 |
Previous Article | Next Article 
The Journal of Neuroscience, February 15, 1998, 18(4):1261-1269
Interaction of Huntingtin-Associated Protein with Dynactin
P150Glued
Shi-Hua
Li1,
Claire-Anne
Gutekunst2,
Steven M.
Hersch2, and
Xiao-Jiang
Li1
Departments of 1 Genetics and 2 Neurology,
Emory University School of Medicine, Atlanta, Georgia 30322
 |
ABSTRACT |
Huntingtin is the protein product of the gene for Huntington's
disease (HD) and carries a polyglutamine repeat that is expanded in HD
(>36 units). Huntingtin-associated protein (HAP1) is a neuronal protein and binds to huntingtin in association with the polyglutamine repeat. Like huntingtin, HAP1 has been found to be a cytoplasmic protein associated with membranous organelles, suggesting the existence
of a protein complex including HAP1, huntingtin, and other proteins.
Using the yeast two-hybrid system, we found that HAP1 also binds to
dynactin P150Glued (P150), an accessory protein for
cytoplasmic dynein that participates in microtubule-dependent
retrograde transport of membranous organelles. An in
vitro binding assay showed that both huntingtin and P150 selectively bound to a glutathione transferase (GST)-HAP1 fusion protein. An immunoprecipitation assay demonstrated that P150 and huntingtin coprecipitated with HAP1 from rat brain cytosol. Western blot analysis revealed that HAP1 was enriched in rat brain microtubules and comigrated with P150 and huntingtin in sucrose gradients. Immunofluorescence showed that transfected HAP1 colocalized with P150
and huntingtin in human embryonic kidney (HEK) 293 cells. We propose
that HAP1, P150, and huntingtin are present in a protein complex that
may participate in dynein-dynactin-associated intracellular transport.
Key words:
Huntington's disease; huntingtin; dynactin; microtubule; intracellular transport; targeting
 |
INTRODUCTION |
The N terminus of huntingtin
contains a polyglutamine repeat that is expanded (>36 units) in
patients with Huntington's disease (HD) (HD Collaborative Research
Group, 1993 ). It has been postulated that the expanded polyglutamine
repeat causes huntingtin to interact abnormally with other cellular
proteins (Perutz, 1994 ; Albin and Tagle, 1995 ; Ross 1995 ). HAP1 is a
huntingtin-associated protein that binds more tightly to huntingtin
with an expanded polyglutamine repeat than to normal huntingtin (Li et
al., 1995 ) and is exclusively expressed in neurons (Li et al., 1996 ).
Like huntingtin, HAP1 is a cytoplasmic protein associated with
microtubules, membranous organelles, and synaptic vesicles (Li et al.,
1996 ; Gutekunst et al., 1997 ; Martin et al., 1997 ; Sharp et al., 1997 ),
suggesting that HAP1 may bind to other proteins. Identification of
proteins that bind to HAP1 and have known function will help to uncover the biological role of HAP1 and possibly the cellular consequences related to the interaction of huntingtin and HAP1. To this end, we used
a yeast two-hybrid screen to identify proteins potentially associated
with the HAP1-huntingtin complex.
We found that HAP1 interacts with dynactin P150Glued
(P150), an accessory protein for the microtubule motor protein dynein.
Cytoplasmic dynein is a microtubule motor protein involved in a wide
range of intracellular motile events, including retrograde vesicle
transport in axons, membrane trafficking, nuclear migration, and both
the positioning and anaphase movement of the mitotic spindle (Paschal and Vallee, 1987 ; Pfarr et al., 1990 ; Steuer et al., 1990 ;
Corthesy-Theulaz et al., 1992 ; Xiang et al., 1994 ; Saunders et al.,
1995 ). Retrograde transport carries large, varied membrane-bound
organelles such as presumptive lysosomes, multivesicular bodies,
mitochondria, and exogenous material to the cell body (Brady, 1985 ;
Vale et al., 1985 ; Brady et al., 1990 ; Hirokawa et al., 1991 ). The
intracellular transport mediated by cytoplasmic dynein involves a
variety of accessory proteins that may participate in targeting dynein
motor proteins to intracellular organelles (Vallee and Sheetz, 1996 ). Among these accessory proteins is the dynactin complex, a 20S protein
heteromultimer that consists of various polypeptides ranging in
molecular mass from 24 to 150 kDa (Paschal and Vallee, 1987 ; Gill et
al., 1991 ; Schroer and Sheetz, 1991 ; Paschal et al., 1993 ; Allan,
1994 ). The dynactin complex is required by dynein to move vesicles
along microtubules in vitro (Gill et al., 1991 ; Schroer and
Sheetz, 1991 ). The largest component of the dynactin complex is P150, a
homolog of the product of the Drosophila gene Glued (Holzbaur et al., 1991 ). The null mutation of Glued is embryonically lethal (Harte and Kankel, 1982 ), suggesting that the P150 polypeptide has a role in an essential cell function.
Using in vitro binding, coimmunoprecipitation, and
cotransfection assays, we demonstrate that HAP1 binds to P150. The
presence of a protein complex containing HAP1, P150, and huntingtin is further supported by a sucrose gradient assay that shows comigration of
these proteins at the 20 S position. We propose that HAP1 and normal
huntingtin may be involved in microtubule and
dynein-dynactin-associated intracellular transport in the neuron.
 |
MATERIALS AND METHODS |
Yeast two-hybrid system. All experiments were
performed with the yeast strain Y190. The yeast two-hybrid screen was
conducted as described previously (Fields and Song, 1989 ; Li et al.,
1995 ) to isolate HAP1-associated proteins (HAPAs). Full-length HAP1-A, an isoform of HAP1, fused to the GAL-4 DNA-binding domain was used as a
bait to screen a rat brain cDNA library (Li et al., 1995 ). Transformed
yeast cells were grown in Trp ,
Leu , and His synthetic medium
containing 25 mM 3-aminotriazole (Sigma, St. Louis, MO)
that can reduce the leaky expression of the His+
phenotype. Positive colonies were identified by filter assays of
-galactosidase ( -gal) activity (Li et al., 1995 ). cDNAs from these positive colonies appearing within 120 min were rescued for
retransformation of fresh yeast cells and confirmation of the
interactions of these cloned proteins with HAP1.
Three HAP1 constructs containing different fragments between the middle
region and the C terminus (amino acids 278-599) were fused to the
GAL-4 activation domain in pPC86 vector to examine their interactions
with huntingtin, DRPLA, and c-Jun proteins in pPC97 vector (Chevray and
Nathans, 1992 ). These HAP1 fragments were also fused to the GAL-4
DNA-binding domain in pPC97 vector to test their interactions with P150
and other cloned HAPA proteins in pPC86 vector. The N-terminal fragment
(amino acids 1-253) of huntingtin containing 23 glutamine repeats was
used. DRPLA is a glutamine-repeat protein product of the gene for
dentatorubral and pallidoluysian atrophy (Nagafuchi et al., 1994 ) with
a 21 glutamine repeat and was used as a control in a previous study (Li
et al., 1995 ). c-Jun (amino acids 250-334) is a DNA-binding protein
used as an irrelevant control.
For assessment of protein-protein interactions in yeast, filter assays
of -galactosidase activity were performed by transferring the yeast
colonies onto Whatman filters. The yeast cells were partially lysed by
submerging the filters in liquid nitrogen for 15-20 sec. Filters were
allowed to dry at room temperature for at least 5 min and placed onto
filter paper presoaked in Z buffer (100 mM sodium
phosphate, pH 7.0, 10 mM KCl, and 1 mM
MgSO4) supplemented with 50 mM
-mercaptoethanol and 0.07 mg/ml 5-bromo-4-chloro-3-indolyl -D-galactoside. Filters were placed at 37°C for up to
3 hr.
Liquid -galactosidase assays were performed as described previously
(Li et al., 1995 ). Briefly, yeast colonies were introduced into
appropriate synthetic media and grown to an optical density at 600 nm
(OD600) of 0.6-0.8. Five milliliters of culture was pelleted, washed once with 1 ml of Z buffer, and then resuspended in
500 µl of Z buffer supplemented with 38 mM
-mercaptoethanol. Acid-washed glass beads were added to each sample
and vortexed for 3 min on ice. Each sample lysate (50-150 µg of
protein) was taken in triplicate for the liquid -galactosidase
assay. These samples were incubated with 900 µl of Z buffer in a
30°C water bath for 30 sec, and then 200 µl of 4 mg/ml
o-nitrophenyl -D-galactopyranoside solution
was added to each tube. The reaction was allowed to continue for 15-30
min at room temperature and stopped by the addition of 500 µl of 1 M Na2CO3. The OD420 was
taken to calculate the -galactosidase activity using the equation:
1000 × OD420/(t × mg), where
t is the elapsed time (in minutes). The -galactosidase activity was thus expressed as units per minute per milligram of yeast
protein.
