Previous Article | Next Article 
The Journal of Neuroscience, September 1, 1998, 18(17):6723-6739
Transcriptional Regulation of the GluR2 Gene: Neural-Specific
Expression, Multiple Promoters, and Regulatory Elements
Scott J.
Myers1, 2,
Jeanne
Peters1,
Yunfei
Huang1,
Mary B.
Comer2,
Fabrice
Barthel3, and
Raymond
Dingledine1
1 Department of Pharmacology, Emory University,
Atlanta, Georgia 30322, 2 Department of Pharmacology,
University of North Carolina at Chapel Hill, Chapel Hill, North
Carolina 27599, 3 U 259 INSERM, Universite de
Bordeaux II, 33077 Bordeaux Cedex, France
 |
ABSTRACT |
To understand how neurons control the expression of the AMPA
receptor subunit GluR2, we cloned the 5' proximal region of the rat gene and investigated GluR2 promoter activity by transient transfection. RNase protection and primer extension of rat brain mRNA
revealed multiple transcription initiation sites from 
340 to 481
bases upstream of the GluR2 AUG codon. The relative use of 5' start
sites was different in cortex and cerebellum, indicating complexity of
GluR2 transcript expression among different sets of neurons. When GluR2
promoter activity was investigated by plasmid transfection into
cultured cortical neurons, cortical glia, and C6 glioma cells, the
promoter construct with the strongest activity, per transfected cell,
was 29.4-fold (± 3.7) more active in neurons than in non-neural
cells. Immunostaining of cortical cultures showed that >97% of the
luciferase-positive cells also expressed the neuronal marker MAP-2.
Evaluation of internal deletion and substitution mutations identified a
functional repressor element I RE1-like silencer and
functional Sp1 and nuclear respiratory factor-1 (NRF-1) elements
within a GC-rich proximal GluR2 promoter region. The GluR2 silencer
reduced promoter activity in glia and non-neuronal cell lines by two-
to threefold, was without effect in cortical neurons, and could bind
the RE1-silencing transcription factor (REST) because
cotransfection of REST into neurons reduced GluR2 promoter activity in
a silencer-dependent manner. Substitution of the GluR2 silencer by the
homologous NaII RE1 silencer further reduced GluR2 promoter activity in
non-neuronal cells by 30-47%. Maximal positive GluR2 promoter
activity required both Sp1 and NRF-1 cis elements and an
interelement nucleotide bridge sequence. These results indicate that
GluR2 transcription initiates from multiple sites, is highly neuronal
selective, and is regulated by three regulatory elements in the 5'
proximal promoter region.
Key words:
AMPA; glutamate receptor; transcription; REST; NRF-1; primary culture; transfection; luciferase; neurons; promoter; Sp1; silencer; neuronal expression; repressor
| |
INTRODUCTION |
The AMPA subtypes of glutamate
receptors are assembled from combinations of GluR1, 2, 3 and 4 (GluRA,
B, C, D) subunits and mediate a large fraction of the postsynaptic
response at most fast excitatory synapses in the brain. Studies with
recombinant receptors indicate that different subunit combinations
produce functionally unique AMPA receptors (Boulter et al., 1990
;
Sommer et al., 1990; Hollmann et al., 1991; Lomeli et al., 1994). In particular, three AMPA receptor properties are strongly influenced by
the level of edited GluR2 expression because of the positively charged
arginine present in the Q/R site of the M2 channel-lining domain. The presence of edited GluR2 reduces Ca2+
permeability (Hollmann et al., 1991; Geiger et al., 1995),
voltage-dependent channel block by cytosolic polyamines (Bowie and
Mayer, 1995; Donevan and Rogawski, 1995; Kamboj et al., 1995; Koh et
al., 1995), and single channel conductance (Swanson et al., 1997).
Thus, EPSPs mediated by GluR2-deficient receptors may be larger than
those mediated by GluR2-rich receptors, which should have significant physiological consequences.
The relative expression of AMPA receptor subunit mRNA and protein in
certain populations of neurons is not static but may be remodeled
during development (Pellegrini-Giampietro et al., 1992a), after
seizures or ischemic insult (Pellegrini-Giampietro et al., 1992b, 1994;
Pollard et al., 1993; Freidman et al., 1994; Kamphuis et al., 1994;
Prince et al., 1995) and after administration of antipsychotics
(Fitzgerald et al., 1995), drugs of abuse (Ortiz et al., 1995;
Fitzgerald et al., 1996), or corticosteroids (Nair et al., 1998). After
ischemia, a drop in relative GluR2 expression in hippocampal CA1
pyramidal cells is associated with changes in AMPA receptor properties
consistent with an increase in GluR2-deficient receptors (Gorter et
al., 1997), although whether GluR2 selectively declines remains
controversial (see Frank et al., 1995). Recent work from our laboratory
indicates that the number of GluR2 subunits in a receptor is variable
and that the relative abundance of GluR2 affects
Ca2+ permeability and rectification differentially
(Washburn et al., 1997). Given that distinct populations of neurons are
known to be GluR2-deficient or GluR2-rich (Bochet et al., 1994; Jonas
et al., 1994; Geiger et al., 1995; Washburn et al., 1997), the
consequences of modulating GluR2 expression in these cells will depend
on pre-existent GluR2 levels.
These studies indicate that mechanisms controlling the level of GluR2
expression may be important regulatory determinants of AMPA receptor
phenotype. GluR2 expression in brain is primarily restricted to neurons
(Monyer et al., 1991; Petralia and Wenthold, 1992; Sato et al., 1993),
although AMPA receptor subunits are expressed by certain populations of
glia (Keinänen et al., 1990; Burnashev et al., 1992) and O-2A
progenitor cells (Patneau et al., 1994). Functional promoter studies of
NMDA and kainate receptor genes have been reported (Bai and Kusiak,
1995; Sasner and Buonanno, 1996; Huang and Gallo, 1997; Suchanek et
al., 1997), and the organization of the mouse GluR2 gene has been
described (Köhler et al., 1994), but no regulatory elements of
AMPA receptor subunits have yet been identified. We show here that the
GluR2 proximal promoter region contains a negative regulatory element
and a positive regulatory region and directs the neural-specific
expression of a luciferase reporter gene in transiently transfected
primary cortical cultures.
Parts of this paper have been published previously in abstract form
(Peters et al., 1995; Myers et al., 1996).
| |
MATERIALS AND METHODS |
Materials. Rat C6 glioma (CCL-107) cells were
obtained from American Type Culture Collection (Rockville, MD). HeLa
cells were a gift from Dr. T. J. Murphy (Emory University).
Timed-pregnant rats were purchased from Harlan Sprague Dawley
(Indianapolis, IN). DMEM and MEM tissue culture media,
L-glutamine, trypsin, and EDTA were obtained from Life
Technologies (Gaithersburg, MD). Poly-D-lysine (molecular
weight of > 60,000), fetal bovine serum, and tissue
culture supplements human transferrin, putrescine, tri-iodothyronine,
progesterone, estradiol, sodium selenite, insulin, L-glucose, and sodium bicarbonate were obtained from Sigma
(St. Louis, MO). Mouse monoclonal anti-MAP-2 (clone AP20) was purchased from Boehringer Mannheim (Indianapolis, IN), mouse monoclonal anti-GFAP
(clone G-A-5) was from Sigma, polyclonal rabbit anti-luciferase was
from Promega (Madison, WI), and Texas Red-conjugated
F(ab')2 donkey anti-rabbit IgG and FITC-conjugated
F(ab')2 donkey anti-mouse IgG were from Jackson
ImmunoResearch (West Grove, PA). Anti-Sp1 and anti-Krox-24
antibodies and Sp1 and Krox-24 double-stranded oligonucleotides were
purchased from Santa Cruz Biotechnology (Tebu, France).
Pfu polymerase and the 
DASH II genomic library
were from Stratagene (La Jolla, CA). Lipofectamine, Superscript II
reverse transcriptase, and RNAsin were obtained from Life Technologies. MMLV reverse transcriptase was from Stratagene. Restriction
enzymes were purchased from New England Biolabs (Beverly, MA) or Life Technologies. T4 DNA ligase, T4 DNA and Klenow polymerases, RNaseONE, luciferase vectors, and assay reagents were purchased from
Promega. pcDNA3 and TA cloning vectors were from
Invitrogen (San Diego, CA), and Sequenase 2.0 was purchased from United
States Biochemicals (Cleveland, OH). Geneclean kits were obtained from
BIO 101 (La Jolla, CA). All oligonucleotides were synthesized in house
on a MilliGen/Biosearch Cyclone Plus DNA Synthesizer using Expedite Chemistry (PerSeptive Biosystems). Radioisotopes were purchased from
Amersham (Arlington Heights, IL). Nylon-backed nitrocellulose membranes
were purchased from Bio-Rad (Hercules, CA). Other general salts and
supplies were purchased from Sigma or Fisher Scientific (Houston,
TX).
Isolation and characterization of genomic clones.
Approximately 0.7 × 106 plaques from a rat
genomic library in DASH II were hybridized on nylon membranes with
a 3505 bp EcoRI-XhoI restriction fragment containing the full coding sequence of the rat GluR2 cDNA, labeled with
[
-32P]dCTP by random priming. Three positive plaques
were purified and subjected to a second round of hybridization with an
end-labeled oligonucleotide (R2-1; GAGGACAGAAATATGCATAATCTTTTGCAT)
complementary to the first 10 codons of the GluR2 coding
sequence (Boulter et al., 1990). A single recombinant phage obtained
from this screen had an 18 kb insert that included a long, interspersed
repeat segment (LINE-1) at its immediate 5' end, ~9 kb upstream of
the 5' end of the GluR2 gene. A 1.64 kb
XbaI-HindIII fragment, which contained the GluR2
proximal promoter region, exon 1, and 288 bp of the first intron, has
been deposited in the GenBank database (accession number AF025917).
5' RACE, RNase protection, and primer extension and
Southern blot. For 5' RACE, poly(A+) mRNA
isolated from adult male Sprague Dawley rat brains by the method of
Chirgwin et al. (1979) was reverse transcribed by MMLV reverse
transcriptase from the R2-1 primer. After addition of an oligo-dC tail
with terminal deoxynucleotidyltransferase, PCR reactions were performed
using the anchor primer provided by the Life Technologies 5' RACE
system, plus the R2-race1 primer (AGTCCCGAGGACTGGCTGAA) complementary
to nucleotides 81-100 of the GluR2 cDNA sequence (Boulter et al.,
1990). PCR products were subcloned into the TA cloning vector and
selected by colony hybridization to the R2-20 oligonucleotide
complementary to bp 64-83 of the GluR2 cDNA (GAATGCAGTTTTTAGCTGAG). Ten clones were selected by size on agarose gels and sequenced through
the anchor-priming site to locate 5' ends of the mRNA.
For primer extension, an oligonucleotide (PER2-3;
TCCCAGTTGTAGCTGGTGGCTGTTGATGCC) complementary to bp 163 to 192 from
the coding AUG (see Fig. 1A) was end-labeled with
[
-32P]ATP (~4.8 × 105
cpm/pmol) and annealed to 30 µg of adult rat cortical and cerebellar total RNA in 20 mM HEPES, pH 7.0, 350 mM NaCl,
and 50% formamide at 50°C for 24 hr. Annealed samples were
precipitated and resuspended in 50 µl containing 50 mM
Tris-HCl, pH 8.3, 75 mM KCl, 3 mM
MgCl2, 2.5 mM dNTPs, 10 mM
DTT, 50 µg/ml actinomycin D, 20 units RNAsin, and 200 units
Superscript II reverse transcriptase and were incubated at 42°C for
90 min; then 1 µl of RNAsONE was added, and the incubation continued for an additional 35 min. Samples were recovered and loaded
onto a sequencing gel. Yeast total RNA (48 µg) and an in vitro synthesized full-length GluR2 sense RNA (10 ng) were used as
templates in negative and positive control reactions, respectively. The
in vitro GluR2 RNA includes 481 bases of GluR2
5'-untranslated region (UTR) sequence plus an additional 40 bp
of polylinker sequence. To confirm the specificity of the primer
extension reactions, we also prepared Southern blots of primer
extension products. For these experiments the reaction conditions were
identical to those described above except that the oligonucleotide
primer was unlabeled and, after gel resolution, reaction products were
electrotransferred to a nylon membrane. Southern blots were then
hybridized with a 32P-radiolabeled DNA probe
(>108 cpm/µg) made from bp 192 through 481
relative to the GluR2 AUG (see Fig. 2A, probe B).
Hybridized blots were washed under high-stringent conditions and
exposed to a Molecular Dynamics PhosphorImager plate (Sunnyvale, CA)
for visualization.
RNase protection experiments were conducted using an Ambion RPA
kit (Austin, TX) following the manufacturer's instructions. For
identification of mRNA 5' ends, an antisense riboprobe complementary to
nucleotides 192 through 481 relative to the GluR2 AUG (see Fig.
2A, probe C) was radiolabeled and annealed (5 × 105 cpm per reaction) to 30 µg of adult rat
cortical and cerebellar total RNA in 20 µl of hybridization solution
(Ambion kit) at 45°C overnight. Annealed samples were digested with
RNase A and RNaseT1, resolved on an RNA-sequencing gel, and exposed to
Kodak X-OMAT film for 12 hr. To quantify the relative use of
transcription initiation sites in cerebellum and cortex, an antisense
RNA probe complementary to bases 136 through 361 relative to the
GluR2 AUG (see Fig. 2A, probe D) was annealed to
total RNA as described above. This probe identifies the major short
transcription initiation site at 340 and also summates all
transcripts with 5' ends extending beyond 360 into a single
band on the gel. Total RNA used in these experiments was prepared
independently from four adult male Sprague Dawley rats.
Methylation sites in the promoter region. Adult rat genomic
DNA was isolated from lung, kidney, cortex, and cerebellum (40-50 µg) and digested with AccI to release a 1.3 kb promoter
fragment (731 to +603 bp relative to the +1 transcription initiation
site) and then was digested again with one of the methylation-sensitive restriction enzymes BssHII, SacII,
AvaI, or Eco47III. Southern blots of the genomic
fragments were prepared and hybridized with an
AccI-restricted 1.3 kb genomic fragment radiolabeled with
[-32P]dCTP by random priming (>108
cpm/µg). All hybridizations and washes were conducted under
high-stringent conditions.
Cell culture. Primary rat cortical neuronal cultures were
prepared from embryonic day 18 fetal rat pups resected from pregnant Sprague Dawley rats. Briefly, cerebral cortices were minced in DMEM
supplemented with 1.1 gm/l glucose, 2.1 gm/l NaHCO3,
and 1.84 mM L-glutamine, pH 7.25 (FDMEM); 1 ml
of fetal bovine serum (FBS) was added; and tissue was dissociated by
trituration. Dissociated cells were rinsed in 8 ml of FDMEM media,
pelleted at low speed for 5 min, and then resuspended in FDMEM
supplemented with 100 µg/ml human apotransferrin and (in
µM): insulin 0.5, putrescine 60, tri-iodothyronine
1 × 10
3, 
-estradiol 1 × 106, progesterone 0.01, and sodium selenite 0.03 (termed TFDMEM). Cortical cells were plated at a density of
0.7-1.0 × 106 cells/well into Falcon 12-well
culture dishes precoated overnight with 180 µg/ml
poly-D-lysine and coated with 20% FBS in FDMEM for 2-3 hr
before plating. Cultures were grown for 3-6 d in vitro, without media change, in an humidified, 5% CO2,
37°C incubator. It should be noted that these cultures are a mixture
of neurons and glia with ~60% of cells MAP-2 positive on days 4-6
in culture.
Primary glial cultures were generated from the primary cortical
neuronal cultures by repeated washing of cells with FDMEM plus 10% FBS
over a period of 1-4 weeks after plating or by passage of cultures to
facilitate the elimination of neurons. Cortical glia and rat C6 glioma
cells were grown in FDMEM plus 10% FBS until use in transfections.
HeLa cells were grown in DMEM supplemented with 10% FBS and 2 mM glutamine. The non-neuronal cultures were grown in the
same incubator as the neurons.
Constructs and mutagenesis. To generate 5'- and 3'-GluR2
promoter deletion constructs, we amplified specific-length fragments of
the GluR2 promoter by PCR with Pfu polymerase using
oligonucleotides complementary to the GluR2 1.64 kb
XbaI-HindIII GluR2 fragment. 5'- and
3'-oligonucleotides contained NheI and BglII
restriction sites, respectively. Amplified DNA fragments were
restricted and cloned into the NheI and BglII
sites of the pGL2 basic vector upstream of the reporter gene firefly
luciferase. Recombinants were analyzed by restriction and sequence
analysis to confirm the location of the GluR2 promoter boundaries.
Throughout this report, construct boundaries [i.e.,
R2(822/+320)luc] are defined relative to the 5'-most
major initiation site identified, 429 bases upstream from the
recognized GluR2 AUG.
To generate internal GluR2 silencer mutations in the context of the
R2(302/+320)luc construct, we used a two-round PCR
mutagenesis protocol as described (Cormack, 1997). After the
second-round PCR reaction, the mutagenized DNA fragment was restricted
with NheI and BglII and cloned back into the pGL2
basic vector. To delete the GluR2 silencer, we replaced 25 bp spanning
the silencer element with an NsiI restriction site. This
construct is designated R2(302/+320)luc-
B. Substitution
mutations were introduced by replacing different 6 bp segments of the
silencer with either an EcoRI or an EcoRV
restriction site and were designated R2(
RI)luc and
R2(RV)luc, respectively. Constructs that replaced the
GluR2 silencer with the Type II Na channel repressor element 1 (NaII-RE1) silencer in the context of the GluR2 promoter
[R2(NaII)luc], or likewise replaced the NaII-RE1
element with the GluR2 silencer in the context of the NaII promoter
[NaII(R2)luc], were also made using the two-round,
oligonucleotide-directed PCR mutagenesis protocol. The NaII promoter
construct without an RE1 element (pMB4) (Kraner et al., 1992) was
excised with EcoRI, blunted with Klenow, cloned into the
SmaI-digested pGL2 basic vector, and renamed
NaII()luc. The NaII promoter construct retaining the RE1
silencer on a 118 bp fragment (1051 to 933) fused 5' of the NaII
minimal promoter region (134 to +177) as described (pSDK7) (Kraner et
al., 1992) and was cloned upstream of firefly luciferase by shuttling
it through the pBluescript HindIII-PstI
polylinker sites and into the pGL2 basic vector KpnI and
NheI sites. This construct was renamed NaIIluc.
All constructs described were confirmed by restriction and sequence
analysis and preserved the correct flanking sequences and silencer
orientations of their natural promoter contexts; e.g.,
R2(NaII)luc contains type II sodium channel RE1 silencer with GluR2 flanking sequence and the GluR2 antisense orientation. The
pairs of oligonucleotides used to introduce these mutations are the
following: to delete the silencer in GluR2,
R2(302/+320)luc-B, sense TCCGACTATGCATCGGATGCGCAACAC
and antisense GCATCCGATGCATAGTCGGAGCTCTGG; the missense mutation
R2(RI)luc, sense AAAGCGCTGTGAATTCTGCTAAAATCGGATGCG and
antisense CCGATTTTAGCAGAATTCACAGCGCTTTAGTCGG; the missense mutation
R2(RV)luc, sense CTAAAGGATATCCCTCGGTGCTAAAATCGG and antisense CCGAGGGATATCCTTTAGTCGGAGCTC; to place the NaII RE1 silencer in the GluR2 promoter, R2(NaII)luc, sense
TGCTGTCCGTGGTTCTGAAATCGGAT and antisense AGAACCACGGACAGCACTTTAGTCG; to
place the GluR2 silencer in the NaII promoter,
NaII(R2)luc, sense GCACCGAGGACAGCGCTAGAGTCTCTGAAT and
antisense GCTGTCCTCGGTGCTAAAACCCAATTACAG.
A two-round PCR mutagenesis strategy was also used to introduce
systematically internal deletions of 25-30 bp in the
R2(302/+320)luc construct to generate a "deletion
scan" of the proximal region of the GluR2 promoter. For each new
mutagenized construct, a unique 6 bp restriction (EcoRV,
NsiI, or StuI) site was introduced to allow easy
identification of recombinants. All mutant constructs were sequenced
for verification. The designations for the internal deletion mutants
are R2(302/+320)luc-A through N, and the following GluR2 promoter regions are deleted: A, 227 to 197; B, 196 to 172; C, 171 to 147; D, 146 to 118; E, 117 to
90; F, 89 to 65; G, 64 to 40; H, 39 to 15; I,
14 to +14; J, +15 to +38; K, 3 to +74; L, +71 to +146;
M, +107 to +206; and N, +182 to +206. Oligonucleotide sequences
used to introduce internal mutations for the
R2(302/+320)luc deletion scan are available on
request.
Transfections. Primary neurons were transfected on days 3-6
after plating. Primary glia were transfected either as confluent, unpassaged cells or at 90% confluency 2-3 d after passage, and C6
glioma cells were transfected similarly at 80-100% confluency. All
transfections were conducted in Falcon 12-well dishes with Lipofectamine according to the manufacturer's instructions. Per well,
1 µg of DNA, 50 µl of 150 mM NaCl, and 5 µl of
Lipofectamine were combined in 0.5 ml of TFDMEM media and incubated
with cells at 37°C for 5 hr. After transfection, the DNA and
Lipofectamine mixture was replaced with fresh TFDMEM (0.5 ml) for
primary neuronal cultures or with normal culture media for primary
glia, C6 glioma, and HeLa cells. Twenty-four hours later, cells were
rinsed with PBS and harvested by lysis. Cell lysates were cleared by
centrifugation and assayed for luciferase activity in a Turner TD-20e
luminometer. A preliminary time course study with the GluR2,
cytomegalovirus (CMV), and SV40 promoters in transfected cortical
cultures indicated that luciferase expression was maximal 24 hr after
transfection and decreased slowly by 48 and 72 hr.
For cotransfections, a similar protocol was used except the amount of
Lipofectamine was increased to 7.5 µl per well to accommodate the
additional DNA. The amount of the GluR2 promoter-firefly reporter construct was varied from 0.1 to 1.0 µg/well, and the amount of the
RE1-repressor factor plasmid (RESTexpress) (Chong et al., 1995)
or the control plasmid pcDNA3 was held fixed at 0.25 or 0.75 µg/well,
and pBS vector was added to adjust the total DNA for all transfections
to a final concentration of 1.75 µg/well. Under these cotransfection
conditions, the amount of luciferase activity recovered in the cell
lysates varied linearly with the amount of pGL2 reporter plasmid DNA
transfected (data not shown). For nuclear respiratory factor-1
(NRF-1) cotransfections, 1 µg of pNRF-1 plasmid (Virbasius et
al., 1993) was mixed with 0.5 µg of the GluR2 promoter-reporter
construct .
All plasmid DNA preparations were prepared from 100 ml of 2xYT
cultures using Qiagen Maxi-DNA Prep columns. At least three independent
DNA preparations for each construct were transfected, in parallel, in
each experiment. Each individual DNA plasmid was transfected into
triplicate wells. For transfections into multiple cell types, a master
mix of the plasmid DNA, NaCl, Lipofectamine, and TFDMEM media was
prepared from which equal aliquots were delivered to the cells. In all
experiments, an SV40-luciferase or a CMV-luciferase control plasmid was
transfected into parallel wells to normalize GluR2 promoter activity
across multiple experiments and primary culture preparations. Where
indicated, luciferase activity was converted to moles of luciferase
(~2.2 Turner light units/1018 mole) using a
standard curve generated with recombinant firefly luciferase under our
assay conditions.
Immunofluorescence. Primary neurons prepared as described
above were plated onto glass coverslips precoated with both
poly-D-lysine (overnight) and then fibronectin (20 µg/ml;
1-2 hr). Cultures were transfected with the
R2(302/+320)luc or the R2(134/+147)luc construct and fixed 24 hr later with 4% paraformaldehyde in PBS for 15 min. Cells were rinsed three times with PBS, permeabilized with 0.1%
w/v Triton X-100 in PBS for 5 min, washed, and then incubated in
staining buffer (2% horse serum in PBS) for 15 min. Cells were
incubated for 2 hr in staining buffer with rabbit anti-luciferase (1:200) and either mouse anti-GFAP (1:800) or mouse anti-MAP-2 (1:600)
and then rinsed four times for 5 min each with excess staining buffer
before incubation with the secondary antibodies, Texas Red-conjugated
donkey anti-mouse IgG (1:250) and FITC-conjugated donkey anti-rabbit
IgG (1:250), in staining buffer for 30 min. Cells were rinsed four
times for 5 min each as described above and mounted onto glass slides.
All washes and staining incubations were conducted at room temperature.
Fluorescence was visualized with a Zeiss Axioplan microscope using a
40× Plan-NEOFLUAR oil objective and appropriate fluorescent filters.
Cells positively identified for firefly luciferase expression were
counted and scored for positivity to either MAP-2 or GFAP
expression.
Nuclear extract and gel mobility shift assays. Nuclear
extracts were prepared from cultured cells according to the method of
Dignam et al. (1983). For gel mobility shift assays, complementary oligonucleotides were purified by denaturing PAGE and then
annealed and 32P-labeled by Klenow fill-in of the 5'
overhangs for 25 min at room temperature. Labeled probes were
extracted, purified through a spin column, precipitated, and stored in
deionized water at 4°C until use.
In vitro binding reactions were conducted in 20 µl volumes
containing (final concentrations) 12 mM HEPES, pH 7.9, 4 mM Tris-HCl, pH 7.9, 60 mM KCl, 1 mM EDTA, 12% v/v glycerol, 1 mM DTT, 1 mM PMSF, 0.225 µg/µl BSA, 0.1 µg/ml poly dI:dC, and
5-10 µg of nuclear extract protein. Individual components of the
binding reaction were combined and incubated on ice for 15-30 min
before the addition of probe (~0.3 nM, final
concentration; 10-30 × 103 cpm) and then were
incubated at 22°C for 15 min. Where indicated, a 30-200-fold excess
of cold competitor oligonucleotides was added on ice 15-30 min before
addition of probe. After incubation, samples were separated on a 4%
polyacrylamide, Tris-glycine, glycerol gel. Dried gels were exposed to
Kodak X-OMAT film or to a Molecular Dynamics PhosphorImager plate for
visualization.
Double-stranded oligonucleotide probes used in the binding reactions
are the following (top strand): probe G,
GGCGCTGTGCGGGGGAGGGGTAGGTGCGCGA; probe H,
CTAGAGCTCCCTGCCTGCCTTGAGTCGGATC; Sp1 consensus,
ATTCGATCGGGGCGGGGCGAGC; g1 mutant,
GGCGCTGTGCTCTAGAGGGGTAGGTGCGCGA; and Krox-24 consensus, GGATCCAGCGGGGGCGAGCGGGGGCGA.
Statistical analysis. For comparison of the promoter
activities between two or more constructs within a given cell type, at least three plasmid preparations for each construct were transfected in
the same experiment. The order in which individual plasmid DNA
preparations were added to the wells for transfection was randomized to
reduce bias attributable to handling of the cells during the procedure.
Raw luciferase activity was normalized to the activity of either the
SV40 promoter or a defined control construct measured in parallel
wells. Data from multiple experiments (culture preparations) were
combined and analyzed by ANOVA followed by post hoc
Dunnett's tests for significance between means or, when appropriate,
Student's t tests. Comparisons of the promoter activities
between constructs were made within, and not across, cell types.
| |
RESULTS |
Multiple tissue-specific transcription initiation sites and
DNA methylation
Exon 1 and the proximal 5'-flanking sequence of the rat GluR2 gene
are shown in Figure 1A,
along with a schematic identifying the salient features. To identify
transcription initiation sites, we first conducted 5' RACE analysis of
rat brain mRNA. Multiple potential initiation sites were identified
from 286 to 481 bases upstream from the GluR2 translation
AUG codon. Most RACE 5' ends mapped to one of two clusters, from 286
to 295 or from 419 to 427 bp, with one end residing at 481 bp
(Fig. 1A, open triangles). The sequence of each RACE PCR product matched that of the genomic DNA
up through the anchor-priming site, reducing the likelihood that an
intron resides in the GluR2 5'-UTR, in accordance with previous
observations for the mouse GluR2 gene (Köhler et al., 1994).
View larger version (54K):
[in this window]
[in a new window]
|
Figure 1.
Features of the rat GluR2 promoter and 5'-flanking
region. A, Schematic showing the salient features of the
GluR2 promoter region and partial nucleotide sequence of the GluR2 5'
proximal promoter region, exon 1, and part of intron 1. The exon 1 sequence is in uppercase with the 5' promoter and intron
1 sequences in lowercase letters. mRNA 5' ends
identified by 5' RACE analysis are indicated by open
triangles, and those identified by RNase protection and primer
extension are indicated by solid or gray
circles, respectively. The 5'-most prominent initiation site
has been designated as the +1 transcription initiation site, located
429 bases 5' of the GluR2 AUG (bent arrow). Consensus
cis element sequences for the GluR2 silencer element and
Sp1/Krox-24 and NRF-1 transcription factors are identified by name
adjacent to the corresponding boxed sequence. The
boundaries of the initiation site region and the location of the
methylated CpG dinucleotide (CpGm; filled
diamond) are indicated in the schematic. The location of the
antisense PER2-3 oligonucleotide used for primer extension reactions
is indicated by double underlining below the nucleotide
sequence. B, GC content of the GluR2 promoter and exon 1 and a methylation-sensitive Southern blot. The average GC content ± 10 bp surrounding a central nucleotide was calculated and plotted
along the length of the GluR2 promoter. The dashed line
represents the average GC content (49.7%) for the whole 1.35 kb GluR2
promoter sequence shown. Open triangles, solid
circles, and gray circles refer to RACE, RNase
protection, and primer extension sites, respectively, as described in
A. The solid and open horizontal
bars above the GC plot represent the location of the GluR2
silencer and the Sp1/Krox-24 and NRF-1 regions, respectively. Also
shown are the locations of CpG dinucleotides in the GluR2 promoter. The
methylation state of the CpG dinucleotides was evaluated by sensitivity
to SacII, Eco47III, and
BssHII restriction digestion and represented by
S, E, and B, respectively.
The filled diamond represents a methylated CpG
dinucleotide in kidney and lung but not in cortex and cerebellar DNA,
whereas open diamonds indicate unmethylated CpGs in the
DNA from all four tissues. The blot at
left is an example of an AccI- and
SacII-restricted Southern blot showing tissue-specific
SacII digestion in cortex (Ctx) but not
in kidney (Kid) DNA; lung and cerebellar Southern blots
are not shown. The 1.3 kb fragment between the two AccI
sites (A) was radiolabeled as probe.
|
|
To further identify potential sites of transcription initiation in the
GluR2 gene, we used both primer extension and RNase protection analysis
of adult rat brain RNA (Fig. 2). Primer
extension analysis on cortical RNA using an oligonucleotide, PER2-3
complementary to the GluR2 5'-UTR, revealed multiple reaction products
extending from 312 to 452 nucleotides upstream from the GluR2 AUG
(Fig. 2B). None of these cortical RNA primer
extension products appeared in parallel reactions conducted with an
in vitro synthesized genomic GluR2 RNA control
(Ctl) that includes putative 5'-UTR sequence from 1
through 481 bases; this positive control also includes an additional
40 bp of non-GluR2 polylinker sequence (Fig. 2B, left lane). This result indicates that the multiple
extension products observed in cortical RNA reactions are not the
result of RNA secondary structure preventing the processivity of
reverse transcriptase. To determine which PER2-3 primed
extension products from cortical RNA were derived from GluR2, a
parallel primer extension reaction was run using unlabeled PER2-3
oligonucleotide as primer. Products from this reaction were then
Southern blotted onto a nylon membrane and hybridized with probe B, DNA
complementary to bases 192 through 481 5' of the GluR2 AUG (Fig.
2A). The results of this Southern blot, depicted in
the right lane of Figure 2B, confirm
the identity of nine GluR2 primer extension products. A single reaction
product at 312 was not confirmed by the Southern blot and is
presumably an artifact caused by extension from a non-GluR2 transcript.
View larger version (41K):
[in this window]
[in a new window]
|
Figure 2.
Differential use of transcription initiation sites
in rat cortex and cerebellum. A, Schematic of the 5'
region of the GluR2 gene. Base positions indicated are relative to the
GluR2 AUG codon, and identified transcription initiation sites are
indicated by gray and solid circles as
described in the Figure 1A legend. The location
of the PER2-3 oligonucleotide used for primer extension and probes B,
C, and D are shown. Probes B and C encode identical sequence except
probe B was a DNA probe used in the Southern blot and probe C was an
antisense RNA used for RNase protection. Probe D was an RNA probe used
for RNase protection experiments. B, Primer extension
(p.e.) of rat cortical RNA and Southern blot
(s.b.). The 32P-labeled PER2-3
oligonucleotide-primed extension products from 30 µg of cortical RNA
(middle lane) are shown. Multiple bands are observed in
cortical RNA (Ctx) reactions ranging from 312 to 452
bases 5' of the GluR2 AUG; none of these bands was observed in the
control GluR2 in vitro synthesized RNA reactions
(left lane), indicating that secondary structure does
not account for the multiple bands observed in cortical RNA reactions.
When the cortical primer extension products, derived from a separate
reaction that used unlabeled PER2-3 oligonucleotide as primer, were
Southern blotted and hybridized with probe B, all extension products,
except the shortest, were positively identified as GluR2 (right
lane). C, RNase protection of 30 µg of adult
cortical (Ctx) and cerebellar (Cb) RNA.
Probe C detected multiple GluR2 5' ends both in cerebellar
(middle lane) and cortical (right lane)
RNA. The banding pattern shown here is nearly identical to that
observed by primer extension. The 5'-most band at 481 relative to the
AUG represents full-length probe sequence; therefore this band is a
summation of all GluR2 transcripts 481 bases and longer. An RNase
protection reaction to in vitro synthesized GluR2 that
also extends to 481 bases is shown in the left lane
(Ctl, Control). D, Regional distribution
in brain of long and short GluR2 transcripts. The design of probe D,
used for RNase protection experiments against 30 µg of RNA isolated
from the cerebellum and cortex of each of four rats, allows for the
summation of all GluR2 transcripts 360 bases and longer into a single
band on the gel as well as the identification of short GluR2
transcripts that initiate at 340 bases. Results for all four rats are
shown at the top and are summarized in the graph at the
bottom. Lines in the graph connect the
ratios of long versus short transcripts in cerebellum
(CB) and cortex (CX) for each rat.
Bar graphs are the mean ± SEM of all data and are significantly
different from each other (p < 0.05, paired
t test).
|
|
We also conducted RNase protection assays on rat cortical and
cerebellar RNA to confirm the primer extension findings. Using an
antisense RNA probe (192 through 481 bp of the GluR2 leader, probe
C in Fig. 2A), we again detected multiple bands
predicting different GluR2 5' ends in the cortex and cerebellum, and
these bands were in agreement with results obtained by primer extension (Fig. 2C). Major RNase-protected 5' ends mapped to 340,
368, 399, and 429 bp 5' of the GluR2 AUG codon, with additional
minor ends mapping to 452 and 481 bp. Because the riboprobe in this experiment included GluR2 sequence only to position 481 bp, the 481
band observed at the top of the gel (Fig. 2C, Cb
and Ctx lanes) is a summation of all natural GluR2
transcripts with 5' leaders at least this long. Despite this, however,
the intensity of the 481 band was much weaker than that observed for
shorter, more dominant mRNA species, indicating that long transcripts
were few in number. From these analyses, it seems that GluR2 initiates transcription from multiple dominant sites between 340 and 429 bases upstream of the GluR2 AUG, with a minority of transcripts initiating at 452 and 481 bases. Therefore, depending on the site
of transcription initiation, GluR2 mRNAs will contain a variable-length and unusually long 5'-UTR leader sequence (Kozak, 1987), a GC-rich 5'
end, an imperfect GU repeat (40 nucleotides), and two to five upstream,
out-of-frame AUG codons (Fig. 1A).
Although the banding pattern observed in cerebellar RNA was similar to
that in cortical RNA in the RNase protection assays, longer transcripts
appeared to predominate in the cerebellum (Fig. 2C). To
address this further, an RNase protection probe, probe D (Fig.
2A), was designed that summates all transcripts 360
bases and longer into a single protected band. This probe is also
partially protected by the major 340 transcript population. By
hybridizing this RNA probe to total cortical and cerebellar RNA derived
from each of four rats in separate reactions, we quantified the amount of long GluR2 transcripts (360 and longer) relative to the amount of
short GluR2 transcripts (340) as shown in Figure
2D. The ratio of long to short GluR2 transcripts was
greater in the cerebellum than in the cortex in each of the four rats
tested (Fig. 2D; p < 0.05, paired
t test). These results indicate that GluR2 initiation site
usage differs between these two brain regions and in a strict sense
supports the conclusion that the GluR2 gene contains multiple promoters.
We have designated the 5'-most dominant transcription initiation site,
approximately 429 bases from the GluR2 AUG, the +1 initiation site.
All plasmid constructs used in evaluating GluR2 promoter activity by
transient transfections are defined relative to this site. Our
designated +1 nucleotide for the rat gene is in agreement with the
5'-most start site identified for the mouse GluR2 gene (Köhler et
al., 1994), but there is clear evidence of minor transcriptional
initiation sites further upstream and additional major sites
downstream; indeed, 5' initiation sites are dispersed over >141 bp of
the GluR2 promoter region.
The GluR2 promoter region displays several areas of high (86%) and low
(14%) GC content (Fig. 1B, right). The
region of highest GC content spans ~150 bp adjacent to the +1 site,
includes some of the identified transcription initiation sites, and
identifies a CpG island that could be subject to regulation by
methylation in vivo. Indeed, when genomic DNA isolated from
adult rat cortex, cerebellum, lung, and kidney was codigested with
AccI and one of the methylation-sensitive enzymes
SacII, Eco47III, or BssHII, only the
SacII site at 568 bp was found methylated in a
tissue-specific manner. This SacII site was fully methylated
in kidney (Fig. 1B, 1.3 kb band) and lung
(data not shown) genomic DNA but only partly methylated in DNA
extracted from the cortex (Fig. 1B) and cerebellum (data not shown). In contrast, Eco47III and
BssHII restriction sites were unmethylated in all four
tissues tested (data not shown). The SacII digestion pattern
in cortex may be attributable to a combination of methylated glial DNA
and unmethylated neuronal DNA in the sample, or it may reflect
methylation of a single GluR2 allele. Although methylation of CpG
dinucleotides increases the informational content of genes, the
biological significance of the tissue-specific methylation of the GluR2
promoter remains to be addressed.
The GC-rich proximal area also contains consensus recognition sequences
for Sp1/Krox-24 and the NRF-1 transcription factors (Fig.
1A, box areas). The regulatory role
of these cis elements is evaluated below. Regions more
distal from the +1 site exhibit a low GC content, minimal at consensus
TATA box sequences at 760 and 361 bp and also at the GluR2
initiation AUG codon (Fig. 1). No TATA box element is near any of the
transcriptional initiation sites identified. A weak consensus sequence
for the pyrimidine-rich initiator element lies near the major 5'
initiation site cluster at bp +3 to +11 (Javahery et al., 1994). The
absence of a TATA box near transcription initiation sites is a common
feature in mammalian genes, including glutamate receptor genes such as
NR1, NR2B, NR2C, and KA-2 (Bai and Kusiak, 1993; Suchanek et
al., 1995; Sasner and Buonanno, 1996; Huang and Gallo, 1997), and mouse
GluR2 (Köhler et al., 1994). Overall, the nucleotide sequence
similarity between the mouse and rat GluR2 promoter regions is high
with a 90-95% sequence identity over 1.2 kb of the proximal promoter region, including 0.8 kb 5' of the +1 transcription initiation site.
Identification of a minimal promoter region
We generated a series of 5'- and 3'-GluR2 promoter deletion
constructs and transfected these into primary cortical and primary glial cultures to define the boundaries of a minimal GluR2 promoter region and to identify cis elements that govern the
cell-specific expression of GluR2. These constructs were also used to
evaluate the role of consensus TATA and CAAT box sequences residing
upstream in the GluR2 5' promoter. Whether deletions were made from the 5' or the 3' side, substantial luciferase expression was observed in
primary cortical cultures when the region delimited by all transcription initiation sites (52 to +144; Fig.
3A, vertical dashed lines) was included in the promoter construct
(Fig. 3B). A similar pattern of promoter activity was
observed when these same constructs were transfected into primary glia
(Fig. 3C) or HeLa cells (data not shown), with the exception
that changes in promoter activity were generally less marked and,
overall, promoter strength relative to SV40 was much lower than that
observed in neurons. From these experiments it seems that GluR2
promoter activity is strongly dependent on cis elements
positioned between 134 and +320 bp (Fig.
3A,B).
View larger version (39K):
[in this window]
[in a new window]
|
Figure 3.
5' and 3' deletion analysis of the GluR2 promoter.
A, A series of 5' and 3' deletion constructs was
generated by PCR and cloned into the NheI and
BglII sites of the pGL2 basic vector, upstream of
firefly luciferase, for transfection into cultured cells. The
boundaries of the promoter constructs are defined relative to the +1
transcriptional initiation site (Fig. 1A) and are
indicated on the left, as are the relative locations of
TATA and CAAT box sequences and the GluR2 AUG codon (A;
bottom). The area spanning all identified transcription
initiation sites is indicated by the vertical dashed
lines, and the +1 initiation site is marked with an
arrow. B, Independent constructs were
transfected into cortical neurons, and the promoter activity was
normalized to that of SV40 to allow pooling of data from multiple
experiments. When a deletion construct eliminated part of the
transcription initiation site region, a significant drop in GluR2
promoter activity was observed. However, no single initiation site was
essential for promoter activity. Note that these cortical neuronal
cultures are a mixture of neurons (~60%) and glia (~40%).
C, When constructs were transfected into pure cultures
of primary glial cells, similar results were observed except that GluR2
promoter activity was very weak compared with that in neurons. Note the
different scales of the x-axes in B and
C. D, Short promoter fragments were made
by PCR to identify the minimal boundaries of the GluR2 promoter region
necessary for strong neuronal expression. The locations of identified
transcription initiation sites are shown with the same
symbols used in Figure 1A.
E, Transfection of minimal constructs into cultured
cortical neurons shows again that elimination of part of the
transcription initiation site region (dashed lines
in D) significantly reduced promoter
activity. F, Similar results were observed in parallel
transfections into cultured glia, and again, promoter activity was weak
compared with that in the neurons. In these glial transfections, the
SV40 construct had unusually low promoter activity, resulting in an
artificially high ratio of GluR2 to SV40 activity on the
x-axis. Results shown are the mean ± SEM for
12-33 plasmid transfections in 47 neuronal cultures in
B, for 3-9 plasmid transfections in 17 primary glial
cultures in C, for 7-20 plasmid transfections in 20 neuronal cultures in E, and for 7-20 plasmid
transfections in 9 glial cultures in F.
*p < 0.05 from the
R2(134/+147)luc construct by ANOVA and post
hoc Dunnett's tests. Statistical analysis was not conducted on
data in B and C. The average raw
luciferase activity for the R2(302/+320)luc construct
in neurons and glia was 1610 ± 160 and 4.1 ± 1.2 attomoles
of luciferase per µg of DNA per well, respectively.
|
|
To define this region of the GluR2 promoter further, we designed
shorter constructs that eliminated portions of this central promoter
area (134 to +320 bp), from either the 5' or the 3' side, and
transfected these constructs into primary cortical neurons and glia.
Among these, R2(134/+147)luc, which spanned all identified initiation sites, possessed more than twice the promoter activity of
any of the shorter constructs (Fig.
3D,E). For example, when 44 bp were
removed from the 3' end of R2(134/+147)luc to generate R2(134/+103)luc, promoter activity was reduced by 53% in
neurons, and likewise, when 124 bp were removed from the 5' end to make R2(10/+147)luc, promoter activity was reduced by 86% in
neurons (Fig. 3E). Similar effects of these deletions on
promoter strength were observed in primary glia (Fig.
3F) and C6 glioma cells (data not shown), except
promoter activity in glia was again much weaker than that in primary
cortical cultures. The promoter activity of the R2(169/+103)
construct was identical to that of R2(98/+103) (Fig.
3D,E), indicating that the sequence
between 169 and 98 bp plays no role in expression under our
conditions. Judging from the activities of the constructs depicted in
Figure 3, it appears that dual regions within the GluR2 central
promoter area may be needed for optimum expression in both cortical
neuronal and glial cells. The upstream region, from 98 to 10 bp,
consists of a GC-rich sequence that includes the putative Sp1/Krox-24
and NRF-1 elements and minor initiation sites. The downstream region,
from +103 to +147 bp, includes a cluster of RACE 5' ends (Fig.
1A) and a consensus sequence for metal element
protein-1 (MEP-1) at bp +127 to +133 on the antisense strand. From
these short constructs, we provisionally identify the entire 98 to
+147 sequence as a minimal GluR2 promoter region that appears
sufficient for strong expression in cortical cultures.
We also evaluated the functional role of upstream TATA box elements
using constructs R2(822/743)luc and
R2(822/332)luc. Both of these constructs produced little
or no activity in both neurons or glia (Fig.
3B,C), eliminating a major role for
the upstream TATA boxes. Similarly, inclusion of the tandem CAAT boxes at bp 317 and 324 in the R2(822/134)luc construct
also produced very low activity in neurons and glia. These functional
results support our RACE, RNase protection, and primer extension
findings that failed to demonstrate an association between
transcription initiation sites and upstream TATA boxes and indicate
that the GluR2 gene functions as a TATA-less promoter, as suggested by Köhler et al. (1994). A construct, R2(822/+832)luc,
which contained 0.77 kb of 5' promoter sequence, all of exon 1, and
part of the GluR2 intron 1, also showed no significant change in
promoter activity in cortical cultures or primary glia (data not
shown), indicating that in transiently transfected cortical cultures, the first GluR2 intron does not appear to harbor promoter regulatory elements.
Neural specificity of the GluR2 promoter
We transfected primary cortical neuronal and primary glial
cultures, as well as C6 glioma and HeLa cell lines, with the
R2(302/+320)luc construct to evaluate the neural
specificity of the GluR2 promoter. Judged by the percentage of stained
cells after transfection with a Rous sarcoma virus
(RSV)--galactosidase expression plasmid, typical
transfection efficiencies were 0.5-1% for primary neurons, 6-8% for
primary glia, and 10-20% for the transformed cell lines (Table
1). Even though transfection efficiencies
in the cultured neurons were low, the total raw firefly luciferase
activity of the R2(302/+320)luc construct was quite strong
in these cultures, on the order of 3000 Turner light units (TLU) per
µg of transfected DNA per well (background, ~0.10 TLU/well). This
signal corresponds to 1.42 ± 0.01 fmols of luciferase per µg of
DNA (n = 80). We estimate that in each transfection up
to 9000 neurons contribute to the total signal, based on transfection
into triplicate wells, 1 × 106 cells/well
plated, an RSV-lacZ transfection efficiency of 0.5%, and a
60% fractional neuronal cell population in the culture.
When luciferase activities were normalized to SV40- or the CMV-promoter
activity in each experiment and the average relative activity was
calculated in neurons, primary glia, C6 glioma, and HeLa cells, the
R2(302/+320)luc construct appeared to be 37-400-fold neuronal-selective. These values, however, are overestimates caused by
the preferred activities of the SV40 and CMV viral promoters in the
non-neuronal cells (Table 1). Nonetheless, when viral promoter cell
preferences are accounted for, the R2(302/+320)luc construct still exhibited a neuronal selectivity of up to 72-fold.
We also analyzed our data on a per-transfected-cell basis by counting
the actual number of RSV-lacZ transfected cells in parallel wells stained with
5-bromo-4-chloro-3-indolyl--galactopyranoside. Over four
experiments, the average R2(302/+320)luc promoter
activity, per transfected cell, was 0.661 ± 0.138 TLU in cortical
cultures, 0.022 ± 0.002 TLU/cell in cultured glia, and 0.034 ± 0.019 TLU/cell in C6 glioma cells. The average ratio of cortical
neuronal to glial and C6 glioma promoter activities, per cell, from all
experiments, showed that GluR2 promoter activity was 32.5 ± 3.9- and
26.6 ± 8.6-fold more active in the cortical neurons than in cortical glia and C6 glioma cells, respectively.
To provide another estimate of cell selectivity, transfected cortical
neuronal cultures were costained with an anti-firefly luciferase
antibody and either anti-MAP-2 or anti-GFAP antibodies 1 d after
R2(302/+320)luc transfection. Of 923 luciferase-positive cells counted, >97% also expressed the neuron-specific marker MAP-2
(Fig.
4A,B).
When immunostainings were conducted in parallel cultures to identify
expression in glial cells, only 6 of 645 luciferase-positive cells
costained for the glial specific marker GFAP (data not shown). In these
six copositive cells, luciferase expression was marginally discernible
above background fluorescence, indicating that even in these glial
cells GluR2 promoter activity was weak. On the other hand, when
cortical cultures were transfected with the CMV-luc
construct, strong anti-luciferase staining in GFAP-positive cells was
observed, indicating that transfected glial cells in the primary
neuronal cultures were capable of strong luciferase expression (data
not shown). These results together demonstrate that the GluR2 promoter
is a strong, neuron-selective promoter that is ~30-fold stronger in
primary neurons than in primary glia.
View larger version (86K):
[in this window]
[in a new window]
|
Figure 4.
Minimal GluR2 promoters restrict luciferase
expression to neurons. The GluR2 promoter constructs
R2(302/+320)luc (A, B)
or R2(134/+147)luc (C,
D) were transfected into day 5 primary cortical neuronal
cultures and double-immunostained 24 hr later with rabbit
anti-luciferase (anti-luc) (A,
C) and mouse anti-MAP-2
(B, D) primary antibodies as described in
Materials and Methods. A, A cell with neuronal
morphology stained positive for luciferase expression, as detected by
the goat anti-rabbit FITC-conjugated secondary antibody.
B, The same cell in A is also positive
for the neuronal-specific antigen MAP-2 (arrow),
detected with a donkey anti-mouse Texas Red-conjugated secondary
antibody. From five R2(302/+320)luc transfections in
which 923 luciferase-positive cells were counted, >97% were clearly
positive for the MAP-2 antigen. C, Another cell with
neuronal morphology was positive for luciferase expression, as
described in A, except the culture was transfected with
the R2(134/+147)luc minimal promoter construct.
D, The same field as in C identified the
transfected cell as MAP-2-positive (arrow). From two
R2(134/+147)luc transfections in which 146 luciferase-positive cells were counted, >93% were clearly
MAP-2-positive. Scale bar: A-D, 50 µm.
|
|
Because the GluR2 minimal promoter region also showed strong activity
in neurons, we were interested in determining, by immunofluorescence, whether a minimal promoter construct could regulate
cell-type-selective GluR2 expression in the mixed neuron-glia
cortical cultures. When cortical cultures were transfected with
R2(134/+147)luc, >93% of 146 luciferase-positive cells
costained positive for MAP-2 (Fig. 4C,D),
indicating that elements in this region of the promoter appear
sufficient to guide selective luciferase expression in transfected
primary cortical neurons.
Deletion scan of the GluR2 promoter identifies a silencer element
and a positive regulatory region
To identify elements more precisely within the proximal promoter
that regulate GluR2 expression, we made internal deletions in the
R2(302/+320)luc construct and analyzed these by
transfection into cortical neuronal and glial cultures, in parallel, as
above. Most constructs substituted a unique 6 bp restriction enzyme
site for 25-30 bp of GluR2 promoter sequence; the deletions in K, L, and M were larger (Fig.
5B). For each experiment,
three or more independent plasmid DNA preparations for each construct
were transfected into the cells. By this analysis, we identified a 25 bp region that, when deleted in the R2(302/+320)luc-B
construct, resulted in a significant increase in expression in glial
cells but not in neurons (Fig. 5B).
R2(302/+320)luc-D, which eliminated the 146 to 118
region, resulted in a 47% increase in promoter activity in neurons but
not in glia, suggesting that this region of the GluR2 promoter may
negatively regulate expression in neurons. Three other 25-30 bp
deletion constructs, G, H, and I, caused a significant
reduction in luciferase expression in both neurons and glial cells. In
these cases, promoter activity in each cell type dropped by 35-65%
compared with that of the parent R2(302/+320)luc construct, even though the basal promoter activity differed ~35-fold in the two cultures (Fig. 5A). Results found in transfected
C6 glioma cells were similar to those in glia (data not shown). The G, H, and I internal deletion constructs span the region from 64 to +14 bp and include the consensus sequences for Sp1/Krox-24 and
NRF-1. The L deletion (+71 to +146) also resulted in a reduction in
promoter activity that was marginally greater in glia than in the
neuronal cultures. This deletion mutant eliminated the most 3'
initiation site identified by primer extension and RNase protection
(Fig. 2A,B, 340 band), the 3'
cluster of RACE 5' ends, and a putative MEP-1 element. In contrast, the
deletion of other major transcription initiation sites in the J,
K, and M constructs did not reduce luciferase expression.
View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Mutation sensitive scan of the proximal GluR2
promoter identifies both positive and negative regulatory regions.
A, The promoter activity of the base construct
R2(302/+320)luc in cultured neurons (N;
n = 63) and glia (G;
n = 46), relative to SV40luc
activity, is shown. Data are the mean ± SEM combined from all
experiments. The average raw luciferase activity recovered from neurons
and glia for the unmutated R2(302/+320)luc control was
1320 ± 120 and 31 ± 14 attomoles per µg of DNA per well,
respectively. B, A series of short internal deletions
(A through N, typically 24-31 bp long, except K, L, and
M) were generated by replacement with unique 6 bp restriction sites
in the R2(302/+320)luc GluR2 context. All deletions
were generated by PCR and are shown schematically at the
top. Dashed lines indicate the sequence
deleted for the indicated construct (uppercase letters).
Gray and solid circles and open
triangles on the line indicate the locations of
primer extension, RNase protection, and RACE 5' ends, respectively.
Open boxes identify the locations of Sp1/Krox-24 and
NRF-1 consensus sequences; the black box identifies the
GluR2 silencer that is homologous with the RE1/NRSE silencers. The
effect of each internal mutation on promoter activity in cultured
cortical neurons and glia is shown. Luciferase activity was normalized
to that of the unmutated R2(302/+320)luc control
construct. Note the log scale on the y-axis. The
R2(302/+320)luc-B construct resulted in a
significant twofold increase in promoter activity in glia. Likewise the
R2(302/+320)luc-D deletion resulted in a
significant increase in promoter activity in neurons. Three other
deletions, R2(302/+320)luc-G, -H, and -I,
resulted in significant decreases in promoter activity in both glia and
neurons. This internal deletion scan identified both a silencer region
that negatively regulates GluR2 promoter activity in glia and a larger
78 bp region that positively regulates promoter activity in both
neurons and glia. Data shown are the mean ± SEM for 6-18 plasmid
transfections in 21 cultured neuronal preparations and for 6-8
transfections in 18 cultured glial preparations. lucif,
Luciferase. *p < 0.05 and **p < 0.01 indicate significance from the control construct by ANOVA and
post hoc Dunnett's tests.
|
|
The pattern of expression from these internal deletion constructs
complements our findings from the external 5' and 3' deletion series
(Fig. 3) and allowed us to provisionally eliminate up to 364 bases of
the GluR2 promoter from further consideration. We focused our attention
on the non-neural silencer element identified in deletion
R2(302/+320)luc-B and the positive regulatory region identified in deletions R2(302/+320)luc-G, -H, and
-I.
The GluR2 silencer is a cell-specific modulator of expression, not
a switch
Inspection of the GluR2 promoter sequence revealed a 21 base
element with 71% identity to both the rat NaII-RE1 (Maue et
al., 1990; Kraner et al., 1992) (Fig.
6A) and the rat SCG10
gene neuron-restrictive silencer element (NRSE) (Mori et al., 1992).
This RE1/NRSE-like element in the GluR2 promoter is located on the
antisense strand at bp 174 to 194 (Fig. 1A) and
had been deleted entirely in the R2(302/+320)luc-B
construct (Fig. 5B). Given the sequence similarity, we
investigated the role of the putative GluR2 silencer in regulating
R2(302/+320)luc promoter activity in neuronal and non-neuronal cells. When the entire GluR2 silencer was replaced with an
NsiI restriction site (Fig. 6A, B) or
different 6 bp stretches were substituted by 6 bp EcoRI or
EcoRV restriction sites (Fig. 6A,
RI, RV), significant two- to
threefold increases in R2(302/+320)luc activity were
observed in glia and C6 gliomas (Fig. 6B). Similar
results were observed when these same mutations were introduced into
the context of a larger R2(822/+320)luc promoter construct
(data not shown). No changes in neuronal expression were observed by
any of these mutations (Fig. 6B), demonstrating that
silencing activity was specific to non-neuronal cells alone. These
results are consistent with known RE1/NRSE silencers in other genes, in
which short internal missense mutations are sufficient to disrupt
silencing activity in non-neuronal cells (Kraner et al., 1992; Mori et
al., 1992; Li et al., 1993; Mieda et al., 1997).
View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
A weak GluR2 silencer interacts with the repressor
REST. A, Schematic showing the location and antisense
orientation of the silencer in the GluR2 promoter. The native (GluR2)
and mutagenized silencer elements introduced into the
R2(302/+320)luc promoter construct are listed.
Dashes represent deleted sequence, and
lowercase, boldface type represents
substitution mutations. The B mutation is the same mutation as the
internal deletion construct depicted in Figure 5. The NaII-RE1 sequence
shown is the Type II Na channel RE1 silencer (Kraner et al., 1992),
which differs from GluR2 in six positions. B, Functional
analysis of silencer mutations on GluR2 promoter activity in primary
cortical neurons, primary cortical glia, and C6 glioma cells. In
neurons, no mutation resulted in a significant change in promoter
activity from that of the R2(302/+320)luc control. In
primary glia and C6 glioma |
|
Top
Abstract
Introduction
