 |
 Previous Article | Next Article 
The Journal of Neuroscience, February 1, 1998, 18(3):811-820
Functional Analysis of the Rat I Sodium Channel in
Xenopus Oocytes
Raymond D.
Smith and
Alan L.
Goldin
Department of Microbiology and Molecular Genetics, University of
California, Irvine, California 92697-4025
 |
ABSTRACT |
Voltage-gated sodium channels in the mammalian CNS initiate and
propagate action potentials when excitatory inputs achieve threshold
membrane depolarization. There are multiple sodium channel isoforms
expressed in rat brain (types I, II, III, 6, and NaG). We have
constructed a full-length cDNA clone encoding type I and compared the
electrophysiological properties of type I (Rat1) and II (Rat2) channels
in the absence and presence of the two accessory subunits
 1 and 2. Injection into
Xenopus oocytes of RNA encoding Rat1 resulted in functional
sodium currents that were blocked by tetrodotoxin, with
Kapp = 9.6 nM. Rat1 sodium channels
had a slower time course of fast inactivation than Rat2. Coexpression
of 1 accelerated inactivation of both Rat1 and Rat2, resulting in comparable inactivation kinetics. Rat1 recovered from fast
inactivation more rapidly than Rat2, regardless of whether 1 or 2 was present. The voltage
dependence of activation was similar for Rat1 and Rat2 without the subunits, but it was more positive for Rat1 when 1 and
2 were coexpressed. The voltage dependence of
inactivation was more positive for Rat1 than for Rat2, and coexpression
with 1 and 2 accentuated that difference. Finally, sodium current amplitudes were reduced by 7-9% for both Rat1
and Rat2 channels when protein kinase A phosphorylation was induced. It
has been suggested previously that Rat1 and Rat6 channels mediate
transient and maintained sodium conductances, respectively, in Purkinje
cells, and the electrophysiological properties of Rat1 currents are
consistent with a role for this channel in mediating the rapidly
inactivating, transient current.
Key words:
sodium channel; cloning; expression; Xenopus
oocytes; brain; RT-PCR; protein kinase A; Purkinje cells
| |
INTRODUCTION |
Various sodium channel
isoforms have been detected by molecular cloning, biochemical
purification, and electrophysiological recording (for review, see
Goldin, 1995 ). Multiple isoforms have been identified in the rat CNS,
including types I (Rat1) (Noda et al., 1986a), II (Rat2) (Noda et al.,
1986a) and a splice variant termed Rat2A (Auld et al., 1988), III
(Rat3) (Kayano et al., 1988; Joho et al., 1990), 6 (Rat6) (Schaller et
al., 1995) and the species variant Scn8a (Burgess et al., 1995), and a
partial cDNA sequence for NaG (Gautron et al., 1992). In addition to
the pore-forming  subunit of the sodium channel, there are two
accessory subunits termed 1 and 2
(Hartshorne and Catterall, 1984). The 1 subunit modulates channel function by accelerating the kinetics of inactivation and shifting its voltage dependence in the hyperpolarizing direction (Isom et al., 1992). The 2 subunit is covalently bound
to the subunit, and it accelerates inactivation slightly (Isom et
al., 1995).
The sodium channel isoforms in the CNS are present at different
times during development and in different locations. Rat1 becomes
detectable shortly after birth and increases until adulthood, Rat2
becomes detectable during embryonic development and reaches maximal
levels during adulthood, Rat3 peaks at birth and becomes undetectable
by adulthood (Beckh et al., 1989), and Rat6 peaks during late embryonic
and early postnatal periods (Felts et al., 1997) but is also present at
high levels during adulthood (Schaller et al., 1995). Levels of Rat2
are highest in the rostral regions of the CNS, Rat1 is the predominant
channel in the caudal regions and the spinal cord (Gordon et al., 1987;
Beckh et al., 1989), and there is no rostral-caudal gradient of Rat6
mRNA (Schaller et al., 1995). In the cerebellum, Rat1 is detectable in
Purkinje cells but not in granule cells, Rat2 is expressed in both
Purkinje (Black et al., 1994) and granule cells (Furuyama et al.,
1993), and Rat6 is expressed predominantly in granule cells (Schaller et al., 1995). Rat1 is localized in the soma of neurons in various CNS
regions, including the hippocampus, cerebellum, and spinal cord,
whereas Rat2 is axonal in distribution (Westenbroek et al., 1989).
Because there are multiple sodium channel isoforms in the mature
brain, it is conceivable that each has a distinct role in determining
electrical excitability. For example, Rat1 and Rat6 channels have been
predicted to mediate transient and maintained sodium conductances,
respectively, in Purkinje cells (Vega-Saenz de Miera et al., 1997).
By examining the functional properties of the different sodium channel
isoforms, it should be possible to gain a better understanding of how
each isoform affects electrical excitability. The properties of the
Rat2 (Auld et al., 1988) and Rat3 (Joho et al., 1990) sodium channels
have been extensively characterized, but neither the Rat1 nor Rat6
channels have been expressed in an exogenous system. Attempts to
characterize the properties of the original Rat1 clone in
Xenopus oocytes were unsuccessful (Noda et al., 1986a), and that clone has not been available for study. We therefore constructed a
full-length clone encoding Rat1 and compared the functional properties
of Rat1 and Rat2 channels in the absence and presence of
1 and 2 subunits.
| |
MATERIALS AND METHODS |
Isolation of rat brain RNA. Total rat brain RNA was
isolated from 15 to 18-d-old rats by a modified lithium chloride/urea procedure (Dierks et al., 1981). RNA was suspended in sterile, RNase-free water at a concentration of 1 mg/ml and stored at
 75°C.
