 |
 Previous Article | Next Article 
The Journal of Neuroscience, March 15, 1998, 18(6):2247-2253
Vagotomy Blocks the Induction of Interleukin-1 (IL-1) mRNA
in the Brain of Rats in Response to Systemic IL-1
Michael K.
Hansen,
Ping
Taishi,
Zutang
Chen, and
James
M.
Krueger
Department of Physiology and Biophysics, The University of
Tennessee, Memphis, Tennessee 38163
 |
ABSTRACT |
There is considerable interest in the mechanisms by which systemic
cytokines signal the CNS to elicit centrally controlled biological
actions. This study determined the effects of intraperitoneal injections of interleukin-1 (IL-1) on IL-1 mRNA and IL-1
receptor accessory protein (IL-1RAP) mRNA production in rat liver and
brain using the reverse transcription-PCR. Saline or IL-1 (0.5 µg/kg) was injected intraperitoneally in subdiaphragmatically
vagotomized and sham-operated (SHAM) rats. All injections were
performed at dark onset, and rats were killed 2 hr after the injection.
In SHAM rats, IL-1 increased IL-1 mRNA levels in the liver,
hypothalamus, hippocampus, and brainstem. Subdiaphragmatic vagotomy
blocked the IL-1-induced increase in IL-1 mRNA in the brainstem
and hippocampus and significantly attenuated the increase in the
hypothalamus. Vagotomy did not affect IL-1-induced IL-1 mRNA
production in the liver. IL-1RAP mRNA was highly expressed in each
region examined; however, no significant differences in IL-1RAP mRNA
production were found in any region after IL-1 injection. The
current results indicate that the vagus nerve is involved in
transmitting cytokine signals to the brain and suggest that the
induction of brain cytokines is a critical step in the pathway by which
vagal-mediated signals result in centrally controlled symptoms of the
acute phase response.
Key words:
interleukin-1; interleukin-1 receptor accessory protein; vagotomy; cytokine; vagus nerve; RT-PCR; mRNA; sleep; fever; acute
phase response
| |
INTRODUCTION |
Interleukin-1 (IL-1) is a
proinflammatory cytokine involved in the regulation of several
physiological CNS processes (e.g., sleep and appetite regulation), and
it plays a role in neural immune responses to tissue damage and
infection (for review, see Krueger and Majde, 1994 ). The peripheral
administration of IL-1 induces many of the symptoms accompanying the
acute phase responses that are mediated by the CNS, including fever,
excess sleep, and social withdrawal (Krueger et al., 1984; Watkins et
al., 1995a; Bluthé et al., 1996; Hansen and Krueger; 1997). These
symptoms also occur after the administration of substances that induce IL-1 production, such as bacterial lipopolysaccharide (LPS) or muramyl-dipeptide (Sehic and Blatteis, 1996; Goldbach et al., 1997;
Kapás et al., 1997). Conversely, inhibition of IL-1 blocks many of the illness responses induced by these agents (Kent et al.,
1992). Furthermore, fever, excess sleep, and behavioral effects of
systemic IL-1, LPS, or muramyl-dipeptide are blocked by the central
inhibition of IL-1 (Kent et al., 1992; Klir et al., 1994; Takahashi
et al., 1996). These data clearly indicate that both systemic and
central pools of IL-1 are important in these responses.
The mechanisms by which peripheral cytokines signal the brain to elicit
central manifestations of the acute phase response have not been
conclusively identified. Cytokines are relatively large, hydrophilic
peptides and are not expected to readily cross the blood-brain
barrier. A saturable transport mechanism for several cytokines exists
(Banks et al., 1991); however, it is uncertain whether the amounts
shown to enter the brain are sufficient to activate central mechanisms.
Furthermore, there is increasing evidence suggesting that vagal
afferents transmit systemic cytokine information to the brain. Thus, in
rats, mice, and guinea pigs, various measures of the acute phase
response are inhibited by vagotomy (for review, see Watkins et al.,
1995b; Blatteis and Sehic, 1997). IL-1 increases vagal afferent
activity (Niijima, 1996), and IL-1 receptors are found on paraganglia
in the hepatic vagus (Goehler et al., 1997). Furthermore, vagotomy
blocks the induction of IL-1 mRNA in the brain of LPS-treated mice
(Layé et al., 1995). Collectively, this evidence suggests that
after an appropriate challenge, the production of IL-1 in brain may be a critical step in the pathway by which vagal-mediated signals result in centrally controlled symptoms of the acute phase
response.
The aim of the present study was to determine (1) whether
intraperitoneal injections of IL-1 induce IL-1 mRNA expression in
the brain, and (2) whether this effect can be blocked by
subdiaphragmatic vagotomy. The dose of IL-1 used in the current
study, 0.5 µg/kg, was demonstrated previously to induce sleep and
fever in rats; vagotomy blocked the fever and attenuated the
sleep-inducing effects of this dose (Hansen and Krueger, 1997). The
current experiments also sought to determine variations in
interleukin-1 receptor accessory protein (IL-1RAP) mRNA levels in
response to systemic IL-1. The IL-1RAP has recently been cloned in
mice (Greenfeder et al., 1995) and rats (Liu et al., 1996) and is
involved in IL-1 binding and signal transduction.
| |
MATERIALS AND METHODS |
Animals. Adult male Sprague Dawley rats (250 gm at
purchase; Harlan Sprague Dawley, Indianapolis, IN) were used in this
study. The animals were housed individually and maintained on a 12 hr light/dark cycle (lights on at 5 A.M. and off at 5 P.M.) and at 25 ± 1°C ambient temperature. Food and
water were continuously available unless otherwise noted.
Surgeries. Bilateral subdiaphragmatic vagotomy (VX) and
pyloroplasty were performed on rats as described previously (Hansen et
al., 1997). Briefly, after an overnight fast, rats were anesthetized using ketamine and xylazine (87 and 13 mg/kg, respectively, i.p.). The
stomach and lower esophagus were visualized from an upper midline
laparotomy. The stomach was gently retracted down beneath the diaphragm
to clearly expose both vagal trunks. At least 1 cm of the visible vagal
nerve was dissected. In addition, all neural and connective tissue
surrounding the esophagus immediately below the diaphragm was removed
to transect all small vagal branches. The vagotomy was supplemented
with pyloroplasty to prevent gastric stasis. An incision was made
parallel to the axis of the pylorus, through the pyloric sphincter, and
then the pylorus wall was reconstructed by sutures perpendicular to the
pylorus axis. The stomach was returned to its normal position, and the
incisions were closed. Sham-operated (SHAM) animals were prepared,
subjected only to pyloroplasty. All animals gained weight during the
recovery period and appeared healthy. Furthermore, there was no
significant difference in body weight at the time of experimental
testing.
