 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 1999, 19(1):288-297
The Mammalian Staufen Protein Localizes to the Somatodendritic
Domain of Cultured Hippocampal Neurons: Implications for Its
Involvement in mRNA Transport
Michael A.
Kiebler1,
Indradeo
Hemraj1,
Paul
Verkade1,
Martin
Köhrmann1,
Puri
Fortes2, 3,
Rosa M.
Marión3,
Juan
Ortín3, and
Carlos G.
Dotti1
European Molecular Biology Laboratory, 1 Cell Biology
Programme and 2 Gene Expression Programme, 69012 Heidelberg, Germany, and 3 Centro Nacional de
Biotecnologia, Consejo Superior de Investigaciones Científicas,
Campus de Cantoblanco, 28049 Madrid, Spain
 |
ABSTRACT |
In hippocampal neurons, certain mRNAs have been found in dendrites
(Steward, 1997 ), and their localization and translation have been
implicated in synaptic plasticity (Martin et al., 1997 ). One attractive
candidate to achieve transport of mRNAs into dendrites is Staufen
(Stau), a double-stranded RNA-binding protein, which plays a
pivotal role in mRNA transport, localization, and translation in
Drosophila (St. Johnston, 1995 ). Using antibodies raised
against a peptide located in the RNA-binding domain IIa and a
polyclonal antibody raised against a recently cloned human Staufen
homolog, we identify a 65 kDa rat homolog in cultured rat hippocampal
neurons. In agreement with the exclusive somatodendritic localization
of mRNAs in these cells, we find that Staufen is restricted to the same
domain. By immunoelectron microscopy, we show enrichment of the
mammalian homolog of Stau (mStau) in the vicinity of smooth endoplasmic reticulum and microtubules near synaptic contacts. Finally,
the association of the mStau with neuronal mRNAs is suggested by the
colocalization with ribonucleoprotein particles specifically in distal
dendrites known to contain mRNA, ribosomes, and translation factors
(Knowles et al., 1996 ). These results suggest a role for mStau in the
polarized transport and localization of mRNAs in mammalian neurons.
Key words:
mammalian Staufen; double-stranded mRNA-binding protein; hippocampal neurons; mRNA transport; ribonucleoprotein particles; SYTO14
 |
INTRODUCTION |
One of the mechanisms to generate
cell polarity is the intracellular localization of mRNAs to discrete
subcellular locations. In differentiating myoblasts and embryonic
fibroblasts, for example, -actin message localizes to the leading
lamellae at the cell periphery (Lawrence and Singer, 1986 ; Hill and
Gunning, 1993 ; Kislauskis et al., 1993 ). In the Drosophila
oocyte, bicoid, oskar, and gurken, mRNAs are targeted to three distinct
positions within the cell, determining the polarity of the
anteroposterior and dorsoventral axes of the embryo (St. Johnston,
1995 ). In the Xenopus laevis oocyte, at least three
different compartments contain localized messages, such as Vg1 (St.
Johnston, 1995 ). In oligodendrocytes, the message for myelin basic
protein has been shown to be transported into processes (Ainger
et al., 1993 , 1997 ). In the mammalian nervous system, several distinct
polarized nerve cells sort mRNAs coding for cytoskeletal, kinase, or
Ca2+-dependent proteins to their respective
dendrites (Steward, 1997 ). Although the precise function of mRNA
localization in dendrites is still unclear, it has been hypothesized
that it offers the possibility of local translational control after
synaptic activation, thereby modifying the existing synaptic strength
(Martin et al., 1997 ). To test this hypothesis, it appears essential to
first identify the molecular machinery involved in targeting such
messages to the synapse. One promising candidate is a double-stranded
RNA-binding protein called Staufen (Stau). In invertebrates, Stau is
required for the proper localization of maternal mRNAs to either the
anterior or the posterior pole of the Drosophila oocyte and
in the asymmetric localization of mRNAs, such as prospero in
Drosophila neuroblasts (St. Johnston, 1995 ; Campos-Ortega,
1997 ; Li et al., 1997 ; Broadus et al., 1998 ). Most notably, Stau
is also involved in the translation of oskar message at the posterior
pole (Breitwieser et al., 1996 ). Finally, Stau is found in
ribonucleoprotein particles (RNPs), which are then actively transported
along the microtubules (MTs) (Ferrandon et al., 1994 ).
Taking advantage of published expressed sequence tag (EST) sequences
[e.g., AA106767] from mouse and human with significant homology to
Stau, we raised our own specific antibodies and studied the pattern of
expression and distribution of the mammalian Stau (mStau) in rat
hippocampal neurons in culture. Furthermore, we used a specific
antibody against the C-terminal domain of human Stau, recently
characterized in HeLa cells (Marión et al., 1999 ).
 |
MATERIALS AND METHODS |
Materials. The following antibodies were used in the
indicated dilutions: monoclonal antibody against MAP2 (Sigma, St.
Louis, MO) at 1:500 (De Hoop et al., 1994 ); the monoclonal
antibody against tau-1 (Boehringer Mannheim, Mannheim, Germany) at
1:200 or 1:500 (Binder et al., 1985 ); and the monoclonal antibody
against ribophorin I (courteously provided by D. Meyer, University of
California at Los Angeles) at 1:100 (Hortsch et al., 1986 ). As
secondary antibodies, a rhodamine-conjugated goat anti-rabbit whole Ig
(1:100; 55674; Organon Teknika-Cappel, Durham, NC), a Cy5-conjugated
donkey anti-rabbit whole Ig (1:300; 711 175 152; Dianova, Hamburg,
Germany) or FITC-conjugated sheep anti-mouse whole Ig (1:50; N1031;
Amersham, Arlington Heights, IL) were used.