In vitro binding. In vitro binding assays
were performed essentially as described previously (Li et al., 1995 ).
The HAP1-A fragment (amino acids 278-599) was fused to the pGEX-4T
vector. Glutathione S-transferase (GST)-HAP1 fusion protein
was produced in bacteria BL21 (Pharmacia, Piscataway, NJ). GST-HAP1
fusion protein was then purified with glutathione-Sepharose beads
(Sigma) and used for binding to full-length P150 and the N-terminal
huntingtin. The cDNA encoding rat P150 was isolated by reverse
transcriptase (RT)-PCR from rat brain RNA with two pairs of primers
(S275, GTAGAGTCCGGGTGAGCAACATGGCC and A1570 GCATCTCCACCATCTCCTCA;
S1503, AGCAGCGTGAGCGTCTTCAGG and A4229 ACCGAATTCACGGAAGTAGCAGAACC).
These primers were derived from published sequences (Holzbaur et al.,
1991 ) and allowed us to construct a full-length P150 cDNA in pCIS
vector (Li et al., 1995 ). The full-length P150 was used to synthesize
[35S]methionine-labeled P150 with the in
vitro translation TNT kit (Promega, Madison, WI). The N terminus
of huntingtin (amino acids 1-253) containing 23 (23Q) or 44 (44Q)
glutamine repeats (Li et al., 1995 ) was also used to synthesize
radiolabeled huntingtin with [35S]methionine.
35S-labeled proteins (5-10 µl) were incubated with
glutathione-agarose beads containing the GST protein or GST-HAP1
fusion protein (200 ng) in 0.2 ml of binding buffer (0.5% Triton X-100
in PBS) for 2 hr. After the beads were washed three times with the
binding buffer, proteins bound to the beads were resolved by 8%
SDS-PAGE and visualized by autoradiography. Quantitative assessment of protein in the gel was performed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). In some cases, the gel was stained with Coomassie brilliant blue to visualize the GST fusion proteins present
in each track.
Antibody production. Two isoforms of HAP1, termed HAP1-A and
HAP1-B, have been isolated. They differ in the sequences at their C
termini; HAP1-A has 21 amino acids at the C terminus that differ from
the 51 amino acids at the C terminus of HAP1-B (Li et al., 1995 ).
Anti-peptide antibodies for HAP1 (EM31 and EM32) were raised against
the C-terminal sequences of these two rat HAP1 isoforms (Li et al.,
1995 ), SRRGHPPASGTSYRSSTL for HAP1-A and ATHSPSAREEEGPSGAT for HAP1-B.
These peptides were conjugated with BSA to serve as immunogens for
Covance Inc. (Denver, PA) to produce rabbit antisera. Anti-peptide
antibodies were purified using affinity columns linked with immunogen
(Li and Snyder, 1995 ). A fragment of rat P150 (amino acids 1023-1223)
was used to produce GST-P150 fusion protein that served as immunogen
to produce rabbit antibodies (EM49). The anti-P150 antibody was
purified by incubation of whole serum with a nitrocellulose strip
containing electrophoretically purified GST-P150. After multiple
washes, antibodies were eluted with 0.2 M Gly, pH 2.15, for
10 min and immediately neutralized by addition of 1.5 M
Tris-HCl, pH 8.8. The specificity of purified EM49 was found to be
comparable with that of the well characterized anti-P150 antibody UP235
(provided by Dr. Holzbaur, University of Pennsylvania; Tokito et al.,
1996 ). Affinity-purified anti-HAP1 antibodies (EM31 and EM32) were
mixed together (1:1) to allow recognition of both HAP1-A and HAP1-B isoforms. These antibodies and anti-P150 antibody (EM49) were used at
1:1000 dilution for Western blotting. The following antibodies were
also used in the study: anti-huntingtin antibodies (1:500 dilution)
that were rabbit polyclonal antibodies described previously (Gutekunst
et al., 1995 ); anti-HA (human influenza hemagglutinin) epitope antibody
12CA5 (1:100-500 dilution; Boehringer Mannheim, Indianapolis, IN); and
rabbit polyclonal antibodies to Rab2 (Santa Cruz Biotechnology, Santa
Cruz, CA), to neuronal nitric oxide synthase (nNOS) (Transduction
Laboratories, Lexington, KY), or to ubiquitin (Dako, Carpenteria,
CA).
Immunoprecipitation. Rat brain cytosolic extracts were
obtained by homogenizing 2 gm of rat brain tissue in 4 ml of PIPES buffer (100 mM Na-PIPES, 50 mM Na-HEPES, 1 mM EDTA, 1 mM MgSO4, pH 6.9, and the following protease inhibitors: 100 µg/ml PMSF, 1 µg/ml
leupeptin, 1 µg/ml aprotinin, and 1 µg/ml pepstatin A). Homogenates
were centrifuged at 18,000 × g for 15 min at 4°C, and the supernatant was then clarified by centrifugation at
120,000 × g for 30 min at 4°C. The clarified
supernatant (600 µl) was preincubated with protein A-Sepharose beads
(50 µl of 1:1 slurry; Pharmacia) for 30 min at 4°C. After the beads
were pelleted, the supernatant was incubated with 50 µl of protein
A-agarose beads linked with 5 µl of affinity-purified anti-HAP1
antibodies for 1 hr at 4°C. Controls involved immunoprecipitations
with 20 µg/ml of unconjugated peptides and HAP1 antibodies that had
been preadsorbed with the peptides overnight. In addition, protein
A-agarose beads alone or linked with 5 µl of rabbit IgG (Sigma) were
also used as controls. The beads containing immunocomplexes were
pelleted and washed twice with 1 ml of 0.4% Triton X-100 in PBS.
Precipitated proteins were resuspended in 100 µl of SDS-PAGE sample
buffer and boiled for 5 min. Thirty microliters of brain extracts and immunoprecipitates were resolved by 6% SDS-PAGE and detected by Coomassie blue staining and Western blotting.
Sucrose gradient fractionation of S3 cytosol. This
experiment was performed as described previously (Paschal et al.,
1993 ). Rat brain homogenate (1:4 w/v) in PIPES buffer was first
centrifuged at 15,000 × g for 15 min and then at high
speed (120,000 × g) for 45 min. The resulting S3
supernatant (3.5 ml) was layered onto 8 ml of 5-20% linear sucrose
density gradient in PIPES buffer that was composed of 16 fractions (0.5 ml/fraction). After centrifugation at 120,000 × g at
4°C for 16 hr in a Ti SW-41 rotor (Beckman), each fraction (0.5 ml)
was collected, and 60 µl samples were analyzed by Western blotting
with antibodies to HAP1, huntingtin, and P150.
Microtubule sedimentation. Microtubule pellets were prepared
from rat brain homogenates by a standard method (Paschal et al., 1991 ).
Rat brain was homogenized in PIPES buffer (1:1 w/v). The homogenates
were clarified by centrifugation at 18,000 × g for 20 min and then at 120,000 × g for 45 min. The resulting
supernatant (S3) was treated with 1 mM GTP and 20 µM taxol (Sigma) at room temperature for 30 min to
polymerize microtubules. The polymerized microtubules were pelleted by
centrifugation at 120,000 × g for 30 min. The pellets
were washed once with PIPES buffer and then resuspended in 4 ml of
PIPES buffer containing 1 mM GTP and 20 µM
taxol. For ATP extraction, MgATP was added to the resuspended pellets
at 10 mM concentration, and the extraction was rocked for
15 min at room temperature. The control was the microtubule pellets
without ATP extraction. The extracted microtubules were then pelleted
again, and the pellets were resuspended in 2 ml of PIPES buffer. The
supernatant (100 µl) and pellet suspension (40 µl) were analyzed by
7.5% SDS-PAGE.
Coexpression and double labeling of transfected cells. Human
embryonic kidney (HEK) 293 cells were used for cotransfection studies.