Three weeks after either VX or SHAM surgery the completeness of
vagotomy was assessed as described previously (Hansen and Krueger,
1997). This test is based on the satiety effect of cholecystokinin (CCK), which is known to be mediated by the vagus nerve (Smith et al.,
1981). In brief, rats were injected intraperitoneally with saline or 4 µg/kg CCK (CCK-octapeptide; Peninsula Laboratories, Belmont, CA)
after 20 hr of food deprivation; a minimum of 3 d was allowed
between the saline and CCK injections. Food intake was then measured
after 1 hr in both SHAM and VX rats.
Experimental protocol. The animals were then allowed at
least another 1 week recovery period. During this time, rats received daily intraperitoneal injections of pyrogen-free saline at dark onset,
the time when the experimental treatments were done. Rats were injected
with saline or 0.5 µg/kg recombinant human IL-1 (R & D Systems,
Minneapolis, MN). IL-1 was dissolved in saline, and all injections
were given by the intraperitoneal route and delivered in an injection
volume of 1 ml/kg. Three groups of rats were used. Group I
(n = 6) were SHAM rats that received saline injections.
In a preliminary study, it was found that there are no significant
differences in IL-1 or IL-1RAP mRNA expression in the liver or brain
of saline-injected SHAM and VX rats. Group II rats (n = 6) were SHAM, and group III (n = 6) were VX rats; groups II and III were injected with IL-1. Rats were killed by decapitation 2 hr after either saline or IL-1 injection. The liver
and brain were quickly removed, and the hypothalamus, hippocampus, and
brainstem were rapidly dissected. Liver and brain samples were
snap-frozen in liquid nitrogen and stored at  80°C until RNA
extraction.
In a separate control experiment, rats (n = 4) were
injected with 0.5 µg/kg IL-1 that had been heat-inactivated at
95°C for 30 min. Rats were killed 2 hr after the injection, and brain
and liver samples were collected as above. Also, as a positive control, rats (n = 5 per group) were injected intraperitoneally
with saline or 100 µg/kg Escherichia coli LPS (055:B5;
Sigma, St. Louis, MO). For this study, rats were killed 90 min after
the injection, and liver samples were collected.
RNA extraction. Total cellular RNA was isolated after
homogenization of the tissue samples in guanidine thiocyanate-phenol solution (RNA STAT-60; Tel-Test, Friendswood, TX) according to the
instructions provided. Each brain region was homogenized in 2 ml and
~100 mg of liver tissue in 3 ml of RNA-STAT-60 using a microtissue
grinder. Liver and brain samples from each rat were homogenized and
processed individually. The integrity of the RNA was checked by
denaturing agarose gel electrophoresis and ethidium bromide staining.
The total amount was measured by spectrophotometry at an absorbance of
260 nm.
Preparation of internal standard cRNAs. A plasmid containing
the coding region for rat IL-1 was constructed using PCR
amplification of cDNA synthesized from rat brain total RNA. The 5'
oligonucleotide used was
5'-GAAGAGCTCATGGCAACTGTCCCTGAACTC-3', which introduces an
SacI site (underlined) upstream of the initiator methionine codon. The 3' antisense oligonucleotide used was
5'-CAGCTCGAGTTAGGAAGACACGGGTTCCATGGT-3', which introduces
an XhoI site (underlined) after the termination codon. The
PCR product was visualized by ethidium bromide staining after agarose
gel electrophoresis. The DNA was extracted from the gel slices
(Geneclean; BIO 101, La Jolla, CA), digested with the restriction
enzymes SacI and XhoI, and ligated into
SacI- and XhoI-digested pBluescript (Stratagene,
La Jolla, CA). The ligated plasmid was transformed into DH5 bacteria
(Life Technologies, Gaithersburg, MD), and colonies containing the
insert were selected and amplified overnight following standard
procedures (Sambrook et al., 1989). Plasmid DNA was purified using the
Qiagen (Chatsworth, CA) Plasmid Mini Kit. An IL-1 mutant plasmid
containing a 217 bp deletion of the coding region was made using
restriction digestion with PstI followed by ligation with T4
DNA ligase; there are two PstI sites within the IL-1
coding region that are 217 bp apart. The internal standard for reverse
transcription (RT)-PCR was generated by in vitro
transcription of the mutated plasmid using T3 RNA polymerase. The DNA
template was removed by extensive DNase I digestion.
To prepare IL-1RAP internal standard, we followed a modified procedure
of that of Riedy et al. (1995). A fragment of the rat IL-1RAP gene was
amplified by PCR using cDNA that was reverse-transcribed from rat brain
total RNA. The 5' oligonucleotide used was
5'-CACGACTTACTGCAGCAAAGTTGC-3', which is identical in sequence to the
mRNA strand. The 3' antisense oligonucleotide was 5'-
AGGGGTGACTTTCTTGATGCTCAAAGGGACGTCATCAGGCTTCTTTCCATC-3'. The first
24 bases starting from the 5' end of this primer are 66 bases
downstream on the message in relation to the next 27 bases at the 3'
end of the primer, thereby producing a 66 bp deletion in the final PCR
product. This PCR product was then cloned using the TA cloning kit
(Invitrogen, Carlsbad, CA) according to the instructions provided. The
plasmid construct was amplified in DH5 bacteria as described above.
The IL-1RAP internal standard cRNA was generated by in vitro
transcription of the mutated gene using SP6 RNA polymerase followed by
DNase I digestion.
The above mutant cRNAs were used as internal controls for RT-PCR of the
respective molecule of interest. Because of the exponential nature of
PCR, small differences in either RT or PCR efficiencies may result in
large errors, which make quantitation of the wild-type mRNA difficult.