Cloning of the rat Staufen homolog. Two PCR primers were
designed based on the sequence alignment (Fig.
1): sense (5' 3') TACTTTTACCCATTTCCAGT; and antisense: ATCTTCTTGCTTTTCCCTTC. A PCR was performed with these primers on a rat embryonic gt11 library (a
generous gift from Drs. H. Monyer and P. Seeburg, ZMBH, University of
Heidelberg, Heidelberg, Germany), and the resulting 370 nt fragment was
cloned into the pGEM-T vector (Promega, Madison, WI). Both strands were
sequenced, and the resulting cDNA sequence was deposited into the
European Molecular Biology Laboratory (EMBL) database (accession number
AJ10200).

View larger version (57K):
[in this window]
[in a new window]
|
Figure 1.
Conserved domain structure in mStau protein. An
amino acid alignment from rStau (EMBL accession number AJ10200), mouse
(EST clones AA106767 and AA896810), human (EST clones AA206573 and
R62169) and Drosophila (M69111) is shown. The partial
rStau cDNA was cloned by PCR, and its sequence was deposited into EMBL
database (EMBL accession number AJ10200). Over the entire 117 amino acid domain, rStau shows 48% identity (71% similarity) compared
with the Drosophila sequence. The recent identification
of both a human Stau (Marión et al., 1999 ) and a mouse full-
length Stau clone (Wickham et al., 1999 ) with high homologies to
Drosophila Staufen protein verified the sequences
predicted from the EST clones. Residues shaded in black
and gray are regions of identity and similarity,
respectively. The gray bars indicate the three conserved
RBDs, IIa, IIb, and III; the black bar indicates the
peptide chosen for immunization within the highly homologous RBD IIa
region of Staufen protein.
|
|
Cell culture, live labeling, and stimulation. Primary
hippocampal neurons derived from rat embryos were cultured according to
the protocol of Goslin and Banker (1991) and De Hoop et al. (1998) .
SYTO14 labeling (50 nM) of cultures was essentially
performed as described previously (Knowles et al., 1996 ), with the
following modification. To ensure high uptake of SYTO14 into the cells, hippocampal neurons were stimulated by membrane depolarization to
induce neurotransmitter release (Rosa et al., 1985 ; Parton et al.,
1992 ). In brief, cells were incubated in SYTO14-containing depolarizing
solution (in mM: 97 NaCl, 35 KCl, 10 HEPES, pH 7.35, 2.2 CaCl2, 0.33 Na2HPO4,
0.44 KH2PO4, 4.2 NaHCO3, and 5.6 glucose) for 5 min at 37°C,
transferred into SYTO14-containing normal medium for 5 min, and finally
into normal medium for 25 min at 37°C. Neurons were briefly rinsed in
HBSS and then fixed.
Antibodies and Western blots. The expression of the
His-tagged C-terminal part of human Stau (pRSTL) and the production of polyclonal antibodies against the purified protein from
Escherichia coli were described elsewhere (Marión et
al., 1999 ). Best results with the antiserum were obtained with a
dilution of 1:200 for immunofluorescence. As controls for antibody
specificity, the primary antibody was omitted or the corresponding
preimmune serum was used (data not shown). Furthermore, the antisera
was preincubated with the purified, bacterially overexpressed antigen
(10 µg/ml) for 1 hr at 4°C and then directly used for
immunofluorescence as described above. Virtually all the dendritic
label was abolished (data not shown).
Two additional polyclonal antibodies were raised against a synthetic
peptide derived from the mouse Stau sequence (EST clone AA106767) in
the dsRNA-binding motif IIa (CVKLERKPMYKPVDPHSR) coupled to KLH. These
antisera were monospecific for rat Stau (rStau) (Fig. 1, lanes
5 and 6). Best results with both antisera were
obtained with a dilution of 1:500 or higher for Western blots or 1:200
for immunofluorescence. Neuronal and glial extracts were prepared as
described previously (De Hoop et al., 1998 ). To ensure sharp bands for
SDS-PAGE, lipids were extracted with chloroform-methanol (Wessel and
Flügge, 1984 ) before SDS-PAGE.
Immunocytochemistry was performed as described by Bradke and Dotti
(1997) . In brief, neurons grown on glass coverslips were fixed in 4%
paraformaldehyde (PFA), quenched with ammonium chloride, permeabilized
with Triton X-100, and incubated with the respective antibodies.
Finally, cells were mounted with Mowiol and DABCO as described.
Image analysis and quantitation. Fluorescent microscopy was
performed with a Zeiss (Oberkochen, Germany) Axioskop using either a
40×, 63×, or 100× objective, standard FITC, rhodamine, or Texas Red
filters, and a 100 W mercury arc lamp. Confocal microscopy was
performed with a Leica (Nussloch, Germany) DM IRBE confocal microscope using either a 40× or 63× objective, and standard FITC, rhodamine, or Cy5 filters. Because excitation of SYTO14 led to emission
in the FITC, rhodamine, and even Texas Red channel (data not shown;
Knowles et al., 1996 ), Stau was detected with a Cy5-conjugated secondary antibody. For fluorescence microscopy, images were acquired using a cooled CCD camera (Photonic Science) controlled by the IP-Lab
(Signal Analytics) or Open Lab version 1.7.6 (Improvision) software
packages and assembled using Adobe photoshop versions 3.0.4. or 4.0. For confocal microscopy, images were acquired using TCS NT
(version 1.5; Leica), imported into NIH Image, and assembled.