Reverse transcription and PCR. The Rat1 coding region was
amplified from total rat brain RNA by reverse transcription followed by
PCR (RT-PCR) in two fragments, with the middle boundary defined by the
unique Sphl site in the coding region. Primers for reverse transcriptase and PCR were designed based on the published sequence (Noda et al., 1986b). The four primers used were (A) 5 end primer: 5-GGCCATAT(GCGGCCGC)ATCAGGAATCTCACATGAAG-3; (B) primer upstream of
Sphl (5): 5-CTGGTGCTGGCCATCATCG-3; (C) primer downstream of Sphl
(3): 5-GCAGTCAGTGGCAATTTTGC-3; and (D) 3 end primer: 5-GGCCATAT(GCGGCCGC)AGTCCTTTGA CTTCACAGG-3. Each of the outer 5
and 3 primers contains a four-base G-C clamp and an extra four
nucleotides to promote efficient cutting at the Notl sites (indicated
in parentheses).
Total brain RNA (2 µg) was heat-denatured at 65°C for 5 min,
followed by rapid cooling on ice. RT was performed with 0.5 mM deoxynucleotide triphosphates, 10 mM
dithiothreitol, 100 pmol of oligonucleotide primers (C and D), 40 U
RNasin (Promega, Madison, WI), and 500 U M-MLV reverse transcriptase
(Life Technologies, Gaithersburg, MD) in a total volume of 50 µl.
Reactions were incubated at room temperature for 5 min and then at
37°C for 2 hr. Reaction products were purified by phenol/chloroform
extraction and ethanol precipitation and were resuspended in 10 µl of
distilled water.
The two RT products were amplified using the primer pairs A-C (amino
terminal portion of Rat1) and B-D (carboxy portion of Rat1). The RT
product was combined with 2.5 mM MgCl2,
200 µmol deoxynucleotide triphosphates, 0.2 µM of each
primer, and 2.5 U LA Taq Polymerase (PanVera, Madison, WI). Thermal
cycle parameters for A-C primer amplification were one cycle
consisting of denaturation at 95°C for 4 min, annealing at 50°C for
3 min, and polymerase extension at 72°C for 6 min, followed by 30 cycles consisting of denaturation at 95°C for 30 sec, annealing at
50°C for 1 min, and polymerase extension at 72°C for 6 min.
Parameters for B-D amplification were the same except that annealing
steps were at 55°C. These conditions resulted in two PCR fragments of
size 3429 and 2851 bp for primer pairs B-D and A-C, respectively.
These fragments were extracted with phenol/chloroform, precipitated with ethanol, and resuspended in distilled water before digestion with
the appropriate restriction enzymes.
Construction of full-length Rat1 cDNA. The full-length cDNA
for Rat1 was constructed by making a series of Rat1-Rat2 chimeras and
then combining Rat1 sequences. Chimeras were constructed using AatII
and SphI restriction sites that are common to both channels. The B-D
PCR product (carboxy end of Rat1) was cloned into the corresponding
region of Rat2 using SphI and NotI restriction sites to generate a
chimeric Rat2-1 channel (written Rat2211, with each number
corresponding to approximately one domain of the channel). This chimera
expressed sodium current in oocytes (data not shown).
A Rat1-2 chimera (Rat1122) was constructed by ligation of the Rat1
amino terminal PCR product A-C (NotI-SphI) with the complementary Rat2 SphI-NotI fragment into the NotI site of pLCT1, a modified version of pBSTA (Goldin, 1991) that contains the gene for tetracycline resistance and an origin of replication from the plasmid pACYC184. An
isolate was obtained that contained Rat1 sequence positioned downstream
from the T3 promoter; however, RNA transcribed by T3 RNA polymerase did
not express sodium current in oocytes. To transfer additional Rat1
sequence into Rat2211, the AatII-SphI region from Rat1 22
(domain 2) was incorporated to yield a Rat211 chimera. This
chimera did express sodium current in oocytes.
We reasoned that the lack of expression by the Rat1122 construct was
most likely attributable to three extra ATG start codons that followed
the T3 promoter but were upstream and in a different reading frame than
the authentic start codon. Therefore, the 5 region was modified by a
secondary round of PCR to exclude the three extra start codons and to
attach an XhoI site at the 5 end for subsequent ligation into the XhoI
site in Rat2. The modification was accomplished using a new 5 primer
[GCGCGC(CTCGAG)TGACAAGATGGAGCAAAC (XhoI site in parentheses)] and a
new primer downstream from the AatII restriction site
CACACTGAGACAGAACACGG. The second round of PCR was performed using 2 ng
of Rat1122 plasmid DNA, 20 µM deoxynucleotide
triphosphates, 1 µM each primer, and 2.5 U Pfu DNA
polymerase (Stratagene, La Jolla, CA). Thermal cycling parameters were
as described for the initial RT-PCR, except that the annealing temperature was 57°C. The secondary PCR product (801 bp) was cut with
XhoI and AatII and ligated into the corresponding sites in Rat2111 to
construct the full-length Rat1 sequence (Rat111). Expression of
sodium current was observed in oocytes after injection of RNA
transcribed from this clone.
The sequence of the entire coding region was determined using the
dideoxy chain termination method and the Taq dye terminator cycle
sequencing kit with an Applied Biosystems sequencer Model 373 Stretch
(Applied Biosystems). To increase the level of expression in oocytes,
the Rat1 coding region was inserted into the BgIII site of pLCT1, which
resulted in the 5 and 3 noncoding regions from the Xenopus
-globin gene being positioned on either side of the Rat1 coding
region and a poly-A tail at the 3 end of the insert. The Rat1 coding
region was inserted into pLCT1 by cutting it with XhoI and NotI,
followed by generation of blunt ends with Klenow DNA polymerase,
attachment of BgIII linkers, and ligation into the BgIII site of
pLCT1.