In the current experiment, mutant cRNA is added before the RT reaction,
which controls for differences in RT efficiencies. In addition, the
same pair of primers amplifies both wild-type and mutant cDNA, thereby
allowing normalization of differences in PCR amplification efficiency
among the samples. Finally, because the wild-type and mutant RNAs are
different sizes, they can be separated by gel electrophoresis and
semiquantified by the ratio of densitometric measurements of the RT-PCR
products visualized on ethidium bromide-stained gels.
RT-PCR. First-strand cDNA was synthesized by random-priming
using 2 µg (liver samples) and 2.5 µg (brain samples) of total RNA,
internal standard RNAs, 50 ng of DNA random hexanucleotides, and 200 U
of Superscript II RNase H reverse transcriptase
(Life Technologies) according to the manufacturer's instructions.
Briefly, the amount of internal standard RNA used was determined by
RT-PCR so that its level approximated that of the target RNA. RT was
performed at 42°C for 70 min, and the reaction was terminated by
heating at 95°C for 10 min. Aliquots (4 µl for brain samples and 1 µl for liver samples) of the RT reaction were amplified by PCR using
Taq DNA polymerase (Promega, Madison, WI) in a reaction
volume of 50 µl. The primers for IL-1 were
5'-GACCTGTTCTTTGAGGCTGAC-3' (sense) and
5'-TCCATCTTCTTCTTTGGGTATTGTT-3' (antisense), which amplify a 578 bp
product corresponding to wild-type IL-1 and a 361 bp product
corresponding to the mutant IL-1. The primers for the IL-1RAP were
5'-CACGACTTACTGCAGCAAAGTTGC-3' (sense) and 5'-AGGGGTGACTTTCTTGATGCTCAA-3' (antisense), which amplify a 616 bp
product corresponding to wild-type IL-1RAP and a 550 bp product corresponding to the mutant IL-1RAP. For the brain and liver samples, respectively, cDNA for IL-1 was amplified for 33 and 34 cycles, whereas cDNA for IL-1RAP was amplified for 26 and 27 cycles. These cycle numbers were chosen based on a preliminary study determining the
linear range of amplification for each respective molecule (Fig.
1). This also confirmed that both the
wild-type and mutant RNAs were amplified uniformly. In each PCR,
denaturation was at 95°C for 45 sec, annealing was at 60°C for 45 sec, and extension was at 72°C for 2 min (for the final cycle,
extension was 7 min). Furthermore, for each cDNA, PCR was performed in
duplicate. DNA sequencing, performed at the University of Tennessee
Molecular Resource Center, was used to confirm sequence
specificity.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
Optimized linearity regions for PCR amplification
of various cycles. RT-PCR was performed on liver and brain samples,
which included total RNA and corresponding amounts of IL-1 or
IL-1RAP internal standard cRNA. The amplification courses for IL-1
(top) wild-type (open circles) and mutant
(closed circles) and for IL-1RAP (bottom)
wild-type (open triangles) and mutant (closed
triangles) were obtained by densitometric measurements of the
ethidium bromide-stained agarose gel and plotted in a semilogarithmic
scale against the cycle number. Arrows indicate the
number of PCR cycles subsequently used for IL-1 mRNA and IL-1RAP
mRNA in liver and brain samples.
|
|
After amplification, aliquots of the PCR products (10 µl for IL-1
and 5 µl for IL-1RAP) were electrophoresed on horizontal gels
containing 2% (w/v) agarose using 0.2× Tris-acetate/EDTA buffer. Gels
were run at 100 V for 1 hr for IL-1 and 80 V for 3 hr for IL-1RAP.
The gels were stained with ethidium bromide (0.5 µg/ml) for 5-10 min
and then washed for 1-2 hr in water. The gels were then photographed
under ultraviolet light using a charge-coupled device camera. Band
densities were obtained by densitometric measurements of the RT-PCR
products using public domain software NIH Image 1.54 for
one-dimensional gels according to the protocol provided. The amounts of
IL-1 mRNA and IL-1RAP mRNA were expressed as a ratio of
densitometric measurements derived from the target message and the
internal standard.
Statistical analysis. All data are expressed as mean ± SE and were analyzed by one-way ANOVA. When appropriate, post
hoc analysis was done using the Student-Newman-Keuls (SNK)
multiple comparison test. In all tests, an level of
p < 0.05 was taken as an indication of statistical
significance.
| |
RESULTS |
Controls
In this study, food intake analysis was used to assess the
completeness of vagotomy. CCK significantly inhibited food intake in
SHAM (groups I and II) [ANOVA, F(1,16) = 12.13;
p < 0.005; SNK test, q(4,16) = 10.31; p < 0.01] but not in VX rats. Food intake was
decreased by 57% in CCK-injected SHAM rats compared with the saline
injection (3.33 ± 0.51 vs 7.77 ± 0.19 gm, respectively). In
contrast, CCK did not significantly decrease food intake in VX rats
compared with the saline injection (6.33 ± 0.64 vs 7.10 ± 0.32 gm, respectively).
Heat-inactivated IL-1 had no effect on IL-1 mRNA or IL-1RAP mRNA
levels in any brain region or in the liver (data not shown). In
contrast, the intraperitoneal injection of 100 µg/kg LPS caused large
increases in IL-1 mRNA and IL-1RAP mRNA levels in the liver (Fig.
2). Taken together, these data indicate
that the effects of IL-1 were not caused by contaminating endotoxin.
In addition, the sequences of the IL-1 and IL-1RAP PCR products, as
well as their respective internal controls, corresponded to the
appropriate mRNA, as determined by DNA sequence analysis. Furthermore,
each had the expected electrophoretic mobility (Fig.
3). Two additional controls were included
in the PCR experiments to rule out possible genomic DNA contamination
and general DNA contamination (Kwok and Higuchi, 1989). In the first
control, rat genomic DNA was amplified with appropriate sense and
antisense primers. It was found that either no product or a larger
product was amplified, indicating that the primers either spanned exons
or covered introns. This control was necessary because the genomic
structures of rat IL-1 and rat IL-1RAP are unknown. The second
control was performed by PCR amplification in the absence of RT to rule
out possible DNA contamination; no bands were observed.
View larger version (18K):
[in this window]
[in a new window]
|
Figure 2.
