 |
 Previous Article | Next Article 
The Journal of Neuroscience, September 1, 1998, 18(17):6776-6789
Spontaneous Activity of Solitary Dopaminergic Cells of the
Retina
Andreas
Feigenspan,
Stefano
Gustincich,
Bruce P.
Bean, and
Elio
Raviola
Department of Neurobiology, Harvard Medical School, Boston,
Massachusetts 02115
 |
ABSTRACT |
Dopaminergic interplexiform amacrine cells were labeled in
transgenic mice with human placental alkaline phosphatase and could therefore be identified after dissociation of the retina and used for
whole-cell current and voltage clamp. In absence of synaptic inputs,
dopaminergic amacrines spontaneously fired action potentials in a
rhythmic pattern. This activity was remarkably robust in the face of
inhibition of various voltage-dependent ion channels. It was minimally
affected by external cesium or cobalt, suggesting no involvement of
either the hyperpolarization-activated cation current
Ih or voltage-dependent calcium channels.
Inhibiting calcium-activated potassium channels by charybdotoxin or
tetraethylammonium slowed the repolarizing phase of the action
potentials and eliminated a slow afterhyperpolarization but had a
scarce effect on the frequency of spontaneous firing. Voltage-clamp
experiments showed that the interspike depolarization leading to
threshold results from tetrodotoxin-sensitive sodium channels active at
the interspike voltages of  60 to 40 mV. Because dopamine acts on
distant targets in the retina, the pacemaker activity of dopaminergic
amacrines may be necessary to ensure a tonic release of the modulator
from their dendritic tree. Pacemaking is a property that this type of
retinal amacrine cell shares with the dopaminergic mesencephalic
neurons, but the ionic mechanisms responsible for the spontaneous
firing are apparently different.
Key words:
dopamine; retina; interplexiform amacrine cells; patch
clamp; pacemaker activity; ion channels; subthreshold sodium
current
| |
INTRODUCTION |
Dopamine subserves fundamental
functions in the nervous system: it facilitates and controls initiation
of movement (Hikosaka and Wurtz, 1983 ), regulates reward behaviors and
affective states (Le Moal and Simon, 1991), and, in the retina, is
responsible for many of the events that lead to neural adaptation to
light (Witkovsky and Dearry, 1991; Djamgoz and Wagner, 1992). Thus, an understanding of the mechanisms that control the release of this
modulator may have important consequences for interventions in motor
and affective disorders. An interesting property of the midbrain
dopaminergic neurons is their capacity to generate action potentials in
a rhythmic manner even in the absence of synaptic inputs (Grace and
Onn, 1989; Lacey et al., 1989; Hainsworth et al., 1991; Yung et
al., 1991; Cardozo, 1993; Cardozo and Bean, 1995). We have found that
also dopaminergic amacrine cells spontaneously generate action
potentials when isolated from the retina and studied in
vitro (Gustincich et al., 1997). In this paper we show that these
cells possess a pacemaker activity very similar to that of their
counterparts in the midbrain (Grace and Bunney, 1983a,b; Grace and Onn,
1989; Yung et al., 1991). However, an analysis of the mechanism of
spontaneous firing showed that, in contrast to the midbrain neurons,
neither the hyperpolarization-activated cation current
Ih nor voltage-dependent calcium currents play a
role in the firing of the dopaminergic amacrines: in these cells, the
slow depolarization between spikes appears to result solely from
tetrodotoxin-sensitive sodium channels. The fact that projection neurons with long axons directed to distant regions of the brain and a
retinal interneuron share the property of spontaneous firing suggests
that tonic dopamine release may be a common functional characteristic
of dopaminergic neurons throughout the nervous system.
| |
MATERIALS AND METHODS |
Dissociation of the retina and identification of
dopaminergic amacrine cells. For this study, a transgenic mouse
line was used in which dopaminergic neurons in the retina and CNS
express human placental alkaline phosphatase (PLAP) on the outer
surface of the cell membrane (Gustincich et al., 1997). These animals were obtained by introducing into the mouse genome PLAP cDNA (Kam et
al., 1985), linked to a promoter sequence of the gene for tyrosine hydroxylase (TH) (Banerjee et al., 1992), the rate-limiting enzyme for
dopamine biosynthesis. Animals were anesthetized by intraperitoneal injection of 0.1 ml of a solution containing 50 mg/ml ketamine HCl
(Ketaset; Fort Dodge Laboratories, Fort Dodge, IA) and 1% xylazine
(Rompun; Bayer, Shawnee Mission, KS). After dissociation of the adult
retina and plating of the cell suspension, solitary dopaminergic
amacrines could be identified for recordings by labeling of their
membrane by a monoclonal antibody to PLAP (E6; De Waele et al., 1982)
conjugated to the fluorochrome Cy3 (E6-Cy3). The procedure of
dissociation of the retina was described elsewhere (Gustincich et al.,
1997): briefly, after removal of cornea, lens, and vitreous body, the
eyecups including the retinas were transferred to a solution containing
20 U/ml papain and 200 U/ml DNase I (both from Worthington, Freehold,
NJ) in Earle's balanced salt solution (EBSS; Sigma, St. Louis, MO). At
the end of the digestion (45 min, 37°C), the eyecups were washed in a
solution to stop papain activity (5 min, 37°C). This solution
contained 1 mg/ml ovomucoid (Worthington), 1 mg/ml bovine serum albumin
(Sigma), and 100 U/ml DNase I in EBSS. Then, the retinal pieces were
carefully detached from the pigment epithelium and triturated using
fire-polished Pasteur pipettes of varying bores. The resulting cell
suspension was centrifuged at 1000 rpm for 5 min, and the pellet was
resuspended in Minimum Essential Medium (Sigma) containing E6-Cy3
(1:100) and 0.1% bovine serum albumin. The dissociated retinal neurons were directly plated on the glass bottom of concanavalin A-coated (1 mg/ml) recording chambers and kept at 37°C in 5%
CO2 and 95% O2 for at least 1 hr before
commencement of recordings. To prove that the cells stained by E6-Cy3
contained TH mRNA, nested RT-PCR was performed on single fluorescent
cells isolated by suction with a patch-clamp pipette. The first-round
forward (THF) primer was CTGGCCTTCCGTGTGTTTCAGTG, which hybridizes with
TH cDNA at nucleotide (nt) 915 (GenBank accession number M69200), and the corresponding reverse (THR) primer was CCGGCTGGTAGGTTTGATCTTGG, which hybridizes with TH cDNA at nt 1296. The first-round RT-PCR product was 382 bp long. The second-round nested THF primer was AGTGCACACAGTACATCCGTCAT, which hybridizes with TH cDNA at nt 934, and
the corresponding nested THR primer was GCTGGTAGGTTTGATCTTGGTA, which
hybridizes with TH cDNA at nt 1293. The final nested RT-PCR product was
360 bp long. This fragment contained a unique SacI site, and
digestion with this enzyme produced fragments of 271 and 89 bp. Further
details of the procedure will be described in another paper.
Electrophysiology. For recordings, Petri dishes with the
dissociated retinal cells were mounted on the stage of an inverted microscope (Diaphot 300, Nikon), and E6-Cy3-stained dopaminergic amacrines were identified by scanning the coverslip in epifluorescence. Patch-clamp recordings in the voltage- and current-clamp mode were
performed with an Axopatch 200A amplifier (Axon Instruments, Foster
City, CA). Currents were low-pass-filtered at 5 kHz using the internal
Bessel filter of the amplifier. Current and voltage outputs from the
patch-clamp amplifier were digitized with a DigiData 1200 interface
(Axon Instruments) and viewed with an oscilloscope (BK Precision,
Chicago, IL) or directly on the screen of a Gateway 4DX2-66 computer.
The sample frequency was 10-50 kHz for whole-cell voltage-clamp
recordings and 2-5 kHz for current-clamp recordings. Fast current
events recorded in the cell-attached mode were sampled at a frequency
of 5 kHz. Patch pipettes were constructed from borosilicate glass (1.65 mm outer diameter, 1.2 mm inner diameter; A-M Systems, Everett, WA)
using a horizontal two-stage electrode puller (BB-CH; Mecanex, Geneva,
Switzerland); the electrode resistance ranged from 5 to 7 M .
Electrodes were connected to the amplifier via an Ag-AgCl wire. The
electrode holder and the head stage were mounted on a piezoelectric,
remote-controlled device attached to a three-dimensional
micromanipulator (Burleigh Instruments, Fishers, NY). In voltage-clamp
experiments, the series resistance of the pipettes was in the range of
12-20 M and could be compensated up to 80% after cancellation of
capacitive transients. Drugs were applied to single cells in the
extracellular bath solution by gravity flow through an array of
microcapillary tubes. Drugs could be selected using a Teflon rotary
valve (Rheodyne, Cotati, CA). This application system allowed for a
complete solution exchange in the vicinity of the recorded cell within
200-500 msec.