Complementary DNA clones encoding the 1 subunit (Isom et
al., 1992) and 2 subunit (Isom et al., 1995) were
isolated from total rat brain RNA by RT-PCR, using published sequence
information to design the following primers:
1(5)-TCGAGATCTATGGGGACGCTGCT; 1(3)GCCAGATCTATTCAGCCACCTGG;
2(5)-GCATCGATGGCCTGAAAATGCACAGGGATGC; and
2(3)-GCATCGATGGATCCGGACACAGGAAGGGGCTTC. RT and PCR
conditions were similar to those used for Rat1, except that annealing
temperatures were adjusted to 5°C below the melting temperature of
each primer pair.
Expression and electrophysiology. RNA transcripts were
synthesized from NotI linearized DNA templates using a T7 RNA
polymerase Message Machine transcription kit (Ambion, Austin, TX). The
yield of RNA was estimated by glyoxal gel analysis. Stage V oocytes were removed from adult female Xenopus laevis frogs and
prepared as described previously (Goldin, 1991), and incubated in ND-96 media, which consists of (in mM) 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, pH
7.5, supplemented with 0.1 mg/ml gentamicin, 0.55 mg/ml pyruvate, and
0.5 mM theophylline. Rat2 sodium channel RNA was injected
at 100 pg/oocyte, and Rat1 RNA was injected at 50 ng/oocyte. The
oocytes were incubated for 40 hr at 20°C in ND-96.
Sodium currents were recorded using the cut-open oocyte technique
(Taglialatela et al., 1992) with the CA-1 high performance oocyte
voltage clamp (Dagan, Minneapolis, MN) and Digidata 1200A interface
(Axon Instruments, Foster City, CA) and pCLAMP 6.0.3 software (Axon
Instruments), as described previously (Kontis et al., 1997).
Temperature was maintained at 20°C using an HCC-100A temperature
controller (Dagan). The intracellular solution consisted of (in
mM) 88 K2SO4, 10 EGTA, 10 HEPES, 10 Na2SO4, pH 7.5, and the
extracellular solution consisted of (in mM) 120 sodium MES, 10 HEPES, and 1.8 Ca-Cs, pH 7.4. Capacitive transients and leak currents were corrected by P/4 subtraction. Sodium current amplitudes were between 1 and 5 µA.
For analysis of recovery from inactivation and modulation by protein
kinase A (PKA), a two-electrode voltage clamp was used at room
temperature as described previously (Patton and Goldin, 1991). Although
this voltage clamp does not provide the fast time resolution of the
cut-open oocyte clamp, the oocytes are more stable over long periods of
time, which was essential for analyzing these two channel properties.
Capacitive and leak currents were eliminated from the recovery from
inactivation records by subtraction of comparable records obtained in
the presence of 400 nM tetrodotoxin, and from the PKA
modulation records by P/4 subtraction. The bath solution consisted of
ND-96. Oocytes were clamped at 100 mV for 5-10 min before recording
to allow for recovery from slow inactivation. After steady-state
current levels were established for 10 min, PKA was induced by
perfusing oocytes with a mixture consisting of 25 µM
forskolin, 10 µM chlorophenylthio-cAMP (cpt-cAMP), 10 µM dibutyryl-cAMP (db-cAMP), and 10 µM
3-isobutyl-1-methylxanthine (IBMX) for 10 min. We have shown previously
that this mixture reduces Rat2 sodium currents by activation of PKA
(Smith and Goldin, 1997). The rate of bath perfusion was carefully
adjusted to 0.3 ml/min to minimize fluctuations in current amplitude
resulting from changes in flow rate. Sodium current amplitudes were
measured every 60 seconds during depolarizations to 10 mV from a
holding potential of 100 mV.
Data analysis. Analysis was performed using pCLAMP 6.0.3 software (Axon Instruments), Excel 7.0 (Microsoft, Redmond, WA), and
Sigmaplot 4.0 (Jandel, San Rafael, CA). Inactivation time constants
were determined using the Chebyshev method to fit current traces with a
single exponential equation: I = Aslow
· exp[(t K)/ slow] + C, or a double exponential equation: I = Afast · exp[(t K)/fast] + Aslow
· exp[(t K)/slow] + C, where I is the current,
Afast and Aslow represent
the percentage of channels inactivating with time constants
fast and slow, K is the
time shift, and C is the steady-state asymptote. The time
shift was manually selected by fitting the traces at the time when the
currents were just starting to decrease exponentially. Recovery data
were fit using a double or triple exponential equation of the form I = 1 [A1 · exp(t/1) + A2 · exp(t/2)] and I = 1 [A1 · exp(t/1) + A2 · exp(t/2) + A3 · (t/3)], where
A1, A2, and A3 are the relative proportions of current
recovering with time constants 1,
2, and 3, and t
is the recovery interval.
Conductance values were calculated using the formula G = I/(V Vr), where G is
conductance, I is current amplitude, V is the
depolarized membrane potential, and Vr is the
reversal potential. Reversal potentials were individually estimated for
each data set by fitting the I-V data with the equation
I = [1 + exp(0.03937 · z · (V V1/2))] 1 · g
· (V Vr), where z is the
apparent gating charge, g is a factor related to the number
of channels contributing to the macroscopic current, V is
equal to the voltage potential of the pulse, and V1/2 is the half-maximal voltage. Conductance
values were fit with a two-state Boltzmann equation, G = 1/(1 + exp[0.03937 · z · (V V1/2)]), with z equal to the
apparent gating charge, V equal to the pulse potential, and
V1/2 equal to the voltage required for
half-maximal activation. The voltage dependence of fast inactivation
data was fit with a two-state Boltzmann equation, I = 1/(1 + exp[(V V1/2)/a]),
with I equal to the current amplitude measured during the
test depolarization, V equal to the inactivating depolarization potential, a equal to the slope factor, and
V1/2 equal to the voltage depolarization
required for half-maximal inactivation. For analysis of current after
PKA induction, there was drift in the peak current amplitude in some
cases, even after allowing for recovery from slow inactivation. In
those cases, the peak current measurements were adjusted by subtracting
a linear relationship that was fit to data acquired during the first 10 min before PKA stimulation.
| |
RESULTS |
Construction of a full-length cDNA clone encoding the Rat1
sodium channel
The type I rat brain sodium channel sequence (Rat1) was amplified
by RT-PCR from total rat brain RNA using primers based on the
previously published sequence (Noda et al., 1986a). The continuous, full-length cDNA containing the coding region was sequenced to determine the predicted amino acid sequence. The sequence of this clone
is similar to that of the previously published Rat1 sequence (Noda et
al., 1986a). The two sequences differ at only 11 nucleotide positions.