Effects of intraperitoneal injections of saline or
100 µg/kg LPS on IL-1 mRNA and IL-1RAP mRNA levels in rat liver 90 min after the injection. The amounts of IL-1 mRNA and IL-1RAP mRNA are expressed as ratios of densitometric measurements of the samples to
the corresponding internal standard. Data are presented as mean ± SE (error bars). *Significant difference compared with the saline
injection (t test).
|
|
View larger version (37K):
[in this window]
[in a new window]
|
Figure 3.
Gel electrophoresis and ethidium bromide staining
of RT-PCR-amplified IL-1 and IL-1RAP mRNAs and corresponding
internal standard cRNAs in the hypothalamus of rats in response to an
intraperitoneal injection of saline (lanes 1-6)
or 0.5 µg/kg IL-1 in sham-operated (SHAM,
lanes 7-12) and subdiaphragmatically vagotomized rats
(VX, lanes 13-18). Lane
19 is a no-RT control run in each gel to verify the lack of DNA
contamination. The PCR products for IL-1 are 578 and 361 bp for the
wild-type (Wt) and mutant (Mu),
respectively. The PCR products for IL-1RAP are 616 and 550 bp for the
Wt and Mu, respectively. On the
left axis is a 123 bp DNA marker (Life Technologies).
See Materials and Methods for a detailed description of the RT-PCR
procedure.
|
|
Vagotomy blocks the increases in IL-1 mRNA in brain
An example of the RT-PCR-amplified IL-1 mRNA and corresponding
internal standard cRNA is shown in Figure 3 for the hypothalamus. The
averaged values for IL-1 mRNA in the liver, brainstem, hippocampus, and hypothalamus are shown in Figure 4.
The intraperitoneal injection of IL-1 increased IL-1 mRNA levels
in the liver of both SHAM and VX rats (Fig. 4)
[F(2,15) = 30.3; p < 0.0001].
In IL-1-treated rats, there was a significant increase in liver
IL-1 mRNA compared with the saline treatment in both SHAM [SNK,
q(3,15) = 9.659; p < 0.01] and
VX rats [SNK, q(2,15) = 9.399;
p < 0.01]. In contrast, vagotomy blocked IL-1
induction of IL-1 mRNA in the brainstem [F(2,15) = 25.0; p < 0.0001]
and hippocampus [F(2,15) = 30.7; p < 0.0001]. In the brainstem, IL-1 mRNA was
increased significantly after IL-1 treatment in the SHAM rats
compared with the saline injection [SNK,
q(3,15) = 8.878; p < 0.01] and
compared with the VX rats [SNK, q(2,15) = 8.436; p < 0.01]. Similarly, in the hippocampus IL-1 significantly increased IL-1 mRNA in SHAM rats compared with
the saline injection [SNK, q(2,15) = 9.525;
p < 0.01] and compared with the IL-1-treated VX
rats [SNK, q(3,15) = 9.661; p < 0.01]. In the hypothalamus, IL-1 increased IL-1 mRNA levels in both SHAM and VX rats [F(2,15) = 41.7;
p < 0.0001]. In IL-1-treated rats, there was a
significant increase in hypothalamic IL-1 mRNA compared with the
saline injection in SHAM [SNK, q(3,15) = 12.91; p < 0.01] and VX rats [SNK,
q(2,15) = 6.0; p < 0.01];
however, this effect was significantly attenuated in the VX rats
compared with the SHAM rats [SNK, q(2,15) = 6.91; p < 0.01].
View larger version (26K):
[in this window]
[in a new window]
|
Figure 4.
Effects of intraperitoneal injections of saline or
IL-1 (0.5 µg/kg) on IL-1 mRNA expression in the brainstem
(BS), hippocampus (HC), hypothalamus
(HT), and liver (LV) of
sham-operated (SHAM) and vagotomized
(VX) rats 2 hr after the injection. The amounts of IL-1 mRNA are expressed as ratios of densitometric measurements of the samples to the corresponding cRNA internal standard. Data are
presented as mean ± SE (error bars) of the values obtained after two PCRs of the appropriate cDNA. *p < 0.01 compared with saline treatment (SNK test);
#p < 0.01 compared with VX-IL-1
(SNK test).
|
|
Intraperitoneal injection of IL-1 has no effect on IL-1RAP
mRNA production
An example of the RT-PCR-amplified IL-1RAP mRNA and corresponding
internal standard cRNA is shown in Figure 3 for the hypothalamus. The
averaged values for IL-1RAP mRNA in the liver, brainstem, hippocampus,
and hypothalamus are shown in Figure 5.
Consistent with a previous report (Liu et al., 1996), IL-1RAP mRNA was
highly expressed in rat liver and brain; this study adds the brainstem to the list of brain regions that express IL-1RAP mRNA. The
intraperitoneal injection of IL-1, however, had no significant
effects on IL-1RAP mRNA production in any region examined in SHAM or VX
rats (Fig. 5), although there was a slight tendency toward increased
IL-1RAP mRNA levels in the liver of the SHAM and VX rats.
View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Effects of intraperitoneal injections of saline or
IL-1 (0.5 µg/kg) on IL-1RAP mRNA expression in the brainstem
(BS), hippocampus (HC), hypothalamus
(HT), and liver (LV) of
sham-operated (SHAM) and vagotomized
(VX) rats 2 hr after the injection. The amounts of IL-1RAP mRNA are expressed as ratios of densitometric measurements of the samples to the corresponding cRNA internal standard. Data are
presented as mean ± SE (error bars) of the values obtained after
two PCRs of the appropriate cDNA.
|
|
| |
DISCUSSION |
In the present study, the intraperitoneal injection of IL-1
increased IL-1 mRNA levels in the liver, hypothalamus, hippocampus, and brainstem of control rats. This finding is consistent with other
studies showing that IL-1 is capable of inducing its own production
(Dinarello, 1996; Ilyin and Plata-Salamán, 1996). Furthermore, it
is agreeable with studies that found that the systemic injection of
substances that induce IL-1 (e.g., LPS) induce IL-1 in the brain
(Ban et al., 1992; Layé et al., 1995). A second major finding of
this study was that vagotomy blocked the induction of IL-1 mRNA in
the hippocampus and brainstem of IL-1-treated rats and significantly
attenuated the effect in the hypothalamus. These results are consistent
with the study of Layé et al. (1995); they found that vagotomy
blocked systemic LPS-induced increases in IL-1 mRNA in the
hippocampus and hypothalamus of mice. In that study, they also found
that increases in pituitary IL-1 mRNA as well as the increase in
plasma levels of IL-1 were not affected by vagotomy. Similarly, in
this study, the IL-1-induced increase in IL-1 mRNA in the liver
was not affected by vagotomy.