Recording solutions. Unless noted otherwise, the
extracellular bath solution for recordings in current-clamp mode
contained (in mM): 137 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5 HEPES, and 10 glucose. The intracellular solution for recordings in current-clamp mode contained (in mM): 125 K-gluconate, 10 KCl, 0.5 EGTA,
and 10 HEPES. Recordings of voltage-dependent calcium currents were performed with the following extracellular solution (in
mM): 145 TEACl, 20 CaCl2, and 10 HEPES.
The intracellular solution for these experiments contained (in
mM): 117 TEACl, 4.5 MgCl2, 9 EGTA, 9 HEPES, 14 phosphocreatine, 4 Mg-ATP, and 0.3 Na-GTP. The extracellular solution for voltage-clamp recordings of sodium currents contained (in
mM): 100 NaCl, 60 TEACl, 2 CaCl2, 0.3 CdCl2, and 10 HEPES, and the corresponding
intracellular solution contained (in mM): 120 CsCl, 20 TEACl, 1 CaCl2, 2 MgCl2, 11 EGTA,
and 10 HEPES. All biochemicals were obtained from Sigma unless
otherwise noted. Stock solutions of apamin and charybdotoxin (Alomone
Laboratories, Jerusalem, Israel) were stored at 20°C and diluted in
extracellular solution immediately before use. A stock solution of
tetrodotoxin (TTX; Research Biochemicals, Natick, MA) was made
in 2 mM citric acid and stored at 20°C. ATP, GTP, and
phosphocreatine were prepared as a 10× stock solution and kept frozen
at 80°C.
| |
RESULTS |
Identification of dopaminergic amacrine cells
As shown previously (Gustincich et al., 1997), two classes of
amacrine cells express PLAP in the retina of our transgenic mice; one
class is characterized by a large, spherical perikaryon that is stained
by antibodies to TH and sends processes to the outer plexiform layer.
This cell corresponds to type 1 dopaminergic (interplexiform) amacrine
cells of other mammalian species (Mariani and Hokoc, 1988;
Nguyen-Legros, 1988; Tauchi et al., 1990; Versaux-Botteri et al.,
1984). Cells of the other class have a smaller perikaryon and do not
exhibit TH-like immunoreactivity. They correspond to the type 2 or
small catecholaminergic amacrines of other mammals (Mariani and Hokoc,
1988; Nguyen-Legros, 1988; type 3 in the rabbit, according to Tauchi et
al., 1990). After dissociation of the retina, type 1 dopaminergic
amacrines are easily recognized because of the large size and intense
staining with both the histochemical method for PLAP (Fig.
1) and the monoclonal antibody to PLAP
E6-Cy3. Small type 2 cells are seen only with difficulty.
View larger version (114K):
[in this window]
[in a new window]
|
Figure 1.
Solitary dopaminergic amacrine cell. After papain
digestion and mechanical trituration of the retina, a
formaldehyde-fixed dopaminergic amacrine was identified because it was
stained by the histochemical method for PLAP (Gustineich et al., 1997).
The dendrites (arrowheads) are mostly out of focus.
Magnification, 800×. Inset, Agarose gel electrophoresis
of the cDNA fragments obtained after nested single-cell RT-PCR for TH
transcript. The 360 bp product specific for TH mRNA was only amplified
from a dopaminergic amacrine labeled by E6-Cy3 (LC). An
unstained cell (UC) and a control reaction
(C) were negative for TH. An aliquot of the
reaction products from LC was purified and cut with SacI
to show the specificity of the amplification. As expected, the
digestion with this restriction enzyme produced fragments of 271 and 89 bp.
|
|
Nested single-cell RT-PCR confirmed beyond doubt that the large neurons
stained by E6-Cy3 contained TH mRNA and, therefore, were dopaminergic
amacrines, because TH transcript was absent in unlabeled cells (Fig. 1,
inset).
Previous experiments had demonstrated that the physiological responses
of dopaminergic amacrines were not altered by expression of PLAP at the
cell surface and binding of antibody to the enzyme (Gustincich et al.,
1997).
Spontaneous activity
Recordings with the patch-clamp technique in the whole-cell
configuration were obtained from 250 dopaminergic amacrines. Cells were
chosen that possessed two or three dendrites that could be followed for
a length of at least 30 µm (Fig. 1). Stable patch-clamp recordings,
lasting from 10 to 45 min, were obtained from 62% of the cells.
Dopaminergic amacrines were spontaneously active. In the cell-attached
configuration, action currents were recorded across the patch, usually
in a rhythmic pattern (Fig.
2A). After disruption
of the patch membrane, ~80% of the cells continued to fire
spontaneous action potentials (recording in current-clamp mode with no
injected current). The frequency of firing was 3-9 Hz [6.0 ± 0.5 (SEM) Hz; n = 25], the same rate as that of the action currents recorded in the cell-attached configuration (Fig. 2B). Interspike intervals were relatively constant in
some cells, with occasional misses, and irregular in others. Cells that
became quiescent on establishment of whole-cell recording had an
average resting potential of 46 ± 1.6 mV (n = 9), approximately corresponding to the midpoint of the slowly rising
ramp that led to spike initiation in spontaneously active cells.
View larger version (26K):
[in this window]
[in a new window]
|
Figure 2.
Spontaneous and depolarization-induced activity of
solitary dopaminergic amacrines. A, Action currents
observed in the cell-attached configuration with the pipette potential
held at 0 mV. Single-channel events, probably attributable to opening
of potassium channels, were also visible. B, Spontaneous
activity of a solitary dopaminergic amacrine measured in whole-cell
current clamp with no current applied. The amplitude of the spikes was
89 mV (measured from the threshold at 37 mV); their width at
threshold was 4.3 msec. The spikes were followed by a prolonged
afterhyperpolarization that peaked at 59 mV. C, In
current clamp, a dopaminergic amacrine was hyperpolarized to 50 mV to
remove spontaneous activity. The membrane potential was then gradually
increased by injecting depolarizing current steps (2 sec each). The
dopaminergic amacrine followed the current injections by linearly
increasing its spike frequency. With depolarizations >20 pA,
dopaminergic amacrines fired a burst of three to five action potentials
followed by a depolarizing block.
|
|
For comparison with identified dopaminergic amacrines, we also recorded
from unlabeled large neurons, probably ganglion cells. These had
resting membrane potentials of 50 to 70 mV and were usually silent.
On occasion, unlabeled cells with a depolarized membrane potential
generated spikes spontaneously, but their pattern of firing was
irregular, and they never exhibited the rhythmic activity of
dopaminergic amacrines. Dopaminergic amacrine cells also differed
markedly from putative ganglion cells in their response to injected
current pulses, applied after spontaneous activity was halted by
hyperpolarization to 50 to 55 mV (Fig. 2C). With injection of increasing amounts of depolarizing current, dopaminergic amacrines responded with an increased frequency of firing up to a limit
of 22 ± 2 Hz (n = 9), beyond which they entered
depolarizing block. In contrast, putative ganglion cells were able to
fire at much higher frequencies (up to 60 Hz) without entering
depolarizing block. The comparison suggests fundamental differences in
the intrinsic membrane properties of the two types of neurons.
Ih is not responsible for
spontaneous activity
The spontaneous activity of dopaminergic amacrines (Fig.
2B) was characterized by relatively broad action
potentials (average spike duration 4.36 ± 0.05 msec;
n = 186; measured at threshold), triggered at a
relatively depolarized threshold (37.8 ± 0.2 mV; n = 186). Average spike height, measured from threshold
to peak, was 91.5 ± 0.5 mV (n = 186). The action
potentials were preceded by a slow depolarization and followed by a
prominent afterhyperpolarization, which merged into the slow
depolarization preceding the next spike.
In many excitable cells that are spontaneously active, the
hyperpolarization-activated cation current Ih
plays a crucial role (DiFrancesco et al., 1986; McCormick and Pape,
1990; Hille, 1992; Pape, 1996). However, this does not seem to be true
for the spontaneous activity of dopaminergic amacrines. Under current
clamp, injection of hyperpolarizing pulses showed only a small amount
of "sag" of the voltage response (Fig.
3A,B).
The input resistance of dopaminergic amacrines was high, 2.4 ± 0.1 G (n = 28) measured from the tangent of the
I-V curve at the resting membrane potential, and
decreased by only 10-15% with hyperpolarization beyond 150 mV (Fig.
3B). This suggests the absence of a significant
hyperpolarization-activated conductance. The membrane time constant was
30.7 ± 1.2 msec (n = 17). The membrane properties
of dopaminergic amacrines under current clamp are summarized in Table
1.
View larger version (29K):
[in this window]
[in a new window]
|
Figure 3.