Most of these differences are silent, so that there are only four amino
acid differences, which are represented by the circled residues in
Figure 1. The amino acid indicated within each circle is the residue present in the clone that we have
constructed, and the amino acid indicated in parentheses is present in
the clone isolated by Noda et al. (1986a). Three of the differences are
located in putative cytoplasmic regions of the channel (R97K, G427E,
and V1823M), and two of these (R97K and V1823M) are conservative changes. The final difference (G979R) is a nonconservative change in
the S6 transmembrane region of domain II.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
Diagram of the Rat1 sodium channel. The predicted
transmembrane topology of the voltage-gated sodium channel consists of
four homologous domains (I-IV), each composed of eight transmembrane segments. The linkers connecting the four domains and the amino and C
termini are on the inside of the membrane. The four amino acids that
differ between the cDNA clone described in this paper (circled) and the cDNA clone originally isolated by Noda et
al. (1986a) (parentheses) are indicated. The five
consensus PKA sites in the I-II linker are depicted by solid
circles.
|
|
Functional expression of Rat1 sodium channels and modulation by
1 and 2
RNA encoding the Rat1 sodium channel was transcribed in
vitro and injected into Xenopus oocytes, which resulted
in significant levels of sodium current. The Rat1 current was sensitive
to tetrodotoxin, with a Kapp = 9.6 ± 3.2 nM, similar to the value obtained for Rat2 currents in this
study (8.8 ± 4.0 nM). Sodium currents were recorded
using a cut-open oocyte voltage clamp, and the properties of Rat1 were
compared with those of Rat2 (Fig. 2).
Both channel isoforms were tested by injection of RNA encoding the subunit alone, + 1 subunits, + 2
subunits, and + 1 + 2 subunits. Sodium currents were elicited by depolarizations ranging from 65 to
+25 mV in 10 mV increments from a holding potential of 100 mV. To
obtain comparable levels of current for the two channels, a 500-fold
greater amount of Rat1 RNA was injected. The properties of both Rat1
and Rat2 were modulated by 1, most notably
resulting in an accelerated time course of fast inactivation (Fig.
2B). The 2 subunit resulted in a slight
acceleration of inactivation that was more pronounced for Rat1 (Fig.
2C). The combination of 1 and
2 resulted in kinetics of inactivation that were similar to those observed when just 1 was added to either subunit (Fig. 2D). The effects of 1 and
2 on Rat2 are consistent with previous studies (Isom et
al., 1992, 1995; Patton et al., 1994).
View larger version (19K):
[in this window]
[in a new window]
|
Figure 2.
Representative Rat1 and Rat2 sodium channel
currents. Rat1 and Rat2 sodium currents are compared for (A)
subunits alone, (B) + 1 subunits,
(C) + 2 subunits, and (D) + 1 + 2 subunits. Rat1 and Rat2 sodium
channels were expressed in Xenopus oocytes, and currents
were recorded using a cut-open oocyte voltage clamp at 20°C as
described in Materials and Methods. Currents were elicited by membrane
depolarizations ranging from 65 to +25 mV in 10 mV increments from a
holding potential of 100 mV. Calibration: 10 msec, 0.5 µA.
|
|
Rat1 sodium channels inactivate more slowly than Rat2 channels
In the absence of 1 and 2,
the Rat1 currents demonstrated a slower time course of fast
inactivation than did the Rat2 currents (Fig. 2A). To
quantify the differences, the time constants for inactivation were
determined by fitting the current traces with single and double
exponential equations, as described in Materials and Methods (Fig.
3A). For depolarizations
between 30 and 0 mV, current traces were fit with a single
exponential equation, resulting in one time constant of inactivation
(slow, squares). For depolarizations between +10 mV and +50 mV, current traces were best fit with a double
exponential equation, resulting in two time constants
(fast, circles, and
slow, squares). The time constants for
both components of inactivation were significantly greater for Rat1
(filled symbols) than for Rat2 (open
symbols). The fraction of current represented by
fast is indicated in the bottom panel of Figure 3. The
fraction represented by fast is 0 between 30 mV and 0 mV, because those traces were fit with a single exponential equation
representing the slow time constant. Between +10 mV and +50 mV, the
fast component of inactivation became increasingly prominent, as
indicated by the fraction of current that was fit with
fast. At depolarizations equal to or greater than +20
mV, both channel isoforms demonstrated approximately equal fractions of
the fast and slow components.
View larger version (37K):
[in this window]
[in a new window]
|
Figure 3.
Time constants for fast inactivation of Rat1 and
Rat2 sodium channels. Currents were recorded from oocytes expressing
Rat1 or Rat2 sodium channels as described in the legend to Figure 2. The kinetics of inactivation were fit with single or double exponential equations as described in Materials and Methods, and the time constants
representing the fast and slow components are shown on a logarithmic
scale in the top panels for (A) subunits
alone, (B) + 1 subunits, (C)
+ 2 subunits, and (D) + 1 + 2 subunits. The fast component
(fast) is represented by circles, and
the slow component (slow) is represented by
squares. Solid symbols indicate Rat1 ( ,  ),
and open symbols indicate Rat2 ( ,  ). The fraction of
current inactivating with fast is shown in the
bottom panels. Solid bars indicate Rat1, and
open bars indicate Rat2. In all cases, the fraction of
fast plus the fraction of slow equals 1. Values represent averages, and error bars indicate SDs. Sample sizes
were Rat1 (7), Rat2 (9), Rat1 + 1 (5), Rat2
+ 1 (7), Rat1 + 2 (6), Rat2 + 2 (5), Rat1 + 1 + 2
(7), and Rat2 + 1 + 2 (6).
|
|
When Rat1 and Rat2 were coexpressed with the 1
subunit, sodium current traces were best fit with two exponential
equations over the entire range of depolarizations (Fig.