The finding that vagotomy blocked the increase in IL-1 mRNA
expression in the hippocampus and brainstem and significantly attenuated this effect in the hypothalamus indicates that the vagus
nerve plays a role in transmitting peripheral cytokine signals to the
brain. It is consistent with the reports that IL-1 induces dose-dependent and long-lasting increases in the afferent activity of
the vagus nerve (Niijima, 1996), and LPS sensitizes vagal afferent terminals by a cytokine-dependent mechanism (Hua et al., 1996). IL-1
receptors are found in liver paraganglia (Goehler et al., 1997), as
indicated by IL-1 receptor antagonist binding. Furthermore, various
behavioral and central actions of both IL-1 and LPS are inhibited by
vagotomy. Subdiaphragmatic vagotomy inhibits sleep (Hansen and Krueger,
1997; Kapás et al., 1997), fever (Watkins et al., 1995a; Sehic
and Blatteis, 1996; Goldbach et al., 1997; Opp and Toth, 1997;
Romanovsky et al., 1997), hyperalgesia (Watkins et al., 1994),
decreased food intake (Bret-Dibat et al., 1995), and decreased social
interaction (Bluthé et al., 1996) in response to peripheral LPS
or IL-1. In addition, vagotomy inhibits increases in ACTH secretion
(Gaykema et al., 1995), c-Fos expression in brain (Wan et al., 1994;
Gaykema et al., 1995), hypothalamic norepinephrine depletion (Fleshner
et al., 1995), and elevated plasma corticosteriod levels (Fleshner et
al., 1995) produced by various peripheral immune stimuli. Finally,
localized cytokine production and interactions with receptors (e.g., on
liver, thoracic, and laryngeal paraganglia; Goehler et al., 1997) could
explain the findings that many CNS manifestations of the acute phase
response occur in the absence of measurable circulating cytokines
(Kluger, 1991). Collectively, these data clearly suggest the existence
of sensors for IL-1 that send information to the CNS via vagal
afferents.
The fact that IL-1 mRNA production in the hypothalamus was not
totally blocked by vagotomy suggests that alternative pathways exist,
in addition to the subdiaphragmatic vagus, which communicate peripheral
cytokine signals to the brain. This is consistent with a previous study
on sleep and fever in rats using the same dose of IL-1, in which it
was found that vagotomy blocks the fever but only attenuates the
sleep-inducing effects of systemic IL-1 (Hansen and Krueger, 1997).
It is possible that IL-1 crosses the blood-brain barrier (Banks et
al., 1991) and induces its own production in the hypothalamus. The
systemic production of other readily diffusable messengers such as
nitric oxide, which is known to play a role in sleep (Kapás and
Krueger, 1996) and thermoregulation (Scammell et al., 1996), may also
affect these responses. Furthermore, it is possible that IL-1
activates additional afferent sensory nerves in addition to the
subdiaphragmatic vagus, e.g., thoracic branches of the vagus (Goehler
et al., 1997). Hence, the failure of vagotomy to completely block
systemic IL-1 or LPS-induced centrally mediated responses likely
involves both the dose (e.g., Hansen and Krueger, 1997; Romanovsky et
al., 1997) and route of administration (e.g., Bluthé et al.,
1996; Goldbach et al., 1997). The relative contribution of the vagus
nerve in communicating information from the periphery to the
hypothalamus, versus the hippocampus and brainstem, remains to be
determined.
Current and past data suggest that locally produced cytokines stimulate
cytokine receptors on, or functionally connected to, vagal afferents,
which send signals to the brain to induce brain production of
cytokines. Brain IL-1 is involved in the regulation of several
physiological processes, as well as being a crucial mediator of many
illness responses. There is a diurnal rhythm of IL-1 mRNA levels in
the brain of rats, with the highest levels corresponding to peak sleep
periods (Taishi et al., 1997). IL-1 levels in CSF of cats vary with the
sleep-wake cycle (Lue et al., 1988). IL-1 mRNA levels in the
hypothalamus and brainstem increase during sleep deprivation
(Mackiewicz et al., 1996). Furthermore, the central administration of
anti-IL-1 antibodies, the IL-1 receptor antagonist, or an IL-1
receptor fragment inhibits increases in sleep (Takahashi et al., 1996),
behavioral responses (Kent et al., 1992), and fevers (Klir et al.,
1994) that are induced by peripherally injected immune stimuli.
Inhibition of brain IL-1 also inhibits spontaneous sleep (Opp and
Krueger, 1991; Takahashi et al., 1996) and IL-1-induced anorexia
(Plata-Salamán, 1994). A critical role for IL-1 in the brain
is also indicated by recent findings in IL-1 knock-out mice; these
mice develop lower fevers in response to LPS and display a higher
mortality rate attributable to influenza infection (Kozak et al.,
1995). IL-1 type I receptor knock-out mice sleep less than their strain
controls and are unresponsive to systemic IL-1 injections (Fang et
al., 1997). These studies suggest that brain cytokines are likely the
critical mediators of centrally mediated illness responses as well as
important mediators in normal physiological processes.
IL-1 is one member of a family of molecules currently containing at
least nine members. These include three ligands, IL-1 and and
the IL-1 receptor antagonist, two receptors, a soluble receptor, an
IL-1 receptor-associated kinase, the IL-1-converting enzyme, and the
IL-1RAP (for review, see Dinarello, 1996). The IL-1RAP has been cloned
in mice (Greenfeder et al., 1995) and rats (Liu et al., 1996) and
appears to be necessary for IL-1 binding and signal transduction. The
IL-1RAP forms a complex with the IL-1 type I receptor and either
IL-1 or IL-1, but not with the IL-1 receptor antagonist, and
increases the binding affinity for IL-1 (Greenfeder et al., 1995).