To double label HAP1 and huntingtin that were coexpressed in HEK 293 cells, we tagged huntingtin (amino acids 1-253) containing 23 glutamine repeats with an HA epitope (YPYDVPDYA) at its C terminus so
the mouse anti-HA antibody 12CA5 could recognize the transfected huntingtin, whereas rabbit polyclonal antibody to HAP1 could recognize transfected HAP1-A. To double label coexpressed HAP1-A and full-length P150, we tagged the C terminus of HAP1-A with the HA epitope to allow
recognition by mouse antibody 12CA5. The addition of the HA epitope to
HAP1-A did not alter the subcellular localization of the expressed
HAP1-A in transfected cells. HEK 293 cells in chamber slides (Nalge
Nunc., Naperville, IL) were cotransfected with HAP1-A and huntingtin or
P150 (1-2 µg of cDNA for each) using lipofectin for 24-36 hr. The
cells were then fixed with 4% paraformaldehyde in PBS for 15 min,
permeabilized with 0.4% Triton X-100 in PBS for 30 min, preincubated
with PBS containing 5% normal goat serum for 1 hr, and then incubated
with specific primary antibodies in PBS containing 2% normal goat
serum overnight. In general, rabbit polyclonal antibodies were used at
1:1000 dilution, and the mouse monoclonal antibody 12CA5 was used at
1:100 dilution for incubation with transfected cells. After the cells
were washed with PBS three times, fluorescent FITC- or
rhodamine-conjugated secondary antibodies (1:200 dilution; Jackson
ImmunoResearch, West Grove, PA) were then added to the cells, and the
expressed proteins were localized using fluorescence microscopy.
 |
RESULTS |
Interaction of HAP1 with P150 and huntingtin in yeast
To investigate whether HAP1 binds to proteins of known function,
we fused full-length HAP1-A to the GAL-4 DNA-binding domain and
screened a rat brain cDNA library using the yeast two-hybrid system.
HAP1-A is a HAP1 isoform and has 21 amino acids at the C terminus that
differ from those (51 amino acids) of HAP1-B (Li et al., 1995 ).
Seventeen positive colonies were isolated from 1.5 million yeast
transformants by selection of His+- and
-galactosidase-positive transformants. We chose to study the clones
that displayed strong and specific interaction with HAP1. Among the 10 clones that displayed specific -galactosidase activity within 2 hr,
three clones contained cDNAs encoding partial amino acid sequences of
HAP1, suggesting that HAP1 binds to itself in yeast. Two clones carried
cDNAs encoding 200 amino acids of rat P150 (from amino acids
1023-1223). Two other clones encoded 340 amino acids of unknown
function that were termed HAPA-10. The remaining clones are being
characterized. Because P150 is a microtubule motor-binding protein and
because huntingtin and HAP1 associate with microtubules and various
intracellular organelles (Gutekunst et al., 1995 , 1997 ; Li et al.,
1996 ; Martin et al., 1997 ; Sharp et al., 1997 ), the interaction between
HAP1 and P150 was chosen for further characterization.
The yeast two-hybrid screen suggests that HAP1 binds to several
proteins. Analysis of the HAP1 protein using the Coils program (Lupas
et al., 1991 ) predicted a coiled coil structure in HAP1 between amino
acids 120 and 380. The coiled coil is also present in various
microtubule-binding proteins including P150 from amino acids 200 to 550 and from 920 to 1020. To verify the specificity of the interactions
between HAP1 and associated proteins in yeast, we examined the
interactions of different HAP1 fragments (between amino acids 278 and
599) with human huntingtin (amino acids 1-253), P150 (amino acids
1023-1223), HAPA-10, c-Jun (amino acids 250-334), and DRPLA (amino
acids 450-712) (Table 1). The N-terminal
huntingtin contained 23 glutamine repeats. c-Jun is a leucine zipper
protein containing a coiled coil, and DRPLA is a polyglutamine (21 glutamine) protein that also contains a coiled coil. The result showed
that all HAP1 fragments interacted with huntingtin, suggesting that the
shortest HAP1 fragment (amino acids 278-370) contains the site for
binding to huntingtin. P150 did not interact with this shortest
fragment but did bind to two other HAP1 fragments (amino acids 278-445
and 278-599). Thus, P150 seems to bind to a different region of HAP1,
which may be between amino acids 370 and 445. HAPA-10 only interacted
with the longest HAP1 fragment that included the C terminus of HAP1-A.
In contrast, we observed no interaction of any of these HAP1 fragments
with c-Jun or DRPLA. These results suggest that the binding of HAP1 to
huntingtin and P150 is selective.
Previous studies using HAP1 (1-445) demonstrated that HAP1 bound more
huntingtin 44Q than 23Q (Li et al., 1995 ; Kalchman et al., 1997 ). As
the shorter fragment of HAP1 (278-370) was sufficient to bind to
huntingtin, we quantitatively tested the binding of this fragment to
huntingtin containing 23 or 44 glutamine repeats using a liquid assay.
We observed that the interaction of HAP1 (278-370) with huntingtin 44Q
yielded more -galactosidase activity (237.2 units/min/mg of protein)
than did the interaction with huntingtin 23Q (119.6 units/min/mg of
protein) (Table 2). Western blot analysis
showed that huntingtin 44Q and 23Q were expressed at similar levels in
yeast (data not shown). In the controls, the liquid assay showed
background levels (8 and 12 units/min/mg of protein) of
-galactosidase activities for the interaction of HAP1 with DRPLA and
c-Jun.
In vitro binding of HAP1 to P150 and huntingtin
Because yeast two-hybrid assays are prone to artifacts, we
performed an in vitro binding assay with GST-HAP1 (amino
acids 278-599) (Fig. 1a). We
used [35S]methionine-labeled full-length P150 in
the binding assay so we could test the direct interaction between these
proteins. To examine whether huntingtin and P150 could simultaneously
bind to HAP1, we also generated 35S-labeled, N-terminal
huntingtin containing 23Q or 44Q (Fig. 1b) and used them in
the binding assay along with P150. P150 alone or mixed with huntingtin
23Q or 44Q was incubated with GST-HAP1 or GST (Fig. 1c). By
autoradiography, we observed that both P150 and huntingtin bound to
GST-HAP1 but not to GST alone. Quantitative assessment of the amounts
of proteins bound to GST-HAP1 was then performed using a
phosphorimager (Fig. 1d). In comparison with the input of
proteins before the binding, more huntingtin 44Q (14.2% of input) than
23Q (9.8% of input) appeared to bind to GST-HAP1. The amount of P150
bound to the GST-HAP1 (17.6% of input) seemed to be slightly higher
than that of huntingtin. However, this binding was decreased in the
presence of huntingtin 23Q (15.1% of input) and huntingtin 44Q (11.2%
of input). Equal amounts of GST-HAP1 were used in each reaction. Thus
the results suggest that these three proteins could form a protein
complex in vitro and perhaps huntingtin, particularly with
44 glutamine repeats, may inhibit the binding of GST-HAP1 to P150.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 1.
In vitro binding of HAP1 to P150 and
huntingtin. a, Coomassie blue staining of a gel
containing purified GST-HAP1 and unconjugated GST. b,
Autoradiograph of 35S-labeled, N-terminal huntingtin with
23Q or 44Q and the 35S-labeled full-length P150 that were
produced by in vitro translation. c, The
binding of the GST-HAP1 fusion protein to lysates containing 35S-labeled P150 and huntingtin. Input was
lysates containing 35S-labeled proteins before incubation
with GST and GST-HAP1. Proteins bound to the agarose beads containing
GST-HAP1 or GST alone were resolved by SDS-PAGE and visualized by
autoradiography. d, Quantitative assessment by
phosphorimaging of huntingtin bound to GST-HAP1 (23Q
and 44Q) and P150 bound to GST-HAP1 in the absence
(no label) and presence of huntingtin
(+23Q and +44Q). Values were obtained from three independent experiments and expressed as percent of the
respective input.
|
|
Coimmunoprecipitation of HAP1, huntingtin, and P150
To examine whether HAP1 associates with P150 and huntingtin
in vivo, we conducted immunoprecipitations with antibodies
to HAP1 and P150. Because the middle portion of HAP1 was found to bind
to both huntingtin and P150, we generated anti-peptide antibodies against the C-terminal regions of HAP1 and expected that these antibodies might more efficiently precipitate the HAP1 complex. Western
blots showed that these antibodies specifically reacted with both HAP1
isoforms (75 kDa for HAP1-A and 85 kDa for HAP1-B) in rat brain and in
transfected cells (Fig. 2a). A
rabbit polyclonal antibody (EM49) to P150 was also produced and found
to react specifically with transfected P150 in HEK 293 cells and with a
doublet at ~150/135 kDa in rat brain (Fig. 2b). The
doublet represented isoforms of P150 that have been revealed by other
anti-P150 antibodies (Tokito et al., 1996 ). Immunoprecipitation of rat
brain cytosol with anti-HAP1 antibodies was then conducted, and the
precipitated proteins were separated by SDS-PAGE. By Coomassie blue
staining of the gel, we observed two weak bands of molecular weights
corresponding to those of HAP1-A and HAP1-B in the sample precipitated
by anti-HAP1 antibodies (Fig. 2c). However, it is difficult
to define the other weak bands in the HAP1 precipitate. We then
performed immunoblots and demonstrated the coprecipitation of HAP1,
P150, and huntingtin by anti-HAP1 antibodies (Fig. 2c).