Input resistance and hyperpolarization-activated
currents of dopaminergic amacrines. A, Input resistance
measurements. To suppress spontaneous activity, a dopaminergic amacrine
was hyperpolarized to 54 mV. Voltage responses to negative current
pulses (6 steps of 10 pA each, 400 msec duration) were measured in
current clamp. The cell showed only a small decrease in apparent input
resistance (sag) with increasing hyperpolarizations. Action
potentials were induced by the rebound depolarization at the end of the
larger current pulses; these segments are not included for
clarity. B, Input resistance of the cell shown in
A was calculated by plotting the peak membrane voltage
response ( ) and steady-state membrane voltage response ( ) versus
the injected hyperpolarizing current. The regression line was fitted to
the linear portion of the plot obtained with small current pulses. The
peak input resistance as determined by the slope of the linear fit was
2.9 G. C, Dopaminergic amacrine was held at 50 mV
in voltage clamp and hyperpolarized in 10 mV steps of 2 sec duration to
a final voltage of 100 mV. No time-dependent current was seen
positive to 90 mV. D, Time-independent resting current
was reduced by 1 mM cesium, and the time-dependent current
at 90 and 100 mV was abolished. Transient current fluctuations were
occasionally seen at very negative potentials. E, In
current clamp, a dopaminergic amacrine had a resting membrane potential
of approximately 45 mV and fired in a rhythmic pattern at a frequency
of 5 Hz. Application of 1 mM cesium for 5 sec had no
significant effect on the membrane potential of the cell or its firing
frequency.
|
|
Voltage-clamp experiments suggested that Ih is
present but very small in dopaminergic amacrines. Long (2 sec)
hyperpolarizing voltage steps delivered from a holding potential of
50 mV elicited only small (<15 pA) time-dependent currents, even
with hyperpolarization to 100 mV (Fig. 3C). Consistent
with Ih, the time-dependent current was
inhibited by 1 mM extracellular cesium (Fig.
3D).
We tested for a contribution of Ih to
spontaneous firing by application of 1 mM cesium under
current clamp. Cesium had no significant effects on firing frequency,
membrane potential, or shape of the action potentials (Fig.
3E, Table 2). Thus, although dopaminergic amacrines have a small Ih,
this current does not contribute to pacemaking. Evidently, the current
is insignificant at the voltages (positive to 60 mV) reached during
spontaneous activity.
Voltage-dependent calcium current
Important roles have been found for voltage-dependent calcium
currents in the spontaneous electrical activity of some types of
excitable cells. In particular, the class of calcium channels known as
low-threshold, low-voltage-activated, or T-type channels is often
associated with cells capable of spontaneous firing, including cardiac
sinoatrial cells, neuroendocrine cells, and thalamic neurons (Hagiwara
et al., 1988; Bal and McCormick, 1993; Gutnick and Yarom, 1989;
Huguenard, 1996). One possible mechanism of rhythmic spontaneous
activity is a cycle involving calcium entry through voltage-dependent
calcium channels and hyperpolarization resulting from calcium-activated
potassium current (Llinás, 1988; Bal and McCormick, 1993).
Current-clamp recordings showed that no type of voltage-dependent
calcium current was necessary for spontaneous activity. When calcium
was completely removed from the extracellular solution (replaced by 0.5 mM cobalt), the frequency of firing did not change significantly (Fig. 4A,
Table 2), although the amplitude of the action potentials was reduced
(to 78.6 ± 0.6 mV; n = 18; or by ~14%).
View larger version (19K):
[in this window]
[in a new window]
|
Figure 4.
Effects of TTX and cobalt on the spontaneous
activity of dopaminergic amacrines. A, In current clamp,
a dopaminergic amacrine had a resting membrane potential of 49 mV and
fired in a rhythmic pattern at a frequency of 9 Hz. When extracellular
calcium was replaced with 0.5 mM cobalt, the cell
depolarized to 46 mV, the amplitude of the action potentials was
reduced, but the frequency did not change significantly. Extracellular
solution (in mM): 137 NaCl, 5.4 KCl, 2.3 MgCl2, 0.5 CoCl2, and 5 HEPES. B, Dopaminergic amacrine was recorded in voltage
clamp at a holding potential of 60 mV. A depolarizing voltage
step to 10 mV (50 msec duration) induced an inward current flowing
through voltage-activated calcium channels. This current was completely
abolished by extracellular cadmium (250 µM).
C, In current clamp, a dopaminergic amacrine had a
resting membrane potential of 45 mV and fired in a rhythmic pattern
at a frequency of 5 Hz. When TTX (1 µM, 1 sec) was
applied extracellularly, the cell became silent and hyperpolarized to
50 mV. After 20 sec, the cell resumed firing, although with reduced
spike amplitude (data not shown). After complete recovery from TTX, the
amplitude of the action potentials gradually increased to predrug
levels. D, In current clamp, a dopaminergic amacrine was
held at 50 mV to suppress spontaneous discharge. The cell was then
further hyperpolarized by injecting a current pulse of 10 pA for 400 msec. At the offset of the current injection, a slow rebound
depolarization beyond the holding potential could be observed (note
deviation from the dotted line). E, Same
cell as in D. With a larger hyperpolarizing current step
(20 pA, 400 msec), the rebound depolarization at the offset of the
current pulse triggered an action potential. F, Same
cell and protocol as in D. Extracellular application of
TTX blocked both the slow depolarization and the action potential at
the offset of the current pulse. G, Same cell and
protocol as in D. Addition of cobalt (250 µM) to the standard extracellular solution had no effect
on the spike discharge at the offset of the current pulse. The larger
amplitude of the voltage response was probably caused by an increase in
the input resistance of the cell because of block of nonspecific leak
conductances.
|
|
No evidence was found for T-type calcium channels in dopaminergic
amacrines. With ionic conditions to isolate calcium currents, a
substantial voltage-activated current was measured, which was abolished
by cadmium (Fig. 4B), but there was no component with the low-threshold and rapid inactivation expected from T-type current.
These results suggest that voltage-dependent calcium current
contributes to the action potential but is not critically involved in
the depolarization that precedes it.
Voltage-dependent sodium current
Previous experiments showed that the action potentials of
dopaminergic amacrines are primarily attributable to
tetrodotoxin-sensitive, voltage-dependent sodium channels (Gustincich
et al., 1997). Consistent with this finding, reducing sodium from
137 to 50 mM [with substitution by the impermeant cation
N-methyl-D-glucamine (NMDG)] resulted in
smaller, broader spikes, whereas with complete replacement of sodium,
the spikes were abolished. In voltage clamp, replacement of sodium by
NMDG resulted in complete disappearance of rapidly inactivating inward
currents. The effects of ion substitution were fully reversible in both
current clamp and voltage clamp (data not shown).
Application of TTX (1 µM) blocked action potentials, as
expected (Fig. 4C). In addition, there was no rhythmic,
subthreshold oscillation of the voltage in the presence of TTX,
suggesting that both spike generation and the depolarization leading to
threshold depend on TTX-sensitive sodium current. Consistent with the
presence of substantial depolarizing sodium current between spikes, TTX had the additional effect of hyperpolarizing the cells by 4.8 ± 0.7 mV (n = 6).
The dependence of the spontaneous activity of dopaminergic amacrines on
TTX-sensitive sodium channels was also illustrated by an experiment
following that done by Grace and Onn (1989) for dopaminergic neurons of
the substantia nigra. The spontaneous activity of a dopaminergic
amacrine was abolished by holding its membrane potential at 50 mV,
and the cell was then further hyperpolarized to 60 mV by injecting a
10 pA current pulse of 400 msec. At the offset of the current
injection, the membrane potential overshot the original holding
potential, giving rise to a slow depolarization of 5.6 ± 0.5 mV
(n = 13) and 120 msec duration (Fig.
4D). With injection of a larger hyperpolarizing
current (20 pA, 400 msec), the "rebound" depolarization was
enough to trigger a spike (Fig. 4E). In different
types of neurons, such anode break excitation can be attributable to
either TTX-sensitive sodium current or T-type calcium current. In the
dopaminergic amacrines, the rebound depolarization was inhibited
completely by TTX (Fig. 4F) but was unaffected by
cobalt (Fig. 4G), suggesting involvement of sodium channels
but not calcium channels.