Electron microscopy. Cultured rat hippocampal neurons
(5-week- old) grown on glass coverslips were briefly rinsed in
prewarmed sodium cacodylate buffer (CB) (100 mM, pH 7.4)
and immediately fixed in 4% PFA and 0.05% glutaraldehyde in CB for 10 min at room temperature (RT). All solutions were made in tridistilled
water. The procedure described is based on a preembedment protocol (Van Lookeren Campagne et al., 1992 ) in which 5 nm gold particles in CB can
penetrate the plasma membrane without previous permeabilization. The
small gold protein A complex ensured significant labeling intensity,
with good ultrastructure after embedment into Epon. After fixation, the
cells were rinsed in blocking buffer (BB) (CB including 5% fetal calf
serum and 0.2% cold water fish skin gelatin), and free aldehydes were
quenched for 10 min with 0.05% NaBH4 and 200 mM glycine in CB. The coverslips were again extensively rinsed with BB, and immunolabeling was performed with anti-human mStau
polyclonal antibody (1:200 in BB) overnight at 4°C. After extensive
rinsing in BB, the coverslips were incubated with 5 nm gold particles
coupled to protein A (purchased from J. Slot, Utrecht, The Netherlands)
for 1 hr at RT, and then cells were extensively rinsed in BB and
tridistilled water. Cells were processed according to routine
Epon-embedding procedures. Ultrathin sections were cut parallel to the
cells, counterstained with uranyl acetate and lead citrate, and viewed
under a Zeiss electron microscope. In controls, omitting the primary
antibody, no gold particles were detected (data not shown). Figure
5a was processed using Adobe Photoshop 4.0 to enhance
visibility of gold particles.
 |
RESULTS |
rStau is a 65 kDa protein
We wanted to explore whether a putative mammalian homolog of Stau
is present in neurons, and moreover, whether it may play a role in mRNA
localization in hippocampal neurons. For this reason, we searched the
EMBL database with the Drosophila Stau sequence and
identified several EST clones from both human and mouse with high
homology to Drosophila Stau (Fig. 1). To confirm the
presence of a mStau homolog in rat as suggested by the presence of EST clones, we cloned a C-terminal fragment of rStau cDNA by PCR and deposited its sequence into the EMBL database (accession number AJ10200). A sequence alignment with the Drosophila sequence
(Fig. 1) reveals a high degree of homology; rStau shows 48% identity (71% similarity) compared with the Drosophila sequence over
the entire 117 amino acid domain. A comparison with the mentioned EST
sequences shows that rStau is 92 and 98% identical (96 and 99%
similar) to human and mouse Stau, respectively. Interestingly, only two
amino acids differ from the corresponding mouse sequence. The recent
identification of both a human Stau (Marión et al., 1999 ) and a
mouse full-length Stau clone (Wickham et al., 1999 ) with high
homologies to the Drosophila Stau protein demonstrated that
the sequence derived from the EST clones were real and further substantiated our findings that mStau homologs exist.
Based on the sequence comparisons, we chose a conserved peptide in the
RNA-binding domain (RBD) IIa region of Stau protein (Fig. 1) for
immunization of rabbits. The epitope is well conserved in mStau
homologs (the mouse epitope is 78% identical and 89% similar to human
Stau) and still shows some homology to the corresponding Drosophila region (39% identity and 50% similarity). It is
important to note that this peptide did not show any significant
homology to any other proteins in the database. The immunization
yielded polyclonal antibodies specific for mStau. Additionally, we took advantage of a specific antibody against the C-terminal domain of human
Stau, recently characterized in HeLa cells (Marión et al., 1999 ).
To determine the molecular weight of the rat homolog, we performed
Western blotting on hippocampal extracts. The two independent anti-rStau peptide antibodies, as well as the anti-human Stau antisera,
recognized a 65 kDa protein in rat neuronal extracts (Fig.
2, lanes 4-6), whereas
the corresponding preimmune antisera did not (Fig. 2, lanes
1-3). This is in agreement with the predicted molecular weight of
the full-length human Stau gene product and its apparent
electrophoretic mobility (Wickham et al., 1999 ). This indicates that
all our antibodies recognize the same rStau homolog. On Western blots
from both astrocyte (Fig. 2, lane 7) and hippocampal
extracts (lane 8), we found approximately the same amount of
expression of mStau, indicating that mStau is expressed in both cell
types. When we tested the two anti-peptide antibodies on Western blots
from HeLa and mouse hippocampal extracts, we also detected the same
band (data not shown). Together, these data indicate that all our
antibodies are monospecific for a 65 kDa protein and that this
represents the rStau homolog.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 2.
rStau is a 65 kDa protein. Western blot of rat
hippocampal neuronal extracts probed with three different anti-mStau
antibodies (lanes 4-6) and its corresponding
preimmune antisera (lanes 1-3). Two of the three
antisera were monospecific for the 65 kDa band (arrow).
The only visible band from one of the preimmune sera was a 72 kDa band
in lane 3 (arrowhead). When we compared
the expression level of Stau on astrocyte (lane
7) and hippocampal neuronal extracts (lane
8), we found approximately the same signal for mStau. The size
of the molecular weight markers is indicated on the left: 202, 104, 82, 66, 48, 33, and 28 kDa. All three antisera gave identical
patterns of labeling (data not shown) as the one used in Figures 3 and
4.
|
|
Expression pattern of Staufen during development of
hippocampal neurons
We then went on to examine the expression pattern of mStau during
neuronal development in hippocampal neurons in culture; several
morphologically distinct events have been characterized leading to
polarization of these cells (Dotti et al., 1988 ). During early stages
of development (stages 1-3), when polarization of neurites into axons
and dendrites has not yet been achieved, mStau is present in all
processes (Fig.
3a,c,e).
-Tubulin immunoreactivity of the same cell served as a
cytoskeletal marker to label all processes (Fig.
3b,d,f). The presence of mStau
in all processes is still evident in stage 4 cells (Fig.
3g,h). However, mStau becomes excluded from some
of the processes (Fig. 3i,j) at stage 5 neurons.
Given that the mStau-negative processes have an axon-like morphology
(thin uniform diameter; see Fig. 5) and that mRNA transport in these
cells occurs in dendrites but not axons, it appears that the
mStau-positive processes are dendrites. This was investigated next.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3.
Intracellular distribution of rStau during the
development of polarity in rat hippocampal neurons. mStau labeling is
present in the cell body of stage 1 cells (a) and
in the cell body and all neurites of stage 2, 3, and 4 (c, e, g,
respectively). b, d,
f, h, and j show all the
processes of the cells identified by -tubulin. At stage 5 (i), mStau becomes excluded from some of the
thin, -tubulin-positive processes (j,
arrowheads). In this experiment, rat hippocampal neurons
for 2, 4, and 8 d in culture have been used.
|
|
Staufen is expressed in the somatodendritic domain of
hippocampal neurons
In fully polarized hippocampal neurons, axons and dendrites can be
distinguished by morphological, immunological, and functional criteria;
also, numerous mRNAs specifically localize to dendrites (Craig and
Banker, 1994 ; Steward, 1997 ). In a representative mature hippocampal neuron (Fig. 4a),
mStau immunoreactivity was present in cell bodies, as well as in
dendrites (Fig. 4b, arrows). MAP2 immunoreactivity of the same cell served as a marker to identify dendrites (Fig. 4c) (Cáceres et al., 1984 ). mStau was
not found in axons (Fig. 4c, arrowheads,
MAP2-negative processes). Also, mStau protein was not found in
tau-1-labeled axons (Fig. 4d-f) (Binder et al.,
1985 ). Because mStau was expressed in immature axons (Fig.
3g,h) but not in fully mature axons (Fig.
3i,j), the size of axons cannot be the factor
preventing the detection of mStau. Additionally, we further investigate
this fact using electron microscopy (EM) (Fig.
5).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 4.
Intracellular distribution of mStau in mature rat
hippocampal neurons in culture (14 d in vitro).
a, Phase-contrast image of a representative cell.
b, mStau labeling is present in the cell body and some
of the long processes identified as dendrites with the specific
dendritic marker MAP2 (c). Note that axons
(arrowheads, MAP2-negative processes) are not labeled
with the mStau antibody. d, Phase-contrast image of
another representative cell. Double-immunofluorescence of neurons with
mStau (e) and the axonal marker tau-1
(f). Note that axons
(arrowheads, tau-1-positive processes) are not labeled
with the mStau antibody (arrows, a Stau-positive
dendrite). The average diameter of a CA1 pyramidal neuron is between 8 and 12 µm.
|
|

View larger version (128K):
[in this window]
[in a new window]
|
Figure 5.
Postsynaptic localization of Staufen protein and
association with MTs and ERs. a, Staufen gold labeling
(arrowheads) is exclusively found in dendrites
(D) but not axonal terminals
(AT) of hippocampal neurons (ratio of 13.4:1; see
Results). Some gold clusters were associated with or in close
vicinity of tubular ER structures in the dendritic process (38% of all
gold; see Results). b, At higher magnification, mStau
gold labeling is clearly seen in dendrites but not axonal terminals.
c, Staufen labeling was found on bundles of MTs
(mt) derived from a dendritic process. The nearby
fasciculating axon above the dendrite did not contain any mStau label.
Scale bar (in c): a, 250 nm;
b, c, 200 nm. m,
Mitochondria; sv, synaptic vesicle; t,
tubular network; psd, postsynaptic density;
mvb, multivesicular body.
|
|
As controls for antibody specificity, the primary antibody was omitted,
the corresponding preimmune serum was used, or the -Stau antisera
was preincubated with its antigen before immunolabeling. All of these
treatments virtually abolished any specific staining for Stau (data not
shown). All three antibodies, when tested by immunofluorescence
microscopy, gave a similar pattern of labeling as described above (data
not shown). Together with the results of the Staufen localization at
earlier stages, the distribution of Staufen corresponds to that of
mRNAs: it is present in all neurites at earlier stages and becomes
preferentially restricted to the somatodendritic region in fully mature neurons.
Staufen is found to be associated with tubular structures and MTs
in dendrites
To confirm the dendrite-specific labeling for mStau obtained by
immunofluorescence and to fully characterize its intracellular location, we performed preembedment immunoelectron microscopy (Van
Lookeren Campagne et al., 1992 ). In Figure 5, a and
b, representative synapses are shown in which mStau
(arrowheads) is almost exclusively found in dendrites but
not in axon terminals. When we performed quantification of gold
particles (Table 1) in 10 axons and
dendrites each, we found 1.0 ± 0.4 (mean ± SEM) gold
particles in axons compared with 13.4 ± 1.5 (mean ± SEM) in
dendrites. This represents 94% postsynaptic mStau. Some dendritic
label was in close proximity to tubular structures, most likely
representing endoplasmic reticulum (ER). This association was found in
38 ± 4.5% (mean ± SEM) of all gold particles. Synaptic
vesicles, multivesicular bodies, and mitochondria were not
labeled. In Figure 5c, a hippocampal axon is shown
fasciculating on a dendrite. The thickening of the axon on the
right side of Figure 5c represents a varicosity
forming a synapse toward the underlying dendrite. As before, mStau
label was only observed in the dendrite but not in the axon, confirming the fluorescence data of Figure 4. Another interesting piece of information from our EM studies was the presence of abundant gold particles close to MTs. When we examined all the EM micrographs with
clearly identifiable MTs, we found 30 of 32 gold particles closer than
18 nm (Verkade et al., 1997 ) to an MT (96 ± 4.2%, mean ± SEM), strongly arguing in favor of an mStau-MT
association. This is of particular interest, because the mStau protein
contains an MT-binding domain similar to that of MAP1B, and it seems to bind MTs in vitro (Wickham et al., 1999 ). Together, these
data show that mStau is specifically found in dendrites, but not axons, of neurons in which it concentrates in the vicinity of ER and MTs.
Staufen colocalizes with ER
To highlight the organelle-bound form of mStau, we removed the
nonmembrane-bound mStau with the nonionic detergent saponin and
analyzed its distribution by immunofluorescence. Under this condition,
mStau labeling appeared in the form of prominent, large clusters in
dendrites (Fig. 6a). Given the
abundance of ER cisternae in dendrites, at least part of these clusters
of mStau could represent ER structures as already suggested by EM.
Because mStau may be involved in transport of certain mRNAs and
potentially in their translation, we next studied its ER-association
using the rough ER marker ribophorin I (Hortsch et al., 1986 ) (Fig.
6c,e). Indeed, mStau (Fig.
6b,d) showed a high degree of colocalization with ribophorin I, confirming that mStau is associated directly with either
ER membranes or ribosomes attached to rough ER. This is in good
agreement with data in HeLa cells in which mStau was found to (1)
colocalize with rough ER and (2) cosediment with polysomes (Marión et al., 1999 ) (data not shown). However, mStau did not show any significant colocalization with the trans-Golgi
network marker TGN38 (Lucio et al., 1990 ). In this context, it is
particularly interesting to note that, in Xenopus, the ER
itself has been implicated in the localization of the mRNA Vg1 in an
MT-dependent step with the help of the ER-associated protein Vera
(Deshler et al., 1997 ).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6.
Staufen protein is found in large dendritic
clusters and colocalizes with rough ER in mature rat hippocampal cells
in culture. Immunofluorescence of a saponin-treated cell
(a) using anti-mStau antibodies shows mStau in
the form of clusters (most likely membrane-bound). b-e,
Double-immunofluorescence of neurons with mStau (b,
d) and the rough ER marker ribophorin I
(c, e) reveals good colocalization
between these two proteins (arrowheads and
arrows). This confirms data shown in Figure
3a and data obtained in HeLa cells (Marión et al.,
1999 ).
|
|
Staufen is found in RNPs containing RNA
The membrane-permeable nucleic acid dye SYTO14 stains
intracellular granules in living hippocampal neurons, which contain poly(A+) mRNA, the 60S ribosomal subunit, and the
elongation factor 1 , and which move in an MT-dependent manner
(Knowles et al., 1996 ). Hence, we used SYTO14 to fluorescently label
the described granules and to test whether mStau is present in these
large RNPs in dendrites. Because SYTO14 also labels mitochondria
(Knowles et al., 1996 ), additional label will be expected. For higher
precision and more restricted labeling, we used confocal microscopy.
Figure 7, a and b,
shows low-magnification photographs of mStau-SYTO14 colabeling. Some,
but not all, of the SYTO14-labeled processes are mStau-positive (Fig.
7a,b, arrows). Because mStau is
restricted to dendrites (Figs. 2, 4), Staufen-negative processes
correspond to axons (Fig. 7a,b,
arrowheads). Figure 7, c and d,
show a high-magnification view of a branched neuronal dendritic process
that contains mStau- and SYTO14-labeled structures. The uppermost
process shows almost perfect colocalization (Fig.
7c,d, arrowheads) between
SYTO14-fluorescent granules and mStau, indicating that mStau is indeed
in a complex with RNPs containing mRNAs and ribosomes. We also observed
SYTO14-labeled clusters that are mStau-negative. Because mStau did not
label mitochondria at both the light microscopical (data not shown) and
the electron microscopical level (Fig. 5), these clusters most likely
represent mitochondria. In conclusion, the colocalization of mStau with
RNPs in dendrites of hippocampal neurons suggest that mStau may be in
direct physical contact with dendritic mRNAs contained in these
RNPs.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 7.
Colocalization of mStau with RNPs in hippocampal
neurons. RNPs and mitochondria were visualized with the RNA-specific
dye SYTO14 and the degree of colocalization with mStau was revealed by
confocal microscopy. Immunofluorescence for mStau
(a) reveals selective dendritic labeling
(arrows). SYTO14 labeling of the same cell
(b) additionally stains axons
(arrowheads). Because axons do not contain ribosomes or
mRNAs, the labeling most likely reflects mitochondria (Knowles et al.,
1996 ). At higher magnification, mStau (c) and
SYTO14 label (d) precisely colocalize in many,
but not all, clusters in the dendrites. Arrowheads
indicate mStau in SYTO14-labeled RNPs; arrows point to
SYTO14 clusters that do not contain mStau. These represent either free
mRNA or mitochondria. The average diameter of a CA1 pyramidal neuron is
between 8 and 12 µm. Asterisks mark the branching
point of a distal dendrite.
|
|
Knowles et al. (1996) provided EM data from cortical neurons in culture
showing polyribosomes in large SYTO14-positive granules, and they
suggested that these granules may represent a translational unit. In
our experimental system, we have not been able to find any
Stau-positive polyribosome-containing granules in neurons under our
conditions (Fig. 5). It remains to be seen whether or not the large
structures double-labeled for Stau and SYTO14 also contain
polyribosomes. It is possible that these RNPs represent active
transport units that deliver mRNAs to the synapse in neurons and
that polyribosomes are rather independent organelles (Steward and Levy,
1982 ).
 |
DISCUSSION |
Our results demonstrate that mStau is found in the cell body and
dendrites of hippocampal neurons in which it may associate with MTs and
RNPs at synaptic contacts (Fig. 5). What role could mStau, a
double-stranded RNA-binding protein, play in neurons? Segregating mRNAs
is a general mechanism to localize protein synthesis to the site of its
function in which it can be locally assembled into macromolecular
complexes. One striking example of asymmetric mRNA localization occurs
in the invertebrate Drosophila oocyte in which Stau is
crucial for the proper localization of maternal mRNAs bicoid and oskar
to the anterior or the posterior pole, respectively (St. Johnston,
1995 ). A 400 nt region of the bicoid 3'-UTR has been identified that
can bind Stau (Ferrandon et al., 1994 ). More recently, Stau (in a
complex with inscuteable) was shown to be involved in asymmetric mRNA
localization in Drosophila neuroblasts, which are progenitor
cells of the CNS (Campos-Ortega, 1997 ; Li et al., 1997 ; Broadus et al.,
1998 ). These data strongly suggest that mStau may also be involved in
dendritic mRNA transport in mammalian neurons. What is the experimental
evidence that there is directed intracellular mRNA transport in
neurons? First, it has been shown by in situ hybridization
that a subset of mRNAs coding for kinases, substrates for kinases, or
cytoskeletal proteins exist in dendrites (Steward, 1997 ). Second,
poly(A+) RNA visualized in RNPs has been identified
that move in an MT-dependent manner (Knowles et al., 1996 ). Third, the
presence of organelles of the protein biosynthetic machinery such as ER
cisternae and polyribosomes has been identified in dendrites, but not
axons of hippocampal neurons (Knowles et al., 1996 ). Fourth,
data suggest that these dendritically transported mRNAs may be
translated after being transported to the synapse, most presumably
after plastic events (Martin et al., 1997 ).
What mechanism(s) does neurons use to target mRNAs to dendrites?
Putting together the data mentioned above and our own results, it
appears logical that the mammalian homolog of mStau is involved in the
dendritic transport of mRNAs. This is further substantiated by the fact
that mStau has been shown to interact with high affinity with
double-stranded RNA, such as the 3'-UTR of bicoid mRNA, and that mStau
is specifically associated with polysomes in mammalian cells
(Marión et al., 1999 ). It is tempting to speculate that mStau, by
binding to 3'-UTRs of dendritically targeted mRNAs, recruits them into
RNPs, which in turn will be moved along MTs into dendrites to the
synapses in which they eventually will be translated after synaptic
activation. These results will now allow the unraveling of the precise
role of mStau in the polarized transport of mRNAs in neurons and will
pave the way for the future analysis of both the cis-acting
transport signals in these mRNAs and its recognition by
trans-acting factors, such as the double-stranded RNA-binding protein Staufen. We hope that the characterization of
mammalian mStau in neurons opens a new perspective in molecular neurobiology regarding mRNA dendritic targeting and its role in synaptic plasticity.
 |
FOOTNOTES |
Received Sept. 9, 1998; accepted Oct. 15, 1998.
This work was supported by a postdoctoral fellowship from the Deutsche
Forschungsgemeinschaft (M.A.K.), research fellowships from the
HFSPO (M.A.K. and P.F.), a University Scholar Program of the
University of Pennsylvania (I.H.), an EC grant and fellowship (P.V. and P.F., respectively), the PNFPI (R.M.M.), PGC
Grant PB94-1542 (J.O.), and Sonderforschungsbereich Grant SFB-317
(C.G.D.). We thank B. Hellias and S. Brendel for technical
assistance, Drs. L. Des Groseillers and D. St. Johnston for courteously
communicating unpublished results and support, Drs. S. Cohen, A. Ephrussi, N. Gunkel, I. Mattaj, J. C. López-García,
P. Scheiffele, and D. St. Johnston for discussions and/or critical
reading of this manuscript.
Correspondence should be addressed to M. Kiebler, European Molecular
Biology Laboratory, Cell Biology Programme, Meyerhofstrasse 1, D-69117
Heidelberg, Germany. E-mail address: Kiebler{at}EMBL-Heidelberg.de
 |
REFERENCES |
-
Ainger K,
Avossa D,
Morgan F,
Hill SJ,
Barry C,
Barbarese E,
Carson JH
(1993)
Transport and localization of exogenous myelin basic protein mRNA microinjected into oligodendrocytes.
J Cell Biol
123:431-441[Abstract/Free Full Text].
-
Ainger K,
Avossa D,
Diana AS,
Barry C,
Barbarese E,
Carson JH
(1997)
Transport and localization elements in myelin basic protein mRNA.
J Cell Biol
138:1077-1087[Abstract/Free Full Text].
-
Binder LI,
Frankfurter A,
Rebhun LI
(1985)
The distribution of tau in the mammalian central nervous system.
J Cell Biol
101:1371-1378[Abstract/Free Full Text].
-
Bradke F,
Dotti CG
(1997)
Neuronal polarity: vectorial cytoplasmic flow precedes axon formation.
Neuron
19:1175-1186[Web of Science][Medline].
-
Breitwieser W,
Markussen FH,
Horstmann H,
Ephrussi A
(1996)
Oskar protein interaction with Vasa represents an essential step in polar granule assembly.
Genes Dev
10:2179-2188[Abstract/Free Full Text].
-
Broadus J,
Westerfield M,
Doe CQ
(1998)
Staufen-dependent localization of prospero mRNA contributes to neuroblast daughter-cell fate.
Nature
391:792-795[Medline].
-
Cáceres A,
Banker G,
Steward O,
Binder L,
Payne M
(1984)
Immunocytochemical localization of tubulin and MAP2 during the development of hippocampal neurons in culture.
Dev Brain Res
13:314-318.
-
Campos-Ortega JA
(1997)
Asymmetric division: intricacies of neuroblast division.
Curr Biol
7:R726-R728[Web of Science][Medline].
-
Craig AM,
Banker G
(1994)
Neuronal polarity.
Annu Rev Neurosci
17:267-310[Web of Science][Medline].
-
De Hoop MJ,
Huber LA,
Stenmark H,
Williamson E,
Zerial M,
Parton RG,
Dotti CG
(1994)
The involvement of the small GTP-binding protein Rab5a in neuronal endocytosis.
Neuron
13:11-22[Web of Science][Medline].
-
De Hoop MJ,
Meyn L,
Dotti CG
(1998)
Culturing hippocampal neurons and astrocytes from fetal rodent brain.
In: Cell biology: a laboratory handbook, Ed 2 (Celis JE,
ed), pp 154-163. San Diego: Academic.
-
Deshler JO,
Highett MI,
Schnapp BJ
(1997)
Localization of Xenopus Vg1 mRNA by Vera protein and the endoplasmic reticulum.
Science
276:1128-1131[Abstract/Free Full Text].
-
Dotti CG,
Sullivan CA,
Banker GA
(1988)
The establishment of polarity by hippocampal neurons in culture.
J Neurosci
8:1454-1468[Abstract].
-
Ferrandon D,
Elphick L,
Nüsslein-Volhard C,
St. Johnston D
(1994)
Staufen protein associates with the 3-UTR of bicoid mRNA to form particles that move in a microtubule-dependent manner.
Cell
79:1221-1231[Web of Science][Medline].
-
Goslin K,
Banker G
(1991)
Rat hippocampal neurons in low-density culture.
In: Culturing nerve cells (Banker G,
Goslin K,
eds), pp 251-281. Cambridge, MA: MIT.
-
Hill MA,
Gunning P
(1993)
and actin mRNAs are differentially located within myoblasts.
J Cell Biol
122:825-832[Abstract/Free Full Text]. -
Hortsch M,
Avossa D,
Meyer DI
(1986)
Characterization of secretory protein translocation: ribosome-membrane interaction in endoplasmic reticulum.
J Cell Biol
103:241-253[Abstract/Free Full Text].
-
Kislauskis EH,
Li Z,
Singer RH,
Taneja KL
(1993)
Isoform-specific 3' untranslated sequences sort
-cardiac and -cytoplasmic actin messenger RNAs to different cytoplasmic compartments.
J Cell Biol
123:165-173[Abstract/Free Full Text]. -
Knowles RB,
Sabry JH,
Martone ME,
Deerinck TJ,
Ellisman MH,
Bassell GJ,
Kosik KS
(1996)
Translocation of RNA granules in living neurons.
J Neurosci
16:7812-7820[Abstract/Free Full Text].
-
Lawrence JB,
Singer RH
(1986)
Intracellular localization of messenger RNAs for cytoskeletal proteins.
Cell
45:407-415[Web of Science][Medline].
-
Li P,
Yang X,
Wasser M,
Cai Y,
Chia W
(1997)
Inscuteable and staufen mediate asymmetric localization and segregation of prospero RNA during Drosophila neuroblast cell division.
Cell
90:437-447[Web of Science][Medline].
-
Lucio JP,
Brake B,
Banting G,
Howell KE,
Braghetta P,
Stanley KK
(1990)
Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).
Biochem J
270:97-102[Web of Science][Medline].
-
Marión RM, Fortes P, Beloso A, Dotti CG, Ortín
J (1999) The human homologue of Staufen protein localizes to
the polysomes of the rough endoplasmic reticulum. Mol Cell Biol, in
press.
-
Martin KC,
Casadio A,
Zhu H,
E Y,
Rose JC,
Chen M,
Bailey CH,
Kandel ER
(1997)
Synapse-specific, long-term facilitation of Aplysia sensory to motor synapses: a function for local protein synthesis in memory storage.
Cell
91:927-938[Web of Science][Medline].
-
Parton RG,
Simons K,
Dotti CG
(1992)
Axonal and dendritic endocytic pathways in cultured neurons.
J Cell Biol
119:123-137[Abstract/Free Full Text].
-
Rosa P,
Hille A,
Lee RWH,
Zanini A,
De Camilli P,
Huttner WB
(1985)
Secretogranins I and II: two tyrosine-sulfated secretory proteins common to a variety of cells secreting peptides by the regulated pathway.
J Cell Biol
101:1999-2011[Abstract/Free Full Text].
-
St. Johnston D
(1995)
The intracellular localization of mRNAs.
Cell
81:161-170[Web of Science][Medline].
-
Steward O
(1997)
mRNA localization in neurons: a multipurpose mechanism?
Neuron
18:9-12[Web of Science][Medline].
-
Steward O,
Levy WB
(1982)
Preferential localization of polyribosomes under the base of dendritic spines in granule cells of the dentate gyrus.
J Neurosci
2:284-291[Abstract].
-
van Lookeren Campagne M,
Dotti CG,
Verkleij AJ,
Gispen WH,
Oestreicher AB
(1992)
Redistribution of B-50/growth-associated protein 43 during differentiation and maturation of rat hippocampal neurons in vitro.
Neuroscience
51:601-619[Web of Science][Medline].
-
Verkade P,
Schrama LH,
Verkleij AJ,
Gispen WH,
Oestreicher AB
(1997)
Ultrastructural co-localization of calmodulin and B-50/growth-associated protein-43 at the plasma membrane of proximal unmyelinated axon shafts studied in the model of the regenerating rat sciatic nerve.
Neuroscience
79:1207-1218[Web of Science][Medline].