Furthermore, cells lacking the IL-1RAP do not respond to IL-1 (Wesche
et al., 1996); however, when the IL-1RAP is expressed in these cells,
IL-1 responsiveness is restored (Wesche et al., 1997). In principle,
the upregulation or downregulation of any one component of the IL-1
family could influence the level of activation of the entire IL-1
system. It was, therefore, of interest to determine whether IL-1RAP
mRNA could also be influenced by systemic IL-1.
In the present study, we found IL-1RAP mRNA to be highly expressed in
all regions examined; to obtain a discernable signal, cDNA for IL-1RAP
was amplified either 26 or 27 cycles, whereas the same cDNA required 33 or 34 cycles of amplification for IL-1 mRNA in the brain and liver
samples, respectively. There were no significant differences in IL-1RAP
mRNA in response to the intraperitoneal administration of IL-1 in
any region in control or vagotomized rats. This finding is consistent
with another study that also found no significant differences in
IL-1RAP mRNA levels after intracerebroventricular microinfusions of
IL-1 (Ilyin and Plata-Salamán, 1996). Greenfeder et al. (1995)
initially reported increases in IL-1RAP mRNA in the lung and spleen,
decreases in the liver, and no change in the brain in response to
IL-1. Using an RNase protection assay, Liu et al. (1996) showed
decreases in IL-1RAP mRNA in the liver and no changes in the
hippocampus 24 hr after two doses of intraperitoneal LPS. In contrast,
in this study we observed increased IL-1RAP mRNA expression in the liver of rats 90 min after an intraperitoneal injection of LPS. Thus,
the regulation of this molecule appears to be complex and may be
similar to the IL-1 type I receptor; IL-1 type I receptor mRNA is
increased 3 hr after the intraperitoneal administration of LPS and then
diminished after 20 hr (Reinisch et al., 1994). Regardless of these
considerations, the regulation of IL-1 and its role in centrally
mediated illness responses likely involves the entire IL-1 system, as
well as that of other cytokines, such as tumor necrosis factor-.
In conclusion, this study provides additional evidence for the
involvement of the vagus nerve as a cytokine-to-brain communication pathway. It further indicates that cytokine signals arising from the
periphery are capable of inducing cytokine messages in the brain. The
subsequent release of IL-1 in the brain is likely a critical step in
the pathway by which vagally mediated signals result in centrally
controlled physiological functions and symptoms of the acute phase
response.
| |
FOOTNOTES |
Received Nov. 3, 1997; revised Dec. 29, 1997; accepted Jan. 2, 1998.
This work was supported in part by National Institutes of Health Grants
NS25378, NS31453, and NS27250, Office of Naval Research Grant
N00014-90-J-1069, and National Research Service Award MH11688.
Correspondence should be addressed to Dr. James M. Krueger, Department
of Veterinary and Comparative Anatomy, Pharmacology and Physiology,
College of Veterinary Medicine, Washington State University, Wegner
Hall, Room 205, Pullman, WA 99164-6520.
| |
REFERENCES |
-
Ban E,
Haour F,
Lenstra R
(1992)
Brain interleukin-1 gene expression induced by peripheral lipopolysaccharide administration.
Cytokine
4:48-54[Web of Science][Medline].
-
Banks WA,
Ortiz L,
Plotkin SR,
Kastin AJ
(1991)
Human interleukin (IL) 1, murine IL-1 and murine IL-1 are transported from blood to brain in the mouse by a shared saturable mechanism.
J Pharmacol Exp Ther
259:988-996[Abstract/Free Full Text].
-
Blatteis CM,
Sehic E
(1997)
Fever: how may circulating pyrogens signal the brain?
News Physiol Sci
12:1-9. [Abstract/Free Full Text]
-
Bluthé R-M,
Michaud B,
Kelley KW,
Dantzer R
(1996)
Vagotomy blocks behavioural effects of interleukin-1 injected via the intraperitoneal route but not via other systemic routes.
NeuroReport
7:2823-2827[Web of Science][Medline].
-
Bret-Dibat JL,
Bluthé R-M,
Kent S,
Kelley KW,
Dantzer R
(1995)
Lipopolysaccharide and interleukin-1 depress food-motivated behavior in mice by a vagal-mediated mechanism.
Brain Behav Immun
9:242-246[Web of Science][Medline].
-
Dinarello CA
(1996)
Biological basis for interleukin-1 in disease.
Blood
87:2095-2147[Abstract/Free Full Text].
-
Fang J, Wang Y, Krueger JM (1997) The effects of
interleukin-1 on sleep are mediated by the type I receptor. Am
J Physiol, in press.
-
Fleshner M,
Goehler LE,
Hermann J,
Relton JK,
Maier SF,
Watkins LR
(1995)
Interleukin-1 induced corticosterone elevation and hypothalamic NE depletion is vagally mediated.
Brain Res Bull
37:605-610[Web of Science][Medline].
-
Gaykema RPA,
Dijkstra I,
Tilders FJH
(1995)
Subdiaphragmatic vagotomy suppresses endotoxin-induced activation of hypothalamic corticotropin-releasing hormone neurons and ACTH secretion.
Endocrinology
136:4717-4720[Abstract].
-
Goehler LE,
Relton JK,
Dripps D,
Kiechle R,
Tartaglia N,
Maier SF,
Watkins LR
(1997)
Vagal paraganglia bind biotinylated interleukin-1 receptor antagonist: a possible mechanism for immune-to-brain communication.
Brain Res Bull
43:357-364[Web of Science][Medline].
-
Goldbach J-M,
Roth J,
Zeisberger E
(1997)
Fever suppression by subdiaphragmatic vagotomy in guinea pigs depends on the route of pyrogen administration.
Am J Physiol
272:675-681.
-
Greenfeder SA,
Nunes P,
Kwee L,
Labow M,
Chizzonite RA,
Ju G
(1995)
Molecular cloning and characterization of a second subunit of the interleukin-1 receptor complex.
J Biol Chem
270:13757-13765[Abstract/Free Full Text].
-
Hansen MK,
Krueger JM
(1997)
Subdiaphragmatic vagotomy blocks the sleep- and fever-promoting effects of interleukin-1.
Am J Physiol
273:1246-1253.
-
Hansen MK, Kapás L, Fang J, Krueger JM (1997) Cafeteria
diet-induced sleep is blocked by subdiaphragmatic vagotomy in rats.