3B). The principal effect of 1 for both
channels was to accelerate the fast component of inactivation, as has
been shown previously to be the case for Rat2 (Isom et al., 1992;
Patton et al., 1994). The 1 subunit had a somewhat
greater effect on Rat1 currents, so that fast values for
both channel isoforms were comparable in the presence of
1. In addition, 1 caused the fast
component to predominate for both Rat1 and Rat2 throughout the entire
range of depolarizations tested (Fig. 3B, bottom
panel). The effect of 1 on
slow was to cause a considerable reduction for Rat1 and
a slight reduction for Rat2, so that the time constants in the presence
of 1 were comparable. Therefore, 1 caused
both channel isoforms to be functionally equivalent with respect to
fast and slow.
When Rat1 and Rat2 were coexpressed with the 2 subunit,
the kinetics were best fit with a single exponential
(slow) between 30 and 0 mV, and two
exponentials between +10 and +50 mV (Fig. 3C). These results
were similar to those observed when the subunits were expressed
alone, with one notable difference. The kinetics of inactivation for
the Rat1 channel were accelerated significantly, and there was only a
minimal effect on the Rat2 channel. Therefore, the kinetics of
inactivation were comparable for Rat1 and Rat2 in the presence of the
2 subunit.
Coexpression of 1 and 2 produced a modest
increase in slow compared with 1 alone
over a range of depolarizations for Rat1 (Fig. 3D). In
addition, a smaller fraction of Rat1 channels inactivated with the fast
component at more negative depolarizations. Most notably, the fraction
of fast at 30 mV was only 25%, but that fraction
increased to 80% by 10 mV (Fig. 3D, bottom
panel). The combination of 1 and
2 resulted in inactivation kinetics of Rat2 that were
comparable to those observed in the presence of 1
alone.
Recovery from inactivation is faster for Rat1 compared with Rat2
sodium channels
Because Rat1 differed from Rat2 with respect to the kinetics
of entry into the inactivated state, it was likely that the two channels would also differ with respect to the kinetics of recovery from inactivation. We therefore examined the kinetics of recovery from
inactivation of Rat1 and Rat2 sodium channels. A two-pulse protocol was
used to measure recovery over a time interval of 1-3000 msec, as
described in the legend to Figure 4. The
kinetics of recovery for Rat1 and Rat2 without subunits are shown
on a log scale in Figure 4A. Recovery is a multicomponent
process for both channels, as can be seen by the multiple slopes of the curves. The kinetics were fit with a triple exponential equation as
described in Materials and Methods, and the values for the time
constants are shown in Table 1. The time
constants for all three components of recovery are smaller for Rat1
than for Rat2, although this is somewhat offset by the fact that a
greater percentage of Rat1 current recovered with the slowest time
constant (3). In general, however, Rat1 recovered
from inactivation more rapidly than Rat2.
View larger version (29K):
[in this window]
[in a new window]
|
Figure 4.
Recovery from fast inactivation of Rat1 and Rat2
sodium currents. Recovery from inactivation was measured using a
two-pulse protocol consisting of an initial conditioning pulse to 10
mV for 50 msec (which inactivated >95% of the channels), a variable recovery interval, and a test pulse to 10 mV to measure the amount of
current that had recovered. Fractional recovery was calculated by
dividing the current amplitude during the test pulse by the amplitude
measured during the corresponding conditioning pulse. Fractional
recovery is plotted on a log scale as a function of recovery time for
(A) subunits alone, (B) + 1 subunits, (C) + 2
subunits, and (D) + 1 + 2
subunits. Data for Rat1 are indicated by solid circles, and
data for Rat2 are indicated by open circles. Values
represent averages, and error bars indicate SDs. The data were fit with
a double or triple exponential equation as described in Materials and
Methods, and the parameters of the fits are shown in Table 1. Sample
sizes were Rat1 (4), Rat2 (5), Rat1 + 1 (3),
Rat2 + 1 (4), Rat1 + 2 (5), Rat2 + 2 (3), Rat1 + 1 + 2 (4), and Rat2 + 1 + 2 (5).
|
|
When the 1 subunit was coexpressed with the subunits, recovery from inactivation was faster for both Rat1 and Rat2,
with Rat1 recovering more quickly than Rat2 at short recovery times (Fig. 4B). The faster recovery resulted from three effects
of 1. First, >80% of the current recovered with the
fast time constant. Second, both 1 and 2
were decreased for both channels. Third, the very long time constant
(3) was minimal or nonexistent. Coexpression of
just 2 with the subunits resulted in recovery
kinetics that were similar to those observed for the subunits
alone, except that the fast time constant (1) was
decreased for both Rat1 and Rat2 (Fig. 4C, Table 1). When
both 1 and 2 were coexpressed with the
subunits, recovery was similar to that observed with just and
1, in that most of the current recovered from
inactivation with the fast time constant (Fig. 4D, Table
1).
The voltage dependence of activation and inactivation is more
positive for Rat1 than for Rat2 sodium channels
The effects of sodium channels on electrical excitability of a
neuron depend on both the kinetics and voltage dependence of sodium
channel activation and inactivation. We therefore compared the voltage
dependence of activation and inactivation for the Rat1 and Rat2
channels to determine whether there were any differences in these
properties (Fig. 5). The curves were fit
with two-state Boltzmann equations as described in Materials and
Methods, and the parameters of the fits are shown in Table 1. When the
subunits were expressed alone, there were no significant
differences in the voltage dependence of conductance between Rat1 (Fig.
