 |
Previous Article | Next Article 
The Journal of Neuroscience, April 15, 1998, 18(8):3059-3072
A Distinct Subgroup of Small DRG Cells Express GDNF Receptor
Components and GDNF Is Protective for These Neurons after Nerve
Injury
David L. H.
Bennett1,
Gregory J.
Michael2,
Navin
Ramachandran1,
John
B.
Munson3,
Sharon
Averill2,
Qiao
Yan4,
Stephen B.
McMahon1, and
John
V.
Priestley2
1 Department of Physiology, United Medical and Dental
Schools (St. Thomas' Campus), London, SE1 7EH, United Kingdom,
2 Department of Anatomy, Queen Mary and Westfield College,
London, E1 4NS, United Kingdom, 3 Department of
Neuroscience, University of Florida College of Medicine, Gainsville,
Florida 32610, and 4 Department of Neuroscience, Amgen
Inc., Thousand Oaks, California 91320
 |
ABSTRACT |
Several lines of evidence suggest that neurotrophin administration
may be of some therapeutic benefit in the treatment of peripheral
neuropathy. However, a third of sensory neurons do not express
receptors for the neurotrophins. These neurons are of small diameter
and can be identified by the binding of the lectin IB4 and the
expression of the enzyme thiamine monophosphatase (TMP). Here we show
that these neurons express the receptor components for glial-derived
neurotrophic factor (GDNF) signaling (RET, GFR -1, and GFR -2). In
lumbar dorsal root ganglia, virtually all IB4-labeled cells express RET
mRNA, and the majority of these cells (79%) also express GFR -1,
GFR -2, or GFR -1 plus GFR -2.
GDNF, but not nerve growth factor (NGF), can prevent several
axotomy-induced changes in these neurons, including the downregulation of IB4 binding, TMP activity, and somatostatin expression. GDNF also
prevents the slowing of conduction velocity that normally occurs after
axotomy in a population of small diameter DRG cells and the A-fiber
sprouting into lamina II of the dorsal horn. GDNF therefore may be
useful in the treatment of peripheral neuropathies and may protect
peripheral neurons that are refractory to neurotrophin treatment.
Key words:
IB4; trkA; RET; somatostatin; GFR -1; GFR -2; axotomy; C-fibers; nociception; pain; sprouting; spinal cord
 |
INTRODUCTION |
In the adult animal, specific dorsal
root ganglion (DRG) cell populations require particular neurotrophins
for their phenotypic maintenance (Verge et al., 1996 ). The trk
receptors in general are expressed in a nonoverlapping manner by
sensory neurons in combination with the low-affinity neurotrophin
receptor p75 (Wright and Snider, 1995 ). Large diameter DRG cells mostly
possess myelinated axons and respond principally to low threshold
stimuli. These neurons express trkB or trkC or both (McMahon et
al., 1994 ). Small diameter DRG cells, in contrast, have unmyelinated
axons and are principally nociceptors and thermoceptors. Half of this
group (40% of total DRG cells) constitutively synthesize neuropeptides and express trkA (Averill et al., 1995 ; Molliver et al., 1995 ). The
other half of the small diameter DRG cells (35% of total DRG cells)
possess cell surface glycoconjugates that can be identified by binding
of the lectin Isolectin B4 from Griffonia simplicifolia (IB4) (Silverman and Kruger, 1990 ). They also express the enzyme thiamine monophosphatase (TMP). During development these cells are
dependent on NGF for survival (Silos-Santiago et al., 1995 ). During the
postnatal period, however, these cells downregulate trkA expression
(Bennett et al., 1996a ; Molliver and Snider, 1997 ). It is this
population that in the adult does not express detectable levels of the
low-affinity neurotrophin receptor p75 nor any known trk receptor
(McMahon et al., 1994 ; Averill et al., 1995 ; Molliver et al., 1995 ;
Wright and Snider, 1995 ). In this study we have examined the
possibility that GDNF exerts a trophic action on these neurons.
GDNF is a member of the transforming growth factor- (TGF- )
superfamily (Lin et al., 1993 ) and is related to neurturin (Kotzbauer et al., 1996 ). GDNF has been demonstrated to have potent
survival-promoting effects on midbrain dopaminergic neurons (Beck et
al., 1995 ; Bowenkamp et al., 1995 ) and motoneurons (Henderson et al.,
1994 ; Oppenheim et al., 1995 ; Yan et al., 1995 ). There is growing
evidence that GDNF can have a trophic action on sensory neurons. In
GDNF-deficient mice there is a significant reduction in the number of
spinal sensory neurons (Moore et al., 1996 ). During the late embryonic and postnatal period, the survival of a subpopulation of DRG cells is
supported by this factor in vitro (Buj-Bello et al., 1995 ), and those neurons that are supported are IB4 binding (Molliver et al.,
1997 ). GDNF can also prevent the death of axotomized developing sensory
neurons in vivo (Matheson et al., 1997 ).
The receptor for GDNF is thought to be a complex of GFR -1 (Jing et
al., 1996 , Treanor et al., 1996 ; GFR Nomenclature Committee, 1997 ),
which acts as a ligand binding domain, and RET, which acts as the
signal transducing domain (Durbec et al., 1996 , Trupp et al., 1996 ).
Neurturin also appears to use RET for signaling, but operates via
another GPI-linked binding protein termed GFR -2 (Baloh et al., 1997 ;
Buj-Bello et al., 1997 ; GFR Nomenclature Committee, 1997 ; Klein et
al., 1997 ). GDNF may also be able to act via GFR -2, particularly in
the presence of RET (Sanicola et al., 1997 ). In this study, we have
examined the expression of these GDNF receptor subunits within adult
sensory neurons.
One means of studying the trophic requirements of different subgroups
of sensory neurons has been to determine to what extent injury-induced
changes can be reversed by the administration of exogenous trophic
factors (Verge et al., 1995 , 1996 ). The second aim of the present work
was to investigate the efficacy of GDNF in reversing such
axotomy-induced changes in adult sensory neurons.
 |
MATERIALS AND METHODS |
Animal surgery. Adult male Wistar rats underwent
unilateral sciatic nerve section combined with an intrathecal infusion
of recombinant human GDNF (rhGDNF), rhNGF or control buffer. The sciatic nerve was exposed under pentobarbitone anesthesia (40 mg/kg,
i.p., with sterile precautions) and ligated 20 mm distal to the
obturator tendon. Concurrently a small laminectomy was performed
between L6 and S1 vertebrae, and the dura was cut. A SILASTIC tube of
0.6 mm outer diameter was introduced intrathecally so that its tip lay
at the level of the lumbar enlargement of the spinal cord. The
intrathecal tubing was attached to an Alzet miniosmotic pump (type
2002; Alzet, Alza Corporation, Palo Alto, CA) delivering at a rate of
0.5 µl/hr. Animals received either a control infusion
(n = 4; saline with rat serum albumin, 1 mg/ml) or this
vehicle plus rhGDNF (n = 4 at 12 µg/d;
n = 3 at 1.2 µg/d) or rhNGF (n = 3 at
12 µg/d; n = 3 at 1.2 µg/d). Another group of
animals underwent axotomy with either control infusion
(n = 4) or GDNF treatment (n = 4 at 12 µg/d; n = 3 at 1.2 µg/d). Twelve days later the
left sciatic nerve was re-exposed and injected with 4 µl of 1%
B-subunit of cholera toxin (CTB) (List Biological Labs, Campbell, CA)
in distilled water, using a micropipette glued to a Hamilton syringe.
Animals were perfused with heparinized saline followed by 4%
paraformaldehyde 14 d after sciatic section. Another group of
normal animals (n = 5) was labeled with CTB in the same
manner but did not undergo sciatic axotomy. After perfusion the left
and right L4 and L5 DRGs were removed as well as L3-L6 segments of the
spinal cord. Pins were placed in the right side of the spinal cord at
the border between L3/L4, L4/L5, and L5/L6 to ease identification of
the spinal levels during analysis. Tissues were post-fixed in 4%
paraformaldehyde for 2 hr, after which they were transferred to 15%
sucrose overnight. One group of animals (n = 4) was
perfused in the same manner and used for in situ
hybridization. Another group of naive animals (n = 3)
was used to provide control values for IB4, somatostatin, calcitonin
gene-related peptide (CGRP), and TMP staining.
Electrophysiological analysis was performed on five different groups of
animals: normal intact animals (n = 4); animals in which the tibial nerve had been cut and tied 2 weeks previously and
with an intrathecal cannula delivering 1 mg/ml normal rat serum albumin
in saline at 12 µl/d (n = 5); animals with tibial nerve axotomy and continuous intrathecal delivery of rhGDNF (12 µg/d;
n = 3), rhNGF (12 µg/d; n = 3), or
rhGDNF and rhNGF (12 µg/d each; n = 4). This surgery
was performed under pentobarbitone anesthesia and with sterile
precautions.
Staining procedures. Sections of DRG and spinal cord were
cut at a thickness of 15 and 20 µm, respectively. Sections of DRG were cut serially onto slides so that each slide contained an ordered
series of sections throughout the ganglia, at a separation of at least
150 µm between sections. When the spinal cord was cut, every fifth
section was mounted serially onto slides. Every slide therefore had a
series of sections through the L4 and L5 region of spinal cord at a
separation of at least 800 µm between sections. For immunostaining,
primary antisera were rabbit anti-CGRP (1:2000, gift of Professor
J. M. Polak), rabbit anti-somatostatin (1:2000, gift of Dr. T. Görcs), goat anti-CTB (1:2000, List), and biotinylated IB4 (10 µg/ml, Sigma). Secondary antisera were FITC- or TRITC-conjugated
anti-rabbit or anti-goat IgG (1:200, Jackson labs) or FITC-conjugated
Extr-Avidin (1:200, Sigma). Histochemistry for TMP was also performed
as described previously (McMahon, 1986 ).
Analyses of colocalization of RET immunoreactivity with other DRG
products were performed on 8 µm cryostat sections using dual-labeling
immunofluorescence. The production and staining characteristics of the
RET antiserum have already been described (Molliver et al., 1997 ). RET
immunostaining was combined sequentially with markers described above
as well as sheep anti-CGRP (1:2000, Affiniti) and anti-rabbit trkA
(Averill et al., 1995 ). Indirect tyramide signal amplification (TSA,
New England Nuclear) was used for the first reaction when staining with
two rabbit antisera as described previously (Michael et al., 1997 ). The
lack of cross-reactivity is thought to be caused by the fact that the
primary antiserum is highly diluted compared with when it is used in
indirect immunofluorescence without amplification (e.g., trkA 1:100,000
vs 1:4000), and therefore the second series reactions do not detect it.
This was verified by a lack of staining in control single-labeled
preparations using indirect immunofluorescence and the antiserum
dilutions used for TSA.
For combined fluorescence histochemistry with in situ
hybridization, cryostat sections (6-8 µm) were cut and thaw-mounted onto Superfrost Plus slides (BDH Chemicals, Poole, UK).
Immunocytochemistry and/or lectin binding histochemistry was performed
before in situ hybridization (Michael and Priestley, 1996b ;
Michael et al., 1997 ). Sections were incubated for 40-48 hr at room
temperature with trkA antibody (4 µg/ml), N52 monoclonal antibody to
phosphorylated heavy chain neurofilament (1:400, Sigma), or
biotinylated IB4 (10 µg/ml) diluted in diethylpyrocarbonate
(DEPC)-treated PBS containing 0.2% Triton X-100, 0.1% sodium azide,
0.5 mM dithiothreitol, and 100 U/ml RNasin (Promega,
Madison, WI). Lectin binding buffer also contained 0.1 mM
MnCl2, 0.1 mM MgCl2,
and 0.1 mM CaCl2. Sections were washed in DEPC
PBS and incubated for 4 hr in tetramethyl rhodamine isothiocyanate
(TRITC)-conjugated secondary antibodies (1:200, Jackson Laboratory, Bar
Harbor, ME) or fluorescein isothiocyanate (FITC)-conjugated Extr-Avidin
(1:200, Sigma) diluted in the same buffer without added divalent
cations. After additional washes in DEPC PBS, sections were processed
through prehybridization steps, hybridized to 35S-dATP
end-labeled oligonucleotides, and washed as described previously (Michael and Priestley, 1996a ). Slides were dipped in autoradiographic emulsion (Amersham, Arlington Heights, IL) and developed after 4-6
weeks. After the slides were coverslipped with PBS glycerol (1:3
containing 2.5% 1,4-diazobicyclo-(2,2,2)-octane), fluorescent labeling
and silver grains were visualized using epifluorescence microscopy
combined with either epipolarized illumination or dark-field illumination. The oligonucleotides used for probes were complementary to nucleotides 996-1029 of the rat GFR -1 sequence (Jing et al., 1996 ) and nucleotides 161-194 of the rat RET sequence (Canzian et al.,
1995 ), and for GFR -2 the oligonucleotide sequence
cctggactgatgtttgtcgtgagctctgtgaagc was used (Klein et al., 1997 ).
Controls for the specificity of in situ hybridization
included adding a 100-fold excess of unlabeled oligonucleotide to
hybridization buffer, which effectively competed all specific binding
of radiolabeled probe. Use of the GFR -1, GFR -2, and RET to label
sections of rat brain yielded patterns of hybridization identical to
reported patterns (Trupp et al., 1997 ) (our unpublished observations). All probes were synthesized to be of the same size and G+C base content
and produced reproducible and characteristic patterns of labeling.
Image analysis. After in situ hybridization,
cells that had silver grains over the cell cytoplasm at least five
times background were counted as positive. For quantitation of in
situ hybridization, counts of cells labeled for RET, GFR- 1, and
GFR -2 and coexpressed cell markers were conducted on ganglia from at
least four animals, with separation between analyzed sections being at
least 100 µm. At least 1500 cells were counted for each probe/peptide
combination. For counts of the percentage of cell profiles expressing
CGRP, somatostatin, IB4 binding, and TMP activity after different
treatments, six sections were randomly selected for each marker for
each animal in each group. In each section the total number of cell
profiles was counted using dark-field illumination, and then the number of positively stained cell profiles was counted.
For image analysis of IB4, TMP, CGRP, and CTB staining within the
dorsal horn, four randomly selected sections of L4/5 spinal cord were
used from each animal. Two sections were selected from L4 and two
sections were selected from L5 to ensure that the analysis was not
biased toward one region of the lumbar enlargement. For analysis of
IB4, CGRP, and TMP staining, images of spinal cord sections were
captured directly off the microscope at 25× objective magnification
using a Grundig FA87 digital camera with integrating framestore. The
image was then thresholded to a set level to reveal the labeling. Four
boxes of size 27 × 27 µm were placed over lamina II of the
axotomized side (within the sciatic territory) and in equivalent
positions on the contralateral (i.e., intact sciatic) side of the
sections. The area occupied by labeled terminals was then calculated
for each box. A similar method was used for analysis of CTB staining,
but in this case the four boxes were placed over lamina III of the
sciatic-labeled territory and four were placed dorsal to the lamina III
boxes in lamina II outer. The area occupied by CTB-stained terminals
within each of these boxes was then calculated.
This image analysis system was similarly used for cell size
distribution analyses of RET, GFR -1, and GFR -2. Images of DRG sections were captured directly off the microscope as described above.
Cell profiles were outlined using a hand-held mouse from which the cell
area was calculated. For the RET analysis 1128 profiles were drawn, for
the GFR -1 analysis 990 profiles were drawn, and for the GFR -2
analysis 567 profiles were drawn. Cell size distribution analyses were
also performed on normal L4/5 ganglia (n = 4 animals),
axotomized ganglia (n = 4 animals), and ganglia that
had undergone axotomy in combination with GDNF treatment (12 µg/d;
n = 4). Twelve sections that had been cut at a
thickness of 15 µm and stained with toluidine blue were selected for
each animal. The selected section was then divided into quadrants, and
all the profiles within a randomly selected quadrant were outlined. In
total 2033 profiles were drawn in the normal group, 2256 in the axotomy
group, and 1875 in the axotomy plus GDNF group.
Trophic factor effects on electrophysiological properties of
axotomized C-fibers. As an independent measure of the efficacy of
trophic factors, we studied the electrophysiological properties of
damaged C-fibers. The conduction velocity (CV) distribution of C-fibers
projecting through the tibial nerve was measured in urethane-anesthetized animals (1.25 gm/kg, i.p.) in terminal
experiments. Fine strands of the L5 dorsal root were dissected and
mounted on recording electrodes. The tibial nerve was continuously
electrically stimulated at 2 Hz with square wave current pulses: 5 mA,
1 msec. The evoked activity on the root filament was amplified and
filtered by conventional means, and the averages of 64-128 responses
were constructed (see Fig. 9). In these averages it was possible to determine the latency of individual fibers. All fibers conducting at
less than 2 m/sec were included in analysis. Typically 3-10 C-fibers
were found in each strand. A sample of approximately 50 individual
C-fibers was measured in each animal, from which the conduction
velocity distribution was computed. Distributions from three to five
animals in each experimental group were averaged and plotted as
cumulative sums (e.g., see Fig. 9). The distributions of CVs were
statistically compared using the Kolmogorov-Smirnov test.
 |
RESULTS |
GDNF receptor expression within sensory neurons
Abundant labeling for RET, GFR -1, and GFR -2 mRNAs was
observed in lumbar DRG cells (Fig. 1),
with 64 ± 4.4, 40.6 ± 1.5, and 32.8 ± 1.0% of DRG
cell profiles labeled, respectively. Cells of all sizes showed
labeling, but GFR -2 and RET mRNAs were expressed by proportionally
more small and intermediate-sized cells (Figs. 1, 2).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
Cell size distribution of DRG cell profiles
positively and negatively labeled for RET, GFR -1, and GFR -2
within L4/5 dorsal root ganglia. RET and GFR -2 are present
predominantly in small and intermediate diameter DRG cell profiles but
are also present in some large diameter DRG cell profiles. GFR -1 is
more evenly distributed through the whole cell size spectrum.
|
|
To identify the cell types that were labeled, in situ
hybridization was combined with immunocytochemistry for markers that are widely used to characterize three main DRG subpopulations (Averill
et al., 1995 ). Strikingly, a high level of expression of all three GDNF
receptor components (RET, GFR -1, and GFR -2) was found in cells
labeled with the lectin IB4 (Fig. 2,
Table 1), a marker for small neurons that
do not express any of the trk receptors (Averill et al., 1995 ; Molliver
et al., 1995 ). In the case of RET, virtually all IB4 cells express RET
mRNA (95%), and the IB4 cells account for a very high percentage of
the RET population (79%) (Table 1). In contrast to RET, GFR -1 and
GFR -2 mRNAs are each expressed in only approximately half of the
IB4 cells (46 and 55%, respectively) (Table 1). To determine
whether GFR -1 and GFR -2 are expressed by the same IB4 cells,
serial sections were triple-labeled for trkA, IB4, and GFR -1 or
GFR -2 mRNAs (Fig. 3). This analysis
revealed that the RET/IB4 cells can be subdivided into four,
roughly equally sized subgroups, based on their expression of the
GFR subunits: GFR -1 alone (21% of IB4 cells), GFR -2 alone
(28%), both GFR -1 and GFR -2 (30%), and neither GFR -1 nor
GFR -2 (21%).

View larger version (165K):
[in this window]
[in a new window]
|
Figure 2.
Expression of RET, GFR -1, and GFR -2 in
IB4-labeled DRG cells. In situ hybridization for RET
(a), GFR -1 (c), or
GFR -2 (e) was combined with IB4 labeling
(b, d, f). a and b
show that many IB4 cells express RET (arrows indicate
double-labeled cells). A similar pattern is seen in c
and d and in e and f in
relation to GFR -1 and GFR -2, except that the GFR components
are expressed in a smaller proportion of IB4 cells. Long
arrows indicate IB4-labeled cells that express GFR -1 or
GFR -2, whereas short open arrows indicate IB4 cells
that do not express GFR -1 or GFR -2. Scale bar, 50 µm.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Percentage of DRG neurons co-expressing immunoreactivity
for trkA, IB4, trkA + IB4, or N52 and in situ
hybridization signal for RET, GFR -1, and GFR -2 mRNAs
|
|

View larger version (91K):
[in this window]
[in a new window]
|
Figure 3.
GFR -1 and GFR -2 expression in IB4 cells.
GFR -1 and GFR -2 are coexpressed in one group of IB4 cells,
expressed separately in other groups, and not expressed at all in a
fourth group. Serial sections are shown triple-labeled for trkA
(a, d), IB4 (b, e), and either GFR -1
(c) or GFR -2
(f) mRNAs. A IB4 cell expressing only
GFR -1 is identified by an arrow. An
arrowhead indicates a IB4 cell that expresses only
GFR -2. The double arrow indicates a IB4 cell that
expresses both GFR -1 and GFR -2. Note that none of these cells are
trkA immunoreactive. The star indicates a IB4 cell that
expresses neither GFR -1 nor GFR -2. This cell is also trkA
immunoreactive. Also shown is a large cell (asterisk)
that expresses both GFR -1 and GFR -2. It is not IB4-labeled or
trkA immunoreactive. Scale bar, 50 µm.
|
|
In contrast to the high expression of GDNF receptor components in the
IB4 cells, expression was low in the second subpopulation of DRG cells,
namely the trkA immunoreactive cells. GFR -2 mRNA was observed in
very few trkA immunoreactive cells (3%) (Table 1), and although RET
mRNA was expressed by a significant number of trkA cells (28%) (Table
1), they belonged to a group that also showed IB4 labeling (Table 1).