These current-clamp results suggest that TTX-sensitive sodium channels
may be crucial for the depolarization leading to threshold as well as
for the rapid upstroke of the action potentials. In voltage-clamp
experiments, we directly examined sodium currents active at
subthreshold voltages. Figure
5A shows the TTX-sensitive sodium current elicited by a ramp of voltage from 60 to 46 mV over
40 msec, a voltage protocol that mimics the initial phase of
spontaneous depolarization after an action potential. This protocol
reliably activated a sodium current, which reached a peak amplitude of
31 ± 7 pA (n = 7) at the end of the ramp. In a
cell with a 2 G resting resistance, a current this size is very
significant. It is striking that although the depolarization from 60
mV is slow, inactivation of the sodium current must also be slow over
this voltage range, because so much current remains noninactivated at
the end of the ramp. In fact, comparison with current elicited by a
step directly from 60 to 46 mV (Fig. 5B) suggested that
inactivation during the ramp reduces current by only ~50%.
View larger version (17K):
[in this window]
[in a new window]
|
Figure 5.
Subthreshold sodium current active between spikes.
The current traces of A-D were obtained
by subtracting currents recorded in the presence of 1 µM
TTX from control currents. A, Dopaminergic amacrine was
ramped from 60 to 46 mV at the speed of its naturally occurring
slow depolarization (350 mV sec 1). The cell
membrane was then held at this potential for 40 msec before returning
to the holding potential of 60 mV. This stimulus protocol elicited a
TTX-sensitive inward sodium current with a peak amplitude of 36 mV
and a steady-state value of 20 pA. B, Same cell as in
A was recorded in voltage-clamp at a holding potential
of 60 mV. A rectangular voltage step to the average resting membrane
potential of 46 mV (80 msec) elicited an inward sodium current with a
peak amplitude of 63 pA, which inactivated to a steady-state value of
15 pA. The time course of inactivation could be fitted with a single
exponential function ( = 23.9 msec). C, TTX-sensitive
sodium current activated by a segment of spontaneous activity used as
command stimulus in the voltage-clamp mode. The cell generated a large,
fast transient sodium current at spike threshold and a persistent
sodium current during the interspike interval (note deviation from
dotted line at 0 pA). The area enclosed in the
rectangle is enlarged in D.
|
|
To directly examine the sodium current active during spontaneous
firing, we used a segment of spontaneous activity recorded under
current clamp as the voltage command in a voltage-clamp experiment
(Fig. 5C,D). The resulting currents were recorded
with and without TTX to isolate current carried by TTX-sensitive sodium channels. In addition to the expected large inward current flowing during the upstroke of the action potential, there was a smaller inward
current throughout the interspike intervals. This current averaged
39 ± 8 pA (n = 13) when measured at 46 mV,
near the midpoint of the slow depolarization.
These results suggest that TTX-sensitive sodium channels are open at
the interspike voltage range of 60 to 40 mV and play a central role
in producing the slow depolarization leading to the next spike. To
address the possibility that the sodium channels active in the
interspike interval are distinct from those responsible for the
upstroke of the action potential, we used voltage protocols designed to
test for the existence of multiple types of sodium channels. With the
idea that distinct types of channels may have different steady-state
inactivation properties, we compared the voltage dependence and
kinetics of sodium currents from a steady holding potential of 50 mV,
at which ~75% of the total sodium current is inactivated, with those
evoked from 80 mV, at which all sodium current is available. The
currents elicited from 50 mV were reduced to ~25% of those from
80 mV but had indistinguishable voltage dependence (Fig.
6A,B).
The kinetics of the currents elicited from the two holding potentials
were also the same, and inactivation of both currents could be fit well
by a single exponential (Fig. 6C,D), consistent
with a single type of channel.
View larger version (19K):
[in this window]
[in a new window]
|
Figure 6.
Properties of the subthreshold sodium
current. A, Current-voltage relation of sodium currents
of dopaminergic amacrines elicited from holding potentials of 80 mV
() or 50 mV (). The currents have different amplitudes but
similar voltage dependence. B, The two
I-V curves of A have been
normalized to the peak current at 10 mV and superimposed. C,
D, Voltage steps to 10 mV from either 50 or 80 mV. Decay
phases are fit with a single exponential function. Average time
constants of decay were 1.11 ± 0.04 msec (n = 5) and 0.97 ± 0.04 msec (n = 5),
respectively. E, Current evoked by continuously ramping
the command potential from 80 to 20 mV at slow speed (60 mV
sec1). TTX (10 nM) blocked the sodium current
to 0.38 ± 0.07 (n = 5) of control values
(data not shown), whereas 100 nM TTX reduced the current to
0.12 ± 0.04 (n = 5). F, When
the cell was stepped from 80 to 38 mV (threshold of action
potential generation), a large transient sodium current was elicited.
This current showed the same sensitivity to TTX when compared with the
current evoked by the slow ramp in E. TTX (10 nM) inhibited the current to 0.46 ± 0.06 (n = 5) and 100 nM TTX to 0.07 ± 0.01 (n = 5) of control values.
|
|
We also compared the TTX sensitivity of the channels giving steady
currents in the voltage range of the interspike interval with that of
channels activated by conventional step depolarizations from negative
holding potentials. With a slow voltage ramp, inward current was
elicited at voltages positive to 60 mV and reached a peak at 45 mV.
The TTX sensitivity of the ramp-evoked current was indistinguishable
from that of a current elicited by a step from 80 to 38 mV; in both
cases, 10 nM TTX reduced the current by ~50% and 100 nM TTX reduced it by ~90% (Fig.
6E,F).
Cerebellar Purkinje neurons, which also fire spontaneously even when
dissociated and with all synaptic contacts removed (Nam and Hockberger,
1997; Raman and Bean, 1997), have an unusual "resurgent" sodium
current active at subthreshold voltages (Raman and Bean, 1997). This is
a time-dependent current that follows large depolarizations that have
produced maximal inactivation; we found no such current in dopaminergic
amacrines using similar protocols.
Potassium currents, afterhyperpolarization, and the
interspike interval
We next examined the dependence of the spontaneous activity on
various types of potassium channels. Although the experiments so far
suggest that TTX-sensitive sodium current supplies the main
depolarizing current between spikes, it is possible that potassium
current activated during the action potential is also necessary to
maintain spontaneous activity. For example, the hyperpolarization after
the action potential (reaching 60 mV) might be necessary to remove
inactivation of sodium channels. We therefore examined the effects of
various blockers of specific potassium channels on spontaneous activity
and action potential waveform.
Two blockers of BK-type, calcium-activated potassium channels,
charybdotoxin (10 nM) and a low concentration (0.5 mM) of tetraethylammonium (TEA), were tested. Their effect
on the frequency of spontaneous firing was modest (Fig.
7A,D;
Table 2), although both changed the form of the action potential by
slowing repolarization and reducing the afterhyperpolarization (Fig.
7B,E). Apamin, a blocker of the SK class of
calcium-activated potassium channels, had no effect on spontaneous
firing (Table 2) and also had no effect on the action potential
waveform (Fig. 7C). Block of calcium entry by 0.5 mM cobalt, which also did not alter significantly the
frequency of spontaneous firing (Fig. 4A), reduced
the afterhypolarization in a very similar manner as charybdotoxin and
0.5 mM TEA (Fig. 7F). These results
suggest that calcium-activated BK channels contribute to the
repolarizing phase of the action potential and to the
afterhyperpolarization but that the afterhyperpolarization is of little
consequence for the frequency of spontaneous firing.
View larger version (34K):
[in this window]
[in a new window]
|
Figure 7.
Effects of blocking BK- and A-type potassium
channels on action potentials. A, Block of
calcium-dependent potassium channels of the BK type by charybdotoxin
(10 nM) had no effect on the membrane potential and a
modest effect on the firing frequency. B, Action
potentials were elicited by injecting depolarizing current pulses (5 pA, 800 msec) in a dopaminergic amacrine hyperpolarized to 50 mV to
remove spontaneous activity. Charybdotoxin (10 nM)
selectively abolished the slow afterhyperpolarization and broadened the
spike during the repolarization phase (from 4.0 to 5.5 msec, measured
at threshold). The dotted line indicates the control
trace measured in absence of the drug. C, Extracellular
application of apamin (1 µM) had no effect on the shape
of the action potential or on its pattern of discharge (data not
shown). D, Discharge pattern of a dopaminergic amacrine
was scarcely affected by extracellular application of TEA (0.5 mM). E, Similar to charybdotoxin, TEA (0.5 mM) blocked the afterhyperpolarization and slowed the repolarization phase
of the spike (from 3.6 to 5.6 msec, measured at threshold).
F, Cobalt (0.5 mM) had effects on the action
potential similar to those of charybdotoxin and low TEA: block of the
afterhyperpolarization and broadening of the spike (from 4.2 to 5.7 msec, measured at threshold). In addition, the amplitude of the spike
was slightly decreased (from 89 to 81 mV), probably because of reduced
calcium influx in the presence of cobalt. G,
Extracellular 4-AP (100 µM) depolarized a spontaneously
firing dopaminergic amacrine. In addition, the firing frequency was
increased to 13-14 Hz. H, Same cell as in
G. Voltage trajectory of an action potential before
(dotted line) and immediately after the onset of
application of 4-AP (solid line). The cell was
depolarized by 5-6 mV during the interspike interval, whereas the
amplitude was not yet affected.
|
|
Figure 7, G and H, shows the effects of
4-aminopyridine (4-AP), a blocker of A- and D-type voltage-activated
potassium channels. With application of 100 µM 4-AP, the
interspike voltage depolarized considerably (Fig.