5A, filled circles) and Rat2 (Fig. 5A,
open circles). When 1 was coexpressed with
the subunits, the conductance curves for the two channel isoforms
were still similar, although the voltage for half-maximal activation
(V1/2) for Rat2 was shifted slightly in
the negative direction, although not to a statistically significant
extent (Fig. 5B, Table 1). Coexpression of the
2 subunit with the subunits did not significantly
affect the voltage dependence of conductance compared with the subunits alone (Fig. 5C, Table 1). When both
1 and 2 were coexpressed with the subunits, the V1/2 for Rat1 was shifted in the
positive direction, whereas the V1/2 for Rat2
was shifted in the negative direction, so that these two values (15
and 22 mV) were significantly different from each other (Fig.
5D, Table 1). The slope factors (z) were not
significantly different between Rat1 and Rat2, and only the Rat1 slope
factor was significantly decreased by coexpression of 1
(Table 1). Coexpression of 2 did not significantly
change the slope factor of either Rat1 or Rat2. In summary, the voltage dependence of conductance was similar for Rat1 and Rat2 subunits alone, but it was significantly more positive for Rat1 + 1 + 2 compared with Rat2 + 1 + 2.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 5.
Voltage dependence of activation and inactivation
for Rat1 and Rat2 sodium channels. The voltage-dependence of activation (circles) and inactivation (squares) are shown
for (A) subunits alone, (B) + 1 subunits, (C) + 2
subunits, and (D) + 1 + 2
subunits. Sodium currents were elicited by depolarizing pulses from a
holding potential of 100 mV to potentials ranging from 90 to +30 mV
in 5 mV increments. Conductance values were calculated by dividing the
peak current amplitude by the driving force at each potential and
normalizing to the maximum conductance, as described in Materials and
Methods. Solid circles indicate Rat1, and open
circles indicate Rat2. Values represent averages, and error bars
indicate SDs. The data were fit with a two-state Boltzmann equation as
described in Materials and Methods, and the parameters of the fits are
shown in Table 1. Sample sizes were Rat1 (8), Rat2 (10), Rat1
+ 1 (5), Rat2 + 1 (7), Rat1 + 2 (6), Rat2 + 2 (5), Rat1 + 1 + 2 (6), and Rat2 + 1 + 2 (5). The voltage dependence of
inactivation was determined using a two-step protocol in which a
conditioning pulse to potentials ranging from 90 mV to +5 mV was
followed by a test pulse to 10 mV to measure the peak current
amplitude. The peak current amplitude during the test pulse was
normalized to the maximum current amplitude and is plotted as a
function of the conditioning pulse potential. Solid squares
indicate Rat1, and open squares indicate Rat2. Values represent averages, and error bars indicate SDs. The data were fit with
a two-state Boltzmann equation as described in Materials and Methods,
and the parameters of the fits are shown in Table 1. Sample sizes were
Rat1 (6), Rat2 (3), Rat1 + 1 (6), Rat2 + 1 (7), Rat1 + 2 (6), Rat2 + 2 (5), Rat1 + 1 + 2
(3), and Rat2 + 1 + 2 (5).
|
|
With respect to the voltage dependence of inactivation, the curve for
the Rat1 subunit alone (Fig. 5A, filled squares)
is shifted in the positive direction compared with that for the Rat2 subunit alone (Fig. 5A, open squares). When
1 was coexpressed with the subunits, the
V1/2 values for both curves were shifted in the
negative direction to a similar extent (Fig. 5B, Table 1).
Coexpression of 2 with the subunits did not
significantly affect the V1/2 for either Rat1 or
Rat2 compared with the subunits alone (Fig. 5C, Table
1). The combination of 1 and 2 shifted the V1/2 for Rat1 by 6 mV, and it shifted the
V1/2 for Rat2 by 15 mV, so that the
V1/2 for Rat2 + 1 + 2 was significantly more negative than that for
Rat1 + 1 + 2 (Fig. 5D,
Table 1). The slope factor (a) for the Rat1 subunit
was significantly smaller than that for the Rat2 subunit alone.
However, the addition of 1 or 1 + 2 decreased only the Rat2 slope factor, so that it was
comparable to that of Rat1 with either 1 or
1 + 2. In summary, the voltage dependence
of inactivation for Rat1 was significantly more positive than that for
Rat2, and this effect was more pronounced when both the
1 and 2 subunits were present.
Rat1 sodium channel current is modulated by
PKA phosphorylation
Electrical excitability of a neuron can be altered by modulating
the activity of the sodium channels (Schiffmann et al., 1995). The Rat2
sodium channel is functionally modulated by PKA in Chinese hamster
ovary cells (Li et al., 1992, 1993) and in Xenopus oocytes (Gershon et al., 1992; Smith and Goldin, 1996). Phosphorylation at PKA
consensus sites in the cytoplasmic linker between domains I and II of
the Rat2 channel reduces sodium current amplitude by 10-20% (Smith
and Goldin, 1996, 1997). The I-II linker in Rat1 contains five
consensus PKA sites at positions comparable to those in Rat2, although
the amino acid sequences of the PKA sites in the two channels are not
identical. It seemed likely that the Rat1 channel would also be
modulated by PKA. To determine whether modulation occurred, sodium
currents were measured during depolarizations to 10 mV before and 10 min after induction of PKA by perfusion with a mixture containing 25 µM forskolin, 10 µM cpt-cAMP, 10 µM db-cAMP, and 10 µl BMX. Application of the
PKA-activating mixture reduced sodium current amplitude for Rat1 by
7 ± 4% (n = 8) and for Rat2 by 9 ± 5%
(n = 9). Therefore, the PKA-activating mixture modulated the Rat1 sodium channel to cause a reduction in current amplitude comparable to that observed for the Rat2 channel.
| |
DISCUSSION |
We have constructed a full-length cDNA clone encoding the
Rat1 sodium channel. Injection into Xenopus oocytes of RNA
transcribed from this clone resulted in macroscopic currents that were
sufficiently large for electrophysiological analysis, in contrast to
the results with the original Rat1 clone (Noda et al., 1986b). The Rat1
clone that we constructed differs at four amino acid positions compared with the original Rat1 clone (Noda et al., 1986a). We do not know whether these differences represent actual polymorphisms in the rat
population or are artifacts of cloning either this channel or the
original Rat1 clone. Three of the differences are in cytoplasmic regions, and two of these are conservative changes. The notable exception is at position 979 in domain IIS6, where the Rat1 clone that
we isolated contains a glycine and the clone isolated by Noda et al.
(1986a) contains an arginine. All other voltage-gated sodium channels
that have been sequenced thus far contain a glycine at the comparable
position (Goldin, 1995). It is possible that this difference accounts
for the fact that we observed significant sodium currents from Rat1 and
Noda et al. (1986b) did not.
The level of current expressed from Rat1 in our studies was
significantly less than that expressed from Rat2. A 500-fold greater amount of Rat1 RNA was injected to yield current amplitudes comparable to those observed for Rat2. This difference in current levels represents either a difference in the amount of protein (resulting from
less efficient post-translational processing or insertion into the
membrane or both), or it might represent a functional property of the
Rat1 channel.
Rat1 sodium channels were modulated by the 1 subunit in
a manner similar to that observed previously for the Rat2 channel (Isom
et al., 1992). The primary effects were a faster time course of fast
inactivation, accelerated recovery from fast inactivation, and a
negative shift in the voltage dependence of inactivation. The effect of
the 2 subunit on Rat1 was a slight acceleration of the
kinetics of inactivation, similar to the effect of 2 on the Rat2 channel (Isom et al., 1995). The combination of
1 and 2 with either Rat1 or Rat2 resulted
in properties similar to those observed when only 1 was
coexpressed with the subunit. It is likely that both Rat1 and Rat2
subunits are associated with 1 and 2
subunits in the CNS, so that the physiologically relevant properties
are those determined in the presence of all three subunits.
The kinetics of fast inactivation for the Rat1 subunit channels
were slower than those for the Rat2 subunit channels (Figs. 2A, 3A); however, coexpression of the 1
subunit caused the two channels to have inactivation kinetics that were
comparable (Figs. 2B, 3B), so that both channels probably
have similar inactivation kinetics in vivo. In the presence
of 1, Rat1 recovered from inactivation more
quickly than Rat2, particularly at short recovery intervals of <10
msec (Fig. 4B). Therefore, on the basis of the kinetics of
inactivation and recovery, Rat1 channels should be capable of
transmitting higher frequencies of electrical impulses compared with
the Rat2 channel.
The electrical excitability of sodium channels is affected by both the
kinetics of inactivation and the voltage-dependent properties of the
channels. When expressed in the absence of the subunits, the Rat1
and Rat2 channels had similar voltage dependence of conductance curves
(Fig. 5A); however, coexpression of both 1
and 2 significantly shifted the
V1/2, for Rat2 in the negative direction
relative to the V1/2 for Rat1 (Fig. 5D,
Table 1). Therefore, Rat1 channels with 1 and
2 would require a stronger depolarization for a
comparable level of activation. With respect to the voltage dependence
of inactivation, the V1/2 for Rat1 subunit
channels was more positive than that for Rat2 subunit channels
(Fig. 5A). This difference was magnified by the presence of
1 and 2 subunits, because their presence
caused a larger negative shift in the V1/2 of
Rat2 channels than for Rat1 channels (Fig. 5D, Table 1). The
differences between Rat1 and Rat2 channels in the voltage dependence of
activation and inactivation would have opposite physiological effects.
The more positive V1/2 of activation for Rat1
would mean that Rat1 channels require a stronger depolarization to be
activated. In contrast, the more positive V1/2
of inactivation would make those channels less likely to be inactivated
than Rat2 channels, resulting in more channels available to be
activated. Because the difference in the V1/2 of
inactivation is greater than that of activation, the net effect should
be that Rat1 sodium channels are more available to transmit electrical
impulses.
The excitability of sodium channels in neurons can be modulated by
extrinsic factors such as phosphorylation. In particular, induction of
PKA phosphorylation reduces current amplitudes through Rat2 sodium
channels (Gershon et al., 1992; Li et al., 1992, 1993; Smith and
Goldin, 1996), and this effect is observed in hippocampal neurons in
which dopaminergic receptors are activated (Cantrell et al., 1997). In
this study, the Rat1 sodium channel currents were similarly reduced by
a PKA-activating mixture containing forskolin, cpt-cAMP, db-cAMP, and
IBMX. We have demonstrated previously that this mixture reduces Rat2
sodium current amplitudes by induction of PKA phosphorylation of the
channel, and that elimination of the consensus PKA sites in the I-II
linker prevents that effect (Smith and Goldin, 1997). It is likely that
the same mechanism is responsible for the reduction of Rat1 currents.
Rat1 and Rat2 have the same number and positioning of the five
consensus PKA sites in the cytoplasmic linker connecting domains I and
II. Three of the five PKA sites have identical amino acid sequences
(site 2: RRNS; site 3: RRDS; site 5: KRRSSS), and the other two sites differ by one amino acid [site 1: KRFSS (Rat2),
KRYSS (Rat1); site 4: RRPS (Rat2),
RRNS (Rat1)]. The second PKA site is of critical importance
in PKA-mediated current reduction for Rat2 (Smith and Goldin, 1997) and
is identical in both channel isoforms.
The electrical responses of neurons in the CNS are largely determined
by the properties of the channels that are expressed in those cells.