The majority of trkA cells do not show IB4 labeling (Averill et al.,
1995 ; Michael et al., 1997 ) and did not express either RET or GFR -2
mRNAs (Table 1). However, a small number of these cells do express
GFR -1 mRNA (Table 1). The GDNF receptor components were also
expressed in the third subpopulation of DRG cells, namely large neurons
that can be identified by labeling with anti-neurofilament
antisera such as N52. GFR -1 and RET mRNAs are expressed by a
significant number of N52 immunoreactive cells (40 and 33%,
respectively) (Table 1), but GFR -2 is virtually absent (only 5% of
N52 cells).
To further study the pattern of RET expression, a polyclonal
antiserum to RET was used (Molliver et al., 1997 ). Staining of L4/5 DRG sections (Fig. 4) revealed
immunoreactivity in a population of DRG cells similar to that labeled
by in situ hybridization. Thus 72% of L4/5 DRG cell
profiles were RET immunoreactive, and of these the majority were
also IB4-labeled (96% of IB4 cells were RET immunoreactive) (Fig. 4).
Only 27 and 30%, respectively, of RET immunoreactive cells showed
immunoreactivity for trkA or for the neuropeptide CGRP (Fig. 4). The
distribution of RET immunoreactivity in the lumbar enlargement of the
spinal cord was also studied. RET immunoreactive terminals were present
principally in lamina IIi (Fig. 4), the same region in which IB4
labeling is observed (Fig. 4). It was interesting, given that some
large diameter DRG cells express RET (see above), that clear labeling
for RET immunoreactive terminals was not observed in the regions of the
spinal cord where these neurons terminate, i.e., the deep dorsal
horn or the ventral horn.

View larger version (121K):
[in this window]
[in a new window]
|
Figure 4.
Colocalization of RET immunoreactivity with
neurochemical markers in DRG cells and spinal cord.
a-f, Dual labeling showing RET immunofluorescence
(a, c, e) combined with IB4 labeling
(b), trkA immunofluorescence
(d), and CGRP immunofluorescence
(f) in DRG cells. Arrows
indicate extensive colocalization of RET and IB4 in small diameter
cells (a, b). Note that all IB4 cells show RET
immunoreactivity. However, several RET positive cells do not bind IB4
(asterisks). RET labeling is not evident in many trkA
cells (c, d). Asterisks denote trkA cells
that are not co-labeled for RET. Similarly, few CGRP-expressing DRG
cells are RET immunoreactive (e, f).
Asterisks indicate cells that do not express RET but are
labeled for CGRP. The arrow indicates a cell that is
dual-labeled. g-j, Low-magnification (g,
i) and high-magnification (h, j) micrographs
showing RET immunofluorescence (g, h) and IB4
(i, j) double labeling in the dorsal horn of the spinal
cord. Labeling is most intense in inner lamina II.
Arrows in h and j indicate
individual double-labeled axons. Scale bars (shown in
f): a-f, 50 µm; (shown in
i): g, i, 100 µm; (shown
in j): h, j, 30 µm.
|
|
GDNF reverses axotomy-induced changes in the IB4-binding
population of sensory neurons
To investigate the trophic effects of GDNF on sensory neurons, the
ability of GDNF and NGF to reverse axotomy-related changes in different
populations of sensory neurons was compared. Two different doses of
these factors were used: a low dose of 1.2 µg/d and a high dose of 12 µg/d administered continuously over 14 d (these doses were based
on our own and others previous findings) (Bennett et al., 1996b , Verge
et al., 1995 ), and because these proteins are being administered
in vivo, these doses are much higher than would be
considered appropriate in vitro.
There were marked phenotypic changes in the IB4-binding population of
small diameter DRG cells after 2 weeks of axotomy, including a
reduction in the percentage of DRG cell profiles that bind IB4, from
~40% to <20% (Fig. 5, Table
2). Intrathecal application of low-dose
GDNF significantly increased the number of DRG cell profiles binding
IB4 after axotomy (p < 0.001; unpaired
t test), and the high-dose GDNF treatment was even more
effective (p < 0.001; unpaired t
test) (Fig. 5, Table 2). In contrast, intrathecal application of NGF
(at either dose) had no significant effect on this marker (Fig. 5,
Table 2). TMP is an enzyme present principally in the IB4-binding
"trk-less" population of DRG cells. A histochemical reaction was
used to reveal TMP activity within DRG cells, and this produced a black
reaction product within the cytoplasm of cells. Axotomy led to a large
reduction in the proportion of DRG cell profiles that expressed TMP
activity (Fig. 5, Table 2). Intrathecal administration of GDNF at a low
dose produced a significant increase in the proportion of cell profiles
expressing TMP activity compared with no treatment
(p < 0.05; unpaired t test) (Table 2). Intrathecal administration of GDNF at a high dose after axotomy was
even more effective (p < 0.001; unpaired
t test) (Fig. 5, Table 2) and restored TMP activity to a
level not significantly different from normal. Intrathecal
administration of NGF (at either dose) was ineffective in restoring the
proportion of DRG cell profiles expressing TMP activity after axotomy
(Fig. 5, Table 2). Somatostatin is a neuropeptide expressed in a
subgroup of trk-less DRG cells (Kashiba et al., 1996 ); its expression
drops after axotomy (Table 2). Administration of GDNF at a low dose produced a small nonsignificant increase in the number of DRG cell
profiles expressing somatostatin after axotomy. Intrathecal administration of GDNF at a high dose prevented this axotomy-induced change (p < 0.05; unpaired t test;
compared with axotomy alone) (Table 2). Intrathecal administration of
NGF was ineffective in preventing this change (Table 2).

View larger version (173K):
[in this window]
[in a new window]
|
Figure 5.
Histochemistry for TMP (a-d), IB4
labeling (e-h), and CGRP immunofluorescence
(i-l) in dorsal root ganglia of control animals
(a, e, i), animals with unilateral sciatic nerve section
(b, f, j), animals with unilateral sciatic nerve section
combined with intrathecal GDNF treatment (12 µg/d) (c, g,
k), and animals with unilateral sciatic nerve section combined
with intrathecal NGF treatment (12 µg/d) (d, h,
l). Sciatic nerve section causes a loss of TMP
(b) and IB4 (f)
labeling, which is prevented by GDNF treatment (c, g)
but not by NGF (d, h). In contrast, the loss of CGRP
staining caused by sciatic nerve section
(j) is prevented by NGF
(l) but not by GDNF
(k). Scale bar, 50 µm. CTRL,
Control; AXOT, axotomized.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2.
The percentage of profiles stained for IB4, TMP, CGRP, or
SOM in naive animals or after axotomy alone or axotomy in combination
with treatment with GDNF (1.2 or 12 µg/d) or NGF (1.2 or 12 µg/d)
|
|
These effects are in contrast to those seen in the other population of
small diameter DRG cells, those that express the trkA receptor and the
neuropeptide CGRP. CGRP expression in DRG cell profiles fell markedly
after axotomy, from ~40% of cell profiles to ~25%. Intrathecal
application of NGF at a low dose could partially prevent this reduction
(Table 2). Intrathecal application of NGF at a high dose prevented this
reduction (p < 0.05; unpaired t
test) (Fig. 5, Table 2). Administration of GDNF (at a low dose or a
high dose) had no significant effect on the proportion of DRG cell
profiles expressing CGRP after axotomy (Fig. 5, Table 2).
A size analysis was performed to ensure that changes in DRG cell
profile counts after different interventions did not occur as a
consequence of alterations in cell size. The mean cell profile size in
L4/5 ganglia in normal animals was 477 ± 28 µm2 (n = 4), after 2 week sciatic
axotomy it was 449 ±38 µm2 (n = 4), and after sciatic axotomy and GDNF treatment (12 µg/d; n = 3) it was 494 ±33 µm2. There
was no significant difference between these groups
(p > 0.2; unpaired t test).
Thus, NGF and GDNF had complementary actions in their ability to rescue
phenotypic changes in trk- and non-trk-expressing small DRG neurons,
respectively. We did not find any significant effects of GDNF on the
percentage of DRG cells expressing IB4 and TMP in the normal DRG (data
not shown).
GDNF reverses a number of axotomy-induced changes within the dorsal
horn of the spinal cord
The alterations seen in DRG cell bodies were also reflected in
changes within the dorsal horn after axotomy. TMP activity and IB4
binding were normally present within lamina IIi of the dorsal horn, the
same region in which RET immunoreactive terminals were present (Fig.
4). After 2 weeks of axotomy, TMP activity was virtually absent from
the sciatic projection territory of the dorsal horn. IB4 binding was
also markedly reduced (Figs. 6,
7a). Quantitative image analysis demonstrated that
continuous intrathecal administration of GDNF at a low dose had a
significant effect on TMP activity and IB4 binding after axotomy
(p < 0.05; unpaired t test; compared
with no treatment) (Figs. 6,
7a). Administration of GDNF at
a high dose was more effective and could almost completely restore TMP
activity and IB4 binding levels within the dorsal horn
(p < 0.001, unpaired t test,
comparing GDNF treatment with axotomy alone; p > 0.2, compared with intact) (Figs. 6, 7a). Administration of NGF
at a low dose had no significant effect on IB4 binding after axotomy
and produced only a slight increase in TMP activity after axotomy
(p < 0.05; unpaired t test;
comparing NGF treatment with axotomy alone) (Figs. 6, 7a).
NGF administration at a high dose had a small but significant effect in
restoring TMP activity and IB4 binding (by ~10-15%,
p < 0.05; unpaired t test comparing NGF
treatment with axotomy alone) (Figs. 6, 7a). The effect of NGF on TMP activity within the dorsal horn was much less than that of
GDNF (p < 0.001; comparing GDNF with NGF
treatment at both high and low doses).

View larger version (87K):
[in this window]
[in a new window]
|
Figure 6.
Histochemistry for TMP at the level of L4 in the
dorsal horn of animals with unilateral sciatic nerve section
(a), animals with unilateral sciatic nerve
section combined with high (12 µg/d) (b) and
low (1.2 µg/d) (c) dose intrathecal GDNF
treatment, and animals with unilateral sciatic nerve section combined
with high (12 µg/d) (d) and low (1.2 µg/d)
(e) dose intrathecal NGF. Sciatic nerve section
causes a loss of TMP in the sciatic termination territory within lamina
IIi (demonstrated by arrows). GDNF treatment at either
dose is effective at preventing this loss (b, c),
whereas NGF is much less effective at either dose used (d,
e). Scale bar, 100 µm. Axot.,
Axotomized.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 7.
a, The ratio of the area occupied
by IB4, TMP, or CGRP stained terminals within lamina II of the dorsal
horn of the spinal cord on the axotomized side versus the normal side
in animals that have undergone axotomy (n = 4) or
axotomy in combination with an intrathecal infusion of GDNF at a dose
of either 1.2 µg/d (n = 3) or 12 µg/d
(n = 4) or NGF at a dose of either 1.2 µg/d
(n = 3) or 12 µg/d (n = 3).