Am J Physiol, in press.
-
Hua X-Y,
Chen P,
Fox A,
Myers RR
(1996)
Involvement of cytokines in lipopolysaccharide-induced facilitation of CGRP release from capsaicin-sensitive nerves in the trachea: studies with interleukin-1 and tumor necrosis factor-.
J Neurosci
16:4742-4748[Abstract/Free Full Text].
-
Ilyin SE,
Plata-Salamán CR
(1996)
In vivo regulation of the IL-1 system (ligand, receptors I and II, receptor accessory protein, and receptor antagonist) and TNF- mRNAs in specific brain regions.
Biochem Biophys Res Commun
227:861-867[Web of Science][Medline].
-
Kapás L,
Krueger JM
(1996)
Nitric oxide donors SIN-1 and SNAP promote non-rapid eye movement sleep in rats.
Brain Res Bull
41:293-298[Web of Science][Medline].
-
Kapás L, Hansen MK, Chang H-Y, Krueger
JM (1997) Vagotomy attenuates but does not prevent the
somnogenic and febrile effects of lipopolysaccharide in rats. Am J
Physiol, in press.
-
Kent S,
Bluthé R-M,
Kelley KW,
Dantzer R
(1992)
Sickness behavior as a new target for drug development.
Trends Pharmacol Sci
13:24-28[Medline].
-
Klir JJ,
McClellan JL,
Kluger MJ
(1994)
Interleukin-1 causes the increase in anterior hypothalamic interleukin-6 during LPS-induced fever in rats.
Am J Physiol
266:1845-1848.
-
Kluger MJ
(1991)
Fever: role of pyrogens and cryogens.
Physiol Rev
71:93-127[Abstract].
-
Kozak W,
Zheng H,
Conn CA,
Soszynski D,
Van der Ploeg LH,
Kluger MJ
(1995)
Thermal and behavioral effects of lipopolysaccharide and influenza in interleukin-1-deficient mice.
Am J Physiol
269:969-977.
-
Krueger JM,
Majde JA
(1994)
Microbial products and cytokines in sleep and fever regulation.
Crit Rev Immunol
14:355-379[Web of Science][Medline].
-
Krueger JM,
Walter J,
Dinarello CA,
Wolff SM,
Chedid L
(1984)
Sleep-promoting effects of endogenous pyrogen (interleukin-1).
Am J Physiol
246:994-999.
-
Kwok S,
Higuchi R
(1989)
Avoiding false positives with PCR.
Nature
339:237-238[Medline].
-
Layé S,
Bluthé R-M,
Kent S,
Combe C,
Médina C,
Parnet P,
Kelley K,
Dantzer R
(1995)
Subdiaphragmatic vagotomy blocks the induction of interleukin-1 mRNA in the brain of mice in response to peripherally administered lipopolysaccharide.
Am J Physiol
268:1327-1331.
-
Liu C,
Chalmers D,
Maki R,
De Souza EB
(1996)
Rat homolog of mouse interleukin-1 receptor accessory protein: cloning, localization and modulation studies.
J Neuroimmunol
66:41-48[Web of Science][Medline].
-
Lue FA,
Bail M,
Jephthah-Ocholo J,
Carayanniotis K,
Gorczynski R,
Moldofsky H
(1988)
Sleep and cerebrospinal fluid interleukin-1-like activity in the cat.
Int J Neurosci
42:179-183[Web of Science][Medline].
-
Mackiewicz M,
Sollars PJ,
Ogilvie MD,
Pack AI
(1996)
Modulation of IL-1 gene expression in the rat CNS during sleep deprivation.
NeuroReport
7:529-533[Web of Science][Medline].
-
Niijima A
(1996)
The afferent discharges from sensors for interleukin-1 in the hepatoportal system in the anesthetized rat.
J Auton Nerv Syst
61:287-291[Web of Science][Medline].
-
Opp MR,
Krueger JM
(1991)
Interleukin-1 receptor antagonist blocks interleukin-1-induced sleep and fever.
Am J Physiol
260:453-457.
-
Opp MR,
Toth LA
(1997)
Circadian modulation of interleukin-1-induced fever in intact and vagotomized rats.
Ann NY Acad Sci
813:435-436[Medline].
-
Plata-Salamán CR
(1994)
Meal patterns in response to the intracerebroventricular administration of interleukin-1 in rats.
Physiol Behav
55:727-733[Medline].
-
Reinisch N,
Wolkersdorfer M,
Kähler CM,
Ye K,
Dinarello CA,
Wiedermann CJ
(1994)
Interleukin-1 receptor type I mRNA in mouse brain as affected by peripheral administration of bacterial lipopolysaccharide.
Neurosci Lett
166:165-167[Web of Science][Medline].
-
Riedy MC,
Timm Jr EA,
Stewart CC
(1995)
Quantitative RT-PCR for measuring gene expression.
Biotechniques
18:70-76[Web of Science][Medline].
-
Romanovsky AA,
Simons CT,
Székely M,
Kulchitsky VA
(1997)
The vagus nerve in the thermoregulatory response to systemic inflammation.
Am J Physiol
273:407-414.
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual, Ed 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Scammell TE,
Elmquist JK,
Saper CB
(1996)
Inhibition of nitric oxide synthase produces hypothermia and depresses lipopolysaccharide fever.
Am J Physiol
271:333-338.
-
Sehic E,
Blatteis CM
(1996)
Blockade of lipopolysaccharide-induced fever by subdiaphragmatic vagotomy in guinea pigs.
Brain Res
726:160-166[Web of Science][Medline].
-
Smith GP,
Jerome C,
Cushin BJ,
Eterno R,
Simansky KJ
(1981)
Abdominal vagotomy blocks the satiety effect of cholecystokinin in the rat.
Science
213:1036-1037[Abstract/Free Full Text].
-
Taishi P,
Bredow S,
Guha-Thakurta N,
Obál Jr F,
Krueger JM
(1997)
Diurnal variations of interleukin-1 mRNA and -actin mRNA in rat brain.
J Neuroimmunol
75:69-74[Web of Science][Medline].
-
Takahashi S,
Kapás L,
Fang J,
Seyer JM,
Wang Y,
Krueger JM
(1996)
An interleukin-1 receptor fragment inhibits spontaneous sleep and muramyl dipeptide-induced sleep in rabbits.