7G,H; on average by 6.7 ± 1.4 mV,
n = 6), and the frequency of firing increased (Fig.
7G; Table 2). This suggests that current from A- or D-type
channels is present between spikes and normally acts as a brake during
the interspike interval. In voltage-clamp experiments, a component of
inactivating potassium current was evident on depolarization from a
holding potential of 70 mV, consistent with the presence of A-type
current in the neurons (data not shown).
To examine possible participation in spontaneous activity of other
voltage-activated potassium channels, we examined the effect of a high
concentration (40 mM) of TEA, which would be expected to
block most types of voltage-activated potassium currents. TEA at 40 mM caused a substantial depolarization of dopaminergic
amacrines and a reduction in amplitude and broadening of the action
potentials (Fig. 8A).
Action potentials in the presence of 40 mM TEA had a
prominent plateau, presumably originating from high-threshold calcium
current (Fig. 8B). In addition, the
afterhyperpolarization was abolished. Despite the dramatic effects of
TEA on the action potential shape, there was no significant effect on
the frequency of firing (Table 2). Taken together, the effects of
blocking potassium channels and calcium channels were remarkable
because the frequency of spontaneous firing was scarcely affected even when the interspike voltage and action potential shape changed dramatically. Spontaneous firing appears to be a robust property of
this type of neuron.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 8.
Effects of a high concentration of TEA.
A, In current clamp, a dopaminergic amacrine had a resting
membrane potential of 48 mV and spontaneously generated action
potentials at a frequency of 9 Hz. On extracellular application of TEA
(40 mM, 3 sec), the membrane potential was depolarized by
15-20 mV, but the frequency of firing did not change. Extracellular
solution (in mM): 97 NaCl, 40 TEACl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5 HEPES, and 10 glucose. B, Same cell as in A. Voltage
trajectory of an action potential immediately after the onset of TEA
application. The membrane potential was slightly depolarized with
respect to control (dotted line). The spike amplitude
was reduced by 15 mV, and the repolarization phase was broadened.
|
|
| |
DISCUSSION |
Our results show that dopaminergic amacrines spontaneously fire
action potentials in a rhythmic pattern even in the absence of synaptic
inputs. TTX-sensitive sodium channels are essential for the spontaneous
activity of the cells, which was little affected by inhibition of
calcium channels or Ih. The voltage-clamp
results show directly that substantial sodium current flows through
TTX-sensitive channels during the interspike intervals, and this
current is sufficient to provide the depolarizing drive leading up to
threshold during each cycle of firing.
The ability to fire spontaneously at a regular rate is a property that
dopaminergic amacrines share with mesencephalic dopaminergic neurons
(Grace and Bunney, 1983a,b, 1984; Grace and Onn, 1989; Lacey et al.,
1989; Yung et al., 1991), but profound differences exist between the
two cell types both in geometry and in the ionic conductances
responsible for their activity. Substantia nigra neurons are large
projection neurons with a long axon originating from a primary
dendrite, and they generate an initial segment sodium spike, followed
by a somatodendritic, high-threshold calcium spike (Grace and Bunney,
1983b; Llinás et al., 1984; Kita et al., 1986; Häusser et
al., 1995). Although dopaminergic amacrines do possess axons in some
mammals (Dacey, 1990), it is unclear whether this is the case in the
mouse. Furthermore, both rhythmic activity and shape of the action
potentials were the same irrespective of whether processes survived the
dissociation procedure.
The frequency of firing, shape of action potentials, and voltage range
of the subthreshold depolarization are remarkably similar between
retinal and midbrain dopaminergic neurons. Furthermore, in both cases a
subthreshold, TTX-sensitive sodium current appears to be important for
pacemaking (Grace and Onn, 1989). However, in the
midbrain neurons, voltage-dependent calcium current seems to play a
crucial role (Kita et al., 1986; Fujimura and Matsuda, 1989; Grace and
Onn, 1989; Kang and Kitai, 1993; Nedergaard et al., 1993; Yung et al.,
1991; Mercuri et al., 1994). In contrast, blocking calcium current had
minimal effect on the firing of dopaminergic amacrines. In addition,
Ih was very small and did not participate in
pacemaking, whereas a prominent Ih current is
present in substantia nigra neurons (Harris and Constanti, 1995;
Mercuri et al., 1995). In the midbrain neurons, firing rates depend on
calcium-activated potassium currents (Harris et al., 1989; Shepard and
Bunney, 1991; Ping and Shepard, 1996), whereas in dopaminergic
amacrines, blocking such currents had but a modest effect on firing
frequency.
The mechanism of pacemaking in dopaminergic amacrines is reminiscent of
other cases of oscillatory behavior depending on a subthreshold sodium
current (Alonso and Llinás, 1989; Klink and Alonso, 1993; Amitai,
1994; Uteshev et al., 1995) and most closely resembles that of neurons
of the suprachiasmatic nucleus, in which spontaneous activity also
depends on a sodium current but not Ih or
calcium currents (Pennartz et al., 1997). For most neurons, it is
uncertain whether subthreshold sodium currents are carried by different
channels than those responsible for the upstroke of the action
potential (Crill, 1996). In dopaminergic amacrines, we found no
evidence that the sodium current in the interspike interval arises from
a distinct type of sodium channel. This is in contrast to neurons from
the suprachiasmatic nucleus, in which the sodium channels involved in
pacemaking appear to differ in kinetics and voltage dependence from
those mediating the action potential, and in which the total sodium
current inactivates with two distinguishable components (Pennartz et
al., 1997).
If the subthreshold current in dopaminergic amacrines arises from the
same channels as conventional transient currents, it may represent
either a particular mode of gating of the channels (Alzheimer et al.,
1993; Brown et al., 1994) or, instead, simply reflect a dynamic
equilibrium between closed, open, and inactivated states at voltages in
the range of the interspike interval, 60 to 40 mV. At this point,
it is impossible to ascribe the sodium current in the interspike
interval to a particular sequence of transitions between gating states.
The Hodgkin and Huxley model of sodium channel gating is not adequate
to describe real channels (Hille, 1992), and its deficiencies may be
greatest at subthreshold voltages, at which both activation and
inactivation are incomplete. Subthreshold sodium currents may be an
intrinsic consequence of the molecular gating mechanism of all sodium
channels, in which case they may be common to all neurons. If so, the
distinguishing feature of a pacemaking neuron may be lack of a large
competing potassium conductance at relevant voltages rather than
possession of specialized sodium channels.
The relative invariance of the frequency of firing with many
pharmacological interventions, including cesium, cobalt, TEA, and
charybdotoxin, seems surprising. The slow interspike depolarization must result from a very small net inward current, and the input resistance of the cell is high. One might expect the system would be
sensitive to small changes in the balance of underlying currents, but
the experiments show little evidence for this. The reasons for the
robustness of the firing frequency in the face of changes in calcium
and potassium currents remain to be determined. One possibility is that
the decay of the potassium current indirectly causes a compensatory
reduction in sodium current by decreasing the afterhypolarization and
thereby diminishing or slowing recovery from inactivation of the sodium
channels.
Application of 4-AP did lead to increased frequency of firing.
According to the analysis of Connor and Stevens (1971a,b), the rate of
inactivation of A-type potassium current, which is often sensitive to
block by 4-AP, regulates interspike intervals, with inactivation being
removed immediately after the action potential and then slowly
redeveloping during the interspike depolarization. Consistent with its
behavior in Anisodoris neurons (Connor and Stevens,
1971a,b), A-type current contributed only minimally to the repolarizing
phase of the action potential, which was little affected by 4-AP.