Precipitation of P150 and huntingtin apparently depended on the
presence of HAP1 because preincubation of these anti-peptide antibodies
with the peptides (20 µg/ml) eliminated the precipitation for HAP1 as
well as P150 and huntingtin. Controls using protein A-Sepharose beads
alone or beads linked with rabbit IgG did not show any significant
precipitation of HAP1, P150, or huntingtin. We also probed the blot
with antibodies to other proteins, including nNOS, GTP-binding protein
Rab2, and ubiquitin, but did not find these proteins in the
immunoprecipitates. These results indicate a specificity of the
coprecipitation of HAP1, P150, and huntingtin.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2.
Immunoprecipitation of rat brain proteins with
anti-HAP1 antibodies. a, Anti-HAP1 antibodies
specifically recognized transfected HAP1 (HAP1-A and
HAP1-B) in HEK 293 cells. The control was untransfected cells. The antibodies also reacted with two bands (75 and 85 kDa) in
rat brain that corresponded to HAP1-A and
HAP1-B, respectively. b, Rabbit
polyclonal antibody to P150 specifically reacted with transfected P150
in HEK 293 cells and with polypeptides of 150 and 135 kDa in rat brain.
The control was untransfected HEK 293 cells. c, Rat
brain cytosolic extracts were immunoprecipitated using anti-HAP1
antibodies (+ anti-HAP1). A Coomassie blue-stained SDS-polyacrylamide gel (8%) containing immunoprecipitates is shown. The same immunoprecipitates were also resolved by 6% SDS-PAGE, and the
blot was cut to strips that were probed with antibodies to huntingtin,
P150, and HAP1. Lysates were brain extracts before immunoprecipitation.
The controls were immunoprecipitations with immunogen-preadsorbed HAP1
antibody (+ peptide), rabbit IgG (+ anti-IgG), and protein A-agarose beads alone (+ beads).
|
|
Comigration of HAP1, huntingtin, and P150 in sucrose gradients
Immunoprecipitation suggested that soluble forms of these proteins
are involved in a protein complex in the cytosol. We therefore performed sucrose gradient fractionation of rat brain cytosol. This
method separates protein complexes based on their densities. Rat brain
cytosol was fractionated on a linear sucrose gradient (5-20%) and
analyzed by Western blotting (Fig. 3).
P150 has been found to peak at 20S (from fraction 13 to 15) in a
5-20% sucrose gradient (Paschal et al., 1993 ). We found that both
P150 and HAP1 peaked in fractions 13-15 with nearly identical
profiles. The distribution of huntingtin covered a relatively broad
region from fraction 9 to 16. However, the highest concentration of
huntingtin was also found between fractions 12 and 15. The comigration
of these proteins in the gradient supports the idea that these proteins may be involved in the same protein complex in the cytosol.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 3.
Comigration of HAP1 with P150 in a sucrose
gradient. Fractionation of rat brain cytosolic fraction (S3) through a
5-20% sucrose density gradient. Sixty microliter samples from each of
16 fractions were resolved by 7.5% SDS-PAGE. The blot with transferred
proteins was probed with antibodies to huntingtin, P150, and HAP1.
H is rat brain cytosolic extract before the gradient
fractionation.
|
|
Sediment of HAP1 in microtubule pellets
Because the dynactin complex can be purified by ATP extraction of
microtubules and because the binding of dynactin P150 to microtubules
is decreased by ATP (Waterman-Storer et al., 1995 ; Tokito et al.,
1996 ), we examined whether HAP1 is associated with microtubules and
whether this association is also regulated by ATP. We prepared
microtubule pellets by sedimentation of polymerized microtubules from
rat brain cytosol. Both HAP1 isoforms (HAP1-A and HAP1-B) cosedimented
with endogenous rat brain microtubules (Fig.
4a,b). HAP1 and P150 were
enriched in microtubules compared with huntingtin that was more
concentrated in the eluate than in the pellets. Of two major isoforms
of dynactin (150 and 135 kDa), only the 150 kDa polypeptide was
preferentially associated with microtubules, consistent with a recent
report (Tokito et al., 1996 ). However, much less HAP1 than P150 was
released into the eluate after extraction of microtubule pellets with
10 mM ATP (Fig. 4). Thus, although HAP1 also associates
with microtubules, this association seemed to be less sensitive to ATP
extraction than was that of P150.

View larger version (68K):
[in this window]
[in a new window]
|
Figure 4.
Cosedimentation of HAP1 and P150 with rat brain
microtubules. a, Coomassie blue staining of a gel
containing polymerized rat brain microtubules. Sup was a
high speed supernatant before the polymerization of microtubules.
Microtubule pellets (MT) were extracted with the
normal PIPES buffer (MT + control)
and with 10 mM ATP (MT + ATP). The respective eluates (control and + ATP) were also resolved in the gel. b,
The same samples analyzed by Western blotting with antibodies to
huntingtin, P150, and HAP1.
|
|
Colocalization of HAP1 with huntingtin or P150 in
transfected cells
To eliminate the possibility that HAP1 and P150 associate with
each other only in vitro or after homogenization, we
examined protein association in vivo by imaging the
localization of HAP1, P150, and huntingtin in the cell. Because the
antibodies we used were all rabbit polyclonal antibodies, we could not
examine the colocalization of these proteins in the brain. Therefore we
expressed HA-tagged HAP1 or huntingtin in HEK 293 cells so a mouse
monoclonal antibody to the HA epitope could be used for
immunofluorescent double labeling. Expressed N-terminal huntingtin
(Fig. 5a) or full-length P150
(Fig. 5b) were diffusely distributed in the cytoplasm in
transfected HEK 293 cells. In addition, transfection of P150 into the
cells produced P150 decoration on thick, wavy bundle-like structures
similar to those observed by Waterman-Storer et al. (1995) in the Rat-2
cell line. These bundle-like structures are thought to be formed by
grouped microtubules (Waterman-Storer et al., 1995 ). Transfection of
HAP1-A isoform alone into HEK 293 cells, however, resulted in
HAP1-immunoreactive granular structures in the cytoplasm (Fig.
5c). Overexpression of HAP1-B or other proteins under the
same conditions did not display such structures (data not shown).
Similar HAP1 immunoreactive structures (0.5-5 µm in diameter) in the
rat brain were also observed and appeared to be cytoplasmic inclusions
(C. A. Gutekunst, S.-H. Li, X.-J. Li, S.M. Hersch, unpublished
observations). While the nature of these structures is being studied,
the unique and granular shapes of these structures allowed examination
of the colocalization of HAP1 and its associated proteins in
transfected cells.

View larger version (108K):
[in this window]
[in a new window]
|
Figure 5.
Colocalization of transfected HAP1-A with
huntingtin and P150 in HEK 293 cells. a, b, Transfection
of (a) huntingtin (amino acids 1-253) with 23 glutamine repeats or (b) full-length P150 resulted in a diffuse distribution of the expressed proteins in the
cytoplasm. c, Transfection of HAP1-A construct alone
resulted in HAP1-immunoreactive granular (arrows) and
punctate-like structures. d-f, Coexpression of HAP1-A
and (d) huntingtin or
(e) P150 resulted in protein colocalization on
the granular (arrows) and punctate-like (arrowheads) structures, whereas coexpression of
(f) HAP1-A and DRPLA did not.
Immunofluorescent double labeling used rabbit antibodies to the
respective proteins and mouse monoclonal antibodies to HA-tagged
proteins.
|
|
We cotransfected HAP1-A with HA-tagged huntingtin into HEK 293 cells.
The expressed huntingtin was precisely colocalized with HAP1-A to the
granular structures (Fig. 5d). Both proteins were also
colocalized to dots or punctate-like structures. Similarly, the
N-terminal huntingtin or full-length huntingtin with 44 glutamine repeats was also localized to these structures when coexpressed with
HAP1-A (data not shown). When P150 was expressed with the HA-tagged
HAP1-A in HEK 293 cells, its subcellular localization was changed, and
it was colocalized with HAP1-A to the granular or punctate-like
structures (Fig. 5e). To confirm the specificity of these
colocalizations, we cotransfected HAP1-A with HA-tagged DRPLA, another
glutamine-repeat protein that does not interact with HAP1 (Li et al.,
1995 ). DRPLA did not colocalize with HAP1-A on the cytoplasmic
structures (Fig. 5f). We also coexpressed HAP1-A with
GST protein or with another polyglutamine-repeat protein, ataxin-1 (Orr
et al., 1993 ). None of them was found to localize with HAP1-A to these
granules (data not shown).
 |
DISCUSSION |
The present study demonstrates that HAP1 interacts with dynactin
P150 and huntingtin, thus implying the presence of a protein complex
that includes huntingtin, HAP1, and P150. This conclusion is supported
by the following findings: (1) P150 and huntingtin specifically
interact with HAP1 in yeast; (2) P150 and huntingtin simultaneously
bind to GST-HAP1 in vitro; (3) a protein complex containing
these three proteins is precipitated by anti-HAP1 antibody and is also
present in the same fractions of sucrose gradients; and (4) HAP1
colocalizes with P150 and huntingtin in transfected cells, suggesting
that they do associate in vivo. Because dynactin P150
participates in dynein-mediated intracellular organelle or vesicle
transport, we propose that this protein complex is involved in the
coupling of the dynein-dynactin complex to intracellular organelles or
structures and that the function of huntingtin may be associated with
intracellular trafficking.