Am J Physiol
271:101-108.
-
Wan W,
Wetmore L,
Sorensen CM,
Greenberg AH,
Nance DM
(1994)
Neural and biochemical mediators of endotoxin and stress-induced c-fos expression in the rat brain.
Brain Res Bull
34:7-14[Web of Science][Medline].
-
Watkins LR,
Wiertelak EP,
Goehler LE,
Smith KP,
Martin D,
Maier SF
(1994)
Characterization of cytokine-induced hyperalgesia.
Brain Res
654:15-26[Web of Science][Medline].
-
Watkins LR,
Goehler LE,
Relton JK,
Tartaglia N,
Gilbert L,
Martin D,
Maier SF
(1995a)
Blockade of interleukin-1-induced hyperthermia by subdiaphragmatic vagotomy: evidence for vagal mediation of immune-brain communication.
Neurosci Lett
183:27-31[Web of Science][Medline].
-
Watkins LR,
Maier SF,
Goehler LE
(1995b)
Cytokine-to-brain communication: a review and analysis of alternative mechanisms.
Life Sci
57:1011-1026[Web of Science][Medline].
-
Wesche H,
Neumann D,
Resch K,
Martin MU
(1996)
Co-expression of mRNA for type I and type II interleukin-1 receptors and the IL-1 receptor accessory protein correlates to IL-1 responsiveness.
FEBS Lett
391:104-108[Web of Science][Medline].
-
Wesche H,
Korherr C,
Kracht M,
Falk W,
Resch K,
Martin MU
(1997)
The interleukin-1 receptor accessory protein (IL-1RAcP) is essential for IL-1 induced activation of interleukin-1 receptor-associated kinase (IRAK) and stress-activated protein kinases (SAP kinases).
J Biol Chem
272:7727-7731[Abstract/Free Full Text].
Copyright © 1998 Society for Neuroscience 0270-6474/98/1862247-07$05.00/0
This article has been cited by other articles:
|
|
|
|
 
J. S. Adelman and L. B. Martin
Vertebrate sickness behaviors: Adaptive and integrated neuroendocrine immune responses
Integr. Comp. Biol.,
September 1, 2009;
49(3):
202 - 214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Parish
Genetic and Immunologic Aspects of Sleep Disorders
ACCP Sleep Med Brd Rev,
January 1, 2009;
4(0):
271 - 286.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Ryan, J. K. Carroll, E. P. Ryan, K. M. Mustian, K. Fiscella, and G. R. Morrow
Mechanisms of Cancer-Related Fatigue
Oncologist,
May 1, 2007;
12(suppl_1):
22 - 34.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P Gourmelon, C Marquette, D Agay, J Mathieu, and D Clarencon
Involvement of the central nervous system in radiation-induced multi-organ dysfunction and/or failure
Br. J. Radiol.,
January 1, 2005;
Supplement_27(1):
62 - 68.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Francis, Z.-H. Zhang, R. M. Weiss, and R. B. Felder
Neural regulation of the proinflammatory cytokine response to acute myocardial infarction
Am J Physiol Heart Circ Physiol,
August 1, 2004;
287(2):
H791 - H797.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Chen, D. Duricka, S. Nelson, S. Mukherjee, S. G. Bohnet, P. Taishi, J. A. Majde, and J. M. Krueger
Influenza virus-induced sleep responses in mice with targeted disruptions in neuronal or inducible nitric oxide synthases
J Appl Physiol,
July 1, 2004;
97(1):
17 - 28.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Francis, Y. Chu, A. K. Johnson, R. M. Weiss, and R. B. Felder
Acute myocardial infarction induces hypothalamic cytokine synthesis
Am J Physiol Heart Circ Physiol,
June 1, 2004;
286(6):
H2264 - H2271.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Gatti, J. Beck, G. Fantuzzi, T. Bartfai, and C. A. Dinarello
Effect of interleukin-18 on mouse core body temperature
Am J Physiol Regulatory Integrative Comp Physiol,
March 1, 2002;
282(3):
R702 - R709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hosoi, Y. Okuma, A. Ono, and Y. Nomura
Subdiaphragmatic vagotomy fails to inhibit intravenous leptin-induced IL-1beta expression in the hypothalamus
Am J Physiol Regulatory Integrative Comp Physiol,
February 1, 2002;
282(2):
R627 - R631.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Kubota, J. Fang, Z. Guan, R. A. Brown, and J. M. Krueger
Vagotomy attenuates tumor necrosis factor-{alpha}-induced sleep and EEG {delta}-activity in rats
Am J Physiol Regulatory Integrative Comp Physiol,
April 1, 2001;
280(4):
R1213 - R1220.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. J. Corwin
Understanding Cytokines Part I: Physiology and Mechanism of Action
Biol Res Nurs,
July 1, 2000;
2(1):
30 - 40.
[Abstract]
[PDF]
|
|
|
|
|
|
|
T. Hosoi, Y. Okuma, and Y. Nomura
Electrical stimulation of afferent vagus nerve induces IL-1beta expression in the brain and activates HPA axis
Am J Physiol Regulatory Integrative Comp Physiol,
July 1, 2000;
279(1):
R141 - R147.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. O. McCarthy
Cytokines and the Anorexia of Infection: Potential Mechanisms and Treatments
Biol Res Nurs,
April 1, 2000;
1(4):
287 - 298.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. K. Hansen, K. T. Nguyen, M. Fleshner, L. E. Goehler, R. P. A. Gaykema, S. F. Maier, and L. R. Watkins
Effects of vagotomy on serum endotoxin, cytokines, and corticosterone after intraperitoneal lipopolysaccharide
Am J Physiol Regulatory Integrative Comp Physiol,
February 1, 2000;
278(2):
R331 - R336.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Takahashi, L. Kapas, J. Fang, and J. M. Krueger
Somnogenic relationships between tumor necrosis factor and interleukin-1
Am J Physiol Regulatory Integrative Comp Physiol,
April 1, 1999;
276(4):
R1132 - R1140.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. K. Hansen, P. Taishi, Z. Chen, and J. M. Krueger
Cafeteria feeding induces interleukin-1beta mRNA expression in rat liver and brain
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 1998;
274(6):
R1734 - R1739.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction
