR2) Translational Initiation by Its Alternative 3' Untranslated Regions
Mol. Pharmacol.,
December 1, 2009;
76(6):
1145 - 1149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Fu, J. Zhang, F. Jin, J. Patchefsky, K.-H. Braunewell, and A. J. Klein-Szanto
Promoter Regulation of the Visinin-like Subfamily of Neuronal Calcium Sensor Proteins by Nuclear Respiratory Factor-1
J. Biol. Chem.,
October 2, 2009;
284(40):
27577 - 27586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Plaisance, G. Niederhauser, F. Azzouz, V. Lenain, J.-A. Haefliger, G. Waeber, and A. Abderrahmani
The Repressor Element Silencing Transcription Factor (REST)-mediated Transcriptional Repression Requires the Inhibition of Sp1
J. Biol. Chem.,
January 7, 2005;
280(1):
401 - 407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ma, L. Song, G. E. Radoi, and N. L. Harrison
Transcriptional Regulation of the Mouse Gene Encoding the {alpha}-4 Subunit of the GABAA Receptor
J. Biol. Chem.,
September 24, 2004;
279(39):
40451 - 40461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tong, R. Balazs, P. L. Thornton, and C. W. Cotman
{beta}-Amyloid Peptide at Sublethal Concentrations Downregulates Brain-Derived Neurotrophic Factor Functions in Cultured Cortical Neurons
J. Neurosci.,
July 28, 2004;
24(30):
6799 - 6809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Bruce, I. J. Donaldson, I. C. Wood, S. A. Yerbury, M. I. Sadowski, M. Chapman, B. Gottgens, and N. J. Buckley
Genome-wide analysis of repressor element 1 silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF) target genes
PNAS,
July 13, 2004;
101(28):
10458 - 10463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-T. Chang and A-M. Huang
{alpha}-Pal/NRF-1 Regulates the Promoter of the Human Integrin-associated Protein/CD47 Gene
J. Biol. Chem.,
April 9, 2004;
279(15):
14542 - 14550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Myers, Y. Huang, T. Genetta, and R. Dingledine
Inhibition of Glutamate Receptor 2 Translation by a Polymorphic Repeat Sequence in the 5'-Untranslated Leaders
J. Neurosci.,
April 7, 2004;
24(14):
3489 - 3499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Belyaev, I. C. Wood, A. W. Bruce, M. Street, J.-B. Trinh, and N. J. Buckley
Distinct RE-1 Silencing Transcription Factor-containing Complexes Interact with Different Target Genes
J. Biol. Chem.,
January 2, 2004;
279(1):
556 - 561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Martin, T. Tawadros, L. Meylan, A. Abderrahmani, D. F. Condorelli, G. Waeber, and J.-A. Haefliger
Critical Role of the Transcriptional Repressor Neuron-restrictive Silencer Factor in the Specific Control of Connexin36 in Insulin-producing Cell Lines
J. Biol. Chem.,
December 26, 2003;
278(52):
53082 - 53089.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Calderone, T. Jover, K.-m. Noh, H. Tanaka, H. Yokota, Y. Lin, S. Y. Grooms, R. Regis, M. V. L. Bennett, and R. S. Zukin
Ischemic Insults Derepress the Gene Silencer REST in Neurons Destined to Die
J. Neurosci.,
March 15, 2003;
23(6):
2112 - 2121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Colbourne, S. Y. Grooms, R. S. Zukin, A. M. Buchan, and M. V. L. Bennett
Hypothermia rescues hippocampal CA1 neurons and attenuates down-regulation of the AMPA receptor GluR2 subunit after forebrain ischemia
PNAS,
March 4, 2003;
100(5):
2906 - 2910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Desai, D. Turetsky, K. Vasudevan, and A. Buonanno
Analysis of Transcriptional Regulatory Sequences of the N-Methyl-D-aspartate Receptor 2A Subunit Gene in Cultured Cortical Neurons and Transgenic Mice
J. Biol. Chem.,
November 22, 2002;
277(48):
46374 - 46384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Huang, J. J. Doherty, and R. Dingledine
Altered Histone Acetylation at Glutamate Receptor 2 and Brain-Derived Neurotrophic Factor Genes Is an Early Event Triggered by Status Epilepticus
J. Neurosci.,
October 1, 2002;
22(19):
8422 - 8428.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nadeau and H. A. Lester
NRSF Causes cAMP-Sensitive Suppression of Sodium Current in Cultured Hippocampal Neurons