Consistent with the above idea, huntingtin has been found to associate
with a variety of membranous organelles and synaptic vesicles (DiFiglia
et al., 1995 ; Gutekunst et al., 1995 ; Sharp et al., 1995 ). Huntingtin
has also been found to bind to various proteins including
glyceraldehyde phosphate dehydrogenase (GAPDH) (Burke et al., 1996 ), an
unidentified calmodulin-associated protein (Bao et al., 1996 ), a
ubiquitin-conjugating protein (HIP2) (Kalchman et al., 1996 ), epidermal
growth factor (EGF) receptor-signaling complexes (Liu et al., 1997 ),
and a protein homologous to the yeast cytoskeleton-associated protein
Sla2p (HIP1) (Kalchman et al., 1997 ; Wanker et al., 1997 ). Therefore,
huntingtin may be involved in various protein complexes. The cellular
and subcellular localization of HAP1 has been found to be similar to
that of huntingtin (Gutekunst, Li, Hersch, unpublished observations).
Immunogold electron microscopy showed that HAP1 is associated with
microtubules and many types of membranous organelles, including
mitochondria, endoplasmic reticulum, tubulovesicles,
endosomal/lysosomal organelles, and synaptic vesicles (Gutekunst, Li,
Hersch, unpublished observations). HAP1 has also been found to
associate with the mitotic spindle apparatus (Martin et al., 1997 ) and
large dense-core vesicles in pheochromocytoma (PC12) cells (Sharp et
al., 1997 ). Yeast two-hybrid assays suggest that HAP1 interacts with
P150 and other unknown proteins. The interaction of HAP1 with dynactin
has also been observed by other investigators (Engelender et
al., 1997 ). Binding of HAP1 to various proteins may be necessary for
HAP1 to associate with intracellular organelles such as microtubules
and the granular structures seen in transfected cells. However, the
HAP1 construct used in the binding assay contains a partial -helical
coiled coil that could also mediate nonspecific protein interactions in
yeast. By testing the binding of HAP1 to various proteins that contain
coiled coil structures, we observed that HAP1 did not interact with
c-Jun and DRPLA that also contain a coiled coil structure. In addition,
HAP1 was not found to interact with c-Fos (amino acids 132-211),
another leucine zipper protein that also contains a coiled coil
structure (Li et al., 1995 ). Moreover, different regions of HAP1
mediated the binding of HAP1 to huntingtin, P150, or other proteins in
yeast. Therefore, it is unlikely that the binding of HAP1 to P150
results from a nonspecific interaction of the coiled coils. Instead,
HAP1 may be a multifunctional polypeptide with distinct domains for
interacting with various proteins.
Because yeast two-hybrid assays suggest that N-terminal huntingtin
(amino acids 1-253) binds to the region of HAP1 (amino acids 278-370)
that was unable to interact with P150, huntingtin and P150 may bind to
different regions of HAP1 and thus form a stable protein complex. The N
terminus of huntingtin was used to characterize its binding to HAP1
because it contains the polyglutamine repeat and could be expressed in
yeast and in vitro. Moreover, the N-terminal human
huntingtin containing an expanded glutamine repeat (>115 units) was
sufficient to induce a progressive neurological phenotype in transgenic
mice (Mangiarini et al., 1996 ). An in vitro binding assay
showed that the N terminus of huntingtin and P150 could be precipitated
by GST-HAP1. It is interesting to note that huntingtin, especially the
huntingtin with 44 glutamine repeats, seemed to decrease the binding of
P150 to HAP1. It remains to be shown whether an expanded polyglutamine
repeat alters the association of HAP1 with P150 in vivo.
A protein complex containing HAP1, P150, and huntingtin in
vivo is suggested by several lines of evidence.
Immunoprecipitation showed that huntingtin and P150 were coprecipitated
with HAP1 from rat brain. The nearly identical migrations of cytosolic
HAP1 and P150 in a sucrose gradient further supports this suggestion. Because P150 associates with a dynein protein complex that can be
isolated by ATP extraction of microtubules (Gill et al., 1991 ; Paschal
et al., 1993 ; Schafer et al., 1994 ), we also examined the association
of HAP1 and huntingtin with microtubules in the absence and presence of
ATP. Although HAP1 was found to be as enriched as P150 in microtubules,
ATP extraction of microtubules liberated less HAP1 than P150 in the ATP
eluate. Therefore, unlike other substoichiometric components in the
ATP-released dynactin complex (Gill et al., 1991 ; Paschal et al., 1993 ;
Schafer et al., 1994 ), HAP1 may be a minor form in this complex. The
association of HAP1 and P150 could mainly occur on membranous
organelles, microtubules, and/or in the cytosol. The lower sensitivity
of HAP1 to ATP extraction suggests that HAP1 may not directly or tightly bind to the dynein protein complex under these conditions. The
enrichment of HAP1 in microtubules may be because of some direct
binding of HAP1 to microtubules or to other molecules associated with
microtubules.
Previous studies using immunocytochemistry demonstrated that huntingtin
is associated with microtubules (DiFiglia et al., 1995 ; Gutekunst et
al., 1995 ; Bhide et al., 1996 ). However, we found that huntingtin was
not as enriched as HAP1 in microtubule pellets. It is possible that the
association of huntingtin with microtubules is via its binding to HAP1
and is therefore not as stable as the binding of HAP1 and P150 to
microtubules in vitro. Huntingtin may also be involved in
protein complexes other than the HAP1-dynactin complex, as suggested
by its relatively wide distribution in the sucrose gradient.
The distinct localization of P150 and huntingtin on HAP1 immunoreactive
granular structures in transfected cells further suggests that these
proteins may associate in vivo. Their colocalization was
selective because another polyglutamine-repeat protein, DRPLA, did not
colocalize with HAP1 on these structures. Overexpressed proteins in
transfected cells may not display the same subcellular localization as
they do in vivo; however, these HAP1-A-induced cytoplasmic
structures in transfected cells enabled us to examine the protein
colocalization in living cells. Although the nature of these structures
remains to be defined, imaging the protein colocalization on these
structures is especially helpful for confirming the binding results
obtained from the yeast two-hybrid screen, in vitro binding,
and immunoprecipitation. Because the definitive subcellular
distribution of P150 in vivo has not been obtained, extensive studies are required to confirm whether HAP1 and P150 also
colocalize in the brain.
The association of HAP1 with P150 and huntingtin provides a possible
link between intracellular transport and the function of normal
huntingtin. This is because the dynactin complex is required for
dynein-mediated vesicle movement in vitro and the function
of P150 is thought to be the targeting of dynein motor proteins to
intracellular organelles (Gill et al., 1991 ; Schroer and Sheetz, 1991 ).
Targeting of microtubule motor proteins to membranous organelles may
involve a number of different proteins that dynamically associate with
a variety of vesicles or organelles. In addition, huntingtin could be
intracellularly transported by the HAP1-dynactin complex. Given that
the dynactin P150 protein complex plays a role in the targeting or
transporting of intracellular organelles or molecules, it is possible
that HAP1 and normal huntingtin may have a role in intracellular
trafficking.
 |
FOOTNOTES |
Received Sept. 24, 1997; revised Nov. 13, 1997; accepted Dec. 1, 1997.
This work was supported by Emory University Research Committee, the
Wills Foundation, the Hereditary Disease Foundation (X.-J.L.), the
United States Public Health Service (Grant NS01624 to S.M.H.), and the
Markey Center for Neurological Sciences (C.-A.G.). We thank Drs.
Richard Kahn and Dean Danner for critical reading of this manuscript.
We are grateful to Dr. Holzbaur at the University of Pennsylvania for
generously providing antibodies for dynactin P150. We thank Drs. P. Worley and A. Lanahan for providing a rat brain cDNA library for the
yeast two-hybrid screening.
Correspondence should be addressed to Dr. Xiao-Jiang Li, Department of
Genetics, Emory University School of Medicine, Atlanta, GA 30322. E-mail address: XiaoLi{at}Genetics.emory.edu
 |
REFERENCES |
-
Albin RL,
Tagle DA
(1995)
Genetics and molecular biology of Huntington's disease.