GDNF at a dose of 12 µg/d almost completely prevented the
axotomy-induced reduction in staining intensity of IB4 and TMP
(p < 0.001; unpaired t test;
comparing GDNF with no treatment after axotomy). The lower dose of GDNF
(1.2 µg/d) also had a significant effect in preventing the
axotomy-induced reduction in staining intensity of these markers but
was less effective than the higher dose. The high dose GDNF had a small
but significant effect in preventing the axotomy-induced reduction in
CGRP staining (p < 0.05; unpaired
t test). NGF could almost completely prevent the
axotomy-induced reduction in CGRP staining
(p < 0.001; unpaired t test;
comparing NGF with no treatment after axotomy). NGF at 12 µg/d had a
small but significant effect on the axotomy-induced reduction in IB4
and TMP expression (p < 0.05; unpaired
t test). b, The ratio of the area
occupied by CTB-labeled terminals in lamina II compared with lamina III
of the dorsal horn in normal (n = 5), axotomized
(n = 4), and axotomy + GDNF (Axot.
GDNF) 1.2 µg/d (n = 3) and 12 µg/d (n = 4) animals. Note that there is a
significant increase in labeling in lamina II after axotomy
(p < 0.01; unpaired t test),
which is almost completely prevented by treatment with GDNF at the
higher dose. GDNF treatment at the low dose also had a significant
effect (p < 0.01 compared with no
treatment; unpaired t test) but was less effective than
the higher dose.
|
|
CGRP immunoreactive terminals are normally present within laminae I and
II of the dorsal horn, the region in which trkA-expressing DRG cells
terminate (Averill et al., 1995 ; Molliver et al., 1995 ). After axotomy
there was ~60% reduction in CGRP immunoreactivity within the sciatic
termination territory (Fig. 7a), as determined by image
analysis. Intrathecal treatment with NGF at either a low or high dose
largely prevented this change (p < 0.001;
unpaired t test; comparing NGF treatment at either dose to
no treatment) (Fig. 7a). GDNF treatment at a low dose had no
significant effect on CGRP levels after axotomy
(p > 0.05; unpaired t test). GDNF treatment at a high dose had a small (~10%) but significant rescue effect on CGRP levels (p < 0.05; unpaired
t test; comparing GDNF treatment to no treatment).
The cholera toxin B subunit (CTB) binds to the GM1 receptor, which is
selectively expressed by myelinated sensory afferents. CTB undergoes
transganglionic transport by these afferents and so can be used to
study A-fiber terminations within the dorsal horn of the spinal cord.
In normal animals (Fig. 8), CTB-labeled terminals were present within lamina I and the deep laminae of the
spinal cord (laminae III-IV). There were some terminals present in
lamina IIi but very few labeled fibers were present in lamina IIo.
Image analysis demonstrated that the ratio of labeling in lamina IIo to
lamina III was extremely low (0.003 ± 0.0006) (Fig. 6b). Two weeks after axotomy, CTB was present throughout
lamina II, including lamina IIo, and there was also more intense
labeling within lamina I (Fig. 8). This change is accepted to indicate A-fiber sprouting into the superficial laminae (Woolf et al., 1992 ,
1995 ; Bennett et al., 1996b ). There was a significant increase in the
ratio of labeling within lamina IIo to lamina III (to 0.631 ± 0.07 after axotomy; p < 0.01; unpaired t
test) (Fig. 7b). In animals that had received a 2 week
intrathecal infusion of GDNF at a low dose, the A-fiber sprouting
within lamina II was largely prevented (Fig. 8). Very few CTB-labeled
terminals were present within lamina IIo. Quantitative image analysis
demonstrated that the ratio of CTB staining between lamina IIo and
lamina III after this treatment was 0.016 ± 0.002 (p < 0.01; unpaired t test compared with no treatment) (Fig. 7b). Treatment with GDNF at the
higher dose was even more effective (the ratio of CTB staining between lamina IIo and lamina III was 0.007 ± 0.003, which was not
significantly different from that seen in normal intact animals). The
difference between untreated and GDNF-treated axotomized animals was
highly significant (p < 0.001; unpaired
t test) (Fig. 7b). The profuse CTB labeling that
normally occurs within lamina I after axotomy also appeared to be
prevented by GDNF treatment.

View larger version (118K):
[in this window]
[in a new window]
|
Figure 8.
Transport of CTB to the dorsal horn of the spinal
cord at the level of L3 (a-c), L4
(d-f), and L5 (g-i) after
sciatic nerve label in control (CTRL) animals (a,
d, g), animals that have undergone axotomy
(AXOT) (b, e, h), and animals that
have undergone axotomy combined with GDNF
(AXOT+GDNF) treatment (12 µg/d) (c, f,
i). In the normal animal, CTB-labeled terminals are present in
lamina I and the deeper laminae of the dorsal horn (III-IV) but are
excluded from lamina II (a, d, g). After axotomy,
CTB-labeled terminals appear in lamina II (denoted by
asterisks), and there is also more dense labeling of
axon bundles within lamina I (arrows in b, e,
h). These axotomy-related changes are prevented by treatment
with GDNF, where the CTB labeling pattern appears the same as control,
and this is seen consistently throughout L3-L5 (c, f,
i). Scale bar, 100 µm.
|
|
Trophic factor effects on electrophysiological properties of
axotomized C-fibers
Axotomy produces a conduction velocity slowing in C-fibers; we
investigated the efficacy of GDNF and NGF in reversing this change. The
conduction velocity (CV) distribution of C-fibers projecting through
the normal tibial nerve was unimodal, with a mean of 0.86 ± 0.06 m/sec. After two weeks of axotomy, velocity was slowed to a mean of
0.68 ± 0.03 m/sec, and this was significant (p < 0.01; unpaired t test). This
slowing was also apparent as a leftward shift in the cumulative sum
plots of CV of units (Fig. 9), and this
shift was also statistically significant (p < 0.01; Kolmogorov-Smirnov). Intrathecal provision of GDNF, at 12 µg/d, throughout the 2 week period of axotomy, partially and
significantly prevented this slowing (Fig. 9) (p < 0.05; Kolmogorov-Smirnov). The slowest conducting C-fibers were
especially rescued by GDNF. NGF at 12 µg/d also had a partial and
significant effect in preventing axotomy-induced slowing (Fig. 9)
(p < 0.05; Kolmogorov-Smirnov), although in
this case C-fibers throughout the CV distribution were more equally
affected, suggesting that GDNF and NGF do not affect the same
population of afferents. Consistent with this suggestion, intrathecal
provision of both NGF and GDNF, at 12 µg/d each, produced the
greatest rescue of C-fiber CV. In fact, in this case neither the CV
distribution nor the mean CV (0.83 ± 0.03 m/sec) differed
significantly from that seen in intact animals
(p > 0.05; Kolmogorov-Smirnov and unpaired
t test, respectively). Thus, these results provide an
independent measure of the ability of GDNF and NGF, delivered by this
route and at this dose, to produce a near-complete reversal of axotomy
effects in C-fibers.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 9.
The conduction velocity (CV) of C-fibers
projecting through the tibial nerve was measured by stimulation of that
nerve electrically and recording and averaging activity in fine strands
of the L5 dorsal root. a shows a representative
recording from an animal in which the tibial nerve had been cut and
tied 2 weeks previously; the animal was treated continuously with
intrathecal GDNF and NGF (each at 12 µg/d). Arrows
show examples of individual C-fiber potentials occurring in response to
the stimulation. b, Cumulative sum plots showing the
average CV distributions constructed from groups of animals receiving
different treatment (n = 3-5 animals per group).
Error bars show SEM. Note that axotomy results in a significant slowing
of C-fibers (seen as a leftward shift in the Qsum plots), and both NGF
and GDNF partially prevent this slowing.
|
|
 |
DISCUSSION |
The principal conclusion of this work is that GDNF is a trophic
factor for a substantial subgroup of adult primary sensory neurons that
are neurotrophin independent. This conclusion is based on two lines of
investigation: the localization of receptor components and the
selective rescue effects of exogenous GDNF on axotomized sensory
neurons, as discussed below.
GDNF receptor component expression within sensory neurons
The signal transducing domain of the GDNF receptor RET was found
to be present in 60-70% of DRG cell profiles. GFR -1 and GFR -2,
the ligand binding domains for GDNF and neurturin, had a more
restricted distribution (they were expressed in 45 and 33% of DRG cell
profiles, respectively). GDNF receptor components were strikingly
expressed by the IB4 binding, trk-less population of DRG cells. Almost
all IB4 cells express RET. Approximately 50% of IB4 cells also express
GFR -1. This implies that 50% of IB4 cells coexpress both receptor
components and are therefore likely to be highly sensitive to GDNF. The
other 50% of the IB4 cells express RET, apparently in the absence of
GFR -1. GDNF has been reported by some authors to be able to activate
RET in the absence of GFR -1 and also to be able to act via the
related neurturin receptor component GFR -2 (Baloh et al., 1997 ;
Buj-Bello et al., 1997 ; Klein et al., 1997 ; Sanicola et al., 1997 ). We
found that this receptor component was also highly localized within the
IB4-binding population of DRG cells. In some cells it was coexpressed
with GFR -1 and in others it was expressed independently of GFR -1. The majority (80%) of IB4-binding DRG cells expressed either one or
both ligand binding components. Therefore GDNF may be able to act on a
larger population of IB4 cells than just those that express GFR -1.
These findings also suggest that a proportion of the IB4-binding
population of DRG cells are likely to be responsive to neurturin. RET
immunoreactive terminals were found to project principally to lamina
IIi of the dorsal horn of the spinal cord, the same lamina in which the
IB4-binding DRG cells terminate. In contrast to the IB4 cells, the
other population of small diameter DRG cells (those that express trkA)
generally lack RET, GFR -1, and GFR -2. Any coexpression is largely
accounted for by the known overlap between trkA and IB4 (18% of trkA
cells also bind IB4) (Averill et al., 1995 ). A significant number of
large diameter DRG cells (as revealed by staining with N52) express
GFR -1 or RET or both, suggesting that these cells may also be
responsive to GDNF.
Neuroprotective effects of GDNF on sensory neurons
The receptor localization data discussed above shows that a large
proportion of the "neurotrophin-independent" population of small
diameter DRG cells express receptor components for GDNF. Markers that
can be used to define this population include binding of the lectin IB4
and the enzyme TMP. A small subset of these cells also expresses the
neuropeptide somatostatin. In this study we directly examined whether
the IB4-binding population of sensory neurons would be responsive to
GDNF (as compared with NGF) after axotomy. Intrathecal delivery was
used, which we have previously demonstrated to be effective at
delivering trophic factors to sensory neurons (Bennett et al., 1996b ;
Michael et al., 1997 ).
After axotomy we found that at both doses used, GDNF was much more
effective than NGF at restoring IB4 binding, TMP staining, and
somatostatin expression within both the DRG and the dorsal horn of the
spinal cord. Conversely, NGF was much more effective than GDNF at
restoring CGRP expression within the DRG and dorsal horn after axotomy.
These findings complement those on receptor distribution. NGF has
selective effects on the CGRP-expressing population of DRG cells,
whereas conversely, GDNF has selective actions on the IB4-binding
(i.e., neurotrophin-independent) population of cells. The known overlap
between these markers (Averill et al., 1995 ) probably accounts for the
limited nonselective effects seen. Our electrophysiological results
provide an independent means of assessing the trophic effects of GDNF
and NGF on small diameter DRG cells (C-fibers). GDNF and NGF appeared
to prevent conduction velocity slowing after axotomy in distinct
populations of C-fibers, and importantly, the actions of these factors
when administered together were additive. We have shown previously that
conduction velocity slowing in large sensory neurons, induced by
axotomy, is only marginally affected by intrathecal GDNF treatment (Munson and McMahon, 1997 ).
We have also demonstrated that GDNF could prevent the axotomy-induced
A-fiber sprouting into lamina II of the dorsal horn. This may represent
a direct effect of GDNF on large DRG neurons or it may occur as a
consequence of the rescue effect of GDNF on IB4-binding small diameter
DRG cells. There is now a body of evidence suggesting that degenerative
atrophy of C-fiber terminals within lamina II after axotomy
(Knyihar-Csillik et al., 1987 ) is critically important for A-fibers
sprouting into this region. This evidence derives from the fact that
C-fibers in the sciatic nerve have a more restricted mediolateral and
rostrocaudal distribution than sciatic A-fibers, and the sprouting of
A-fibers occurs only in the termination region of axotomized C-fibers
(Woolf et al., 1995 ). Furthermore, capsaicin, which selectively damages
C-fibers, can induce A-fiber sprouting (Mannion et al., 1996 ). We have
shown previously that NGF can prevent A-fiber sprouting (Bennett et al., 1996b ), and the demonstration here that GDNF is also effective is
likely to represent the "rescue" of the IB4-binding population of
small diameter afferents after axotomy. These results are interesting in that, as we have demonstrated here, NGF and GDNF support largely separate populations of C-fibers and yet either can prevent the sprouting response after axotomy.
Functional implications of GDNF effects
Our data indicate that GDNF has a potent and selective
effect on the IB4-binding population of DRG cells, and similar
selectivity has recently been observed in vitro (Molliver et
al., 1997 ; Leclere et al., 1998 ). The IB4 population of primary
afferents are primarily small in diameter. Given that 80-90% of
C-fibers are nociceptors (Lynn and Carpenter, 1982 ; Kress et al.,
1992 ), IB4-binding DRG cells must be principally nociceptive in
function (Willis and Coggeshall, 1991 ). These neurons are capsaicin
sensitive (Fitzgerald, 1983 ) and possess free nerve endings in various
tissues, including skin, muscle, joint, and viscera. It has recently
been shown that this group of sensory neurons selectively expresses the
purinergic receptor P2X3 (Vulchanova et al., 1996 ). This
receptor is thought to be important in mediating the nociceptive
actions of ATP (Cook et al., 1997 ). The sensitivity of this population
to GDNF suggests that this factor may be important in the development
and maintenance of pain-signaling systems.
One important question is whether GDNF is normally required for the
phenotypic maintenance of the IB4 population of DRG cells or whether
the rescue effects on these cells reflect a purely pharmacological
action. GDNF is produced by peripheral targets (Trupp et al., 1995 ) and
may normally be available to these afferents. It is unknown, as yet,
whether neurturin also has actions on the IB4-binding population of DRG
cells.
It is interesting that the IB4-binding population of DRG cells develops
such marked sensitivity to GDNF during postnatal development. During
embryonic development these neurons are dependent for survival on NGF
and are absent in animals that lack trkA (Silos-Santiago et al., 1995 ).
The developmental regulation of RET has been studied by Molliver et al.
(1997) in the mouse. RET was only clearly seen in DRG cells from
embryonic day 15. Expression increased in IB4 cells during the late
embryonic and early postnatal period and reached the adult levels by
approximately postnatal day 7. At the time RET is reaching its peak,
the same neurons downregulate trkA and lose their NGF sensitivity
(Bennett et al., 1996a ; Molliver and Snider, 1997 ). Molliver et al.
(1997) also reported a pattern of GFR -1/RET distribution similar to
what we report here.
Nerve injury may result in abnormalities of sensation and importantly
the generation of a chronic pain state in both animals and man. One
important mechanism for these changes is the impaired retrograde
transport of trophic factors after nerve injury (McMahon and Bennett,
1997 ). As a consequence of nerve injury, there is a large upregulation
of GDNF expression within the damaged nerve (Trupp et al., 1995 ), as
has been shown previously for NGF (Lindholm et al., 1987 ). Expression
of GFR -1 has also been reported to increase in injured nerves (Baloh
et al., 1997 ; Trupp et al., 1997 ), and this may act to present GDNF to
regenerating neurons. Our results imply that the upregulation of GDNF
expression in damaged nerves is not sufficient to prevent
axotomy-induced changes.
The restitution of IB4 binding, TMP activity, and somatostatin
expression by GDNF after axotomy may indicate a general beneficial action of GDNF in normalizing the properties of damaged sensory neurons. These anatomical findings were supported by the evidence that
GDNF can partially prevent the conduction velocity slowing that occurs
in a population of C-fibers after axotomy. The A-fiber sprouting that
occurs after axotomy has previously been implicated in the generation
of some aspects of neuropathic pain. The suggestion is that when the
large diameter, low-threshold mechanoreceptive A-fibers form synapses
in lamina II with presumed pain-signaling postsynaptic dorsal horn
systems, this provides an explanation for the condition of allodynia,
or touch-evoked pain, that is frequently seen in neuropathic pain
patients (Woolf et al., 1992 ).
Behavioral data suggest that GDNF can exert trophic effects on IB4
binding nociceptive afferents without altering their responses to acute
noxious thermal and mechanical stimuli (D. L. H. Bennett and
S. B. McMahon, unpublished observations). This is in marked contrast to the actions of NGF, which acts on the other major group of
nociceptors, those expressing trkA. NGF acutely or chronically administered to animals and man can produce pain and hyperalgesia (Lewin et al., 1993 ; Petty et al., 1994 ; Woolf et al., 1994 ; Andreev et
al., 1995 ). Because many forms of neuropathy in man affect small
diameter nociceptive afferents, our results suggest that GDNF may be of
some use in the treatment of these conditions. In particular, we would
predict that GDNF may add to, rather than simply substitute for, the
effects of NGF in the treatment of neuropathies.
 |
FOOTNOTES |
Received Dec. 8, 1997; revised Jan. 23, 1998; accepted Jan. 28, 1998.
This work was funded by the Medical Research Council of Great Britain.
D.L.H.B. is supported by the Special Trustees of Guy's and St.
Thomas' Hospitals. We acknowledge the expert technical assistance of
C. Abel and S. Hamilton. We also thank Genentech for the provision of
rhNGF and Amgen for the provision of rhGDNF; H. S. Phillips and
R. D. Klein for the provision of the GFR -2 sequence; and Dr.
D. O. Clary, Dr. T. Görcs, and Professor J. M. Polak
for the provision of the trkA, somatostatin, and CGRP antisera,
respectively.
D.L.H.B. and G.J.M. contributed equally to this work.
Correspondence should be addressed to Professor S. B. McMahon,
Department of Physiology, St. Thomas' Hospital Medical School, Lambeth
Palace Road, London SE1 7EH, UK.
 |
REFERENCES |
-
Andreev NY,
Dimitrieva N,
Koltzenburg M,
McMahon SB
(1995)
Peripheral administration of nerve growth factor in the adult rat produces a thermal hyperalgesia that requires the presence of sympathetic post-ganglionic neurones.
Pain
63:109-115[Web of Science][Medline].
-
Averill S,
McMahon SB,
Clary SB,
Reichardt LF,
Priestley JVP
(1995)
Immunocytochemical localization of trkA receptors in chemically identified subgroups of adult rat sensory neurons.
Eur J Neurosci
7:1484-1494[Web of Science][Medline].
-
Baloh RH,
Tansey MG,
Golden JP,
Creedon DJ,
Heukeroth RO,
Keck CL,
Zimonjic DB,
Popescu NC,
Johnson EM,
Milbrandt J
(1997)
TrnR2, a novel receptor that mediates neurturin and GDNF signaling through Ret.
Neuron
18:793-802[Web of Science][Medline].
-
Beck KD,
Valverde J,
Alexi T
(1995)
Mesencephalic dopaminergic neurons protected by GDNF from axotomy-induced degeneration in the adult brain.
Nature
373:339-341[Medline].
-
Bennett DLH,
Averill S,
Clary DO,
Priestley JV,
McMahon SB
(1996a)
Postnatal changes in the expression of the trkA high affinity NGF receptor in primary sensory neurons.
Eur J Neurosci
8:2204-2208[Web of Science][Medline].
-
Bennett DLH,
French J,
Priestley JVP,
McMahon SB
(1996b)
NGF but not NT-3 or BDNF prevents the A fiber sprouting into lamina II of the spinal cord that occurs following axotomy.
Mol Cell Neurosci
8:211-220[Web of Science][Medline].
-
Bowenkamp KE,
Hoffman AF,
Gerhardt GA,
Henry MA,
Biddle PT,
Hoffer BJ,
Granholm ACE
(1995)
Glial cell line-derived neurotrophic factor supports survival of injured midbrain dopaminergic neurons.
J Comp Neurol
355:479-489[Web of Science][Medline].
-
Buj-Bello A,
Buchman VL,
Horton A,
Rosenthal A,
Davies AM
(1995)
GDNF is an age-specific survival factor for sensory and autonomic neurons.
Neuron
15:821-828[Web of Science][Medline].
-
Buj-Bello A,
Adu J,
Pinon LGP,
Horton A,
Thompson J,
Rosenthal A,
Chinchetru M,
Buchman V,
Davies A
(1997)
Neurturin responsiveness requires a GPI-linked receptor and Ret receptor tyrosine kinase.
Nature
387:721-724[Medline].
-
Canzian F,
Ushijima T,
Nagao M,
Matera I,
Romeo G,
Ceccherini I
(1995)
Genetic mapping of the RET protooncogene on rat chromosome 4.
Mamm Genome
6:433-435[Web of Science][Medline].
-
Cook SP,
Vulchanova L,
Hargreaves KM,
Elde R,
McCleskey EW
(1997)
Distinct ATP receptors on pain-sensing and stretch sensing neurons.
Nature
387:505-508[Medline].
-
Durbec P,
Marcos-Gutierrez CV,
Kilkenny C,
Grigoriou M,
Wartiowaaria K,
Suvanto P,
Smioth D,
Ponder B,
Costantini F,
Saarma M,
Sariola H,
Pachnis V
(1996)
GDNF signalling through the Ret receptor tyrosine kinase.
Nature
381:789-793[Medline].
-
Fitzgerald M
(1983)
Capsaicin and sensory neurons: a review.
Pain
15:109-130[Web of Science][Medline].
-
GFR
Nomenclature Committee
(1997)
Nomenclature of GPI linked receptors for the GDNF ligand family.
Neuron
19:485[Web of Science][Medline]. -
Henderson CE,
Phillips HS,
Pollock RA,
Avies A,
Lemeulle C,
Armanini M,
Simmons L,
Moffet B,
Vandlen R
(1994)
GDNF: a potent survival factor for motoneurons present in peripheral nerve and muscle.
Science
266:1062-1064[Abstract/Free Full Text].
-
Jing S,
Wen D,
Yu Y,
Holst PL,
Luo Y,
Fang M,
Tamir R,
Antonio L,
Hu Z,
Cupples R,
Louis JC,
Hu S,
Altrock BW,
Fox GM
(1996)
GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF.
Cell
85:1113-1124[Web of Science][Medline].
-
Kashiba H,
Ueda Y,
Senba E
(1996)
Coexpression of preprotachykinin-A, alpha-calcitonin gene-related peptide, somatostatin, and neurotrophin receptor family messenger RNAs in rat dorsal root ganglion neurons.
Neuroscience
70:179-189[Web of Science][Medline].
-
Klein RD,
Sherman D,
Ho WH,
Stone D,
Bennett G,
Moffat B,
Vandlen R,
Simmons L,
Gu Q,
Hongo J,
Devaux B,
Poulsen K,
Armanini M,
Nozaki C,
Asai N,
Goddard A,
Phillips H,
Henderson C,
Takahashi M,
Rosenthal A
(1997)
A GPI-linked protein that interacts with RET to form a candidate neurturin receptor.
Nature
387:717-721[Medline].
-
Knyihar-Csillik E,
Rakic P,
Csillik B
(1987)
Transganglionic degenerative atrophy in the substantia gelatinosa of the spinal cord after peripheral nerve transection in rhesus monkeys.
Cell Tissue Res
247:599-604[Web of Science][Medline].
-
Kotzbauer PT,
Lampe PA,
Heukeroth RO,
Golden JP,
Creedon DJ,
Johnson EM,
Milbrandt JD
(1996)
Neurturin a relative of glial-cell-line-derived neurotrophic factor.
Nature
6608:467-470.
-
Kress M,
Koltzenburg M,
Reeh PW,
Handwerker HO
(1992)
Responsiveness and functional attributes of electrically localized terminals of cutaneous C-fibres in vivo and in vitro.
J Neurophysiol
68:581-595[Abstract/Free Full Text].
-
Leclere PG,
Ekstrom P,
Edstrom A,
Priestley JV,
Averill S,
Tonge DA
(1998)
Effects of glial cell line-derived neurotrophic factor on axonal growth and apoptosis in adult mammalian sensory neurons in vitro.
Neuroscience
82:545-558[Web of Science][Medline].
-
Lewin GR,
Ritter AM,
Mendell LM
(1993)
Nerve growth factor-induced hyperalgesia in the neonatal and adult rat.
J Neurosci
230:2136-2148.
-
Lin LF,
Doherty DH,
Lile JD,
Bektesh S,
Collins F
(1993)
GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons.
Science
260:1130-1132[Abstract/Free Full Text].
-
Lindholm D,
Heumann R,
Meyer M,
Thoenen H
(1987)
Interleukin-1 regulates synthesis of nerve growth factor in non-neuronal cells rat sciatic nerve.
Nature
330:658-659[Medline].
-
Lynn B,
Carpenter SE
(1982)
Primary afferent units from the hairy skin of the rat hind limb.
Brain Res
238:29-43[Web of Science][Medline].
-
Mannion RJ,
Doubell TP,
Coggeshall RE,
Woolf CJ
(1996)
Collateral sprouting of uninjured primary afferent A-fibers into the superficial dorsal horn of the adult rat spinal cord after topical capsaicin treatment of the sciatic nerve.
J Neurosci
16:5189-5195[Abstract/Free Full Text].
-
Matheson CR,
Garnahan J,
Urich JL,
Bocangel D,
Zhang TJ,
Yan Q
(1997)
Glial cell line-derived neurotrophic factor (GDNF) is a neurotrophic factor for sensory neurons: comparison with the effects of the neurotrophins.
J Neurobiol
32:22-32[Web of Science][Medline].
-
McMahon SB
(1986)
The localization of fluoride-resistant acid phosphatase (FRAP) in the pelvic nerves and sacral spinal cord of rats.
Neurosci Lett
64:305-310[Web of Science][Medline].
-
McMahon SB,
Bennett DLH
(1997)
Growth factors and pain.
In: Handbook of pharmacol 130 (Dickenson A, Besson J-M), pp 135-157. Berlin: Springer.
-
McMahon SB,
Armanini MP,
Ling LH,
Phillips HS
(1994)
Expression and coexpression of Trk receptors in subpopulations of adult primary sensory neurons projecting to identified peripheral targets.
Neuron
12:1161-1171[Web of Science][Medline].
-
Michael GJ,
Priestley JV
(1996a)
Expression of trkA and p75 nerve growth factor receptors in the adrenal gland.
NeuroReport
7:1617-1622[Web of Science][Medline].
-
Michael GJ,
Priestley JV
(1996b)
Combined immunocytochemistry and in situ hybridization.
In: In situ hybridization techniques for the brain (Henderson Z,
ed), pp 111-118. New York: Wiley.
-
Michael GJ,
Averill S,
Nitkunan A,
Rattray M,
Bennett DLH,
Yan Q,
Priestley JV
(1997)
Nerve growth factor treatment increases brain-derived neurotrophic factor selectively in trkA-expressing dorsal root ganglion cells and in their central terminations within the spinal cord.
J Neurosci
17:8476-8490[Abstract/Free Full Text].
-
Molliver DC,
Snider WD
(1997)
Nerve growth factor receptor trkA is down-regulated during postnatal development by a subset of dorsal root ganglion neurons.
J Comp Neurol
381:428-438[Web of Science][Medline].
-
Molliver DC,
Radeke MJ,
Feinstein SC,
Snider WD
(1995)
Presence or absence of trkA protein distinguishes subsets of small sensory neurons with unique cytochemical characteristics and dorsal horn projections.
J Comp Neurol
361:404-416[Web of Science][Medline].
-
Molliver DC,
Wright DE,
Leitner ML,
Parsadanian AS,
Doster K,
Wen D,
Yan Q,
Snider WD
(1997)
IB4-binding nociceptors switch from NGF to GDNF dependence in early postnatal life.
Neuron
19:849-861[Web of Science][Medline].
-
Moore MW,
Klein RD,
Farinas I,
Sauer H,
Armanini M,
Phillips HS,
Reichart LF,
Ryan AM,
Carver-Moore K,
Rosenthal A
(1996)
Renal and neuronal abnormalities in mice lacking GDNF.
Nature
382:76-79[Medline].
-
Munson JB,
McMahon SB
(1997)
Effects of GDNF on axotomised sensory and motor neurons in adult rats.
Eur J Neurosci
9:1126-1129[Web of Science][Medline].
-
Oppenheim RW,
Houenou LJ,
Johnson JE,
Lin L-FH,
Li L,
Lo AC,
Newsome AL,
Prevette DM,
Wang S
(1995)
Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF.
Nature
373:344-346[Medline].
-
Petty BG,
Cornblath DR,
Adornato BT,
Chaudhry V,
Flexner C,
Wachsman M,
Sinicropi D,
Burton LE,
Peroutka SJ
(1994)
The effect of systemically administered recombinant human nerve growth factor in healthy human subjects.
Ann Neurol
36:244-246[Web of Science][Medline].
-
Sanicola M,
Hession C,
Worley P,
Carmillo P,
Ehrenfels C,
Walus L,
Robinson S,
Jaworski G,
Wei H,
Tizard R,
Whitty A,
Pepinsky R,
Cate R
(1997)
Glial cell line-derived neurotrophic factor-dependent RET activation can be mediated by two different cell-surface accessory proteins.
Proc Natl Acad Sci USA
94:6238-6243[Abstract/Free Full Text].
-
Silos-Santiago I,
Molliver DC,
Ozaki S,
Smeyne RJ,
Fagan AM,
Barbacid M,
Snider WD
(1995)
Non-TrkA-expressing small DRG neurons are lost in TrkA deficient mice.
J Neurosci
15:5929-5942[Abstract].
-
Silverman JD,
Kruger L
(1990)
Selective neuronal glycoconjugate expression in sensory and autonomic ganglia: relation of lectin reactivity to peptide and enzyme markers.
J Neurocytol
19:789-801[Web of Science][Medline].
-
Treanor JJ,
Goodman L,
de Sauvage F,
Stone DM,
Poulsen KT,
Beck CD,
Gray C,
Armanini MP,
Pollock RA,
Hefti F,
Phillips HS,
Goddard A,
Moore MW,
Buj-Bello A,
Davies AM,
Asai N,
Takahashi M,
Vandlen R,
Henderson CE,
Rosenthal A
(1996)
Characterization of a multicomponent receptor for GDNF.
Nature
382:80-83[Medline].
-
Trupp M,
Ryden M,
Jornvall H,
Funakoshi H,
Timmusk T,
Arenas E,
Ibanez CF
(1995)
Peripheral expression and biological activities of GDNF, a new neurotrophic factor for avian and mammalian peripheral neurons.
J Cell Biol
130:137-148[Abstract/Free Full Text].
-
Trupp M,
Arenas E,
Fainzilber M,
Nilsson A-S,
Sieber B-A,
Grigoriou M,
Kilkenny C,
Salazar-Grueso E,
Pachnis V,
Arumae U,
Sariola H,
Saarma M,
Ibanez CF
(1996)
Functional receptor for GDNF encoded by the c-ret proto-oncogene.
Nature
381:785-788[Medline].
-
Trupp M,
Belluardo N,
Funakoshi H,
Ibanez CF
(1997)
Complementary and overlapping expression of glial cell line-derived neurotrophic factor (GDNF), c-ret proto-oncogene, and GDNF receptor-alpha indicates multiple mechanisms of trophic actions in the adult rat CNS.
J Neurosci
17:3554-3567[Abstract/Free Full Text].
-
Verge VM,
Richardson PM,
Wiesenfeld-Hallin Z,
Hokfelt T
(1995)
Differential influence of nerve growth factor on neuropeptide expression in vivo: a novel role in peptide suppression in adult sensory neurons.
J Neurosci
15:2081-2096[Abstract].
-
Verge VM,
Gratto KA,
Karchewski LA,
Richardson PM
(1996)
Neurotrophins and nerve injury in the adult.
Philos Trans R Soc Lond B Biol Sci
351:423-430[Web of Science][Medline].
-
Vulchanova L,
Riedl M,
Shuster S,
Wang J,
Buell G,
Surprenant A,
North RA,
Elde R
(1996)
Immunohistochemical localization of the P2X3 receptor subunit in rat dorsal root ganglion (DRG) neurons.
Soc Neurosci Abstr
22:1810.
-
Willis WD,
Coggeshall RE
(1991)
In: Sensory mechanisms of the spinal cord, Ed 2. New York: Plenum.
-
Woolf CJ,
Shortland P,
Coggeshall RE
(1992)
Peripheral nerve injury triggers central sprouting of myelinated afferents.
Nature
355:75-78[Medline].
-
Woolf CJ,
Safieh-Garabedian B,
Ma QP,
Crilly P,
Winter J
(1994)
Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity.
Neuroscience
62:327-331[Web of Science][Medline].
-
Woolf CJ,
Shortland P,
Reynolds M,
Ridings J,
Doubell T,
Coggeshall RE
(1995)
Reorganization of central terminals of myelinated primary afferents in the rat dorsal horn following peripheral axotomy.
J Comp Neurol
360:121-134[Web of Science][Medline].
-
Wright DE,
Snider WD
(1995)
Neurotrophin receptor mRNA expression defines distinct populations of neurons in rat dorsal root ganglia.
J Comp Neurol
351:329-338[Web of Science][Medline].
-
Yan Q,
Matheson C,
Lopez OT
(1995)
In vivo neurotrophic effects of GDNF on neonatal and adult facial motor neurons.
Nature
373:341-344[Medline].
Copyright © 1998 Society for Neuroscience 0270-6474/98/1883059-14$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Y. Imai, K. Apakupakul, P. R. Krause, W. P. Halford, and T. P. Margolis
Investigation of the Mechanism by Which Herpes Simplex Virus Type 1 LAT Sequences Modulate Preferential Establishment of Latent Infection in Mouse Trigeminal Ganglia
J. Virol.,
August 15, 2009;
83(16):
7873 - 7882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xing, J. Lu, and J. Li
Contribution of nerve growth factor to augmented TRPV1 responses of muscle sensory neurons by femoral artery occlusion
Am J Physiol Heart Circ Physiol,
May 1, 2009;
296(5):
H1380 - H1387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Jankowski, J. J. Lawson, S. L. McIlwrath, K. K. Rau, C. E. Anderson, K. M. Albers, and H. R. Koerber
Sensitization of Cutaneous Nociceptors after Nerve Transection and Regeneration: Possible Role of Target-Derived Neurotrophic Factor Signaling
J. Neurosci.,
February 11, 2009;
29(6):
1636 - 1647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-C. Lo, C.-H. Hsu, A. T.H. Wu, L.-Y. Yang, W.-H. Chen, W.-T. Chiu, W.-F. Lai, C.-H. Wu, J. G. Gelovani, and W.-P. Deng
A Novel Cell-Based Therapy for Contusion Spinal Cord Injury Using GDNF-Delivering NIH3T3 Cells with Dual Reporter Genes Monitored by Molecular Imaging
J. Nucl. Med.,
September 1, 2008;
49(9):
1512 - 1519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakajima, S. Ohtori, G. Inoue, T. Koshi, S. Yamamoto, J. Nakamura, K. Takahashi, and Y. Harada
The characteristics of dorsal-root ganglia and sensory innervation of the hip in rats
J Bone Joint Surg Br,
February 1, 2008;
90-B(2):
254 - 257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Liu, F.-C. Yang, T. Okuda, X. Dong, M. J. Zylka, C.-L. Chen, D. J. Anderson, R. Kuner, and Q. Ma
Mechanisms of Compartmentalized Expression of Mrg Class G-Protein-Coupled Sensory Receptors
J. Neurosci.,
January 2, 2008;
28(1):
125 - 132.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. P. Margolis, Y. Imai, L. Yang, V. Vallas, and P. R. Krause
Herpes Simplex Virus Type 2 (HSV-2) Establishes Latent Infection in a Different Population of Ganglionic Neurons than HSV-1: Role of Latency-Associated Transcripts
J. Virol.,
February 15, 2007;
81(4):
1872 - 1878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Leclere, E. Norman, F. Groutsi, R. Coffin, U. Mayer, J. Pizzey, and D. Tonge
Impaired Axonal Regeneration by Isolectin B4-Binding Dorsal Root Ganglion Neurons In Vitro
J. Neurosci.,
January 31, 2007;
27(5):
1190 - 1199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Marker, R. Lujan, J. Colon, and K. Wickman
Distinct Populations of Spinal Cord Lamina II Interneurons Expressing G-Protein-Gated Potassium Channels.
J. Neurosci.,
November 22, 2006;
26(47):
12251 - 12259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ohta, Y. Ikemi, M. Murakami, T. Imagawa, K.-i. Otsuguro, and S. Ito
Potentiation of transient receptor potential V1 functions by the activation of metabotropic 5-HT receptors in rat primary sensory neurons
J. Physiol.,
November 1, 2006;
576(3):
809 - 822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Katsura, K. Obata, T. Mizushima, J. Sakurai, K. Kobayashi, H. Yamanaka, Y. Dai, T. Fukuoka, M. Sakagami, and K. Noguchi
Activation of SRC-family kinases in spinal microglia contributes to mechanical hypersensitivity after nerve injury.
J. Neurosci.,
August 23, 2006;
26(34):
8680 - 8690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Elitt, S. L. McIlwrath, J. J. Lawson, S. A. Malin, D. C. Molliver, P. K. Cornuet, H. R. Koerber, B. M. Davis, and K. M. Albers
Artemin Overexpression in Skin Enhances Expression of TRPV1 and TRPA1 in Cutaneous Sensory Neurons and Leads to Behavioral Sensitivity to Heat and Cold.
J. Neurosci.,
August 15, 2006;
26(33):
8578 - 8587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Malin, D. C. Molliver, H. R. Koerber, P. Cornuet, R. Frye, K. M. Albers, and B. M. Davis
Glial Cell Line-Derived Neurotrophic Factor Family Members Sensitize Nociceptors In Vitro and Produce Thermal Hyperalgesia In Vivo.
J. Neurosci.,
August 15, 2006;
26(33):
8588 - 8599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Fang, L. Djouhri, S. McMullan, C. Berry, S. G. Waxman, K. Okuse, and S. N. Lawson
Intense isolectin-B4 binding in rat dorsal root ganglion neurons distinguishes C-fiber nociceptors with broad action potentials and high Nav1.9 expression.
J. Neurosci.,
July 5, 2006;
26(27):
7281 - 7292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-R. Chen and H.-L. Pan
Loss of TRPV1-Expressing Sensory Neurons Reduces Spinal {micro} Opioid Receptors But Paradoxically Potentiates Opioid Analgesia
J Neurophysiol,
May 1, 2006;
95(5):
3086 - 3096.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Di Castro, L. J. Drew, J. N. Wood, and P. Cesare
Modulation of sensory neuron mechanotransduction by PKC- and nerve growth factor-dependent pathways
PNAS,
March 21, 2006;
103(12):
4699 - 4704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Albers, C. J. Woodbury, A. M. Ritter, B. M. Davis, and H. R. Koerber
Glial cell line-derived neurotrophic factor expression in skin alters the mechanical sensitivity of cutaneous nociceptors.
J. Neurosci.,
March 15, 2006;
26(11):
2981 - 2990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. Lindfors, V. Voikar, J. Rossi, and M. S. Airaksinen
Deficient Nonpeptidergic Epidermis Innervation and Reduced Inflammatory Pain in Glial Cell Line-Derived Neurotrophic Factor Family Receptor {alpha}2 Knock-Out Mice
J. Neurosci.,
February 15, 2006;
26(7):
1953 - 1960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Xu, C. Van Slambrouck, L. Berti-Mattera, and A. K. Hall
Activin Induces Tactile Allodynia and Increases Calcitonin Gene-Related Peptide after Peripheral Inflammation
J. Neurosci.,
October 5, 2005;
25(40):
9227 - 9235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. B. Hucho, O. A. Dina, and J. D. Levine
Epac Mediates a cAMP-to-PKC Signaling in Inflammatory Pain: An Isolectin B4(+) Neuron-Specific Mechanism
J. Neurosci.,
June 29, 2005;
25(26):
6119 - 6126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Vydyanathan, Z.-Z. Wu, S.-R. Chen, and H.-L. Pan
A-Type Voltage-Gated K+ Currents Influence Firing Properties of Isolectin B4-Positive But Not Isolectin B4-Negative Primary Sensory Neurons
J Neurophysiol,
June 1, 2005;
93(6):
3401 - 3409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Fang, L. Djouhri, S. McMullan, C. Berry, K. Okuse, S. G. Waxman, and S. N. Lawson
trkA Is Expressed in Nociceptive Neurons and Influences Electrophysiological Properties via Nav1.8 Expression in Rapidly Conducting Nociceptors
J. Neurosci.,
May 11, 2005;
25(19):
4868 - 4878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Kindig, T. B. Heller, and M. P. Kaufman
VR-1 receptor blockade attenuates the pressor response to capsaicin but has no effect on the pressor response to contraction in cats
Am J Physiol Heart Circ Physiol,
April 1, 2005;
288(4):
H1867 - H1873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Wilson-Gerwing, M. V. Dmyterko, D. W. Zochodne, J. M. Johnston, and V. M. K. Verge
Neurotrophin-3 Suppresses Thermal Hyperalgesia Associated with Neuropathic Pain and Attenuates Transient Receptor Potential Vanilloid Receptor-1 Expression in Adult Sensory Neurons
J. Neurosci.,
January 19, 2005;
25(3):
758 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-Z. Wu, S.-R. Chen, and H.-L. Pan
Differential Sensitivity of N- and P/Q-Type Ca2+ Channel Currents to a {micro} Opioid in Isolectin B -Positive and -Negative Dorsal Root Ganglion Neurons
J. Pharmacol. Exp. Ther.,
December 1, 2004;
311(3):
939 - 947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jain, C. K. Naughton, M. Yang, A. Strickland, K. Vij, M. Encinas, J. Golden, A. Gupta, R. Heuckeroth, E. M. Johnson Jr, et al.