It seems possible that dopaminergic amacrines also fire spontaneous
action potentials in vivo. If their input resistance in the
intact retina is similar to that of other large amacrine cells (150 M in starburst amacrines; Taylor and Wässle, 1995), a
persistent sodium current of the same magnitude as that observed
in vitro would depolarize the cell by ~6 mV and, thus, be
sufficient to raise the membrane potential to the threshold for
generation of an action potential. The presence of a spike-generating
neuron in the pathway leading to dopamine release was suggested by
Piccolino et al. (1987) on the basis of the effects of veratridine and
TTX on the coupling of horizontal cells in the turtle. In
vivo, however, the firing pattern of dopaminergic amacrines is
probably different from that observed in vitro after removal
of all synaptic influences: we have recently shown that the spontaneous
activity of isolated dopaminergic amacrines can be abolished by the
amacrine cell transmitters GABA and glycine and is stimulated by
kainate, an agonist at the receptor for the bipolar cell transmitter
glutamate (Gustincich et al., 1997). On this basis, it seems likely
that on cessation of illumination the spontaneous discharge of
dopaminergic amacrines is inhibited by GABAergic amacrines that receive
their input from off-bipolars. It must be emphasized, however, that the
cells may not be totally silent in the dark-adapted retina; perhaps, a
slow rhythmic discharge of action potentials may be responsible for the
basal efflux of dopamine that has been reported in the dark (Witkovsky
and Dearry, 1991; Djamgoz and Wagner, 1992). Dopaminergic amacrines are
probably inhibited in scotopic illumination because of the influence of
the glycinergic AII amacrine cells and may fire bursts of action
potentials with photopic stimulation as a result of the excitation
received from on-bipolars. Such a behavior would cause variations in
dopamine release that are consistent with the modulation of coupling
between AII amacrines in different conditions of illumination
(Bloomfield et al., 1997).
The spread of action potentials throughout the plexus of dopaminergic
amacrine cell dendrites in the scleral region of the inner plexiform
layer is probably responsible for the depolarization that causes
calcium-dependent dopamine release in the light (Sarthy et al., 1981;
Boatright et al., 1989; Kolbinger and Weiler, 1993). It is unclear,
however, whether dopamine release exclusively occurs at the synaptic
junctions established by dopaminergic amacrines with other amacrine
cells. This problem is further complicated by the fact that GABA is
colocalized in dopaminergic amacrines (Wässle and Chun, 1988):
perhaps GABA is released at the synapses and mediates fast
inhibitory events, whereas the release of dopamine takes place
throughout the surface of their dendritic tree.
It seems significant that both retinal dopaminergic amacrines and the
mesencephalic dopaminergic neurons exhibit pacemaker activity in
vitro: this common behavior is even more remarkable considering
that different constellations of voltage-gated ion channels apparently
converge to generate the same functional phenotype. The spontaneous
activity is probably related to a common pattern of ongoing dopamine
release. It is interesting, in this respect, that substantia nigra
neurons, like dopaminergic amacrines, release dopamine from their
dendrites (Geffen et al., 1976; Korf et al., 1976; Cheramy et al.,
1981; Lacey et al., 1990; Johnson and North, 1992; Rice et al., 1994).
Perhaps the generation of action potentials on removal of inhibitory
influences and the resulting depolarization are essential to cause a
tonic release of dopamine from the dendritic tree and, thus, ensure a
high concentration of the modulator in the intercellular spaces. Then,
the released molecules diffuse throughout the retina to influence the
activity of more distant targets, such as horizontal cells and
photoreceptors.
| |
FOOTNOTES |
Received Feb. 18, 1998; revised May 18, 1998; accepted June 10, 1998.
This work was supported by National Institutes of Health Grants EY01344
(E.R.) and NS36855 (B.P.B.) and by a McKnight Senior Investigator Award
to E.R. A.F. and S.G. were supported by European Molecular Biology
Fellowships. We thank Dr. R. C. Reid for help with the analysis of
interspike intervals, Dr. I. M. Raman and A. Taddese for
discussions, and H. M. Regan for technical assistance.
Correspondence should be addressed to Dr. Elio Raviola, Department of
Neurobiology, Harvard Medical School, 220 Longwood Avenue, Boston, MA
02115.
Dr. Feigenspan's present address: Carl von Ossietzky Universität
Oldenburg, Ammerländer Heerstra e 114-118, D-26111 Oldenburg, Germany.
| |
REFERENCES |
-
Alonso A,
Llinás RR
(1989)
Subthreshold Na+-dependent theta-like rhythmicity in stellate cells of entorhinal cortex layer II.
Nature
342:175-177[Medline].
-
Alzheimer C,
Schwindt PC,
Crill WE
(1993)
Modal gating of Na+ channels as a mechanism of persistent Na+ current in pyramidal neurons from rat and cat sensorimotor cortex.
J Neurosci
13:660-673[Abstract].
-
Amitai Y
(1994)
Membrane potential oscillations underlying firing patterns in neocortical neurons.
Neuroscience
63:151-161[Web of Science][Medline].
-
Bal T,
McCormick DA
(1993)
Mechanisms of oscillatory activity in guinea-pig nucleus reticularis thalami in vitro: a mammalian pacemaker.
J Physiol (Lond)
468:669-691[Abstract/Free Full Text].
-
Banerjee SA,
Hoppe P,
Brilliant M,
Chikaraishi DM
(1992)
5' flanking sequences of the rat tyrosine hydroxylase gene target accurate tissue-specific, developmental, and transsynaptic expression in transgenic mice.
J Neurosci
12:4460-4467[Abstract].
-
Bloomfield SA,
Xin D,
Osborne T
(1997)
Light-induced modulation of coupling between AII amacrine cells in the rabbit retina.
Vis Neurosci
14:565-576[Web of Science][Medline].
-
Boatright JH,
Hoel MJ,
Iuvone PM
(1989)
Stimulation of endogenous dopamine release and metabolism in amphibian retina by light- and K+-evoked depolarization.
Brain Res
482:164-168[Web of Science][Medline].
-
Brown AM,
Schwindt PC,
Crill WE
(1994)
Different voltage dependence of transient and persistent Na+ currents is compatible with modal-gating hypothesis for sodium channels.
J Neurophysiol
71:2562-2565[Abstract/Free Full Text].
-
Cardozo DL
(1993)
Midbrain dopaminergic neurons from postnatal rat in long-term primary culture.
Neuroscience
56:409-421[Web of Science][Medline].
-
Cardozo DL,
Bean BP
(1995)
Voltage-dependent calcium channels in rat midbrain dopamine neurons: modulation by dopamine and GABAB receptors.
J Neurophysiol
74:1137-1148[Abstract/Free Full Text].
-
Cheramy A,
Leviel V,
Glowinski J
(1981)
Dendritic release of dopamine in the substantia nigra.
Nature
289:537-542[Medline].
-
Connor JA,
Stevens CF
(1971a)
Voltage clamp studies of a transient outward membrane current in gastropod neural somata.
J Physiol (Lond)
213:21-30[Abstract/Free Full Text].
-
Connor JA,
Stevens CF
(1971b)
Prediction of repetitive firing behaviour from voltage clamp data on an isolated neurone soma.
J Physiol (Lond)
213:31-53[Abstract/Free Full Text].
-
Crill WE
(1996)
Persistent sodium current in mammalian central neurons.
Annu Rev Physiol
58:349-362[Web of Science][Medline].
-
Dacey DM
(1990)
The dopaminergic amacrine cell.
J Comp Neurol
301:461-489[Web of Science][Medline].
-
De Waele P,
De Groote G,
Van de Voorde A,
Fiers W,
Franssen JD,
Herion P,
Urbain J
(1982)
Isolation and identification of monoclonal antibodies directed against human placental alkaline phosphatase.
Arch Int Physiol Biochim
90:B21.
-
DiFrancesco D,
Ferroni A,
Mazzanti M,
Tromba C
(1986)
Properties of the hyperpolarizing-activated current (if) in cells isolated from the rabbit sino-atrial node.
J Physiol (Lond)
377:61-88[Abstract/Free Full Text].
-
Djamgoz MB,
Wagner HJ
(1992)
Localization and function of dopamine in the adult vertebrate retina.
Neurochem Int
20:139-191[Web of Science][Medline].
-
Fujimura K,
Matsuda Y
(1989)
Autogenous oscillatory potentials in neurons of the guinea pig substantia nigra pars compacta in vitro.
Neurosci Lett
104:53-57[Web of Science][Medline].
-
Geffen LB,
Jessell TM,
Cuello AC,
Iversen LL
(1976)
Release of dopamine from dendrites in rat substantia nigra.
Nature
260:258-260[Medline].
-
Grace AA,
Bunney BS
(1983a)
Intracellular and extracellular electrophysiology of nigral dopaminergic neurons-1. Identification and characterization.
Neuroscience
10:301-315[Web of Science][Medline].
-
Grace AA,
Bunney BS
(1983b)
Intracellular and extracellular electrophysiology of nigral dopaminergic neurons
 2. Action potential generating mechanisms and morphological correlates.
Neuroscience
10:317-331[Web of Science][Medline]. -
Grace AA,
Bunney BS
(1984)
The control of firing pattern in nigral dopamine neurons: single spike firing.
J Neurosci
4:2866-2876[Abstract].
-
Grace AA,
Onn SP
(1989)
Morphology and electrophysiological properties of immunocytochemically identified rat dopamine neurons recorded in vitro.
J Neurosci
9:3463-3481[Abstract].