Trends Neurosci
18:11-14[Web of Science][Medline].
-
Allan V
(1994)
Organelle movement. Dynactin: portrait of a dynein regulator.
Curr Biol
4:1000-1002[Web of Science][Medline].
-
Bao J,
Sharp AH,
Wagster MV,
Becher M,
Schilling G,
Ross CA,
Dawson VL,
Dawson TM
(1996)
Expansion of polyglutamine repeat in huntingtin leads to abnormal protein interactions involving calmodulin.
Proc Natl Acad Sci USA
93:5037-5042[Abstract/Free Full Text].
-
Bhide PG,
Day M,
Sapp E,
Schwarz C,
Sheth A,
Kim J,
Young AB,
Penney J,
Golden J,
Aronin N,
DiFiglia M
(1996)
Expression of normal and mutant huntingtin in the developing brain.
J Neurosci
16:5523-5535[Abstract/Free Full Text].
-
Brady ST
(1985)
A novel brain ATPase with properties expected for the fast axonal transport motor.
Nature
317:73-75[Medline].
-
Brady ST,
Pfister KK,
Bloom GS
(1990)
A monoclonal antibody against kinesin inhibits both anterograde and retrograde fast axonal transport in squid axoplasm.
Proc Natl Acad Sci USA
87:1061-1065[Abstract/Free Full Text].
-
Burke JR,
Enghild JJ,
Martin ME,
Jou YS,
Myers RM,
Roses AD,
Vance JM,
Strittmatter WJ
(1996)
Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH.
Nat Med
2:347-350[Web of Science][Medline].
-
Chevray PM,
Nathans D
(1992)
Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun.
Proc Natl Acad Sci USA
89:5789-5793[Abstract/Free Full Text].
-
Corthesy-Theulaz I,
Pauloin A,
Rfeffer SR
(1992)
Cytoplasmic dynein participates in the centrosomal localization of the Golgi complex.
J Cell Biol
118:1333-1345[Abstract/Free Full Text].
-
DiFiglia M,
Sapp E,
Chase K,
Schwarz C,
Meloni A,
Young C,
Martin E,
Vonsattel JP,
Carraway R,
Reeves SA,
Boyce FM,
Aronin N
(1995)
Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons.
Neuron
14:1075-1081[Web of Science][Medline].
-
Engelender S,
Sharp AH,
Colomer V,
Ross CA
(1997)
Huntingtin associated protein (HAP-1) interacts with protein related to cytoskeletal components.
Soc Neurosci Abstr
23:1910.
-
Fields S,
Song O
(1989)
A novel genetic system to detect protein-protein interactions.
Nature
340:245-246[Medline].
-
Gill SR,
Schroer TA,
Szilak I,
Steuer ER,
Sheetz MP,
Cleveland DW
(1991)
Dynactin a conserved ubiquitously expressed component of an activator of vesicle motility mediated by cytoplasmic dynein.
J Cell Biol
115:1639-1650[Abstract/Free Full Text].
-
Gutekunst CA,
Levey AI,
Heilman CJ,
Whaley WL,
Yi H,
Nash NR,
Rees HD,
Madden JJ,
Hersch SM
(1995)
Identification and localization of huntingtin in brain and human lymphoblastoid cell lines with anti-fusion protein antibodies.
Proc Natl Acad Sci USA
92:8710-8714[Abstract/Free Full Text].
-
Gutekunst CA,
Li S-H,
Yi H,
Ferrante RJ,
Li X-J,
Hersch SM
(1997)
Subcellular localization of HAP1: similarity to huntingtin and identification of a unique neuronal organelle.
Soc Neurosci Abstr
23:1911.
-
Harte PJ,
Kankel DR
(1982)
Genetic analysis of mutations at the Glued locus and interacting loci in Drosophila melanogaster.
Genetics
101:477-501[Abstract/Free Full Text].
-
HD Collaborative Research Group
(1993)
A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes.
Cell
72:971-983[Web of Science][Medline].
-
Hirokawa N,
Sato-Yoshitake R,
Kobayashi N,
Pfister KK,
Bloom GS,
Brady ST
(1991)
Kinesin associates with anterogradely transported membranous organelles in vivo.
J Cell Biol
114:295-302[Abstract/Free Full Text].
-
Holzbaur EL,
Hammarback JA,
Paschal BM,
Kravit NG,
Pfister KK,
Vallee RB
(1991)
Homology of a 150K cytoplasmic dynein-associated polypeptide with the Drosophila gene Glued.
Nature
351:579-583[Medline].
-
Kalchman MA,
Graham RK,
Xia G,
Koide HB,
Hodgson JG,
Graham KC,
Goldberg YP,
Gietz RD,
Pickart CM,
Hayden MR
(1996)
Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme.
J Biol Chem
271:19385-19394[Abstract/Free Full Text].
-
Kalchman MA,
Koide HB,
McCutcheon K,
Graham RK,
Nichol K,
Nishiyama K,
Kazemi-Esfarjani P,
Lynn FC,
Wellington C,
Metzler M,
Goldberg YP,
Kanazawa I,
Gietz RD,
Hayden MR
(1997)
HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain.
Nat Genet
16:44-53[Web of Science][Medline].
-
Li X-J,
Snyder SH
(1995)
Molecular cloning of Ebnerin, a von Ebner's gland protein associated with taste buds.
J Biol Chem
270:17674-17679[Abstract/Free Full Text].
-
Li X-J,
Li S-H,
Sharp AH,
Nucifora Jr FC,
Schilling G,
Lanahan A,
Worley P,
Snyder SH,
Ross CA
(1995)
A huntingtin-associated protein enriched in brain with implications for pathology.
Nature
378:398-402[Medline].
-
Li X-J,
Sharp AH,
Li SH,
Dawson TM,
Snyder SH,
Ross CA
(1996)
Huntingtin-associated protein (HAP1): discrete neuronal localizations in the brain resemble those of neuronal nitric oxide synthase.
Proc Natl Acad Sci USA
93:4839-4844[Abstract/Free Full Text].
-
Liu YF,
Deth RC,
Devys D
(1997)
SH3 domain-dependent association of huntingtin with epidermal growth factor receptor signaling complexes.
J Biol Chem
272:8121-8124[Abstract/Free Full Text].
-
Lupas A,
Van Dyke M,
Stock J
(1991)
Predicting coiled coils from protein sequences.
Science
252:1162-1164[Free Full Text].
-
Mangiarini L,
Sathasivam L,
Seller M,
Cozens B,
Harper A,
Hetherington C,
Lawton M,
Trottier Y,
Lehrach H,
Davies SW,
Bates GP
(1996)
Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice.
Cell
87:493-509[Web of Science][Medline].
-
Martin EJ,
Kim M,
Velier J,
Sapp E,
Lee H-S,
Chase K,
Won LA,
Bhide PG,
Heller A,
Aronin N,
DiFiglia M
(1997)
Localization of huntingtin associated protein 1 in brain and somatic tissues.
Soc Neurosci Abstr
23:1910.
-
Nagafuchi S,
Yanagisawa H,
Sato K,
Shirayama T,
Ohsaki E,
Bundo M,
Takeda T,
Tadokoro K,
Kondo I,
Murayama N,
Tanaka Y,
Kikushima H,
Umino K,
Kurosawa H,
Furukawa T,
Nihei K,
Inoue T,
Sano A,
Komure O,
Takahashi M,
Yoshizawa T,
Kanazawa I,
Yamada M
(1994)
Dentatorubral and pallidoluysian atrophy expansion of an unstable CAG trinucleotide on chromosome 12p.
Nat Genet
6:14-18[Web of Science][Medline].
-
Orr HT,
Chung MY,
Banfi S,
Kwiatkowski Jr TJ,
Servadio A,
Beaudet AL,
McCall E,
Duvick LA,
Ranum LP,
Zoghbi HY
(1993)
Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1.
Nat Genet
4:221-226[Web of Science][Medline].
-
Paschal BM,
Vallee RB
(1987)
Retrograde transport by the microtubule-associated protein MAP 1C.
Nature
330:181-183[Medline].
-
Paschal BM,
Shpetner HS,
Vallee RB
(1991)
Purification of brain cytoplasmic dynein and characterization of its in vitro properties.
Methods Enzymol
196:181-191[Web of Science][Medline].
-
Paschal BM,
Holzbaur EL,
Pfister KK,
Clark S,
Meyer DI,
Vallee RB
(1993)
Characterization of a 50 kDa polypeptide in cytoplasmic dynein preparations reveals a complex with p150GLUED and a novel actin.
J Biol Chem
268:15318-15323[Abstract/Free Full Text].
-
Perutz MF,
Johnson T,
Suzuki M,
Finch JT
(1994)
Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases.
Proc Natl Acad Sci USA
91:5355-5358[Abstract/Free Full Text].
-
Pfarr CM,
Coue M,
Grissom PM,
Hays TS,
Porter ME,
McIntosh JR
(1990)
Cytoplasmic dynein is localized to kinetochores during mitosis.
Nature
345:263-265[Medline].
-
Ross CA
(1995)
When more is less: pathogenesis of glutamine repeat neurodegenerative diseases.
Neuron
15:493-496[Web of Science][Medline].
-
Saunders WS,
Koshland D,
Eshel D,
Gibbons IR,
Hoyt MA
(1995)
Saccharomyces cerevisiae kinesin- and dynein-related proteins required for anaphase chromosome segregation.
J Cell Biol
128:617-624[Abstract/Free Full Text].
-
Schafer DA,
Korshunova YO,
Schroer TA,
Cooper JA
(1994)
Differential localization and sequence analysis of capping protein beta-subunit isoforms of vertebrates.
J Cell Biol
127:453-465[Abstract/Free Full Text].
-
Schroer TA,
Sheetz MP
(1991)
Two activators of microtubule-based vesicle transport.
J Cell Biol
115:1309-1318[Abstract/Free Full Text].
-
Sharp AH,
Loev SJ,
Schilling G,
Li SH,
Li XJ,
Bao J,
Wagster MV,
Kotzuk JA,
Steiner JP,
Lo A,
Hedreen J,
Sisodia S,
Snyder SH,
Dawson TM,
Ryugo DK,
Ross CA
(1995)
Widespread expression of Huntington's disease gene (IT15) protein product.
Neuron
14:1065-1074[Web of Science][Medline].
-
Sharp AH,
Zhang C,
Ward CM,
Cooper JK,
Colomer V,
Ross CA
(1997)
Huntingtin associated protein (HAP1): association with membranous organelles possibly including large dense-core vesicles.
Soc Neurosci Abstr
23:1909.
-
Steuer ER,
Wordeman L,
Schroer TA,
Sheetz MP
(1990)
Localization of cytoplasmic dynein to mitotic spindles and kinetochores.
Nature
345:266-268[Medline].
-
Tokito MK,
Howland DS,
Lee VMY,
Holzbaur ELF
(1996)
Functionally distinct isoforms of dynactin are expressed in human neurons.
Mol Biol Cell
7:1167-1180[Abstract].
-
Vale RD,
Schnapp BJ,
Mitchison T,
Steuer E,
Reese TS,
Sheetz MP
(1985)
Different axoplasmic proteins generate movement in opposite directions along microtubules in vitro.
Cell
43:623-632[Web of Science][Medline].
-
Vallee RB,
Sheetz MP
(1996)
Targeting of motor proteins.
Science
271:1539-1544[Abstract].
-
Vaughan KT,
Vallee RB
(1995)
Cytoplasmic dynein binds dynactin through a direct interaction between the intermediate chains and p150Glued.
J Cell Biol
131:1507-1516[Abstract/Free Full Text].
-
Wanker EE,
Rovira C,
Scherzinger E,
Hasenbank R,
Walter S,
Tait D,
Colicelli J,
Lehrach H
(1997)
HIP-I: a huntingtin interacting protein isolated by the yeast two-hybrid system.
Hum Mol Genet
6:487-495[Abstract/Free Full Text].
-
Waterman-Storer CM,
Karki S,
Holzbaur EL
(1995)
The p150Glued component of the dynactin complex binds to both microtubules and the actin-related protein centractin (Arp-1).
Proc Natl Acad Sci USA
92:1634-1638[Abstract/Free Full Text].
-
Xiang X,
Beckwith SM,
Morris NR
(1994)
Cytoplasmic dynein is involved in nuclear migration in Aspergillus nidulans.
Proc Natl Acad Sci USA
91:2100-2104[Abstract/Free Full Text].
Copyright © 1998 Society for Neuroscience 0270-6474/98/1841261-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. J. Lee, C. Chae, and M. M. Wang
p150/Glued Modifies Nuclear Estrogen Receptor Function
Mol. Endocrinol.,
May 1, 2009;
23(5):
620 - 629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Russo, K. Louie, A. Wellington, G. T. Macleod, F. Hu, S. Panchumarthi, and K. E. Zinsmaier
Drosophila Miro Is Required for Both Anterograde and Retrograde Axonal Mitochondrial Transport
J. Neurosci.,
April 29, 2009;
29(17):
5443 - 5455.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zala, E. Colin, H. Rangone, G. Liot, S. Humbert, and F. Saudou
Phosphorylation of mutant huntingtin at S421 restores anterograde and retrograde transport in neurons
Hum. Mol. Genet.,
December 15, 2008;
17(24):
3837 - 3846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shimojo
Huntingtin Regulates RE1-silencing Transcription Factor/Neuron-restrictive Silencer Factor (REST/NRSF) Nuclear Trafficking Indirectly through a Complex with REST/NRSF-interacting LIM Domain Protein (RILP) and Dynactin p150Glued
J. Biol. Chem.,
December 12, 2008;
283(50):
34880 - 34886.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-S. Her and L. S. B. Goldstein
Enhanced Sensitivity of Striatal Neurons to Axonal Transport Defects Induced by Mutant Huntingtin
J. Neurosci.,
December 10, 2008;
28(50):
13662 - 13672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Mugat, M.-L. Parmentier, N. Bonneaud, H. Y. E. Chan, and F. Maschat
Protective role of Engrailed in a Drosophila model of Huntington's disease
Hum. Mol. Genet.,
November 15, 2008;
17(22):
3601 - 3616.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Metzger, J. Rong, H.-P. Nguyen, A. Cape, J. Tomiuk, A. S. Soehn, P. Propping, Y. Freudenberg-Hua, J. Freudenberg, L. Tong, et al.
Huntingtin-associated protein-1 is a modifier of the age-at-onset of Huntington's disease
Hum. Mol. Genet.,
April 15, 2008;
17(8):
1137 - 1146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Lumsden, T. L. Henshall, S. Dayan, M. T. Lardelli, and R. I. Richards
Huntingtin-deficient zebrafish exhibit defects in iron utilization and development
Hum. Mol. Genet.,
August 15, 2007;
16(16):
1905 - 1920.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Caviston, J. L. Ross, S. M. Antony, M. Tokito, and E. L. F. Holzbaur
Huntingtin facilitates dynein/dynactin-mediated vesicle transport
PNAS,
June 12, 2007;
104(24):
10045 - 10050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rong, S. Li, G. Sheng, M. Wu, B. Coblitz, M. Li, H. Fu, and X.-J. Li
14-3-3 Protein Interacts with Huntingtin-associated Protein 1 and Regulates Its Trafficking
J. Biol. Chem.,
February 16, 2007;
282(7):
4748 - 4756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Trushina, R. D. Singh, R. B. Dyer, S. Cao, V. H. Shah, R. G. Parton, R. E. Pagano, and C. T. McMurray
Mutant huntingtin inhibits clathrin-independent endocytosis and causes accumulation of cholesterol in vitro and in vivo
Hum. Mol. Genet.,
December 15, 2006;
15(24):
3578 - 3591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Kirk, L.-S. Chin, and L. Li
GRIF1 binds Hrs and is a new regulator of endosomal trafficking
J. Cell Sci.,
November 15, 2006;
119(22):
4689 - 4701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. T. Cox and A. C. Spradling
Milton controls the early acquisition of mitochondria by Drosophila oocytes
Development,
September 1, 2006;
133(17):
3371 - 3377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rong, J. R. McGuire, Z.-H. Fang, G. Sheng, J.-Y. Shin, S.-H. Li, and X.-J. Li
Regulation of intracellular trafficking of huntingtin-associated protein-1 is critical for TrkA protein levels and neurite outgrowth.
J. Neurosci.,
May 31, 2006;
26(22):
6019 - 6030.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. McGuire, J. Rong, S.-H. Li, and X.-J. Li
Interaction of Huntingtin-associated Protein-1 with Kinesin Light Chain: IMPLICATIONS IN INTRACELLULAR TRAFFICKING IN NEURONS
J. Biol. Chem.,
February 10, 2006;
281(6):
3552 - 3559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Liao, J. Shen, Y. Zhang, S.-H. Li, X.-J. Li, and H. Li
Immunohistochemical Localization of Huntingtin-associated Protein 1 in Endocrine System of the Rat
J. Histochem. Cytochem.,
December 1, 2005;
53(12):
1517 - 1524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Sahlender, R. C. Roberts, S. D. Arden, G. Spudich, M. J. Taylor, J. P. Luzio, J. Kendrick-Jones, and F. Buss
Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis
J. Cell Biol.,
April 25, 2005;
169(2):
285 - 295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Brickley, M. J. Smith, M. Beck, and F. A. Stephenson
GRIF-1 and OIP106, Members of a Novel Gene Family of Coiled-Coil Domain Proteins: ASSOCIATION IN VIVO AND IN VITRO WITH KINESIN
J. Biol. Chem.,
April 15, 2005;
280(15):
14723 - 14732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gunawardena and L. S. B. Goldstein
Polyglutamine Diseases and Transport Problems: Deadly Traffic Jams on Neuronal Highways
Arch Neurol,
January 1, 2005;
62(1):
46 - 51.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dragatsis, S. Zeitlin, and P. Dietrich
Huntingtin-associated protein 1 (Hap1) mutant mice bypassing the early postnatal lethality are neuroanatomically normal and fertile but display growth retardation
Hum. Mol. Genet.,
December 15, 2004;
13(24):
3115 - 3125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-y. Cheung, Y. Zhang, J. Long, S. Lin, M. Zhang, Y. Jiang, and Z. Wu
p150Glued, Dynein, and Microtubules Are Specifically Required for Activation of MKK3/6 and p38 MAPKs
J. Biol. Chem.,
October 29, 2004;
279(44):
45308 - 45311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Trushina, R. B. Dyer, J. D. Badger II, D. Ure, L. Eide, D. D. Tran, B. T. Vrieze, V. Legendre-Guillemin, P. S. McPherson, B. S. Mandavilli, et al.
Mutant Huntingtin Impairs Axonal Trafficking in Mammalian Neurons In Vivo and In Vitro
Mol. Cell. Biol.,
September 15, 2004;
24(18):
8195 - 8209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Kittler, P. Thomas, V. Tretter, Y. D. Bogdanov, V. Haucke, T. G. Smart, and S. J. Moss
Huntingtin-associated protein 1 regulates inhibitory synaptic transmission by modulating {gamma}-aminobutyric acid type A receptor membrane trafficking
PNAS,
August 24, 2004;
101(34):
12736 - 12741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Li, Z.-X. Yu, C.-L. Li, H.-P. Nguyen, Y.-X. Zhou, C. Deng, and X.-J. Li
Lack of Huntingtin-Associated Protein-1 Causes Neuronal Death Resembling Hypothalamic Degeneration in Huntington's Disease
J. Neurosci.,
July 30, 2003;
23(17):
6956 - 6964.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-A. Gutekunst, E. R. Torre, Z. Sheng, H. Yi, S. H. Coleman, I. B. Riedel, and H. Bujo
Stigmoid Bodies Contain Type I Receptor Proteins SorLA/LR11 and Sortilin: New Perspectives on Their Function
J. Histochem. Cytochem.,
June 1, 2003;
51(6):
841 - 852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Beck, K. Brickley, H. L. Wilkinson, S. Sharma, M. Smith, P. L. Chazot, S. Pollard, and F. A. Stephenson
Identification, Molecular Cloning, and Characterization of a Novel GABAA Receptor-associated Protein, GRIF-1
J. Biol. Chem.,
August 9, 2002;
277(33):
30079 - 30090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, L.-S. Chin, A. I. Levey, and L. Li
Huntingtin-associated Protein 1 Interacts with Hepatocyte Growth Factor-regulated Tyrosine Kinase Substrate and Functions in Endosomal Trafficking
J. Biol. Chem.,
July 26, 2002;
277(31):
28212 - 28221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-X. Yu, S.-H. Li, H.-P. Nguyen, and X.-J. Li
Huntingtin inclusions do not deplete polyglutamine-containing transcription factors in HD mice
Hum. Mol. Genet.,
April 15, 2002;
11(8):
905 - 914.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Y. W. Chan, J. Nasir, C.-A. Gutekunst, S. Coleman, A. Maclean, A. Maas, M. Metzler, M. Gertsenstein, C. A. Ross, A. Nagy, et al.
Targeted disruption of Huntingtin-associated protein-1 (Hap1) results in postnatal death due to depressed feeding behavior
Hum. Mol. Genet.,
April 15, 2002;
11(8):
945 - 959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Li, A. L. Cheng, H. Zhou, S. Lam, M. Rao, H. Li, and X.-J. Li
Interaction of Huntington Disease Protein with Transcriptional Activator Sp1
Mol. Cell. Biol.,
March 1, 2002;
22(5):
1277 - 1287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sathasivam, B. Woodman, A. Mahal, F. Bertaux, E. E. Wanker, D. T. Shima, and G. P. Bates
Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients
Hum. Mol. Genet.,
October 1, 2001;
10(21):
2425 - 2435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Waelter, E. Scherzinger, R. Hasenbank, E. Nordhoff, R. Lurz, H. Goehler, C. Gauss, K. Sathasivam, G. P. Bates, H. Lehrach, et al.
The huntingtin interacting protein HIP1 is a clathrin and {alpha}-adaptin-binding protein involved in receptor-mediated endocytosis
Hum. Mol. Genet.,
August 1, 2001;
10(17):
1807 - 1817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. B. Goldstein
Kinesin molecular motors: Transport pathways, receptors, and human disease
PNAS,
June 19, 2001;
98(13):
6999 - 7003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Kegel, M. Kim, E. Sapp, C. McIntyre, J. G. Castano, N. Aronin, and M. DiFiglia
Huntingtin Expression Stimulates Endosomal-Lysosomal Activity, Endosome Tubulation, and Autophagy
J. Neurosci.,
October 1, 2000;
20(19):
7268 - 7278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Metzler, C. D. Helgason, I. Dragatsis, T. Zhang, L. Gan, N. Pineault, S. O. Zeitlin, R. K. Humphries, and M. R. Hayden
Huntingtin is required for normal hematopoiesis
Hum. Mol. Genet.,
February 12, 2000;
9(3):
387 - 394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Li, A. L. Cheng, H. Li, and X.-J. Li
Cellular Defects and Altered Gene Expression in PC12 Cells Stably Expressing Mutant Huntingtin
J. Neurosci.,
July 1, 1999;
19(13):
5159 - 5172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-A. Gutekunst, S.-H. Li, H. Yi, J. S. Mulroy, S. Kuemmerle, R. Jones, D. Rye, R. J. Ferrante, S. M. Hersch, and X.-J. Li
Nuclear and Neuropil Aggregates in Huntington's Disease: Relationship to Neuropathology
J. Neurosci.,
April 1, 1999;
19(7):
2522 - 2534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. PIREDDA, M. GRAZIA FARRACE, M. LO BELLO, W. MALORNI, G. MELINO, R. PETRUZZELLI, and M. PIACENTINI
Identification of `tissue' transglutaminase binding proteins in neural cells committed to apoptosis
FASEB J,
February 1, 1999;
13(2):
355 - 364.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. E. Mains, M. R. Alam, R. C. Johnson, D. N. Darlington, N. Back, T. A. Hand, and B. A. Eipper
Kalirin, a Multifunctional PAM COOH-terminal Domain Interactor Protein, Affects Cytoskeletal Organization and ACTH Secretion from AtT-20 Cells
J. Biol. Chem.,
January 29, 1999;
274(5):
2929 - 2937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Ratovitski, M. R. Alam, R. A. Quick, A. McMillan, C. Bao, C. Kozlovsky, T. A. Hand, R. C. Johnson, R. E. Mains, B. A. Eipper, et al.
Kalirin Inhibition of Inducible Nitric-oxide Synthase
J. Biol. Chem.,
January 8, 1999;
274(2):
993 - 999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-A. Gutekunst, S.-H. Li, H. Yi, R. J. Ferrante, X.-J. Li, and S. M. Hersch
The Cellular and Subcellular Localization of Huntingtin-Associated Protein 1 (HAP1): Comparison with Huntingtin in Rat and Human
J. Neurosci.,
October 1, 1998;
18(19):
7674 - 7686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Li, S. H. Hosseini, C.-A. Gutekunst, S. M. Hersch, R. J. Ferrante, and X.-J. Li
A Human HAP1 Homologue. CLONING, EXPRESSION, AND INTERACTION WITH HUNTINGTIN
J. Biol. Chem.,
July 24, 1998;
273(30):
19220 - 19227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Peters and C. A. Ross
Isolation of a 40-kDa Huntingtin-associated Protein
J. Biol. Chem.,
January 26, 2001;
276(5):
3188 - 3194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Muchowski, K. Ning, C. D'Souza-Schorey, and S. Fields
Requirement of an intact microtubule cytoskeleton for aggregation and inclusion body formation by a mutant huntingtin fragment
PNAS,
January 22, 2002;
99(2):
727 - 732.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|