 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 1998, 18(18):7244-7255
The Nitric Oxide-cGMP Pathway May Mediate Communication between
Sensory Afferents and Projection Neurons in the Antennal Lobe of
Manduca Sexta
Alan
Nighorn1,
Nicholas
J.
Gibson1,
David M.
Rivers1,
John G.
Hildebrand1, and
David B.
Morton2
1 Arizona Research Laboratories, Division of
Neurobiology, University of Arizona, Tucson, Arizona 85721, and
2 Department of Biological Structure and Function, School
of Dentistry, Oregon Health Sciences University, Portland, Oregon 97201
 |
ABSTRACT |
The nitric oxide (NO)-cGMP signaling system is thought to play
important roles in the function of the olfactory system in both
vertebrates and invertebrates. One way of studying the role of NO in
the nervous system is to study the distribution and properties of NO
synthase (NOS), as well as the soluble guanylyl cyclases (sGCs), which
are the best characterized targets of NO. We study NOS and sGC in the
relatively simple and well characterized insect olfactory system of the
hawkmoth, Manduca sexta. We have cloned Manduca
sexta nitric oxide synthase (MsNOS) and two sGCs (MsGC 1 and
MsGC 1), characterized their basic biochemical properties, and
studied their expression in the olfactory system. The sequences of the
Manduca genes are highly similar to their mammalian
homologs and show similar biochemical properties when expressed in
COS-7 cells. In particular, we find that MsGC functions as an
obligate heterodimer that is stimulated significantly by NO. We also
find that MsNOS has a Ca2+-sensitive NO-producing
activity similar to that of mammalian neuronal NOS. Northern and
in situ hybridization analyses show that MsNOS and the
MsGCs are expressed in a complementary pattern, with MsNOS expressed at
high levels in the antennae and the MsGCs expressed at high levels in a
subset of antennal lobe neurons. The expression patterns of these genes
suggest that the NO-sGC signaling system may play a role in mediating
communication between olfactory receptor neurons and projection neurons
in the glomeruli of the antennal lobe.
Key words:
nitric oxide synthase; soluble guanylyl cyclase; Manduca sexta; olfaction; cGMP; NO
 |
INTRODUCTION |
Nitric oxide (NO) has been shown to
play many roles in the function of the nervous system as an
intercellular and intracellular messenger (O'Dell et al., 1991 ;
Schuman and Madison, 1994 ). A good model system in which to examine the
roles of NO is the olfactory system, particularly the first synaptic
neuropil: the olfactory bulb in mammals and the antennal lobe in
insects (Breer and Shepherd, 1993 ). One way to do this is to examine
the distribution of NO synthase (NOS) and soluble guanylyl cyclase
(sGC), the best characterized target of NO. In situ
hybridization and immunohistochemical and histochemical studies in
mammals have shown that NOS and sGC are expressed at high levels in the
olfactory bulb (Kishimoto et al., 1993 ; Hopkins et al., 1996 ).
In insects, studies have focused on the antennal lobe, a structure both
functionally and anatomically similar to the olfactory bulb. In the
antennal lobe, sensory axons from the antennae and inhibitory
interneurons and projection neurons of the antennal lobe enter into
complex synaptic arrangements within spheroidal neuropils called
glomeruli. Sensory afferents project to the outer margin, interneurons
form dense arborizations more medially, and neurites of projection
neurons occupy the basal margin of each glomerulus. The location of NOS
within the antennal lobe has been investigated primarily using the
histochemical stain for NADPH-diaphorase, an activity that frequently
colocalizes with NOS (Schmidt et al., 1992 ). In these studies, high
levels of NADPH-diaphorase activity was found in the antennal lobes,
both in the glomeruli and in the groups of neuronal somata bordering
the neuropil (Elphick et al., 1995 ; Müller and Hildebrandt, 1995 ;
Bicker et al., 1996 ; Schachtner et al., 1998 ). It is unclear, however,
whether this staining pattern accurately and specifically reflects the
distribution of the NOS enzyme.
The distribution of NOS and sGC in the olfactory bulb of vertebrates
and of NADPH-diaphorase staining in the antennal lobes of insects
suggests that the NO-cGMP signaling system plays important roles in
the processing of olfactory information. It has been suggested that
each glomerulus, a spheroidal module of neuropil surrounded by a glial
sheath, might be an ideal domain for NO to coordinate neural activity
(Breer and Shepherd, 1993 ). The NO-sGC signaling system also might
mediate olfactory synaptic plasticity. Indeed, evidence for a form of
olfactory learning mediated by NO-sGC has been found in mice (Okere et
al., 1996 ), sheep (Kendrick et al., 1997 ), and honeybees (Müller,
1996 ).
In this paper, we examine the roles of the NO-cGMP signaling system in
the olfactory system of Manduca sexta. We clone
Manduca NOS and sGC and characterize their biochemical
properties in vitro and their expression patterns in
vivo. We find that these enzymes have the expected activities but
a surprising expression pattern. This expression pattern suggests that
NADPH-diaphorase staining may not accurately reflect NOS distribution.
More importantly, this expression pattern also suggests that the
NO-cGMP signaling system may mediate direct communication between
sensory afferents and projection neurons in the antennal lobe.
 |
MATERIALS AND METHODS |
Animals. Manduca sexta (Lepidoptera:
Sphingidae) were reared in a laboratory culture on an artificial diet
as previously described (Sanes and Hildebrand, 1976 ; Prescott et al.,
1977 ). Animals used in the present study were at stage 18 of adult
development, ~4-8 hr before the expected time of adult ecdysis
(Tolbert et al., 1983 ) or 4 hr before ecdysis to the pupal stage, and
were staged according to external morphological markers (Truman et al.,
1980 ).
RNA isolation and degenerate oligo reverse
transcription-PCR. Total RNA was isolated from ventral nerve cords
of prepupae with the aid of Trizol reagent (Life Technologies,
Gaithersburg, MD). The poly(A+) RNA fraction was
purified using oligo-dT cellulose columns (Life Technologies).
First-strand cDNA was then generated from 5 µg of
poly(A+) RNA using oligo-dT primers and Superscript
II RT (Life Technologies). The cDNA was then resuspended in 40 µl of
water. To clone sGCs, degenerate oligonucleotide primers were designed
against the amino acid sequences DVYKVETI (CCRAAIARRCARTAICKNGGCAT) and
MPRYCLFG (GAYGTITAYAARGTIGWIACNAT) from the putative catalytic
domain common to both sGCs and receptor guanylyl cyclases (rGCs)
(Chinkers and Garbers, 1991 ). PCR was performed in a 20 µl reaction
containing 1 µl of cDNA from the above reaction, 200 pmols of each
degenerate primer, 2 mM MgCl2, 1× PCR
buffer II (Perkin-Elmer, Foster City, CA), all four deoxynucleotides at
200 µM, 12.5 µCi of
[35S]dATP, and 2 U of Amplitaq (Perkin-Elmer).
Thirty cycles were performed on a thermocycler (9600; Perkin-Elmer) at
94°C for 20 sec, 50°C for 20 sec, and 72°C for 30 sec. Because
the amplified domain of sGCs is three to six nucleotides shorter than
that of rGCs, the resulting PCR products were analyzed on an 8%
polyacrylamide sequencing gel. Bands that were below the 235 bp
expected size of the receptor GCs were cut out, eluted in TE,
and reamplified using the same conditions without the
[35S]dATP. The PCR products were T/A cloned
into the vector pCRII (Invitrogen, Carlsbad, CA) and manually
sequenced. To clone NOS, degenerate oligonucleotide primers were
generated against the conserved amino acids WYMS/GTEIG
(TGGTAYATGISNACNGARATHGG) and PVFHQEM (CATYTGRTGTAANACNGG). PCR was
performed as described above, except that
[35S]dATP was not added, and the products were
analyzed on a 1% agarose gel. A band of 330 bp was electroeluted, T/A
cloned, and sequenced. Note that there is a mismatch at the 3' end of
the 3' primer compared with the Manduca sexta nitric oxide
synthase (MsNOS) sequence (see Fig. 1). The MsNOS PCR product was
obtained, because some truncated degenerate oligos remained in the
oligo mixture as a result of incomplete synthesis.
Reverse transcription-PCR. Total RNA was isolated from
ventral nerve cords and antennal lobes using Trizol (Life
Technologies). Aliquots (5 µg) of the total RNA were treated with
DNaseI (Life Technologies) for 30 min at 37°C. Reverse transcription
(RT) was then performed using oligo-dT primers and Superscript RT in a 20 µl total volume for 1 hr at 37°C. Control reactions performed in
parallel omitted the RT. The cDNA was diluted to 40 µl with water.
PCR was performed in a 20 µl reaction containing 1 µl of cDNA from
the above reaction, 200 pmols of each primer, 2 mM
MgCl2, 1× PCR buffer II (Perkin-Elmer), all four
deoxynucleotides at 200 µM each, and 2 U of Amplitaq
Gold (Perkin-Elmer). Thirty cycles were performed on a
thermocycler (9600; Perkin-Elmer) at 94°C for 20 sec, 68°C for 20 sec, and 72°C for 30 sec. Products were then analyzed on a 1%
agarose gel and stained with ethidium bromide. The primers for MsGC 1
and MsNOS were designed using Oligo 4.0 (National Biosciences,
Plymouth, MN). The primers for MsGC 1 were TCACTGCTGTGTTCCGAT
and ATAGAAGGCCGTGGTCTT. The primers for MsNOS were
CATCATAGACGGCACCAG and TCACTGCTGTGTTCCGAT.
32P-labeled probe generation.
-32P-labeled single-stranded DNA probes were generated
in a 20 µl PCR reaction that contained 50 ng of linearized template
DNA, 200 pmol of specific primer, 200 µM dATP, 200 µM dGTP, 200 µM dTTP, 50 µCi of
[ -32P]dCTP (3000 mCi/ml), 2 mM
MgCl2, 1× PCR buffer II, and 2 U of Amplitaq Gold
(Perkin-Elmer). PCR (35 cycles) was performed with a Perkin-Elmer 9600 thermocycler at 94°C for 20 sec, 50°C for 30 sec, and 72°C for 5 min. Unincorporated nucleotides were removed by precipitation with
ammonium acetate and ethanol.
Random priming. Random labeling was performed on
gel-purified linearized templates with the Decaprime kit (Ambion,
Austin, TX) using [32P]dCTP.
cDNA library construction and screening. cDNA libraries were
constructed from 5 µg of poly(A+) RNA and purified
as described above from stage 18 antennae and prepupal ventral nerve
cords. Oligo-dT-primed double-stranded cDNA was generated using a
Superscript Choice cDNA construction kit (Life Technologies) according
to the manufacturer's instructions, except that the RT reaction was
performed in a thermocycler at 37°C for 15 min, followed by a
slow rise to 50°C over the following 45 min. Adapted cDNA was
then ligated into EcoRI cut Lambda-ZAPII (Stratagene, La
Jolla, CA) and packaged using Gigapack Gold III (Stratagene) packaging
extract. The library was screened using nitrocellulose filters
(Schleicher & Schuell, Keene, NH) that were hybridized and washed
according to the manufacturer's instructions. Positive clones were
sequenced in both directions using automated sequencing (Perkin-Elmer)
and a primer walking strategy with sequencing primers designed using
Oligo 4.0 (NBI).
5' Rapid amplification of cDNA ends. 5' Rapid amplification
of cDNA ends (RACE) was performed to confirm the 5' end of the MsNOS
gene. Five micrograms of poly(A+) RNA isolated from
antennae (see above) was used to generate adapted double stranded cDNA
with the Marathon kit (Clontech, Palo Alto, CA). PCR was then performed
with the adapter primer and the MsNOS-specific primer
CATGAGGCTGGTCTGGCATAC under the following conditions using ExTaq DNA
polymerase (TaKaRa): 30 cycles at 94°C for 30 sec and at
68°C for 4 min. The resulting PCR products were analyzed on a 0.9%
agarose gel, T/A cloned, and sequenced.
DNA sequencing and sequence analysis. Manual DNA sequencing
was performed using the Sequenase 2.0 kit (Amersham, Arlington Heights,
IL). Most sequencing was done by an automated sequencing facility
running an Applied Biosystems (Foster City, CA) 377 sequencer. Sequence analysis was performed on a Macintosh LC475 computer running
Geneworks DNA analysis software (Oxford Molecular Group, Campbell, CA).
Protein sequence alignments were performed using the CLUSTAL W
program (Thompson et al., 1994 ) through the Baylor College of Medicine
search launcher.
Northern blot analysis. Poly(A+) RNA was
separated on a formaldehyde-agarose (1%) gel and blotted onto
Zetaprobe membrane (Bio-Rad, Hercules, CA) using capillary transfer.
The blot was UV cross-linked, dried completely, and hybridized
overnight at 42°C with a hybridization solution consisting of
50% formamide, 5× SSPE, 5× Denhardt's solution, 1% SDS,
10% dextran sulfate, 100 µg/ml sonicated salmon sperm DNA, and
32P-labeled probe at 106 cpm/ml. Probes
were generated by random priming using the entire gel-purified cDNA
clone as a template.
Cell transfections and enzyme assays. The open reading
frames for MsNOS, MsGC 1, and MsGC 1 were cloned into pcDNA3.1
(Invitrogen), and 8 µg of each plasmid was transfected into a 10 cm
dish of COS-7 cells using Lipofectamine (Life Technologies).
Three days after transfection, the cells were harvested and assayed for
either NOS or GC activity. For NOS activity, the cells were homogenized in 1 ml of 25 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 1 mM PMSF,
pH 7.4, and assayed for their ability to convert [3H]arginine to
[3H]citrulline as described previously (Bredt and
Schmidt, 1996 ). As a comparison, pcDNA3.1 containing rat neuronal NOS
(nNOS) [kindly supplied by Dr. David Bredt, University of
California at San Francisco (UCSF), San Francisco, CA] was also
transfected into COS-7 cells and assayed in parallel. For GC assays,
the cells were harvested and homogenized in 1 ml of 25 mM
Tris-HCl and 1 mM PMSF, pH 7.4, and assayed for their
ability to convert [ -32P]GTP to
[ -32P]cGMP in the presence or absence of 250 µM sodium nitroprusside (SNP) as described
previously (Morton and Giunta, 1992 ).
Riboprobe generation. Digoxigenin (Boehringer Mannheim,
Indianapolis, IN)-labeled riboprobes used for in situ
hybridization were generated in both the sense and antisense directions
with T3 and T7 RNA polymerase (Life Technologies) as described
previously (Komminoth, 1996 ). The entire linearized cDNA clone for each
gene was used as a template. The resulting riboprobes were then
hydrolyzed to an average size of 200 nucleotides using alkaline
hydrolysis as described previously (Angerer and Angerer, 1992 ).
In situ hybridization. In situ hybridization was
performed using modifications of a protocol described by Komminoth
(1996) . Briefly, brains of pharate adult Manduca were
dissected and fixed in 4% paraformaldehyde in PBS overnight at 4°C.
Frozen sections (20 µm) were then cut, mounted onto Superfrost slides
(Electron Microscopy Sciences, Fort Washington, PA), and incubated
overnight at 42°C. The slides were then pretreated with a 15 min wash
in PBST, a 20 min incubation in 0.2N HCl, a 10 min wash in 2×
SSPE, a 30 min incubation with 2 mg/ml proteinase K in TE at 37°C, a 10 min fix in 4% paraformaldehyde in PBS at 4°C, and a 10 min incubation in 0.1% acetic anhydride in 0.1 M
triethanolamine, pH 8.0. The slides were washed in PBS between each of
the steps in the pretreatment. The slides were then hybridized
overnight at 42°C in 50% formamide, 10% dextran sulfate, 1×
Denhardt's solution, 4× SSPE, 500 µg/ml yeast tRNA, 250 µg/ml
sonicated salmon sperm DNA, and ~5 ng of digoxigenin-labeled
riboprobe. Equal amounts of a sense riboprobe were used as a negative
control. After hybridization, the slides were washed 2× for 15 min in 2× SSPE, incubated for 30 min at 37°C with 20 µg/ml
RNaseA, and washed 2× for 15 min in 0.1× SSPE at 50°C. The
probes were then visualized by incubation in alkaline
phosphatase-labeled sheep anti-digoxigenin antibody (Boehringer
Mannheim) at 1:1000 dilution in TBST overnight at 4°C. The
slides were washed 4× for 15 min in TBS. The staining was
developed using a BCIP-NBT solution (Amresco, Solon, OH), and
the slides were mounted using Gel/Mount (Biomeda, Foster City, CA).
cGMP immunohistochemistry. The brains of pharate adult
Manduca were dissected in HBSS (Sigma, St. Louis,
MO) and incubated for 15 min in either saline or saline with 1 mM SNP (Sigma) added. The brains were then fixed overnight
in 4% paraformaldehyde at 4°C. The brains were mounted in 7%
low-melt agarose, and 50 µm vibratome sections were cut. The sections
were blocked (PBS, 0.3% Triton X-100, and 2% normal goat serum) for 1 hr at room temperature and incubated with sheep anti-cGMP antisera (H. Steinbusch, University of Limburg, The Netherlands) diluted
1:20,000 in blocking solution at 4°C overnight. The slides were
washed with PBST and then incubated in HRP-conjugated anti-sheep
(Jackson ImmunoResearch, West Grove, PA) at 2°C diluted 1:1000 in
blocking solution at 4°C overnight. The slides were then washed,
developed with 0.5 mg/ml diaminobenzidine in the presence of 0.03%
hydrogen peroxide, and mounted with Gel/Mount (Biomeda).
 |
RESULTS |
Manduca sexta NOS is similar to mammalian nNOS
We used degenerate oligo RT-PCR with primers designed against
amino acid sequences just upstream of the tetrahydrobiopterin-binding domain (Fig. 1) to amplify a product from
Manduca nervous system RNA. The resulting band of 330 bp was
cloned and sequenced. Fifteen independent clones were obtained, all of
which contained an identical cDNA sequence with high similarity to
known NOS clones from other species. This probe was then used to screen
two independent cDNA libraries (see Materials and Methods). We obtained
identical 5854 bp clones from both libraries. This 5854 bp clone
contains an open reading frame extending from an initial methionine at
base pair 100 to a termination codon at base pair 3717, resulting in a
putative protein product of 1206 amino acids. There are no stop codons
upstream of the initial methionine, but the 5' end of the clone was
confirmed by comparison of clones from the two different cDNA
libraries. We obtained the same 5' end of the gene using 5' RACE.
Northern blot analysis (see Fig. 5) also shows a clone of 5.8-6.0 kb.
All of the above evidence suggests that we have obtained a full-length
cDNA clone of NOS from Manduca sexta.

View larger version (96K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid alignment of MsNOS with
Drosophila NOS (dNOS) and rat neuronal
NOS (nNOS). The amino acid sequences were aligned using
the CLUSTAL W program (Thompson et al., 1994 ). Identical amino acids
are printed in white lettering on black background.
Conserved amino acid changes are represented by black lettering
on gray background. The amino acids used for degenerate primer
design are denoted by arrows describing the direction of
the primer. Known cofactor binding sites are labeled and
boxed. Note the high levels of similarity for all three
clones within the cofactor binding domains and particularly in the
region from MsNOS residues 119-576. The nucleic acid sequence of MsNOS
has been deposited in GenBank under accession number AF062749.
|
|
Sequence comparisons of the MsNOS clone with other cloned NOS genes
from both mammalian and insect species have shown that MsNOS is more
closely related to the other known insect NOS genes (52% identical to
Rhodnius NOS and 47% identical to Drosophila NOS) (Regulski and Tully, 1995 ; Yuda et al., 1996 ) than to any of the
mammalian NOS isoforms. Of the mammalian isoforms, MsNOS is more
closely related to neuronal NOS (nNOS or NOS1) than to either inducible
NOS (iNOS or NOS2) or endothelial NOS (eNOS or NOS3). Alignment of
MsNOS with the rat nNOS gene shows that MsNOS contains all of the
cofactor- and heme- binding domains present in nNOS (Fig. 1). The MsNOS
clone, however, does not contain the amino terminal extension present
in nNOS, which contains the PDZ and PIN domains that are
important for the subcellular localization and regulation of the
function of nNOS (Brenman et al., 1996 ; Jaffrey and Snyder, 1996 ). Like
the NOS cloned from Rhodnius (Yuda et al., 1996 ), MsNOS does
not contain the amino terminal extension of unknown function that is
present in the Drosophila NOS gene (Regulski and Tully,
1995 ). Nevertheless, the MsNOS clone does appear to represent a genuine
Manduca NOS with all of the essential biochemical domains
necessary for the calcium-dependent generation of NO.
Manduca sexta expresses and isoforms
of sGC
There are two main classes of guanylyl cyclases: rGC and sGC.
Active sGC is a heme-containing heterodimer consisting of an and a
subunit. Both subunits have catalytic, dimerization, and
heme-binding domains (Wedel et al., 1995 ). The rGCs are thought to act
as homodimers and consist of catalytic, dimerization, kinase-like, transmembrane, and extracellular ligand-binding domains (Garbers, 1992 ). The catalytic domains of rGCs and sGCs are highly conserved. We
used degenerate oligo RT-PCR to amplify a section of this conserved catalytic domain (Nakane and Murad, 1994 ) present in both rGCs and
sGCs. We obtained a band of 230 bp, which was cloned and sequenced. We
sequenced 115 different cloned PCR products and obtained eight different guanylyl cyclase fragments, including two that showed high
similarity to the mammalian and sGC isoforms. We isolated the
subunit six times and the subunit four times.
The isolated fragments were used to screen a cDNA library made from
prepupal abdominal nervous system. We obtained full-length cDNA clones
of the Manduca homologs of both the (MsGC 1) and (MsGC 1) subunits (Fig. 2)
MsGC 1 is a 5809 bp clone with an open reading frame spanning base
pairs 235 to 2331, resulting in a protein product of 699 amino acids.
MsGC 1 is a 3691 bp clone with an open reading frame spanning base
pairs 168 to 1967, resulting in a protein product of 600 amino
acids. In both clones, there are termination codons upstream of
the initial methionine in all three potential ORFs, and the sizes of
the cDNA clones match the band size seen in Northern blot analyses
(Fig. 5).

View larger version (83K):
[in this window]
[in a new window]
|
Figure 2.
Amino acid alignment of the Manduca
sexta sGCs with their rat homologs. The amino acid sequences
were aligned using the CLUSTAL W program (Thompson et al., 1994 ).
Identical amino acids are printed in white lettering on black
background. Conserved amino acid changes are represented by
black lettering on gray background. The amino acids used
for degenerate primer design are denoted by arrows
describing the direction of each primer. The amino acids identified by
Stone and Marletta (1995) are boxed. The
asterisks denote boxed residues that are not conserved
in MsGC 1. Specific amino acids shown to be important by mutational
analysis are denoted by the carats, including His-105,
Cys-78, and Cys-214 (labeled according to the rat sGC 1 amino acids).
Note that MsGC 1 has all three of these residues, whereas MsGC 1
has the His-105 and Cys-214 homologs but is missing the Cys-78 homolog.
The nucleic acid sequences of MsGC 1 and MsGC 1 have been deposited
into GenBank under accession numbers AF062750 and AF062751,
respectively.
|
|
Sequence comparisons show that MsGC 1 is more closely related to the
Drosophila subunit (50% identity) (Shah and Hyde, 1995 ) than to the rat sGC 1 subunit (36% identity) (Nakane et al., 1990 ). When functional domains are compared between MsGC 1 and rat sGC 1, there is 55% identity in the catalytic domain, 63% identity in the
dimerization domain, and only 16% identity in the heme-binding domain
(Wedel et al., 1995 ; Friebe et al., 1997 ). Despite their low
overall identity in the heme-binding domain, MsGC 1 has all of the 25 amino acids identified by Stone and Marletta (1995) as being conserved
in all sGCs. In addition, MsGC 1 contains a histidine in a position
homologous to that of the histidine in position 105 in the rat 1,
which is thought to be the axial ligand for interaction of heme with NO
(Stone and Marletta, 1994 ; Wedel et al., 1994 ).
Sequence analysis of MsGC 1 shows that it is approximately equally
similar to the Drosophila subunit (56% identity) and the rat 1 subunit (58% identity). Domain comparison to the rat 1
shows 66% identity in the catalytic domain, 72% identity in the
dimerization domain, and 50% identity in the heme-binding domains.
Interestingly, although MsGC 1 has a histidine in position 105, it is
missing four of the 25 highly conserved amino acids (Stone and
Marletta, 1995 ) including the Phe-254, Phe-276, Ser-324, and Ser-341
present in the rat sGC 1 gene. These amino acids, however, are
apparently not necessary for function, because MsGC 1 expressed in
COS cells functions as a classic NO-sensitive sGC (see below). MsGC 1
does contain the other 21 amino acids, as well as cysteines at
positions 78 and 214 that have been shown by mutational analysis to be
important for NO activation of sGC (Friebe et al., 1997 ).
The MsNOS clone appears to be biochemically similar to nNOS
We wanted to confirm that we had obtained a functional NOS clone
from Manduca sexta, and then we wanted to compare its
biochemical properties to those of nNOS. We expressed our cDNA clones
in COS-7 cells using transient transfection assays and measured the
conversion of arginine to citrulline in COS-cell homogenates. The MsNOS
clone showed significant NOS activity (Fig. 3). This
activity depended on calcium and NADPH, was clearly affected by the
lack of flavin adenine dinucleotide and tetrahydrobiopterin, and
was relatively unaffected by loss of calmodulin and flavin
mononucleotide (FMN). We transiently transfected a rat nNOS
(kindly supplied by Dr. David Bredt, UCSF) in a parallel assay. In this
system, with these cells and reaction conditions, the cofactor
requirements for nNOS were almost identical to those of MsNOS, although
the overall level of activity was higher for nNOS (52.7 ± 4.5 pmol/min/mg protein) than for MsNOS (13.7 ± 1.9 pmol/min/mg
protein). This difference could easily be accounted for by differences
in the transfection efficiencies. The two significant differences were that nNOS was more profoundly affected by the loss of exogenously added
calmodulin and FMN than was MsNOS. This could actually be a result of
the lower activity of the MsNOS, because the COS cells are likely to
provide some endogenous calmodulin and FMN, which may have been enough
to support the activity of MsNOS but not the higher activity of the
nNOS. These assays clearly show, however, that we obtained a functional
calcium-dependent NOS from Manduca sexta and that the
protein expressed from this clone has cofactor requirements similar to
those of nNOS.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3.
NOS activities of the MsNOS and rat nNOS clones
after transfection into COS-7 cells. COS-7 cell homogenates were tested
for their ability to convert arginine to citrulline after transfection
with either vector alone (A, pcDNA3.1),
MsNOS in pcDNA3.1 (A, pcDNA3.1-MsNOS), or
rat nNOS in pcDNA3.1 (B). Levels shown are the
mean ± SEM (n = 3) for a single transfection
experiment. A replicate transfection experiment gave an essentially
similar result.
|
|
MsGC 1 and MsGC 1 form a functional heterodimer
We wanted to determine whether the Manduca sGC isoforms
were functional either by themselves or as heterodimers. Again we used
transient transfections to express each clone in COS-7 cells, either by
itself or in a cotransfection experiment. We then measured the
conversion of [ -32P]GTP to
[32P]cGMP in the presence or absence of 250 µM SNP, an NO donor (Fig. 4). Neither subunit was active when
transfected alone. When the two clones were cotransfected, a
significant amount of basal activity was detected (8.6 ± 1.9 pmol/min/mg of protein). This basal activity was stimulated 14-fold (to
123 ± 26 pmol/min/mg of protein) in the presence of 250 µM SNP. These results confirm that we have obtained
Manduca sexta and sGC isoforms, which form a
functional heterodimer that can be stimulated by NO.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4.
Guanylyl cyclase activity of MsGC 1 and MsGC 1
in COS-7 cells. The guanylyl cyclase activity of COS-7 cell homogenates
was tested after transfection with either vector alone
(pcDNA3.1), MsGC 1 in pcDNA3.1 alone
(MsGC 1), MsGC 1 in pcDNA3.1 alone
(MsGC 1), or a cotransfection experiment with both
MsGC 1 and MsGC 1 (MsGC 1 + MsGC 1). Activities
were examined in both the presence and absence of 250 mM
SNP. Levels shown are the mean ± SEM (n = 12)
of data pooled from four separate transfection experiments.
|
|
MsNOS and Manduca sexta sGCs show
nonoverlapping expression patterns
We used Northern blot analysis to examine the tissue-specific
expression patterns of each of the genes (Fig.
5). We compared the expression of each of
the clones in muscle, antenna, brain, and the abdominal CNS. All
of the genes were highly expressed in portions of the nervous system
but not detectable in muscle. Note, however, that there was less mRNA
in the muscle lane (Fig. 5). The expression pattern found within the
nervous system was surprising. Both of the sGC subunits were expressed
strongly in the abdominal nerve cord and brain and only weakly
expressed in the antenna. The MsNOS gene, like the sGC subunits, was
strongly expressed in the abdominal nerve cord but, surprisingly, only barely detectable in the brain. Moreover, the MsNOS gene was strongly expressed in the antenna. Thus, MsNOS and the Manduca sGC
subunits have complementary expression patterns in the brain and
antenna, with MsNOS highly expressed in the antennae and the sGC
subunits highly expressed in the brain.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5.
Northern blot and RT-PCR analyses of MsNOS and
MsGC mRNA expression. A, Northern blot showing the
expression of MsNOS, MsGC 1, and MsGC 1 in different tissues. Five
micrograms of poly(A+) RNA was isolated from each
tissue, separated on a 1% agarose-formaldehyde gel, and blotted onto
Zetaprobe. This blot was then hybridized successively with random
primed probes generated from each of the four clones. Manduca
eukaryotic elongation factor 4A (EEF) was
used as a control for loading and for the efficiency of
poly(A+) selection of the mRNA. The blot was
stripped with boiling 0.1% SSC and 1% SDS between each hybridization.
The sizes of each of the bands are noted on the left in
kilobases. B, RT-PCR of MsNOS and MsGC 1 in abdominal
nerve cord and antennal lobe. RT-PCR was performed on total RNA
isolated from the abdominal nervous system and the antennae. The
resulting PCR products were separated on a 1% agarose gel and stained
with ethidium bromide. A control experiment in which the reverse
transcriptase was left out of the reaction was performed as a control
for genomic DNA contamination. No PCR products were detected in these
samples.
|
|
The MsNOS probe detected a single strong band of 6.0 kb in both the
nerve cord and antenna and a faint 6.0 kb band in the brain. No
evidence for additional splice forms was detected, except for a faint
band of 4.3 kb detected in antennae. This band could represent another
splice form, or because NOS has some sequence similarity to cytochrome
P450, it could represent some weak hybridization to the cytochrome
P450-like molecules, which are highly expressed in adult antennae and
are thought to be involved in the clearing and degradation of odorants
from the antennal lymph (Pelosi, 1995 ; Hovemann et al., 1997 ). This
band was not detected in any other tissue, nor was it detected in
antennae earlier in development (data not shown).
The MsGC 1 probe detected a single strong band of ~6.0 kb in the
abdominal nerve cord and brain and a weak band of the same size in the
antenna. A weak 4.1 kb band of unknown significance was also found in
the abdominal nerve cord. The MsGC 1 probe detected a single strong
band just below 4.0 kb in both the abdominal nerve cord and the brain.
A weaker band of the same size was found in antennae. No other splice
forms were detected. The overall expression patterns of MsGC 1 and
MsGC 1 appeared to be very similar to each other.
The weak MsNOS expression in the brain was surprising because of the
strong NADPH-diaphorase staining observed in the antennal lobes of
other insects (Elphick et al., 1995 ; Müller and Hildebrandt, 1995 ; Bicker et al., 1996 ). To investigate this result further, we used
RT-PCR to determine whether MsNOS was present at higher levels
specifically in the antennal lobes (Fig. 5). We detected a clear
RT-dependent PCR product for MsGC 1 in both abdominal nerve cord RNA
and antennal lobe RNA. We also found a clear MsNOS PCR product in
abdominal nerve cord but only a faint product in antennal lobe RNA.
Although these RT-PCR experiments were not done quantitatively, the
faint MsNOS signal present in the antennal lobes compared with the
signal in abdominal nerve cord suggests that a relatively small amount
of MsNOS RNA is present in antennal lobes. This is consistent with the
faint MsNOS signal found in the brain by Northern blot analysis and the
undetectability of MsNOS in the antennal lobe by means of in
situ hybridization (see below).
A subset of cells in the antennal lobe express MsGC 1
and MsGC 1
To determine which cells in the antennal lobe can produce and/or
respond to NO, we used in situ hybridization to determine which cells express NOS and or sGC mRNA. Most of the neuronal cell
bodies in the antennal lobe are found in two groups, the lateral and
the medial cell groups (see Fig. 7). The medial cell group comprises
primarily projection neurons. The lateral group contains both local
interneurons and projection neurons. Local interneurons are primarily
inhibitory and mediate interactions among the olfactory receptor
neurons and projection neurons. The projection neurons collect
information from one or a few glomeruli and project out of the antennal
lobe to higher brain centers.
Although the positive RT-PCR result demonstrated that the antennal lobe
does express some NOS, we were unable to detect expression of MsNOS
mRNA in stage 18 animals with in situ hybridization. This
negative result was consistent, although the probe was able to detect
mRNA expression at earlier developmental stages (data not shown), and
other probes (MsGC 1) used in parallel gave positive results. Because
RT-PCR is much more sensitive than in situ hybridization, this finding suggests that very little MsNOS is expressed in antennal lobes. The low level of expression detected by RT-PCR could reflect a
small number of cells that have high levels of MsNOS mRNA, or it could
reflect a generally low level present in a larger group of cells. The
lack of a signal detected by MsNOS in situ hybridization lends support to the second interpretation.
We detected a strong MsGC 1 signal in both the lateral and medial
cell body groups of the antennal lobe. In the lateral cell group, some
cells stained very darkly, a larger number of cells stained lightly,
and some cells exhibited no detectable MsGC 1 mRNA expression. In the
medial cell group, a more homogenous level of staining was observed,
with all of the cells staining at an intermediate level, although some
small differences among cells were detectable (Fig.
6). No expression of MsGC 1 mRNA was
detected in the glial cells that surround the glomeruli of the antennal lobe.

View larger version (118K):
[in this window]
[in a new window]
|
Figure 6.
Localization of MsGC 1, MsGC 1, and
SNP-stimulated cGMP in the Manduca antennal lobe.
A-F, In situ hybridization with MsGC 1
and MsGC 1 probes. A, Low-magnification view of
antennal lobe probed with MsGC 1 antisense probe. Note the lateral
cell body cluster (LC) staining and the lack of staining
in any other structure. B, Low-magnification view of the
antennal lobe probed with a MsGC 1 sense control probe. Note the lack
of any detectable staining. A section through the lateral cell cluster
(LC) is shown. C, High-magnification view
of the lateral cell cluster shown in A (MsGC 1
antisense probe). A darkly staining cell (large arrow),
a lightly staining cell (small arrow), and a nonstaining
cell (Figure legend continues) (open arrowhead) are shown.
D, High-magnification view of the lateral cell cluster
probed with MsGC 1 antisense probe. Darkly staining (large
arrow), lightly staining (small arrow), and
nonstaining cells (open arrowhead) are shown.
E, High-power view of the medial cell cluster
(MC) probed with MsGC 1 antisense probe. Note the
general light level of staining in all cells. F,
High-magnification view of the medial cell cluster (MC)
probed with MsGC 1 antisense probe. Note the general light level of
staining in all cells. G, H, cGMP
immunocytochemistry. G, Low-magnification view of an
antennal lobe stimulated with SNP and stained with an anti-cGMP
antibody. Staining of cell bodies in the medial cell cluster
(MC) is shown. Note the nuclear staining present in some
cells (arrowhead). The processes of these cells are
clearly seen, including dendrites in the macroglomerular complex
neuropil (MGC). H, Low-magnification view
of an antennal lobe not treated with SNP but stained with the anti-cGMP
antibody. Note the lack of any detectable staining. Scale bars:
A, B, G, H,
400 µM; C-F, 100 µM.
|
|
MsGC 1 mRNA expression was also observed in both the lateral and
medial cell body packets (Fig. 6). The expression pattern was subtly
different, however. For MsGC 1, like MsGC 1, we observed three
different levels of mRNA expression, but unlike the pattern for
MsGC 1, there were relatively fewer darkly staining cells and many
more intermediately staining cells. Like MsGC 1, however, MsGC 1
showed more homogeneous staining in the medial cell group, with all of
the cells showing some level of staining. Also, like MsGC 1, MsGC 1
was undetectable in glial cells of the antennal lobe.
cGMP immunocytochemistry shows projection neuron staining in the
antennal lobe
To classify the antennal lobe cells that express functional sGC
and to confirm that the sGC in the antennal lobe can respond to NO, we
examined the NO-stimulated levels of cGMP in the antennal lobe by means
of cGMP immunocytochemistry. We stimulated the brain by incubation with
SNP and then detected the resulting increase in cGMP with an anti-cGMP
antibody (Fig. 6). We were unable to detect a cGMP signal in the
absence of SNP stimulation. With SNP stimulation, however, a subset of
antennal lobe neurons stained with the anti-cGMP antibody. The cell
bodies as well as the processes of these cells stained, allowing us to
ascertain unambiguously that some of these cells were projection
neurons of both the medial and lateral cell groups. Only a subset of
cells in each group stained, with some minor variations in the level of
staining among the cells that did stain. Nuclear staining was evident
within some of the cells that stained. The significance of the nuclear localization of cGMP in these cells is unknown, but it is intriguing to
speculate that cGMP might mediate changes in gene expression. There was
also strong staining in some of the projection neuron processes
enervating the macroglomerular complex (MGC), a male-specific glomerular complex involved in the processing of pheromonal information (Christensen and Hildebrand, 1987 ). These results suggest that at least
some of the projection neurons within the antennal lobe can respond to
NO with an increase in cGMP.
Note that fewer cells exhibited detectable levels of cGMP after SNP
stimulation than were positive for sGC expression as determined by
in situ hybridization. This is most likely attributable to the relatively low sensitivity of the anti-cGMP antibody (Morton, 1996 ). Another possibility is that this difference reflects regulation of the NO sensitivity of the sGCs within the cells that express them
(see Discussion). There was some variability from preparation to
preparation using this method. Although in each brain approximately the
same number of cells stained in each experiment, these cells appeared
to extend into a slightly different subset of glomeruli in each animal.
Within each individual, however, the pattern was primarily similar in
both antennal lobes. One constant from all individuals examined
(n = 8) was that some projection neurons from the
MGC were always stained. These results are consistent with the
concept that a subset of antennal lobe neurons express NO-sensitive sGC
and that this subset of cells consists primarily of projection
neurons.
 |
DISCUSSION |
To study the roles of NO in the olfactory system of Manduca
sexta, we have cloned NOS (MsNOS) and both the (MsGC 1) and (MsGC 1) subunits of sGC from the Manduca nervous
system. Sequence comparisons show that MsNOS is more closely related to
other known insect NOS genes than to any of the mammalian NOS isoforms.
Of the mammalian isoforms, MsNOS is more closely related to nNOS than
to either iNOS or eNOS. Most importantly, MsNOS is functional and
displays biochemical properties similar to nNOS, including its
sensitivity to exogenous Ca2+.
The Manduca sGCs appear to be functional homologs of the
mammalian sGCs. Transient expression experiments suggest that they are
obligate heterodimers that are sensitive to stimulation by NO. Although
we do not know exactly which amino acids are required for the function
of the dimerization and heme-binding domains, comparison across species
can yield valuable clues. Stone and Marletta (1995) have done this
comparison with the putative heme-binding and dimerization domains of
sGC subunits. They identified 25 residues that are conserved in all of
the sequences examined. All 25 of these residues are present in
MsGC 1, but four of them are missing in MsGC 1, although MsGC 1
is more similar to its mammalian homolog. Because three of the four
substitutions are not conservative (Fig. 2), this result suggests that
these four amino acids are not absolutely required for function. The
number of conserved residues present in the heme-binding and
dimerization domains of sGC subunits is thus reduced to 21.
The sensitivity of a particular neuron to NO may be partially
regulated by sGC expression
Formation of functional sGC requires coexpression of MsGC 1 and
MsGC 1. In situ hybridization studies of antennal lobe
neurons show that ~90% of those neurons express detectable levels of
MsGC 1 and that ~60-70% express detectable levels of MsGC 1.
Thus, it is clear that a large proportion of antennal lobe neurons
express both subunits. The ability of MsGC 1 and MsGC 1
heterodimers to be activated in vivo is supported by the
ability of the anti-cGMP antibody to detect significant elevations of
cGMP in a subset of projection neurons in response to NO. Fewer neurons
can be detected with this method, however, than would be predicted to express active sGC by the in situ hybridization analysis.
This is possibly explained by the difference in sensitivity of the two
methods, although the medial cell packet showed the highest sensitivity
to NO, whereas the lateral cell packet had the highest levels of sGC
expression. This suggests that the sensitivity of sGC to NO may be
regulated. Thus, the efficacy of the NO-cGMP pathway may be determined
both by the activity of NOS as well as the sensitivity of the sGC. If
regulation of the NO sensitivity of the projection neurons occurs in
the antennal lobe, it would have important functional implications. It
might imply, for example, that sensitivity of the organism to a
particular odorant could be altered in response to changing
physiological conditions by changing the sensitivity of a subset of
antennal lobe neurons to NO.
If the ability of a particular neuron to respond to NO is regulated,
does the pattern of expression of the sGC subunits reflect that
regulation? The expression pattern of MsGC 1 and MsGC 1 in the
antennal lobe parallels the expression pattern of the sGC subunits in
the mammalian olfactory bulb (Hopkins et al., 1996 ), with MsGC 1
widely expressed and MsGC 1 showing large variations among cells.
This difference in the regulation of the two subunits could reflect two
different possibilities. First, one or more as yet unidentified MsGC
subunits could be present in those cells. If this is the case, the
sensitivity of a neuron to NO could be controlled by the nature of the
different sGC subunits expressed in that neuron. A second
possibility is that the responsiveness of some subsets of cells could
be controlled by the amount of MsGC 1 expressed in them at any given
time, with MsGC 1 always expressed and ready to form heterodimers.
Although this possibility might account for the differential
sensitivity to NO of different antennal lobe neurons in the lateral
cell group, it cannot account for differences among neurons in the
medial group, because both subunits are expressed at approximately
equal levels in all of those neurons. The evidence to date suggests
that the expression pattern of the sGC-subunit mRNA can account for
some of the differences among antennal lobe neurons, most obviously
those in which no sGC expression is detected. It cannot, however,
account for all of the apparent differential sensitivity to NO. There
may be additional levels of regulation at the level of the protein.
Functional implications of the MsNOS and MsGC expression patterns
for the roles of NO in antennal lobe
Using the clones described in this paper, we now can explore the
roles of NO in the olfactory system. We have shown that NO-sensitive sGC is expressed at relatively high levels in the antennal lobes and at
comparatively low levels in the antennae. Because neurons in both the
lateral and medial cell groups of the antennal lobe (Fig.
7) express sGC subunits, we predict that
at least some projection neurons can respond to NO with an increase in
cGMP. Moreover, because both interneurons and projection neurons are
present in the lateral cell group, it is possible that representatives
of both classes of neurons can respond to a NO signal. The
NO-stimulated cGMP increases measured with immunohistochemistry,
however, suggest that projection neurons are the main target of NO
produced in the antennal lobe.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 7.
Schematic diagram of a Manduca
antennal lobe. A, General overview. The antennal lobe
consists of a glomerular neuropil. Each glomerulus is surrounded by a
glial border (dotted lines). Antennal lobe neurons have
their cells bodies in either the medial cell group (containing
projection neurons only) or the lateral cell group (containing both
projection and interneurons). Olfactory receptor neurons from the
antennae send axons down the antennal nerve in the antennal lobe. In
the lobe, sensory afferents project to the outer portions of glomeruli.
Interneurons send processes into multiple glomeruli. Projection neurons
have dendrites projecting into one or more glomeruli and send their
axons to higher brain centers. B, Close-up of a
glomerulus. In this close-up view of an individual glomerulus, the
relationships between the sensory afferents (medium
lines), interneurons (thin lines), and
projection neurons (thick lines) are shown.
|
|
The relative lack of MsNOS expression in the antennal lobes is
surprising in view of the high levels of NADPH-diaphorase staining in
insect antennal lobes shown previously. There could be several different explanations for this finding. First, MsNOS mRNA levels may
not accurately reflect the levels of the NOS protein or protein activity. In view of the fact that MsNOS mRNA is expressed at high
levels in antennal lobes early in development (A. Nighorn and N.J.
Gibson, unpublished observations), it is possible that the protein
product generated at that time is maintained and that there is no need
for additional message in the adult. Second, NADPH-diaphorase staining
may not specifically detect MsNOS. Other enzymes could be detected by
this relatively nonspecific histochemical method. Third, it is possible
that other as yet unidentified forms of NOS are responsible for the
NADPH-diaphorase staining in the brain. The Northern and Southern blot
analyses, however, show no evidence of any additional splice variants
or other forms of NOS, except possibly in the antenna. We cannot,
however, rule out the possibility that NOS expression in the brain is
inducible and that we have not examined its expression under the proper stimulatory conditions, especially because these animals were not yet
fully functional adults. It is also possible, although unlikely, that
the small amount of MsNOS that we could detect is sufficient to fully
activate the sGC.
Whether NADPH-diaphorase staining does or does not accurately reflect
MsNOS protein expression, we also have to consider that NO is not the
only way of stimulating sGC. CO, for example, stimulates sGC in a
manner similar to NO (Kharitonov et al., 1995 ). The noncoincident expression patterns of Manduca sGC and MsNOS may reflect
that the sGC in those locations in which MsNOS is absent is activated by CO or some other mechanism.
Another, more interesting, explanation of the lack of NOS message
specifically in the antennal lobe is suggested by the high level of
MsNOS expression in the antenna. MsNOS may be expressed in olfactory
receptor cells (ORCs) in which NADPH-diaphorase staining has been
demonstrated (Stengl and Zintl, 1996 ). MsNOS might then be transported
down the axons and be highly enriched in the glomeruli of the antennal
lobe where the ORCs interact with interneurons and, indirectly, with
projection neurons. Because projection neurons are the most sensitive
to NO, as measured by immunocytochemistry after NO stimulation, they
are the most likely targets of NO generated within the glomerulus.
Thus, NO may provide a mechanism by which the ORCs may bypass the
inhibitory interneurons to affect the excitability of the projection
neurons directly (Fig. 7). An NOS immunocytochemical study will be
necessary to determine whether NOS protein is indeed localized to the
ORC axons.
In summary, we have cloned MsNOS, MsGC 1, and MsGC 1 from the
Manduca sexta nervous system. We have demonstrated that
these clones are functional when expressed in a heterologous cell
system. MsNOS converts arginine to citrulline and shows similar
cofactor requirements to rat nNOS. MsGC 1 and MsGC 1 act as
obligate heterodimers and can be stimulated by NO. We found that MsNOS
is enriched in antennae, whereas MsGC 1 and MsGC 1 are enriched in
antennal lobes, suggesting that the ORCs from the antennae may express
NOS in their axons and provide a means of communication within the
glomeruli of the antennal lobe. In this way, the ORCs could bypass
interneurons and directly activate projection neurons, or they could
interact nonsynaptically with a subset of interneurons. The function of these potential interactions remains unidentified.
 |
FOOTNOTES |
Received May 18, 1998; revised July 1, 1998; accepted July 6, 1998.
Correspondence should be addressed to Dr. Alan Nighorn, Arizona
Research Laboratories, Division of Neurobiology, University of Arizona,
Tuscon, AZ 85721.
This work was supported by National Science Foundation Grant IBN9604536
(A.N.) and National Institutes of Health Grants NS23253 (J.G.H.) and
NS29740 (D.B.M.). We thank Mark Higgins for his invaluable technical
assistance and Leslie Tolbert, Sharon Hesterlee, and Jeanette Simpson
for their helpful review of this manuscript. We also thank Dr. David
Bredt for his gift of the rat nNOS clone.
 |
REFERENCES |
-
Angerer LM,
Angerer RC
(1992)
In situ hybridization to cellular RNA with radiolabeled RNA probes.
In: In situ hybridization: a practical approach, pp 16-32. New York: Oxford UP.
-
Bicker G,
Schmachtenberg O,
De Vente J
(1996)
The nitric oxide/cyclic GMP messenger system in olfactory pathways of the locust brain.
Eur J Neurosci
8:2635-2643[Web of Science][Medline].
-
Bredt DS,
Schmidt HHHW
(1996)
The citrulline assay.
In: Methods in nitric oxide research (Feelisch M,
Stamler JS,
eds), pp 249-255. New York: Wiley.
-
Breer H,
Shepherd GM
(1993)
Implications of the NO/cGMP system for olfaction.
Trends Neurosci
16:5-9[Web of Science][Medline].
-
Brenman JE,
Chao DS,
Gee SH,
McGee AW,
Craven SE,
Froehner SC,
Bredt DS
(1996)
Interaction of nitric oxide synthase with the postsynaptic density protein PDS-95 and alpha1-syntrophin mediated by PDZ domains.
Cell
84:757-767[Web of Science][Medline].
-
Chinkers M,
Garbers DL
(1991)
Signal transduction by guanylyl cyclases.
Annu Rev Biochem
60:553-575[Web of Science][Medline].
-
Christensen TA,
Hildebrand JG
(1987)
Male-specific sex pheromone-selective projection neurons in the antennal lobes of the moth Manduca sexta.
J Comp Physiol [A]
160:553-569[Medline].
-
Elphick MR,
Rayne RC,
Riveros-Moreno V,
Moncada S,
O'Shea M
(1995)
Nitric oxide synthesis in locust olfactory interneurons. J.
Exp Biol
198:821-829.
-
Friebe A,
Wedel B,
Harteneck C,
Foerster J,
Schultz G,
Koesling D
(1997)
Functions of conserved cysteines of soluble guanylyl cyclases.
Biochemistry
36:1194-1198[Medline].
-
Garbers DL
(1992)
Guanylyl cyclase receptors and their endocrine, paracrine, and autocrine ligands.
Cell
71:1-4[Web of Science][Medline].
-
Hopkins DA,
Steinbusch HWM,
Karkerink-Van Ittersum M,
De Vente J
(1996)
Nitric oxide synthase, cGMP, and NO-mediated cGMP production in the olfactory bulb of the rat.
J Comp Neurol
375:641-658[Medline].
-
Hovemann BT,
Sehlmeyer F,
Malz J
(1997)
Drosophila melanogaster NADPH-cytochrome P450 oxidoreductase: pronounced expression in antennae may be related to odorant clearance.
Gene
189:213-219[Web of Science][Medline].
-
Jaffrey SR,
Snyder SH
(1996)
PIN: an associated protein inhibitor of neuronal nitric oxide synthase.
Science
274:774-777[Abstract/Free Full Text].
-
Kendrick KM,
Guevara-Guzman R,
Zorilla J,
Hinton MR,
Broad KD,
Mimmack M,
Ohkura S
(1997)
Formation of olfactory memories mediated by nitric oxide.
Nature
388:670-674[Medline].
-
Kharitonov VG,
Sharma VS,
Pilz RB,
Madge D,
Koesling D
(1995)
Basis of guanylate cyclase activation by carbon dioxide.
Proc Natl Acad Sci USA
92:2568-2571[Abstract/Free Full Text].
-
Kishimoto J,
Keverne EB,
Hardwick J,
Emson PC
(1993)
Localization of nitric oxide synthase in the mouse olfactory and vomeronasal system: a histochemical, immunological and in situ hybridization study.
Eur J Neurosci
5:1684-1694[Web of Science][Medline].
-
Komminoth P
(1996)
Detection of mRNA in tissue sections using DIG-labeled RNA and oligonucleotide probes.
In: Nonradioactive in situ hybridization application manual, Ed 2 (Grünewald-Janho S,
Keesey J,
Leous M,
van Miltenburg R,
Schroeder C,
eds), pp 126-135. Ingelheim am Rhein, Germany: Boehringer Ingelheim International GmbH.
-
Morton DB
(1996)
Neuropeptide-stimulated cyclic guanosine monophosphate immunoreactivity in the neurosecretory terminals of a neurohemal organ.
J Neurobiol
29:341-353[Medline].
-
Morton DB,
Giunta MA
(1992)
Eclosion hormone stimulates cGMP levels in Manduca sexta nervous tissue via arachidonic acid metabolism with little or no contribution from the production of nitric oxide.
J Neurochem
59:1522-1530[Web of Science][Medline].
-
Müller U
(1996)
Inhibition of nitric oxide synthase impairs a distinct form of long-term memory in the honeybee, Apis mellifera.
Neuron
16:541-549[Web of Science][Medline].
-
Müller U,
Hildebrandt H
(1995)
The nitric oxide/cGMP system in the antennal lobe of Apis mellifera is implicated in integrative processing of chemosensory stimuli.
Eur J Neurosci
7:2240-2248[Web of Science][Medline].
-
Nakane M,
Murad F
(1994)
Cloning of guanylyl cyclase isoforms.
Adv Pharmacol
26:7-18.
-
Nakane M,
Arai K,
Saheki S,
Kuno T,
Buechler W,
Murad F
(1990)
Molecular cloning and expression of cDNAs coding for soluble guanylyl cyclase from rat lung.
J Biol Chem
265:16841-16845[Abstract/Free Full Text].
-
O'Dell TJ,
Hawkins RD,
Kandel ER,
Arancio O
(1991)
Tests on the roles of two diffusible substances in LTP: evidence for nitric oxide as a possible early retrograde messenger.
Proc Natl Acad Sci USA
88:11285-11289[Abstract/Free Full Text].
-
Okere CO,
Kaba H,
Higuchi T
(1996)
Formation of an olfactory recognition memory in mice: reassessment of the role of nitric oxide.
Neuroscience
71:349-354[Web of Science][Medline].
-
Pelosi P
(1995)
Perireceptor events in olfaction.
J Neurobiol
30:3-19.
-
Prescott DJ,
Hildebrand JG,
Sanes JA,
Jewett S
(1977)
Biochemical and developmental studies of acetylcholine metabolism in the central nervous system of the moth, Manduca sexta.
Comp Biochem Physiol
56:77-84.
-
Regulski M,
Tully T
(1995)
Molecular and biochemical characterization of dNOS: a Drosophila Ca++/calmodulin-dependent nitric oxide synthase.
Proc Natl Acad Sci USA
92:9072-9076[Abstract/Free Full Text].
-
Sanes JR,
Hildebrand JG
(1976)
Structure and development of antennae in a moth, Manduca sexta.
Dev Biol
151:282-299.
-
Schachtner J,
Truman JW,
Homberg U
(1998)
In: The NO/cGMP signaling pathway in the developing antennal lobe of the tobacco hornworm Manduca sexta. In: New Neuroethology On The Move. Proceedings of the 26th Goettingen Neurobiology Conference. (Elsner N, Wehner R, eds) New York: Thieme.
-
Schmidt HH,
Gagne GD,
Nakane M,
Pollock JS,
Miller MF,
Murad F
(1992)
Mapping of neural nitric oxide synthase in the rat suggests frequent co-localization with NADPH diaphorase but not with soluble guanylyl cyclase, and novel paraneural functions for nitrinergic signal transduction.
J Histochem Cytochem
40:1439-1456[Abstract].
-
Schuman EM,
Madison DV
(1994)
Nitric oxide and synaptic function.
Annu Rev Neurosci
17:153-183[Web of Science][Medline].
-
Shah S,
Hyde DR
(1995)
Two Drosophila genes that encode the alpha and beta subunits of soluble guanylyl cyclase.
J Biol Chem
270:15368-15376[Abstract/Free Full Text].
-
Stengl M,
Zintl R
(1996)
NADPH diaphorase activity in the antennae of the hawkmoth Manduca sexta.
J Exp Biol
199:1063-1072[Abstract].
-
Stone JR,
Marletta MA
(1994)
Soluble guanylyl cyclase from bovine lung: activation with nitric oxide and carbon monoxide and spectral characterization of the ferrous and ferric states.
Biochemistry
33:5636-5640[Medline].
-
Stone JR,
Marletta MA
(1995)
Heme stoichiometry of heterodimeric soluble guanylate cyclase.
Biochemistry
34:14668-14674[Medline].
-
Thompson JD,
Higgins DG,
Gibson TJ
(1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22:4673-4680[Abstract/Free Full Text].
-
Tolbert LP,
Matsumoto SG,
Hildebrand JG
(1983)
Development of synapses in the antennal lobes of the moth Manduca sexta during metamorphosis.
J Neurosci
3:1158-1175[Web of Science][Medline].
-
Truman JW,
Taghert PH,
Reynolds SE
(1980)
Physiology of pupal ecdysis in the tobacco hornworm Manduca sexta. I. Evidence for control by eclosion hormone.
J Exp Biol
88:327-337[Abstract/Free Full Text].
-
Wedel B,
Humbert P,
Harteneck C,
Foester J,
Malkewitz J,
Böhme E,
Schultz G,
Koesling D
(1994)
Mutation of His-105 in the
1 subunit yields a nitric oxide-insensitive form of soluble guanylyl cyclase.
Proc Natl Acad Sci USA
91:2592-2596[Abstract/Free Full Text]. -
Wedel B,
Harteneck C,
Foester J,
Friebe A,
Schultz G,
Koesling D
(1995)
Functional domains of soluble guanylyl cyclase.
J Biol Chem
270:24871-24875[Abstract/Free Full Text].
-
Yuda M,
Hirai M,
Matsumura H,
Ando K,
Chinzei Y
(1996)
cDNA cloning, expression, and characterization of nitric oxide synthase from the salivary glands of the blood-sucking insect Rhodnius prolixus.
Eur J Biochem
242:807-812[Web of Science][Medline].
Copyright © 1998 Society for Neuroscience 0270-6474/98/18187244-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Watanabe, Y. Kirino, and A. Gelperin
Neural and molecular mechanisms of microcognition in Limax
Learn. Mem.,
August 26, 2008;
15(9):
633 - 642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Hu, L. B. Murata, A. Weichsel, J. L. Brailey, S. A. Roberts, A. Nighorn, and W. R. Montfort
Allostery in Recombinant Soluble Guanylyl Cyclase from Manduca sexta
J. Biol. Chem.,
July 25, 2008;
283(30):
20968 - 20977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. L. Newland and P. Yates
Nitric Oxide Modulates Salt and Sugar Responses via Different Signaling Pathways
Chem Senses,
April 1, 2008;
33(4):
347 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Lee, B. D. Bader, E. S. Chang, and D. L. Mykles
Effects of elevated ecdysteroid on tissue expression of three guanylyl cyclases in the tropical land crab Gecarcinus lateralis: possible roles of neuropeptide signaling in the molting gland
J. Exp. Biol.,
September 15, 2007;
210(18):
3245 - 3254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-W. Kim, L. A. Batista, J. L. Hoppes, K. J. Lee, and D. L. Mykles
A crustacean nitric oxide synthase expressed in nerve ganglia, Y-organ, gill and gonad of the tropical land crab, Gecarcinus lateralis
J. Exp. Biol.,
July 15, 2004;
207(16):
2845 - 2857.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Collmann, M. A. Carlsson, B. S. Hansson, and A. Nighorn
Odorant-Evoked Nitric Oxide Signals in the Antennal Lobe of Manduca sexta
J. Neurosci.,
July 7, 2004;
24(27):
6070 - 6077.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kaneko and A. Nighorn
Interaxonal Eph-Ephrin Signaling May Mediate Sorting of Olfactory Sensory Axons in Manduca sexta
J. Neurosci.,
December 17, 2003;
23(37):
11523 - 11538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Gibbs, A. Becker, R. W. Hardy, and J. W. Truman
Soluble Guanylate Cyclase Is Required during Development for Visual System Function in Drosophila
J. Neurosci.,
October 1, 2001;
21(19):
7705 - 7714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Gibbs
Regulation of Drosophila Visual System Development by Nitric Oxide and Cyclic GMP
Integr. Comp. Biol.,
April 1, 2001;
41(2):
268 - 281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Moroz
Gaseous Transmission Across Time and Species
Integr. Comp. Biol.,
April 1, 2001;
41(2):
304 - 320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gelperin, J. P. Y. Kao, and I. R. C. Cooke
Gaseous Oxides and Olfactory Computation
Integr. Comp. Biol.,
April 1, 2001;
41(2):
332 - 345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. F. Rast
Nitric oxide induces centrally generated motor patterns in the locust suboesophageal ganglion
J. Exp. Biol.,
January 11, 2001;
204(21):
3789 - 3801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Champlin and J. Truman
Ecdysteroid coordinates optic lobe neurogenesis via a nitric oxide signaling pathway
Development,
January 8, 2000;
127(16):
3543 - 3551.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Daly and B. Smith
Associative olfactory learning in the moth Manduca sexta
J. Exp. Biol.,
January 7, 2000;
203(13):
2025 - 2038.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gelperin, J. Flores, F. Raccuia-Behling, and I.R.C. Cooke
Nitric Oxide and Carbon Monoxide Modulate Oscillations of Olfactory Interneurons in a Terrestrial Mollusk
J Neurophysiol,
January 1, 2000;
83(1):
116 - 127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Simpson, A. Nighorn, and D. B. Morton
Identification of a Novel Guanylyl Cyclase That Is Related to Receptor Guanylyl Cyclases, but Lacks Extracellular and Transmembrane Domains
J. Biol. Chem.,
February 12, 1999;
274(7):
4440 - 4446.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nighorn, K. A. Byrnes, and D. B. Morton
Identification and Characterization of a Novel beta Subunit of Soluble Guanylyl Cyclase That Is Active in the Absence of a Second Subunit and Is Relatively Insensitive to Nitric Oxide
J. Biol. Chem.,
January 22, 1999;
274(4):
2525 - 2531.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Moroz, R Gillette, and J. Sweedler
Single-cell analyses of nitrergic neurons in simple nervous systems
J. Exp. Biol.,
January 2, 1999;
202(4):
333 - 341.
[Abstract]
[PDF]
|
 |
|
|

|