J Neurophysiol,
July 1, 2002;
88(1):
409 - 421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tanaka, A. Calderone, T. Jover, S. Y. Grooms, H. Yokota, R. S. Zukin, and M. V. L. Bennett
Ischemic preconditioning acts upstream of GluR2 down-regulation to afford neuroprotection in the hippocampal CA1
PNAS,
February 6, 2002;
(2002)
261713299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-J. Chew, X. Yuan, S. E. Scherer, L. Qie, F. Huang, W. P. Hayes, and V. Gallo
Characterization of the Rat GRIK5 Kainate Receptor Subunit Gene Promoter and Its Intragenic Regions Involved in Neural Cell Specificity
J. Biol. Chem.,
November 2, 2001;
276(45):
42162 - 42171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Roopra, Y. Huang, and R. Dingledine
Neurological Disease: Listening to Gene Silencers
Mol. Interv.,
October 1, 2001;
1(4):
219 - 228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Opitz, S. Y. Grooms, M. V. L. Bennett, and R. S. Zukin
Remodeling of alpha -amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptor subunit composition in hippocampal neurons after global ischemia
PNAS,
November 21, 2000;
97(24):
13360 - 13365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Paquette, S. E. Perez, and D. J. Anderson
Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo
PNAS,
October 24, 2000;
97(22):
12318 - 12323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dragich, I. Houwink-Manville, and C. Schanen
Rett syndrome: a surprising result of mutation in MECP2
Hum. Mol. Genet.,
October 1, 2000;
9(16):
2365 - 2375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Roopra, L. Sharling, I. C. Wood, T. Briggs, U. Bachfischer, A. J. Paquette, and N. J. Buckley
Transcriptional Repression by Neuron-Restrictive Silencer Factor Is Mediated via the Sin3-Histone Deacetylase Complex
Mol. Cell. Biol.,
March 15, 2000;
20(6):
2147 - 2157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Canton and P. H. Quail
Both phyA and phyB Mediate Light-Imposed Repression of PHYA Gene Expression in Arabidopsis
Plant Physiology,
December 1, 1999;
121(4):
1207 - 1215.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Dingledine, K. Borges, D. Bowie, and S. F. Traynelis
The Glutamate Receptor Ion Channels
Pharmacol. Rev.,
March 1, 1999;
51(1):
7 - 62.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. McDonough, N. Francis, T. Miller, and E. S. Deneris
Regulation of Transcription in the Neuronal Nicotinic Receptor Subunit Gene Cluster by a Neuron-selective Enhancer and ETS Domain Factors
J. Biol. Chem.,
September 8, 2000;
275(37):
28962 - 28970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Seth and J. A. Majzoub
Repressor Element Silencing Transcription Factor/Neuron-restrictive Silencing Factor (REST/NRSF) Can Act as an Enhancer as Well as a Repressor of Corticotropin-releasing Hormone Gene Transcription
J. Biol. Chem.,
April 20, 2001;
276(17):
13917 - 13923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Borges and R. Dingledine
Functional Organization of the GluR1 Glutamate Receptor Promoter
J. Biol. Chem.,
July 6, 2001;
276(28):
25929 - 25938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tong, P. L. Thornton, R. Balazs, and C. W. Cotman
beta -Amyloid-(1-42) Impairs Activity-dependent cAMP-response Element-binding Protein Signaling in Neurons at Concentrations in Which Cell Survival Is Not Compromised
J. Biol. Chem.,
May 11, 2001;
276(20):
17301 - 17306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. K. Fazio, T. A. Bolger, and G. Gill
Conserved Regions of the Drosophila Erect Wing Protein Contribute Both Positively and Negatively to Transcriptional Activity
J. Biol. Chem.,
May 25, 2001;
276(22):
18710 - 18716.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tanaka, A. Calderone, T. Jover, S. Y. Grooms, H. Yokota, R. S. Zukin, and M. V. L. Bennett
Ischemic preconditioning acts upstream of GluR2 down-regulation to afford neuroprotection in the hippocampal CA1
PNAS,
February 19, 2002;
99(4):
2362 - 2367.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|