-
Gustincich S,
Feigenspan A,
Wu DK,
Koopman LJ,
Raviola E
(1997)
Control of dopamine release in the retina: a transgenic approach to neural networks.
Neuron
18:723-736[Web of Science][Medline].
-
Gutnick MJ,
Yarom Y
(1989)
Low threshold calcium spikes, intrinsic neuronal oscillation and rhythm generation in the CNS.
J Neurosci Methods
28:93-99[Web of Science][Medline].
-
Hagiwara N,
Irisawa H,
Kameyama M
(1988)
Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial nodal cells.
J Physiol (Lond)
395:233-253[Abstract/Free Full Text].
-
Hainsworth AH,
Roper J,
Kapoor R,
Ashcroft FM
(1991)
Identification and electrophysiology of isolated pars compacta neurons from guinea-pig substantia nigra.
Neuroscience
43:81-93[Web of Science][Medline].
-
Harris NC,
Constanti A
(1995)
Mechanism of block by ZD 7288 of the hyperpolarization-activated inward rectifying current in guinea pig substantia nigra neurons in vitro.
J Neurophysiol
74:2366-2378[Abstract/Free Full Text].
-
Harris NC,
Webb C,
Greenfield SA
(1989)
A possible pacemaker mechanism in pars compacta neurons of the guinea-pig substantia nigra revealed by various ion channel blocking agents.
Neuroscience
31:355-362[Web of Science][Medline].
-
Häusser M,
Stuart G,
Racca C,
Sakmann B
(1995)
Axonal initiation and active dendritic propagation of action potentials in substantia nigra neurons.
Neuron
15:637-647[Web of Science][Medline].
-
Hikosaka O,
Wurtz RH
(1983)
Visual and oculomotor functions of monkey substantia nigra pars reticulata. III. Memory-contingent visual and saccade responses.
J Neurophysiol
49:1268-1284[Free Full Text].
-
Hille B
(1992)
In: Ionic channels of excitable membranes. Sunderland, MA: Sinauer.
-
Huguenard JR
(1996)
Low-threshold calcium currents in central nervous system neurons.
Annu Rev Physiol
58:329-348[Web of Science][Medline].
-
Johnson SW,
North RA
(1992)
Two types of neurone in the rat ventral tegmental area and their synaptic inputs.
J Physiol (Lond)
450:455-468[Abstract/Free Full Text].
-
Kam W,
Clauser E,
Kim YS,
Kan YW,
Rutter WJ
(1985)
Cloning, sequencing, and chromosomal localization of human term placental alkaline phosphatase cDNA.
Proc Natl Acad Sci USA
82:8715-8719[Abstract/Free Full Text].
-
Kang Y,
Kitai ST
(1993)
Calcium spike underlying rhythmic firing in dopaminergic neurons of the rat substantia nigra.
Neurosci Res
18:195-207[Web of Science][Medline].
-
Kita T,
Kita H,
Kitai ST
(1986)
Electrical membrane properties of rat substantia nigra compacta neurons in an in vitro slice preparation.
Brain Res
372:21-30[Web of Science][Medline].
-
Klink R,
Alonso A
(1993)
Ionic mechanisms for the subthreshold oscillations and differential electroresponsiveness of medial entorhinal cortex layer II neurons.
J Neurophysiol
70:144-157[Abstract/Free Full Text].
-
Kolbinger W,
Weiler R
(1993)
Modulation of endogenous dopamine release in the turtle retina: effects of light, calcium, and neurotransmitters.
Vis Neurosci
10:1035-1041[Web of Science][Medline].
-
Korf J,
Zieleman M,
Westerink BHC
(1976)
Dopamine release in substantia nigra?
Nature
260:257-258[Medline].
-
Lacey MG,
Mercuri NB,
North RA
(1989)
Two cell types in rat substantia nigra zona compacta distinguished by membrane properties and the actions of dopamine and opioids.
J Neurosci
9:1233-1241[Abstract].
-
Lacey MG,
Mercuri NB,
North RA
(1990)
Actions of cocaine on rat dopaminergic neurones in vitro.
Br J Pharmacol
99:731-735[Web of Science][Medline].
-
Le Moal M,
Simon H
(1991)
Mesocorticolimbic dopaminergic network: functional and regulatory roles.
Physiol Rev
71:155-234[Free Full Text].
-
Llinás R
(1988)
The intrinsic electrophysiological properties of mammalian neurons: Insights into central nervous system function.
Science
242:1654-1664[Abstract/Free Full Text].
-
Llinás R,
Greenfield SA,
Jahnsen H
(1984)
Electrophysiology of pars compacta cells in the in vitro substantia nigra-a possible mechanism for dendritic release.
Brain Res
294:127-132[Web of Science][Medline].
-
Mariani AP,
Hokoc JN
(1988)
Two types of tyrosine hydroxylase immunoreactive amacrine cell in the rhesus monkey retina.
J Comp Neurol
276:81-91[Web of Science][Medline].
-
McCormick DA,
Pape H-C
(1990)
Properties of a hyperpolarization-activated cation current and its role in rhythmic oscillation in thalamic relay neurones.
J Physiol (Lond)
431:291-318[Abstract/Free Full Text].
-
Mercuri NB,
Bonci A,
Calabresi P,
Stratta F,
Stefani A,
Bernardi G
(1994)
Effects of dihydropyridine calcium antagonists on rat midbrain dopaminergic neurones.
Br J Pharmacol
113:831-838[Web of Science][Medline].
-
Mercuri NB,
Bonci A,
Calabresi P,
Stefani A,
Bernardi G
(1995)
Properties of the hyperpolarization-activated cation current Ih in rat midbrain dopaminergic neurons.
Eur J Neurosci
7:462-469[Web of Science][Medline].
-
Nam SC,
Hockberger PE
(1997)
Analysis of spontaneous electrical activity in cerebellar Purkinje cells acutely isolated from postnatal rats.
J Neurobiol
33:18-32[Web of Science][Medline].
-
Nedergaard S,
Flatman JA,
Engberg I
(1993)
Nifedipine- and omega-conotoxin-sensitive Ca2+ conductances in guinea-pig substantia nigra pars compacta neurones.
J Physiol (Lond)
466:727-747[Abstract/Free Full Text].
-
Nguyen-Legros J
(1988)
Morphology and distribution of catecholamine-neurons in mammalian retina.
Prog Retinal Res
7:113-147.
-
Pape H-C
(1996)
Queer current and pacemaker: the hyperpolarization-activated cation current in neurons.
Annu Rev Physiol
58:299-327[Web of Science][Medline].
-
Pennartz CMA,
Bierlagh MA,
Geursten AMS
(1997)
Cellular mechanisms underlying spontaneous firing in rat suprachiasmatic nucleus: involvement of a slowly inactivating component of sodium current.
J Neurophysiol
78:1811-1825[Abstract/Free Full Text].
-
Piccolino M,
Witkovsky P,
Trimarchi C
(1987)
Dopaminergic mechanisms underlying the reduction of electrical coupling between horizontal cells of the turtle retina induced by D-amphetamine, bicuculline, and veratridine.
J Neurosci
7:2273-2284[Abstract].
-
Ping HX,
Shepard PD
(1996)
Apamin-sensitive Ca(2+)-activated K+ channels regulate pacemaker activity in nigral dopamine neurons.
NeuroReport
7:809-814[Web of Science][Medline].
-
Raman IM,
Bean BP
(1997)
Resurgent sodium current and action potential formation in dissociated cerebellar Purkinje neurons.
J Neurosci
17:4517-4526[Abstract/Free Full Text].
-
Rice ME,
Richards CD,
Nedergaard S,
Hounsgaard J,
Nicholson C,
Greenfield SA
(1994)
Direct monitoring of dopamine and 5-HT release in substantia nigra and ventral tegmental area in vitro.
Exp Brain Res
100:395-406[Web of Science][Medline].
-
Sarthy PV,
Rayborn ME,
Hollyfield JG,
Lam DMK
(1981)
The emergence, localization, maturation of neurotransmitter systems during development of the retina in Xenopus laevis. III. Dopamine.
J Comp Neurol
195:595-602[Medline].
-
Shepard PD,
Bunney BS
(1991)
Repetitive firing properties of putative dopamine-containing neurons in vitro: regulation by an apamin-sensitive Ca(2+)-activated K+ conductance.
Exp Brain Res
86:141-150[Web of Science][Medline].
-
Tauchi M,
Madigan NK,
Masland RH
(1990)
Shapes and distributions of the catecholamine-accumulating neurons in the rabbit retina.
J Comp Neurol
293:178-189.
-
Taylor WR,
Wässle H
(1995)
Receptive field properties of starburst cholinergic amacrine cells in the rabbit retina.
Eur J Neurosci
7:2308-2321[Web of Science][Medline].
-
Uteshev V,
Stevens DR,
Haas HL
(1995)
A persistent sodium current in acutely isolated histaminergic neurons from rat hypothalamus.
Neuroscience
66:143-149[Web of Science][Medline].
-
Versaux-Botteri C,
Nguyen-Legros J,
Vigny A,
Raoux N
(1984)
Morphology, density and distribution of tyrosine hydroxylase-like immunoreactive cells in the retina of mice.
Brain Res
301:192-197[Web of Science][Medline].
-
Wässle H,
Chun MH
(1988)
Dopaminergic and indoleamine-accumulating amacrine cells express GABA-like immunoreactivity in the cat retina.
J Neurosci
8:3383-3394[Abstract].
-
Witkovsky P,
Dearry A
(1991)
Functional roles of dopamine in the vertebrate retina.
Prog Retinal Res
11:247-292.
-
Yung WH,
Häusser MA,
Jack JJB
(1991)
Electrophysiology of dopaminergic and non-dopaminergic neurones of the guinea-pig substantia nigra pars compacta in vitro.
J Physiol (Lond)
436:643-667[Abstract/Free Full Text].
Copyright © 1998 Society for Neuroscience 0270-6474/98/18176776-14$05.00/0
This article has been cited by other articles:
|
|
|
|
 
H. Hirasawa, M. Puopolo, and E. Raviola
Extrasynaptic Release of GABA by Retinal Dopaminergic Neurons
J Neurophysiol,
July 1, 2009;
102(1):
146 - 158.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. K. Archibald, M. P. Clarke, U. P. Mosimann, and D. J. Burn
The retina in Parkinson's disease
Brain,
May 1, 2009;
132(5):
1128 - 1145.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Petit-Jacques and S. A. Bloomfield
Synaptic Regulation of the Light-Dependent Oscillatory Currents in Starburst Amacrine Cells of the Mouse Retina
J Neurophysiol,
August 1, 2008;
100(2):
993 - 1006.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. K. Mojumder, D. M. Sherry, and L. J. Frishman
Contribution of voltage-gated sodium channels to the b-wave of the mammalian flash electroretinogram
J. Physiol.,
May 15, 2008;
586(10):
2551 - 2580.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. J. Russo, E. Mugnaini, and M. Martina
Intrinsic properties and mechanisms of spontaneous firing in mouse cerebellar unipolar brush cells
J. Physiol.,
June 1, 2007;
581(2):
709 - 724.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. J. Margolis and P. B. Detwiler
Different Mechanisms Generate Maintained Activity in ON and OFF Retinal Ganglion Cells
J. Neurosci.,
May 30, 2007;
27(22):
5994 - 6005.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Puopolo, E. Raviola, and B. P. Bean
Roles of Subthreshold Calcium Current and Sodium Current in Spontaneous Firing of Mouse Midbrain Dopamine Neurons
J. Neurosci.,
January 17, 2007;
27(3):
645 - 656.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D.-Q. Zhang, T.-R. Zhou, and D. G. McMahon
Functional Heterogeneity of Retinal Dopaminergic Neurons Underlying Their Multiple Roles in Vision
J. Neurosci.,
January 17, 2007;
27(3):
692 - 699.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Gingl and H. Tichy
Continuous Tonic Spike Activity in Spider Warm Cells in the Absence of Sensory Input
J Neurophysiol,
September 1, 2006;
96(3):
989 - 997.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Forti, E. Cesana, J. Mapelli, and E. D'Angelo
Ionic mechanisms of autorhythmic firing in rat cerebellar Golgi cells
J. Physiol.,
August 1, 2006;
574(3):
711 - 729.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. F. Miller, N. P. Staff, and T. J. Velte
Form and Function of ON-OFF Amacrine Cells in the Amphibian Retina
J Neurophysiol,
May 1, 2006;
95(5):
3171 - 3190.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Puopolo, B. P. Bean, and E. Raviola
Spontaneous Activity of Isolated Dopaminergic Periglomerular Cells of the Main Olfactory Bulb
J Neurophysiol,
November 1, 2005;
94(5):
3618 - 3627.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Petit-Jacques, B. Volgyi, B. Rudy, and S. Bloomfield
Spontaneous Oscillatory Activity of Starburst Amacrine Cells in the Mouse Retina
J Neurophysiol,
September 1, 2005;
94(3):
1770 - 1780.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Pignatelli, K. Kobayashi, H. Okano, and O. Belluzzi
Functional properties of dopaminergic neurones in the mouse olfactory bulb
J. Physiol.,
April 15, 2005;
564(2):
501 - 514.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Habermann, B. J. O'Brien, H. Wassle, and D. A. Protti
AII Amacrine Cells Express L-Type Calcium Channels at Their Output Synapses
J. Neurosci.,
July 30, 2003;
23(17):
6904 - 6913.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Vigh, E. Solessio, C. W. Morgans, and E. M. Lasater
Ionic Mechanisms Mediating Oscillatory Membrane Potentials in Wide-Field Retinal Amacrine Cells
J Neurophysiol,
July 1, 2003;
90(1):
431 - 443.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.C.W. van Rossum, B. J. O'Brien, and R. G. Smith
Effects of Noise on the Spike Timing Precision of Retinal Ganglion Cells
J Neurophysiol,
May 1, 2003;
89(5):
2406 - 2419.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Yamada, A. Koizumi, E. Iwasaki, S.-I. Watanabe, and A. Kaneko
Propagation of Action Potentials From the Soma to Individual Dendrite of Cultured Rat Amacrine Cells Is Regulated by Local GABA Input
J Neurophysiol,
June 1, 2002;
87(6):
2858 - 2866.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Koizumi, S.-I. Watanabe, and A. Kaneko
Persistent Na+ Current and Ca2+ Current Boost Graded Depolarization of Rat Retinal Amacrine Cells in Culture
J Neurophysiol,
August 1, 2001;
86(2):
1006 - 1016.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Flores-Herr, D. A. Protti, and H. Wassle
Synaptic Currents Generating the Inhibitory Surround of Ganglion Cells in the Mammalian Retina
J. Neurosci.,
July 1, 2001;
21(13):
4852 - 4863.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. M. Raman, A. E. Gustafson, and D. Padgett
Ionic Currents and Spontaneous Firing in Neurons Isolated from the Cerebellar Nuclei
J. Neurosci.,
December 15, 2000;
20(24):
9004 - 9016.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. D. Bennett, J. C. Callaway, and C. J. Wilson
Intrinsic Membrane Properties Underlying Spontaneous Tonic Firing in Neostriatal Cholinergic Interneurons
J. Neurosci.,
November 15, 2000;
20(22):
8493 - 8503.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-I. Watanabe, A. Koizumi, S. Matsunaga, J. W. Stocker, and A. Kaneko
GABA-Mediated Inhibition Between Amacrine Cells in the Goldfish Retina
J Neurophysiol,
October 1, 2000;
84(4):
1826 - 1834.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. A. Hughes, G. Kumar, Y. Yuan, A. Swaminathan, D. Yan, A. Sharma, L. Plumley, T. L. Yang-Feng, and A. Swaroop
Cloning and functional expression of human retinal Kir2.4, a pH-sensitive inwardly rectifying K+ channel
Am J Physiol Cell Physiol,
September 1, 2000;
279(3):
C771 - C784.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Cohen and R. Miles
Contributions of intrinsic and synaptic activities to the generation of neuronal discharges in in vitro hippocampus
J. Physiol.,
April 15, 2000;
524(2):
485 - 502.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Amini, J. W. Clark Jr., and C. C. Canavier
Calcium Dynamics Underlying Pacemaker-Like and Burst Firing Oscillations in Midbrain Dopaminergic Neurons: A Computational Study
J Neurophysiol,
November 1, 1999;
82(5):
2249 - 2261.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Fricker, J. A H Verheugen, and R. Miles
Cell-attached measurements of the firing threshold of rat hippocampal neurones
J. Physiol.,
June 15, 1999;
517(3):
791 - 804.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-Y. Wang, B. A. Olshausen, and L. M. Chalupa
Differential Effects of Apamin- and Charybdotoxin-Sensitive K+ Conductances on Spontaneous Discharge Patterns of Developing Retinal Ganglion Cells
J. Neurosci.,
April 1, 1999;
19(7):
2609 - 2618.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. M. Raman and B. P. Bean
Ionic Currents Underlying Spontaneous Action Potentials in Isolated Cerebellar Purkinje Neurons
J. Neurosci.,
March 1, 1999;
19(5):
1663 - 1674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. R. Cummins, J. R. Howe, and S. G. Waxman
Slow Closed-State Inactivation: A Novel Mechanism Underlying Ramp Currents in Cells Expressing the hNE/PN1 Sodium Channel
J. Neurosci.,
December 1, 1998;
18(23):
9607 - 9619.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction
