 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 1998, 18(24):10438-10444
UNC-55, an Orphan Nuclear Hormone Receptor, Orchestrates Synaptic
Specificity among Two Classes of Motor Neurons in Caenorhabditis
elegans
H. Mimi
Zhou and
W. W.
Walthall
Department of Biology and Center for Neural Communication and
Computation, Georgia State University, Atlanta, Georgia 30303
 |
ABSTRACT |
Loss of UNC-55 function in the nematode Caenorhabditis
elegans causes one motor neuron class, the ventral D (VD) motor
neurons, to adopt the synaptic pattern of another motor neuron class,
the dorsal D (DD) motor neurons. Here we show that
unc-55 encodes a member of the nuclear hormone receptor
gene family that is similar to the vertebrate chicken ovalbumin
upstream promoter transcription factors. Although the VD and DD motor
neuron classes arise from different lineages at different developmental
stages, they share a number of structural and functional features that
appear to be the product of identical genetic programs. UNC-55 is
expressed in the VD but not the DD motor neurons to modify this genetic program and to create the synaptic pattern that distinguishes the two
motor neuron classes from one another.
Key words:
synaptic specificity; C. elegans; motor
neurons; nuclear hormone receptor; neuromuscular junction; unc-55
 |
INTRODUCTION |
The complexity of synaptic patterns
present in mature nervous systems raises a fundamental question: how
does a finite amount of genetic material create the synaptic diversity
present in even the simplest nervous systems? Several lines of evidence
suggest that the genetic programs are less diverse than would be
predicted by the multitude of synaptic patterns. For example, in the
development of layer 5 neurons in the mammalian cortex, visual and
motor cortical neurons initially extend projections to the same
subcortical regions, including the spinal cord. Subsequently, the
structural and functional differences that distinguish these neurons
emerge because of differential pruning of collateral branches (O'Leary
and Terashima, 1988 ). A conceptually similar example has been reported
in the nematode Caenorhabditis elegans: two sets of
mechanosensory neurons initiate either forward or backward locomotion
by activating different neural circuits based on whether the animal is
touched on the anterior or posterior part of the body (Chalfie and Au,
1989 ). However, the same genetic program regulates the differentiation and function of the two circuits (Way and Chalfie, 1988 ; Xue et al.,
1993 ). In both examples a common genetic program plus features associated with the relative positions of the neurons cause them to
form distinctive synaptic patterns (Chalfie et al., 1983 ; Walthall and
Chalfie, 1988 ). Our goal is to investigate the mechanisms responsible
for modifying the common genetic programs of neurons to create
different synaptic specificities.
The precisely defined sets of nerve and muscle cells responsible for
locomotion in C. elegans allow genetic and cellular
manipulations that provide a unique opportunity for investigating the
generation of specific synaptic patterns. The sinuous forward and
backward locomotion exhibited by C. elegans is produced by
two neural circuits; one dedicated to forward movement and the other
dedicated to backward movement (Chalfie et al., 1985 ). These two
circuits converge on the dorsal and ventral body wall muscles and two
classes of inhibitory motor neurons: 6 dorsal D (DD) motor neurons
(born embryonically) and 13 ventral (VD) motor neurons (born
postembryonically). In adults, the DD and VD motor neurons form a
cross-inhibitory network (Fig.
1A). A common genetic
program is responsible for establishing the cellular morphology
(Hedgecock et al., 1990 ; McIntire et al., 1992 ) and maintaining the
neurotransmitter profile (cholinergic inputs and GABAergic outputs) in
both classes (McIntire et al., 1993a ,b , 1997 ; Jin et al., 1994 ).
However, none of the identified genes influences the synaptic patterns
that distinguish the VD motor neurons from the DD motor neurons.
Mutations in the gene unc-55 (uncoordinated) cause the VD
motor neurons to adopt the synaptic pattern of the DD motor neurons and
result in an asymmetric locomotive pattern when the animals move
backward (Walthall and Plunkett, 1995 ). We report here that
unc-55 encodes a nuclear hormone receptor that is expressed
in the VD motor neurons but not the DD motor neurons to modify a shared
genetic program that produces the synaptic pattern that distinguishes
one from the other.

View larger version (68K):
[in this window]
[in a new window]
|
Figure 1.
Neural circuit alteration and the resulting
uncoordination in unc-55 mutants. A,
Schmetic diagram of the structures of a VD motor neuron and a DD motor
neuron in both a wild-type adult animal and an unc-55
adult mutant. Each VD and DD motor neuron has a ventral cell body
(ovals) and processes in the dorsal and ventral nerve
cords that are connected via a commissure (the direction of information
transfer is indicated by the arrows). In wild-type
adults, the VD motor neuron (black) receives synaptic
input from the dorsal processes of the excitatory motor neurons
(DA, DB) and innervates ventral body wall
muscles. The DD motor neuron (gray) receives
synaptic input from the ventral processes of the excitatory motor
neurons (VA, VB) and innervates dorsal
body wall muscles. In unc-55 adult mutants, the DD and
VD motor neurons both have the DD motor neuron synaptic pattern.
B, The sequence of photographs was taken from video
recordings comparing the behavior of an unc-55
(jd4) mutant with a wild-type and
a rescued animal (jdEx1) after a touch with an
eyelash on the animal's head. The unc-55
(jd4) animal responded by curling
its body from tail to head with the ventral side in the center. The
wild-type and rescued animals responded to this stimulus by moving
backward sinuously. The interval between frames is 0.5 sec. Views are
of the left side of the animals with anterior to the
left.
|
|
 |
MATERIALS AND METHODS |
Strains and growth of C. elegans. The wild-type
strain N2, unc-55 I strains [jd3, jd4, jd9, jd9R
(revertant), jd13, u411, e402, and e1170] and
unc-30 IV (e191) were used. Deficiency strains nDf24 and nDf25 and mutator strains TR679 and RW7000 were used for
mapping and cloning of unc-55. C. elegans for general
studies were grown on nematode growth medium (NGM)-agar plates as
described by Brenner (1974) . Strains for DNA preparations were grown on NGM-agarose plates (0.9% agarose) to avoid contaminants that interfere with restriction enzyme digestion. Large numbers of C. elegans for obtaining RNA were generated by growing strains in
liquid culture. In addition, DNA from a wild-type revertant
(jd9R) obtained from unc-55
(jd9) was examined.
Gene mapping. The unc-55 locus was mapped using
standard genetic techniques. The genetic deficiencies nDf24 and nDf25
both failed to complement the Unc-55 mutant phenotype. However, nDf25 complements Gld-1 (germline-deficient),
whereas nDf24 does not (Jones and Schedl, 1995 ), indicating that the
breakpoint for nDf24 lies to the right of gld-1 and to the
left of unc-55. Three-factor mapping using a
transheterozygote unc-13 (e1091) che-3
(e1124)/unc-55 (e402) placed
unc-55 to the left of che-3.
Molecular biology. Methods published by Sambrook et al.
(1989) were used unless otherwise noted. C. elegans genomic
DNA was isolated following published procedures (Emmons et al., 1979 ). Cosmid DNA was purified using Tip 100 from Qiagen (Chatsworth, CA). DNA
transfer, hybridization, and detection used the Genius System and
followed protocols in the user's guide from Boehringer Mannheim
(Indianapolis, IN).
The 1.8 kb PstI-EcoRI fragment that contains the
upstream regulatory region of unc-55 was cloned from cosmid
ZC579 into pUC 18 to create pJD1.8. pJD1.8 was then modified by the
addition of a SalI site, and the resulting
PstI-SalI fragment was cloned into pPD95.79, a
promoterless green fluorescent protein (gfp) expression vector that was
provided by Andrew Fire (Carnegie Institue) (Chalfie et al., 1994 ).
This construct is referred to as ME2.
RT-PCR. Large numbers of mixed stage animals were grown in
liquid culture in a fermentor (Bioflo III, New Brunswick Scientific). Total RNA was isolated using Trizol reagent from Life Technologies (Gaithersburg, MD) following the included protocol. mRNA was isolated from total RNA using an Oligotex mRNA kit (Qiagen). Approximately 1.5 µg of the isolated mRNA was used in each reverse transcription experiment with 0.5 µg of a 15 mer oligo-dT primer. The transcription reaction proceeded at 42°C for 1 hr with 1× first-strand buffer, 8 mM DTT, 20 U of Rnase inhibitor, 0.8 mM dNTP, 1 µg of nuclease-free BSA, and 20 U of avian myeloblastosis virus
reverse transcriptase. One-twentieth of the reverse-transcribed DNA was
used in each PCR, which was performed under the following conditions in
a Perkin-Elmer (Norwalk, CT) thermal cycler: 94°C for 1 min, 55°C
for 1 min, and 72°C for 3 min, plus cycle elongation of 5 sec for
each cycle for a total 30 cycles using regular Taq
polymerase. RT-PCR products were then checked on a 1.0% agarose gel.
Primers used to identify unc-55 were mm-1R
(ATGGACAGTTCAGTTGTGAAGGAT), TSL-1 (GGTTTAATTACCCAAGTTTGAG), and RT-1
(CTAATTTCTGGAAGGTAGTTG). The unc-55 cDNA was generated by
cloning the RT-PCR product into pGEM-T vector from Promega (Madison,
WI); the identity of the amplified cDNA was verified by sequencing
(automated sequencer; Applied Biosystems, Foster City, CA) and DNA
hybridization with an unc-55 probe labeled with digoxygenin.
Transformation in C. elegans. Injection of cosmid DNAs into
the gonad (germline) of C. elegans followed the procedures
described by Mello et al. (1991) . Cosmid F55D12 (25 µg/ml) was
injected into the gonad of unc-55
(jd4). A rescued (wild-type locomotion) strain
(jdEx1) was obtained from the progeny of the injected
animal, and it carries a heritable extrachromosomal array.
Plasmid ME2 (25 µg/ml), which contains the upstream regulatory region
of unc-55 fused to a gfp reporter, together with plasmid pRF4 (50 µg/ml), a plasmid that contains a C. elegans
dominant rol-6 mutation (su1006) (Kramer
et al., 1990 ), was injected into the gonad of wild-type
unc-55 (N2). Animals with a roller phenotype were isolated
from the F1 generation, and their progeny were examined for gfp
expression. A strain of roller animals that expressed gfp,
jdEx2, was established.