Mice expressing a dominant-negative Ret mutation phenocopy human Hirschsprung disease and delineate a direct role of Ret in spermatogenesis
Development,
November 1, 2004;
131(21):
5503 - 5513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Pearson Jr. and S. L. Carroll
ErbB Transmembrane Tyrosine Kinase Receptors Are Expressed by Sensory and Motor Neurons Projecting into Sciatic Nerve
J. Histochem. Cytochem.,
October 1, 2004;
52(10):
1299 - 1311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Woodbury, M. Zwick, S. Wang, J. J. Lawson, M. J. Caterina, M. Koltzenburg, K. M. Albers, H. R. Koerber, and B. M. Davis
Nociceptors Lacking TRPV1 and TRPV2 Have Normal Heat Responses
J. Neurosci.,
July 14, 2004;
24(28):
6410 - 6415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Zylka, X. Dong, A. L. Southwell, and D. J. Anderson
Atypical expansion in mice of the sensory neuron-specific Mrg G protein-coupled receptor family
PNAS,
August 19, 2003;
100(17):
10043 - 10048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. Holmes, A. Bacon, R. J. P. Pope, P. A. Vanderplank, N. C. H. Kerr, M. Sukumaran, V. Pachnis, and D. Wynick
Transgenic overexpression of galanin in the dorsal root ganglia modulates pain-related behavior
PNAS,
May 13, 2003;
100(10):
6180 - 6185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. C. J. Wallace, D. F. Cottrell, P. J. Brophy, and S. M. Fleetwood-Walker
Focal Lysolecithin-Induced Demyelination of Peripheral Afferents Results in Neuropathic Pain Behavior That Is Attenuated by Cannabinoids
J. Neurosci.,
April 15, 2003;
23(8):
3221 - 3233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hoke, T. Ho, T. O. Crawford, C. LeBel, D. Hilt, and J. W. Griffin
Glial Cell Line-Derived Neurotrophic Factor Alters Axon Schwann Cell Units and Promotes Myelination in Unmyelinated Nerve Fibers
J. Neurosci.,
January 15, 2003;
23(2):
561 - 567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dirajlal, L. E. Pauers, and C. L. Stucky
Differential Response Properties of IB4-Positive and -Negative Unmyelinated Sensory Neurons to Protons and Capsaicin
J Neurophysiol,
January 1, 2003;
89(1):
513 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L Stucky, J. Rossi, M. S Airaksinen, and G. R Lewin
GFR {alpha}2/neurturin signalling regulates noxious heat transduction in isolectin B4-binding mouse sensory neurons
J. Physiol.,
November 15, 2002;
545(1):
43 - 50.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kato, S. Kiryu-Seo, and H. Kiyama
Damage-Induced Neuronal Endopeptidase (DINE/ECEL) Expression Is Regulated by Leukemia Inhibitory Factor and Deprivation of Nerve Growth Factor in Rat Sensory Ganglia after Nerve Injury
J. Neurosci.,
November 1, 2002;
22(21):
9410 - 9418.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Averill, D. R. Davis, P. J. Shortland, J. V. Priestley, and S. P. Hunt
Dynamic Pattern of Reg-2 Expression in Rat Sensory Neurons after Peripheral Nerve Injury
J. Neurosci.,
September 1, 2002;
22(17):
7493 - 7501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Dai, K. Iwata, T. Fukuoka, E. Kondo, A. Tokunaga, H. Yamanaka, T. Tachibana, Y. Liu, and K. Noguchi
Phosphorylation of Extracellular Signal-Regulated Kinase in Primary Afferent Neurons by Noxious Stimuli and Its Involvement in Peripheral Sensitization
J. Neurosci.,
September 1, 2002;
22(17):
7737 - 7745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Leffler, T. R. Cummins, S. D. Dib-Hajj, W. N. Hormuzdiar, J. A. Black, and S. G. Waxman
GDNF and NGF Reverse Changes in Repriming of TTX-Sensitive Na+ Currents Following Axotomy of Dorsal Root Ganglion Neurons
J Neurophysiol,
August 1, 2002;
88(2):
650 - 658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-S. Xiao, Q.-H. Huang, F.-X. Zhang, L. Bao, Y.-J. Lu, C. Guo, L. Yang, W.-J. Huang, G. Fu, S.-H. Xu, et al.
Identification of gene expression profile of dorsal root ganglion in the rat peripheral axotomy model of neuropathic pain
PNAS,
June 11, 2002;
99(12):
8360 - 8365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zwick, B. M. Davis, C. J. Woodbury, J. N. Burkett, H. R. Koerber, J. F. Simpson, and K. M. Albers
Glial Cell Line-Derived Neurotrophic Factor is a Survival Factor for Isolectin B4-Positive, but not Vanilloid Receptor 1-Positive, Neurons in the Mouse
J. Neurosci.,
May 15, 2002;
22(10):
4057 - 4065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Stucky, M. S. Gold, and X. Zhang
Mechanisms of pain
PNAS,
September 13, 2001;
(2001)
211373398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Kidd and L. A. Urban
Mechanisms of inflammatory pain
Br. J. Anaesth.,
July 1, 2001;
87(1):
3 - 11.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Widenfalk, K. Lundstromer, M. Jubran, S. Brene, and L. Olson
Neurotrophic Factors and Receptors in the Immature and Adult Spinal Cord after Mechanical Injury or Kainic Acid
J. Neurosci.,
May 15, 2001;
21(10):
3457 - 3475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. H. Bennett
Neurotrophic Factors: Important Regulators of Nociceptive Function
Neuroscientist,
February 1, 2001;
7(1):
13 - 17.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Cummins, J. A. Black, S. D. Dib-Hajj, and S. G. Waxman
Glial-Derived Neurotrophic Factor Upregulates Expression of Functional SNS and NaN Sodium Channels and Their Currents in Axotomized Dorsal Root Ganglion Neurons
J. Neurosci.,
December 1, 2000;
20(23):
8754 - 8761.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Petruska, J. Napaporn, R. D. Johnson, J. G. Gu, and B. Y. Cooper
Subclassified Acutely Dissociated Cells of Rat DRG: Histochemistry and Patterns of Capsaicin-, Proton-, and ATP-Activated Currents
J Neurophysiol,
November 1, 2000;
84(5):
2365 - 2379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Boucher, K. Okuse, D. L. H. Bennett, J. B. Munson, J. N. Wood, and S. B. McMahon
Potent Analgesic Effects of GDNF in Neuropathic Pain States
Science,
October 6, 2000;
290(5489):
124 - 127.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. A. Sleeper, T. R. Cummins, S. D. Dib-Hajj, W. Hormuzdiar, L. Tyrrell, S. G. Waxman, and J. A. Black
Changes in Expression of Two Tetrodotoxin-Resistant Sodium Channels and Their Currents in Dorsal Root Ganglion Neurons after Sciatic Nerve Injury But Not Rhizotomy
J. Neurosci.,
October 1, 2000;
20(19):
7279 - 7289.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. Holmes, S. Mahoney, V. R. King, A. Bacon, N. C. H. Kerr, V. Pachnis, R. Curtis, J. V. Priestley, and D. Wynick
Targeted disruption of the galanin gene reduces the number of sensory neurons and their regenerative capacity
PNAS,
September 29, 2000;
(2000)
210221897.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C Baudet, A Mikaels, H Westphal, J Johansen, T. Johansen, and P Ernfors
Positive and negative interactions of GDNF, NTN and ART in developing sensory neuron subpopulations, and their collaboration with neurotrophins
Development,
January 10, 2000;
127(20):
4335 - 4344.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. H. Bennett, T. J. Boucher, M. P. Armanini, K. T. Poulsen, G. J. Michael, J. V. Priestley, H. S. Phillips, S. B. McMahon, and D. L. Shelton
The Glial Cell Line-Derived Neurotrophic Factor Family Receptor Components Are Differentially Regulated within Sensory Neurons after Nerve Injury
J. Neurosci.,
January 1, 2000;
20(1):
427 - 437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Leitner, D. C. Molliver, P. A. Osborne, R. Vejsada, J. P. Golden, P. A. Lampe, A. C. Kato, J. Milbrandt, and E. M. Johnson Jr
Analysis of the Retrograde Transport of Glial Cell Line-Derived Neurotrophic Factor (GDNF), Neurturin, and Persephin Suggests That In Vivo Signaling for the GDNF Family is GFRalpha Coreceptor-Specific
J. Neurosci.,
November 1, 1999;
19(21):
9322 - 9331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Mannion, M. Costigan, I. Decosterd, F. Amaya, Q.-P. Ma, J. C. Holstege, R.-R. Ji, A. Acheson, R. M. Lindsay, G. A. Wilkinson, et al.
Neurotrophins: Peripherally and centrally acting modulators of tactile stimulus-induced inflammatory pain hypersensitivity
PNAS,
August 3, 1999;
96(16):
9385 - 9390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Stucky and G. R. Lewin
Isolectin B4-Positive and -Negative Nociceptors Are Functionally Distinct
J. Neurosci.,
August 1, 1999;
19(15):
6497 - 6505.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. N. Thompson, D. L. H. Bennett, B. J. Kerr, E. J. Bradbury, and S. B. McMahon
Brain-derived neurotrophic factor is an endogenous modulator of nociceptive responses in the spinal cord
PNAS,
July 6, 1999;
96(14):
7714 - 7718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Szallasi and P. M. Blumberg
Vanilloid (Capsaicin) Receptors and Mechanisms
Pharmacol. Rev.,
June 1, 1999;
51(2):
159 - 212.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Murphy, L. S. Borthwick, R. S. Johnston, G. Kuchel, and P. M. Richardson
Nature of the Retrograde Signal from Injured Nerves that Induces Interleukin-6 mRNA in Neurons
J. Neurosci.,
May 15, 1999;
19(10):
3791 - 3800.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Michael and J. V. Priestley
Differential Expression of the mRNA for the Vanilloid Receptor Subtype 1 in Cells of the Adult Rat Dorsal Root and Nodose Ganglia and Its Downregulation by Axotomy
J. Neurosci.,
March 1, 1999;
19(5):
1844 - 1854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Huang, K Zang, A Schmidt, A Saulys, M Xiang, and L. Reichardt
POU domain factor Brn-3a controls the differentiation and survival of trigeminal neurons by regulating Trk receptor expression
Development,
January 7, 1999;
126(13):
2869 - 2882.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Fundin, A Mikaels, H Westphal, and P Ernfors
A rapid and dynamic regulation of GDNF-family ligands and receptors correlate with the developmental dependency of cutaneous sensory innervation
Development,
January 6, 1999;
126(12):
2597 - 2610.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Krieglstein, P. Henheik, L. Farkas, J. Jaszai, D. Galter, K. Krohn, and K. Unsicker
Glial Cell Line-Derived Neurotrophic Factor Requires Transforming Growth Factor-beta for Exerting Its Full Neurotrophic Potential on Peripheral and CNS Neurons
J. Neurosci.,
December 1, 1998;
18(23):
9822 - 9834.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. Holmes, S. Mahoney, V. R. King, A. Bacon, N. C. H. Kerr, V. Pachnis, R. Curtis, J. V. Priestley, and D. Wynick
Targeted disruption of the galanin gene reduces the number of sensory neurons and their regenerative capacity
PNAS,
October 10, 2000;
97(21):
11563 - 11568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Stucky, M. S. Gold, and X. Zhang
Mechanisms of pain
PNAS,
October 9, 2001;
98(21):
11845 - 11846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Linnarsson, A. Mikaels, C. Baudet, and P. Ernfors
Activation by GDNF of a transcriptional program repressing neurite growth in dorsal root ganglia
PNAS,
December 4, 2001;
98(25):
14681 - 14686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-D. Delcroix, S. Averill, K. Fernandes, D. R. Tomlinson, J. V. Priestley, and P. Fernyhough
Axonal Transport of Activating Transcription Factor-2 Is Modulated by Nerve Growth Factor in Nociceptive Neurons
J. Neurosci.,
September 15, 1999;
19(18):
RC24 - RC24.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|