Sodium channels that inactivate rapidly cause the transient, inward
currents representative of fast action potentials, whereas persistent
or noninactivating sodium channels may be responsible for spontaneous
action potentials and plateau potentials (Llinas, 1988; Taylor, 1993;
Grill, 1996). These two distinct sodium channel conductances have been
well characterized in cerebellar Purkinje cells (Llinas and Sugimori,
1980; Raman and Bean, 1997). Vega-Saenz de Miera et al. (1997)
suggested that the inactivating and noninactivating sodium conductances
result from expression of Rat1 and Rat6, respectively. Rat2 RNA was
undetectable in Purkinje cells in that study (Vega-Saenz de Miera et
al., 1997). The role of Rat6 has been examined by electrophysiological
analysis of Purkinje cells from ataxic mice that either lack or have a
mutant form of Scn8a, the murine ortholog of Rat6 (Burgess et al.,
1995; Kohrman et al., 1995; Kohrman et al., 1996). These studies
indicated that Scn8a channels are responsible for subthreshold
currents, suggesting that the rapidly inactivating sodium current
results from Rat1 channels (Raman et al., 1997). The
electrophysiological properties that we have demonstrated for Rat1
sodium channels are consistent with this conclusion.
In summary, we have constructed a full-length cDNA clone for the Rat1
sodium channel and demonstrated that this channel is functional in
Xenopus oocytes. Some of the electrophysiological properties
of Rat1 differ from those of Rat2, which would result in greater
availability of Rat1 channels. These differences suggest that Rat1
channels are capable of more rapid firing of action potentials compared
with Rat2 channels. In addition, the electrophysiological properties of
the Rat1 channels are consistent with a role for these channels in
mediating the rapidly inactivating transient current in cerebellar
Purkinje cells. The availability of a functional clone for Rat1 will
make it possible to evaluate the physiological role of this sodium
channel isoform.
| |
FOOTNOTES |
Received Aug. 20, 1997; revised Oct. 6, 1997; accepted Nov. 6, 1997.
This research was supported by National Institutes of Health Grant NS
26729 to A.L.G. A.L.G. is an Established Investigator of the
American Heart Association. We thank Drs. Linda Hall, Marianne Smith,
Ted Shih, and Michael Pugsley for helpful discussions during the course
of this work, and Dr. Linda Hall and Mike Wishingrad for the
sequencing. We acknowledge Esther Yu and Mimi Reyes for excellent
technical assistance.
Correspondence should be addressed to Dr. Alan L. Goldin,
Department of Microbiology and Molecular Genetics, University of California, Irvine, CA 92697-4025.
| |
REFERENCES |
-
Auld VJ,
Goldin AL,
Krafte DS,
Marshall J,
Dunn JM,
Catterall WA,
Lester HA,
Davidson N,
Dunn RJ
(1988)
A rat brain Na+ channel subunit with novel gating properties.
Neuron
1:449-461[ISI][Medline].
-
Beckh S,
Noda M,
Lubbert H,
Numa S
(1989)
Differential regulation of three sodium channel messenger RNAs in the rat central nervous system during development.
EMBO J
8:3611-3636[ISI][Medline].
-
Black JA,
Yokoyama S,
Higashida H,
Ransom BR,
Waxman SG
(1994)
Sodium channel mRNAs I, II and III in the CNS: cell-specific expression.
Mol Brain Res
22:275-289[Medline].
-
Burgess DL, Kohrman DC, Gait J, Plummer NW, Jones JM, Spear B,
Meisler MH (1995) Mutation of a new sodium channel gene,
Scn8a, in the mouse mutant "motor endplate disease."
Nature Genet 461-465.
-
Cantrell AR,
Smith RD,
Goldin AL,
Scheuer T,
Catterall WA
(1997)
Dopaminergic modulation of sodium current in hippocampal neurons via cAMP-dependent phosphorylation of specific site(s) in the sodium channel subunit.
J Neurosci
17:7330-7338[Abstract/Free Full Text].
-
Crill WE
(1996)
Persistent sodium current in mammalian central neurons.
Annu Rev Physiol
58:349-362[ISI][Medline].
-
Dierks P,
van Ooyen A,
Mantel N,
Weissmann C
(1981)
DNA sequences preceding the rabbit -globin gene are required for formation in mouse L cells of beta-globin RNA with the correct 5 terminus.
Proc Natl Acad Sci USA
78:1411-1415[Abstract/Free Full Text].
-
Felts PA,
Yokoyama S,
Dib-Hajj S,
Black JA,
Waxman SG
(1997)
Sodium channel -subunit mRNAs I, II, III, NaG, Na6 and hNE (PN1): different expression patterns in developing rat nervous system.
Mol Brain Res
45:71-82[Medline].
-
Furuyama T,
Morita Y,
Inagaki S,
Takagi H
(1993)
Distribution of I, II and III subtypes of voltage-sensitive Na+ channel mRNA in the rat brain.
Mol Brain Res
17:169-173[Medline].
-
Gautron S,
Dos Santos G,
Pinto-Henrique D,
Koulakoff A,
Gros F,
Berwald-Netter Y
(1992)
The glial voltage-gated sodium channel: cell- and tissue-specific mRNA expression.
Proc Natl Acad Sci USA
89:7272-7276[Abstract/Free Full Text].
-
Gershon E,
Weigl L,
Lotan I,
Schreibmayer W,
Dascal N
(1992)
Protein kinase A reduces voltage-dependent Na+ current in Xenopus oocytes.
J Neurosci
12:3743-3752[Abstract].
-
Goldin AL
(1991)
Expression of ion channels by injection of mRNA into Xenopus oocytes.
Methods Cell Biol
36:487-509[Medline].
-
Goldin AL
(1995)
Voltage-gated sodium channels.
In: Ligand- and voltage-gated ion channels (North RA,
ed), pp 73-112. Boca Raton, FL: CRC.
-
Gordon D,
Merrick D,
Auld V,
Dunn R,
Goldin AL,
Davidson N,
Catterall WA
(1987)
Tissue-specific expression of the RI and RII sodium channel subtypes.
Proc Natl Acad Sci USA
84:8682-8686[Abstract/Free Full Text]. <
|
Top
Abstract
Introduction