Immunohistochemistry. Animals were processed according to an
immunohistochemistry protocol reported by Walthall and Plunkett (1995) .
The identification of motor neurons in the ventral nerve cord that
expressed an unc-55-gfp reporter construct was determined by
simultaneously staining for gfp and GABA, a neurotransmitter that is
expressed in the ventral nerve cord exclusively in the DD and VD motor
neurons, using indirect immunofluorescence. unc-55-gfp was
detected using a rabbit anti-gfp antibody (purchased from Clontech,
Basingstoke, UK) that was detected with a goat anti-rabbit secondary
antibody conjugated to rhodamine. GABA expression was determined using
a guinea pig anti-GABA primary antibody (purchased from Protos Biotech
Corp., New York, NY) and a goat anti-guinea pig secondary
antibody conjugated to fluorescein isothiocyanate (FITC; Sigma, St.
Louis, MO). Nuclei were stained by adding Hoechst 33258 to the second
of three washes.
Preparations were viewed on a Zeiss (Thornwood, NY) LS 510 laser
scanning confocal microscope. To avoid detection of overlapping excitation, scans for rhodamine and FITC fluorescence were run separately. The image stacks presented in Figure 5 were captured and
collapsed along the z axis. These captured images were
transferred as tagged image files into Adobe (Mountain View, CA)
Photoshop, where they were labeled and printed.
 |
RESULTS |
Molecular cloning of the unc-55 gene
Three-factor mapping with unc-55, che-3, and
gld-1 and deficiency tests identified the genetic interval
on chromosome I that contains unc-55 (Fig.
2A). A 5.4 kb
EcoRI probe made from either of two overlapping cosmids in
this genetic interval, ZC579 and F55D12, revealed a restriction
fragment length polymorphism (RFLP) in three transposon-tagged
unc-55 alleles (jd9, jd13, and
u411) that corresponded to the size of the C. elegans transposon Tc1 (Fig. 2B,C; Collins et
al., 1987 ).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2.
Positional cloning of unc-55.
A, Genetic map of the central right arm of chromosome I
showing the position of unc-55 in relation to flanking
genetic loci. Deficiencies (nDf25 and nDf24) are shown with approximate
breakpoints. B, Contiguous physical map showing the
cosmids between gld-1 and che-3. Line
length is not proportional to cosmid size. Cosmids F55D12 and ZC579,
which show RFLPs in unc-55 alleles, are indicated in
bold face. C, Physical map showing the
location of unc-55 (arrow) in cosmid
F55D12. The fragment shown here has been rotated 180° from cosmid
F55D12 shown in B. Restriction sites for
HindIII (H),
PstI (P), EcoRI
(E), EcoRV
(RV), and SalI
(S) are indicated. The open
triangle indicates the approximate site of a transposon-Tc1
insertion in the unc-55(jd9) allele. D,
Composite summary of the gene structure as determined from cDNA
sequencing. Coding regions are shown in boxes.
Trans-splicing occurs at the 5' end of the transcript to the
22-nucleotide leader SL1 (open box). The putative
polyadenylation signal (AATAAA) is indicated in the 3' end. Regions of
sequence similarity, as described in Results, are shown as
shaded regions superimposed on the gene structure. The
exons encoding the DNA-binding domain are boxed in
black, and the exons encoding the ligand-binding domain
are boxed in gray.
|
|
The cosmid F55D12, which showed RFLPs associated with transposon-tagged
unc-55 alleles, was injected into the gonads of unc-55 (jd4) mutants following the procedures of
Mello et al. (1991) . In transgenic animals backward locomotion was
completely restored (Fig. 1B).
A 1.1 kb full-length cDNA was isolated by RT-PCR (Fig.
2D). Like many C. elegans genes,
unc-55 is trans-spliced at its 5' end to the RNA splice
leader SL1 (Krause and Hirsh, 1987 ). The SL1-derived consensus sequence
was found at the 5' end of the first methionine codon of the
unc-55 cDNA. The methionine codon is actually in the context
(UUUCAGAUG) that matches the 3' splice site consensus sequence UUUCAG/G
(Blumenthal, 1995 ). After trans-splicing, the SL1 is fused directly to
the 5' end of AUG in the unc-55 cDNA and creates a putative
initiator methionine under a consensus sequence (Kozak, 1991 ): the A of
the AUG is defined as position +1, and the position 3 is G, which
comes from the SL1 (Fig. 3). A putative
polyadenylation signal, AAUAAA, is located 560 bp downstream of the
stop codon TAG (Fig. 2D). No alternative mRNAs were
detected by Northern or RT-PCR analyses.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 3.
Nucleotide and predicted protein sequence of the
unc-55 cDNA. Nucleotides are numbered beginning with the
first of the nine nucleotides (small characters)
composing the putative RNA trans-splice leader sequence (SL1). Amino
acids are numbered (in italics) beginning with the first
methionine. The stop codon is marked by an asterisk. The
DNA-binding domain is underlined twice, and the
ligand-binding domain is underlined once. A
triangle indicates the Tc1 insertion site.
|
|
The polymorphic fragments of the three transposon-tagged alleles were
sequenced. Each independently isolated allele had the transposon Tc1
inserted into an identical site of unc-55; this site is a
consensus target site for the Tc1 transposase (Eide and Anderson,
1988 ). The insertion site is located in the exon that encodes the
DNA-binding domain (DBD) of the protein (Fig. 3).
unc-55 encodes a member of the nuclear hormone
receptor superfamily
The 1113 bp unc-55 cDNA encodes a predicted protein of
371 amino acids (Fig. 3). Comparison of the sequence of UNC-55 with other sequences in various databases indicated that UNC-55 belongs to
the superfamily of nuclear hormone receptors and shares particularly high similarity with the chicken ovalbumin upstream promoter
transcription factors (COUP-TFs) and the Drosophila seven-up
receptors (SVPs) (Fig. 4). The COUP-TFs
include the human and mouse apolipoprotein AI regulatory proteins
(ARP-1), which are also known as COUP-TF II (Ladias and Karathanasis,
1991 ), human COUP-TF I (EAR-3 or hCOUP) (Wang et al., 1989 ), and human-
and mouse-related protein EAR-2 (Jonk et al., 1994 ), and the SVPs
include Drosophila steroid receptor seven-up type 1 (SVP-1)
and type 2 (Mlodzik et al., 1990 ) and the zebrafish steroid receptors
seven-up type 46 (SVP46) and type 44 (Fjose et al., 1993 ).

View larger version (102K):
[in this window]
[in a new window]
|
Figure 4.
Alignment of UNC-55 with COUP-TFs/SVP homologs.
Alignment of UNC-55 with human proteins hARP-1 (Ladias and
Karathanasis, 1991 ), hCOUP (Wang et al., 1989 ),
Drosophila SVP-1 (Mlodzik et al., 1990 ) and zebrafish
SVP46 (Fjose et al., 1993 ). The first 58 amino acids of hARP1, first 65 amino acids of hCOUP, first 179 amino acids of SVP-1, and first 33 amino acids and last five amino acids of SVP46 are not included. Three
or four similar amino acids shared among the five proteins are
boxed in gray, and five similar amino
acids shared are boxed in black. The
following amino acids were considered to be similar: D and N; A and G;
E and Q; S and T; K and R; F, Y, and W; and L, I, V, and M. Gaps are
indicated by dashes. The alignment analysis was
performed with the CLUSTAL program. The P box, D box, and
LBD-specific-signature motif are indicated by the bars
above the alignment. The DNA-binding domain and the ligand-binding
domain are underlined twice and once,
respectively.
|
|
Two highly conserved zinc fingers are found near the N terminus of
UNC-55, which based on sequence similarity is the DBD. The DBD contains
two conserved elements: the P box (CEGCK) and the D box (RATKN), which
are reported to be necessary for sequence-specific DNA binding (Umesono
and Evans, 1989 ; Truss and Beato, 1993 ) and dimer formation (Glass,
1994 ), respectively (Fig. 4). A ligand-binding domain (LBD) is located
near the C terminus and contains an LBD-specific signature motif
(LBD-SSM), which is reported to be essential for regulatory function
(Burke et al., 1996 ; Downes et al., 1996 ). Comparison of the amino acid
sequence similarity between UNC-55 and hARP-1 is summarized in Table
1. UNC-55 has extremely high similarity
(91%) with hARP-1 in the DBD especially in the P box (100%). Although
the similarity in the LBD is less (44%), UNC-55 possesses highly
conserved amino acids in the critical LBD-SSM (90%).
Identification of ventral cord motor neurons
expressing unc-55-gfp
The temporal and spatial pattern of expression of the
unc-55-gfp construct was visualized in the transgenic strain
jdEx2 using indirect immunofluorescence visualized using a
confocal microscope (Fig. 5). Analysis of
six worms revealed a consistent staining pattern in which
unc-55-gfp was detected in 2 pairs of neurons in the nerve
ring, ~13 pairs of motor neurons in the ventral nerve cord, and a
pair of cells in the preanal ganglion. We have focused on the
expression in the ventral nerve cord, where we found that unc-55-gfp staining was restricted to the L2 and L3
postembryonic stages and occurred in pairs of cells that were usually
adjacent to one another. To determine whether any of the stained cells were VD or DD motor neurons, we simultaneousy stained for
unc-55-gfp visualized with rhodamine and the
neurotransmitter GABA visualized with FITC. Three populations of
neurons were identified, and specific examples of each are indicated in
Figure 5. Population 1 was unc-55-gfp(+) and GABA(+),
population 2 was unc-55-gfp( ) and GABA(+), and population 3 was unc-55-gfp(+) and GABA( ). Based on the numbers of
neurons in the three classes and the relative positions of the neuron cell bodies visualized with the nuclear stain Hoechst 33258, population 1 corresponds to the VD motor neurons, population 2 corresponds to the
DD motor neurons, and population 3 has been tentatively identified as
the AS motor neurons. The identification of population 3 as AS
is because AS and VD motor neurons are lineal sisters, and as a result
the AS motor neurons are positioned anterior and immediately adjacent
to the VD motor neurons, which is the location of the
unc-55-gfp(+) GABA( ) cell bodies.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 5.
Simultaneous expression of the
neurotransmitter GABA (A) and an
unc-55-gfp reporter (B) in the
nervous system of an L2 Stage C. elegans. 1, Cell bodies
that colocalize GABA and the unc-55-gfp reporter; these
are the VD motor neurons. 2, Locations of cell bodies
that express GABA but not the unc-55-gfp reporter; these
are the DD motor neurons. 3, Locations of cell bodies
that express the unc-55-gfp reporter but not GABA; these
have been identified tentatively as AS motor neurons. Criteria for
motor neuron identification are described in Results. Anterior is to
the left. Scale bar, 20 µm.
|
|
 |
DISCUSSION |
UNC-55 acts at a critical crossroad in the differentiation
of the DD and VD motor neurons. Although the two motor neuron classes are generated by distinct lineages, are born at different developmental stages, and exhibit different synaptic specificities, they share a
number of morphological and biochemical features that are apparently the product of a single genetic program. This genetic program is
initiated in both the DD and VD motor neurons by the expression of
unc-30, which encodes a homeodomain-containing protein that is necessary for the morphological and biochemical differentiation of
the DD and VD motor neurons (McIntire et al., 1993a ,b , 1997 ; Jin et
al., 1994 ). Although the expression of this genetic program explains
the similarities that exist between the DD and VD motor neurons, it
does not explain the synaptic patterns that distinguish the two motor
neuron classes. UNC-55 is necessary for the production of the synaptic
pattern that distinguishes the VD motor neurons from the DD motor
neurons. Furthermore, loss of UNC-55 function causes the VD motor
neurons to assume the synaptic pattern of the DD motor neurons
(Walthall and Plunkett, 1995 ).
UNC-55 is a member of the nuclear hormone receptor superfamily
The amino acid sequence of UNC-55 shows a high degree of
similarity to the COUP-TF family members, which are also known as orphan nuclear hormone receptors because ligands either have not been
identified or possibly do not exist (Fig. 4). Recently, several reports
have described roles for COUP-TFs in neural differentiation in
zebrafish, Drosophila, and mice (Mlodzik et al., 1990 ; Fjose et al., 1993 ; Pereira et al., 1995 ). UNC-55 is currently the only member of the COUP-TF family found in C. elegans. Mutations
in the Drosophila homolog seven-up
(svp) cause photoreceptor cells R1, R3, R4, and R6 to
adopt the fate of R7 cells (Mlodzik et al., 1990 ). This homeotic
transformation in the photoreceptor cells is reminiscent of that of the
VD motor neuron transformation observed in unc-55 mutants.
The COUP-TFs and SVP family members generally act as transcriptional
suppressors (for review, see Mangelsdorf and Evans, 1995 ). This has
been well characterized in SVP, which forms an inactive heterodimer
with the ecdysone receptor. This reduction of functional ecdysone
receptors leads to the activation of an alternative downstream promoter
(Zelhof et al., 1995 ). This repression was recently characterized at
the amino acid sequence level. A specific signature motif
[(F/W)AKXXXXFXXLXXXDQXXLL] is found within the LBD that is critical for the repressor activity (Downes et al., 1996 ). The sequence similarity among UNC-55, mammalian COUP-TFs, and SVP receptors in the LBD is less than that observed in
the DBD. However, UNC-55 does share a number of critical amino acids
with the LBD-specific signature motif (Fig. 4, position 164-181). The
major difference is the number of amino acids between K/R and L (Fig.
4, position 166-172), a region that is predicted to be a loop between
two helices (Bourguet et al., 1995 ). The variation in certain
critical amino acids in the LBD may indicate that the amino acids in
the loop are not important or that UNC-55 represents a new subclass in
the group of COUP-TFs and SVP receptors.
Spatial and temporal expression of an
unc-55-gfp reporter
The analysis of the unc-55-gfp expression in the
ventral nerve cord revealed relatively tight spatial and temporal
regulation. Expression was limited to the VD and probably the AS motor
neurons during the L2 and L3 developmental stages (Fig. 5).
Importantly, no unc-55-gfp staining was observed in the DD
motor neurons during these developmenal stages. The expression of
unc-55-gfp in a second set of ventral cord motor neurons was
unexpected. We have tentatively identified this second class as the AS
motor neurons. Lineally the 12 AS motor neurons are the anterior
sisters of the VD motor neurons (Sulston and Horvitz, 1977 ). Of the
five classes of postembryonic motor neurons, only VD and AS have
processes in the dorsal and ventral nerve cord (White et al., 1986 ). Of
the motor neurons involved in locomotion, the least is known about the
role of the AS motor neurons. Their synaptic inputs and outputs are
very similar to an embryonic class of motor neuron, the DAs. Like the
DAs they are thought to be dorsal excitators involved in backward
movement, but no attempt to analyze their role using genetic or
surgical manipulations has been reported.
The tentative identification of AS motor neurons as expressing
unc-55 impacts on a number of areas regarding the analysis of the uncoordinated phenotype and the role of unc-55 during
development. The ventral coiling phenotype could be explained by a
combination of changes associated with unc-55 mutations: the
reduction of ventral inhibition and the addition of dorsal inhibition
associated with the transformation of the VD motor neurons and the
reduction of dorsal excitation that may result from compromising the AS motor neurons. Whether unc-55 is necessary for the
differentiation and or function of the AS motor neurons remains to be determined.
Synaptic respecification in the DD motor neurons
In newly hatched animals the six embryonic DD motor neurons
receive dorsal input and innervate ventral muscles, a synaptic pattern
that is identical to the adult VD motor neurons. During the molt
between the L1 and L2 stages when the VD motor neurons form their
synapses, the DD motor neurons respecify their synapses and assume
their adult innervation pattern (White et al., 1978 ). Thus both D motor
neuron classes undergo synaptogenesis as the animal completes its first
postembryonic molt, a period when the animal is immobile. This
remodeling of the inhibitory neural circuits resembles the changes in
identified neurons of certain holometabolous insects during
metamorphosis (Levine, 1989 ). The insect molt is regulated by ecdysone,
via the ecdysone receptor, which is also a member of the nuclear
hormone receptor gene family (Koelle et al., 1991 ). The reorganization
of the inhibitory neural circuits coincides with the first molt in
C. elegans. The identification of a nuclear hormone receptor
(UNC-55) that is in the same gene family as a number of
Drosophila receptors that are involved in neural
differentiation and are responsive to ecdysone is particularly intriguing (Tsai and O'Malley, 1994 ; Urness and Thummel, 1995 ) (for
review, see Thummel, 1995 ). Although the hormone that initiates molting
in C. elegans has not been identified, it is conceivable that UNC-55 in the VD motor neurons is activated by a hormone in
conjunction with the molt cycle. Activation of these receptors could
stabilize the synaptic pattern of the VD motor neurons by suppressing a
response to a general (hormonal) signal that instructs the DD motor
neurons to respecify their synaptic pattern and establish ventral
inputs and dorsal outputs. In the absence of UNC-55 the VD motor
neurons respond to the molt signal by default and form a synaptic
pattern that is identical to the DD motor neurons. Specifically, we
propose that activated UNC-55 receptors modify the expression of the
common D motor neuron genetic program so that in the VD motor neurons
proteins targeted for the presynaptic and postsynaptic processes are
not redirected, whereas similar proteins in the DD motor neurons are
redirected, thereby creating the synaptic pattern that distinguishes
the two related classes of motor neurons.
In conclusion, the ability to integrate cellular, genetic, and
molecular approaches with behavior in C. elegans has made it possible to identify and characterize a transcription factor that is
necessary for establishing a synaptic pattern that distinguishes two
functionally related classes of motor neurons from one another. We
expect that the genes regulated by UNC-55 maintain the VD motor neuron
synaptic pattern by establishing the polarity of the VD motor neuron
cytoskeleton. The ubiquitous phylogenetic distribution of members of
the nuclear hormone receptor gene family suggests that this has
continued to be an important strategy for generating synaptic diversity
as nervous systems have become more complex.
 |
FOOTNOTES |
Received Jan. 29, 1998; revised July 6, 1998; accepted Oct. 7, 1998.
This work was supported by the National Science Foundation and a
dissertation grant from the Office of Research and Sponsored Programs
at Georgia State University. Some of the strains used in this work were
supplied by the Caenorhabditis Genetics Center, which is
funded by the National Institutes of Health National Center for
Research Resources. We thank Mark Borodovsky and Xiaowei Lu for help in
computer sequence analysis, Sarah Combs for help in the molecular
cloning, and Andrew Fire and colleagues, who provided the gfp cloning
vector. We are also grateful to Ann Sluder and Guy Benian for
discussions and Sarah Pallas and Vincent Rehder for comments on this manuscript.
Correspondence should be addressed to W. W. Walthall, Department
of Biology, Georgia State University, P.O. Box 4010, Atlanta, GA
30303-4010.
Dr. Zhou's present address: Emory University School of Medicine,
Department of Gynecology and Obstetrics, Atlanta, GA 30322.
 |
REFERENCES |
-
Blumenthal T
(1995)
Trans-splicing and polycistronic transcription in Caenorhabditis elegans.
Trends Genet
11:132-136[Web of Science][Medline].
-
Bourguet W,
Ruff M,
Chambon P,
Gronemeter H,
Moras D
(1995)
Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-a.
Nature
375:377-382[Medline].
-
Brenner S
(1974)
The genetics of Caenorhabditis elegans.
Genetics
77:71-94[Abstract/Free Full Text].
-
Burke L,
Downes M,
Carozzi A,
Giguere V,
Muscat GE
(1996)
Transcriptional repression by the orphan steroid receptor RVR/Rev-erb beta is dependent on the signature motif and helix 5 in the E region: functional evidence for a biological role of RVR in myogenesis.
Nucleic Acids Res
24:3481-3489[Abstract/Free Full Text].
-
Chalfie M,
Au M
(1989)
Genetic control of differentiation of the Caenorhabditis elegans touch receptor neurons.
Science
243:1027-1033[Abstract/Free Full Text].
-
Chalfie M,
Thomson JN,
Sulston JE
(1983)
Induction of neuronal branching in Caenorhabditis elegans.
Science
221:61-63[Abstract/Free Full Text].
-
Chalfie M,
Sulston JE,
White JG,
Southgate E,
Thomson JN,
Brenner S
(1985)
The neurocircuit for touch sensitivity in Caenorhabditis elegans.
J Neurosci
5:956-964[Abstract].
-
Chalfie M,
Tu Y,
Euskirenchen G,
Ward W,
Prasher D
(1994)
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
-
Collins J,
Saari B,
Anderson P
(1987)
Activation of a transposable element in the germ line but not the soma of Caenorhabditis elegans.
Nature
328:726-728[Medline].
-
Downes M,
Burke L,
Muscat GE
(1996)
Transcriptional repression by REv-erbA alpha is dependent on the signature motif and helix 5 in the ligand-binding domain: silencing does not involve an interaction with N-CoR.
Nucleic Acids Res
24:3490-3498[Abstract/Free Full Text].
-
Eide D,
Anderson P
(1988)
Insertion and excision of Caenorhabditis elegans transposable element Tc1.
Mol Cell Biol
8:737-746[Abstract/Free Full Text].
-
Emmons SW,
Klass MR,
Hirsh D
(1979)
Analysis of the constancy of DNA sequences during development and evolution of the nematode Caenorhabditis elegans.
Proc Natl Acad Sci USA
76:1333-1337[Abstract/Free Full Text].
-
Fjose A,
Nornes S,
Weber U,
Mlodzik M
(1993)
Functional conservation of vertebrate seven-up related genes in neurogenesis and eye development.
EMBO J
12:1403-1414[Web of Science][Medline].
-
Glass CK
(1994)
Differential recognition of target genes by nuclear receptor monomers, dimers and heterodimers.
Endocr Rev
15:391-407[Abstract/Free Full Text].
-
Hedgecock E,
Culotti J,
Hall D
(1990)
The unc-5, unc-6, and unc-40 gene guide circumferential migration of pioneer axons and mesodermal cells on the epidermis in C. elegans.
Neuron
2:61-85.
-
Jin YS,
Hoskins R,
Horvitz HR
(1994)
Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein.
Nature
372:780-783[Medline].
-
Jones AR,
Schedl T
(1995)
Mutations in gld-1, a female germ cell-specific tumor suppressor gene in Caenorhabditis elegans, affect a conserved domain also found in Scr-associated protein Sam68.
Genes Dev
9:1491-1504[Abstract/Free Full Text].
-
Jonk LJ,
Jonge ME,
Pals CE,
Wissink S,
Vervaart JM,
Schoorlemmer J,
Fruijer W
(1994)
Cloning and expression during development of three murine members of the COUP family of nuclear orphan receptors.
Mech Dev
48:81-97[Web of Science][Medline].
-
Koelle MR,
Talbot WS,
Segraves WA,
Bender MT,
Cherbas P,
Hogness DS
(1991)
The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily.
Cell
67:59-77[Web of Science][Medline].
-
Kozak M
(1991)
Structural features in eukaryotic mRNAs that modulate the initiation of translation.
J Biol Chem
266:19867-19870[Free Full Text].
-
Kramer JM,
French RP,
Park EC,
Johnson JJ
(1990)
The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology, encodes a collagen.
Mol Cell Biol
10:2081-2089[Abstract/Free Full Text].
-
Krause M,
Hirsh D
(1987)
Trans-spliced leader sequence on actin mRNA in C. elegans.
Cell
49:753-761[Web of Science][Medline].
-
Ladias JA,
Karathanasis SK
(1991)
Regulation of the Apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily.
Science
251:561-565[Abstract/Free Full Text].
-
Levine RB
(1989)
Expansion of the central arborizations of persistent sensory neurons during insect metamorphosis: the role of the steroid hormone, 20-hydroxyecdysone.
J Neurosci
9:1045-1054[Abstract].
-
Mangelsdorf DJ,
Evans RM
(1995)
The RXR heterodimers and orphan receptors.
Cell
83:841-850[Web of Science][Medline].
-
McIntire SL,
Garriga G,
Horvitz R
(1992)
Genes necessary for directed axonal elongation or fasciculation in C. elegans.
Neuron
8:307-322[Web of Science][Medline].
-
McIntire SL,
Jorgensen EM,
Horvitz HR
(1993a)
Genes required for GABA function in Caenorhabditis elegans.
Nature
364:334-337[Medline].
-
McIntire SL,
Jorgensen EM,
Horvitz HR
(1993b)
The GABAergic nervous system of Caenorhabditis elegans.
Nature
364:337-341[Medline].
-
McIntire SL,
Reimer RJ,
Schuske K,
Edwards RH,
Jorgensen EM
(1997)
Identification and characterization of the vesicular GABA transporter.
Nature
389:870-876[Medline].
-
Mello CC,
Kramer JM,
Stinchcomb D,
Ambros V
(1991)
Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences.
EMBO J
10:3959-3970[Web of Science][Medline].
-
Mlodzik M,
Hiromi Y,
Weber U,
Goodman CS,
Rubin GM
(1990)
The Drosophila seven-up gene, a member of the steroid receptor gene superfamily, controls photoreceptor cell fates.
Cell
60:211-224[Web of Science][Medline].
-
O'Leary DD,
Terashima T
(1988)
Cortical axons branch to multiple subcortical tragets by interstitial axon budding: implication for target recognition and "waiting periods."
Neuron
1:901-910[Web of Science][Medline].
-
Pereira FA,
Qiu Y,
Tsai MJ,
Tsai SY
(1995)
Chicken ovalbumin upstream promoter transcription factor (COUP-TF): expression during mouse embryogenesis.
J Steroid Biochem Mol Biol
53:503-508[Web of Science][Medline].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual. Cold Spring Habor, NY: Cold Spring Habor Laboratory.
-
Sulston J,
Horvitz HR
(1977)
Postembryonic cell lineages of the nematode Caenorhabditis elegans.
Dev Biol
56:110-156[Web of Science][Medline].
-
Thummel CS
(1995)
From embryogenesis to metamorphosis: the regulation and function of Drosophila nuclear receptor superfamily members.
Cell
83:871-877[Web of Science][Medline].
-
Truss M,
Beato M
(1993)
Steroid hormone receptors: interaction with DNA and transcription factors.
Endocr Rev
14:459-479[Abstract/Free Full Text].
-
Tsai MJ,
O'Malley BW
(1994)
Molecular mechanisms of action of steroid/thyroid receptor superfamily members.
Annu Rev Biochem
63:451-486[Web of Science][Medline].
-
Umesono K,
Evans RM
(1989)
Determinants of target gene specificity for steroid/thyroid hormone receptors.
Cell
57:1139-1146[Web of Science][Medline].
-
Urness LD,
Thummel CS
(1995)
Molecular analysis of a steroid-induced regulatory hierarchy: the Drosophila E74A protein directly regulates L71-6 transcriptions.
EMBO J
14:6239-6246[Web of Science][Medline].
-
Walthall WW,
Chalfie M
(1988)
Cell-cell interactions in the guidance of late-developing neurons in Caenorhabditis elegans.
Science
239:643-645[Abstract/Free Full Text].
-
Walthall WW,
Plunkett JA
(1995)
Genetic transformation of the synaptic pattern of a motoneuron class in Caenorhabditis elegans.
J Neurosci
15:1035-1043[Abstract].
-
Wang LH,
Tsai SY,
Cook RG,
Beattie WG,
Tsai MJ,
O'Malley BW
(1989)
COUP transcription factor is a member of the steroid receptor superfamily.
Nature
340:163-166[Medline].
-
Way JC,
Chalfie M
(1988)
mec-3, a homeobox containing gene that specifies differentiation of the touch receptor neurons in C. elegans.
Cell
54:5-16[Web of Science][Medline].
-
White JG,
Alberston DG,
Anness MAR
(1978)
Connectivity changes in a class of motoneuron during the development of a nematode.
Nature
271:764-766[Medline].
-
White JG,
Southgate E,
Thomson JN,
Brenner S
(1986)
The structure of the nervous system of the nematode Caenorhabditis elegans.
Philos Trans R Soc Lond B Biol Sci
314:1-340.
-
Xue D,
Tu Y,
Chalfie M
(1993)
Cooperative interactions between the Caenorhabditis elegans homeoproteins UNC-86 and MEC-3.
Science
261:1324-1328[Abstract/Free Full Text].
-
Zelhof AC,
Yao T,
Evans RM,
McKeown M
(1995)
Seven-up inhibits ultraspiracle-based signaling pathways in vitro and in vivo.
Mol Cell Biol
15:6736-6745[Abstract].
Copyright © 1998 Society for Neuroscience 0270-6474/98/182410438-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
R. Jovelin
Rapid Sequence Evolution of Transcription Factors Controlling Neuron Differentiation in Caenorhabditis
Mol. Biol. Evol.,
October 1, 2009;
26(10):
2373 - 2386.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Melkman and P. Sengupta
Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1
Development,
April 15, 2005;
132(8):
1935 - 1949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Novillo, S.-J. Won, C. Li, and I. P. Callard
Changes in Nuclear Receptor and Vitellogenin Gene Expression in Response to Steroids and Heavy Metal in Caenorhabditis elegans
Integr. Comp. Biol.,
January 1, 2005;
45(1):
61 - 71.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Aurelio, T. Boulin, and O. Hobert
Identification of spatial and temporal cues that regulate postembryonic expression of axon maintenance factors in the C. elegans ventral nerve cord
Development,
February 1, 2003;
130(3):
599 - 610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kostrouchova, M. Krause, Z. Kostrouch, and J. E. Rall
Nuclear hormone receptor CHR3 is a critical regulator of all four larval molts of the nematode Caenorhabditis elegans
PNAS,
June 19, 2001;
98(13):
7360 - 7365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Vogel and E. Hedgecock
Hemicentin, a conserved extracellular member of the immunoglobulin superfamily, organizes epithelial and other cell attachments into oriented line-shaped junctions
Development,
January 3, 2001;
128(6):
883 - 894.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
O Hobert, K Tessmar, and G Ruvkun
The Caenorhabditis elegans lim-6 LIM homeobox gene regulates neurite outgrowth and function of particular GABAergic neurons
Development,
January 4, 1999;
126(7):
1547 - 1562.
[Abstract]
[PDF]
|
 |
|
|

|