-
Wessel D,
Flügge UI
(1984)
A method for quantitative recovery of protein in dilute solution in the presence of detergents and lipids.
Anal Biochem
138:141-143[Web of Science][Medline].
-
Wickham L, Duchaîne T, Luo M, Nabi IR, Des Groseillers
L (1999) Mammalian Staufen is a double-stranded RNA- and
tubulin-binding protein which localizes to the rough endoplasmic
reticulum. Mol Cell Biol, in press.
Copyright © 1999 Society for Neuroscience 0270-6474/99/191288-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. G. Thomas, L. J. M. Tosar, M. A. Desbats, C. C. Leishman, and G. L. Boccaccio
Mammalian Staufen 1 is recruited to stress granules and impairs their assembly
J. Cell Sci.,
February 15, 2009;
122(4):
563 - 573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yamaguchi, R. Oohinata, T. Naiki, and K. Irie
Stau1 negatively regulates myogenic differentiation in C2C12 cells.
Genes Cells,
June 1, 2008;
13(6):
583 - 592.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lebeau, M. Maher-Laporte, L. Topolnik, C. E. Laurent, W. Sossin, L. DesGroseillers, and J.-C. Lacaille
Staufen1 Regulation of Protein Synthesis-Dependent Long-Term Potentiation and Synaptic Function in Hippocampal Pyramidal Cells
Mol. Cell. Biol.,
May 1, 2008;
28(9):
2896 - 2907.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Furic, M. Maher-Laporte, and L. DesGroseillers
A genome-wide approach identifies distinct but overlapping subsets of cellular mRNAs associated with Staufen1- and Staufen2-containing ribonucleoprotein complexes
RNA,
February 1, 2008;
14(2):
324 - 335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Poon, S.-H. Choi, C. A. M. Jamieson, D. H. Geschwind, and K. C. Martin
Identification of Process-Localized mRNAs from Cultured Rodent Hippocampal Neurons
J. Neurosci.,
December 20, 2006;
26(51):
13390 - 13399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. Burry and C. L. Smith
HuD Distribution Changes in Response to Heat Shock but Not Neurotrophic Stimulation
J. Histochem. Cytochem.,
October 1, 2006;
54(10):
1129 - 1138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Solecki, E.-E. Govek, T. Tomoda, and M. E. Hatten
Neuronal polarity in CNS development
Genes & Dev.,
October 1, 2006;
20(19):
2639 - 2647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Scholz, P. McDermott, M. Garnovskaya, T. N. Gallien, S. Huettelmaier, C. DeRienzo, and G. Cooper IV
Microtubule-associated protein-4 (MAP-4) inhibits microtubule-dependent distribution of mRNA in isolated neonatal cardiocytes
Cardiovasc Res,
August 1, 2006;
71(3):
506 - 516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, J.-Y. Hu, F. Wu, J. H. Schwartz, and S. Schacher
Two mRNA-Binding Proteins Regulate the Distribution of Syntaxin mRNA in Aplysia Sensory Neurons.
J. Neurosci.,
May 10, 2006;
26(19):
5204 - 5214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Rowe, M. Rizzi, K. Hirose, G. A. Peters, and G. C. Sen
A role of the double-stranded RNA-binding protein PACT in mouse ear development and hearing
PNAS,
April 11, 2006;
103(15):
5823 - 5828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Goetze, F. Tuebing, Y. Xie, M. M. Dorostkar, S. Thomas, U. Pehl, S. Boehm, P. Macchi, and M. A. Kiebler
The brain-specific double-stranded RNA-binding protein Staufen2 is required for dendritic spine morphogenesis
J. Cell Biol.,
January 17, 2006;
172(2):
221 - 231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Baez and G. L. Boccaccio
Mammalian Smaug Is a Translational Repressor That Forms Cytoplasmic Foci Similar to Stress Granules
J. Biol. Chem.,
December 30, 2005;
280(52):
43131 - 43140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Fujii and T. Takumi
TLS facilitates transport of mRNA encoding an actin-stabilizing protein to dendritic spines
J. Cell Sci.,
December 15, 2005;
118(24):
5755 - 5765.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Iijima, T. Imai, Y. Kimura, A. Bernstein, H. J. Okano, M. Yuzaki, and H. Okano
Hzf protein regulates dendritic localization and BDNF-induced translation of type 1 inositol 1,4,5-trisphosphate receptor mRNA
PNAS,
November 22, 2005;
102(47):
17190 - 17195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Tretyakova, A. S. Zolotukhin, W. Tan, J. Bear, F. Propst, G. Ruthel, and B. K. Felber
Nuclear Export Factor Family Protein Participates in Cytoplasmic mRNA Trafficking
J. Biol. Chem.,
September 9, 2005;
280(36):
31981 - 31990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dugre-Brisson, G. Elvira, K. Boulay, L. Chatel-Chaix, A. J. Mouland, and L. DesGroseillers
Interaction of Staufen1 with the 5' end of mRNA facilitates translation of these RNAs
Nucleic Acids Res.,
August 26, 2005;
33(15):
4797 - 4812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Shiina, K. Shinkura, and M. Tokunaga
A Novel RNA-Binding Protein in Neuronal RNA Granules: Regulatory Machinery for Local Translation
J. Neurosci.,
April 27, 2005;
25(17):
4420 - 4434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Angenstein, A. M. Evans, S.-C. Ling, R. E. Settlage, S. Ficarro, F. A. Carrero-Martinez, J. Shabanowitz, D. F. Hunt, and W. T. Greenough
Proteomic Characterization of Messenger Ribonucleoprotein Complexes Bound to Nontranslated or Translated Poly(A) mRNAs in the Rat Cerebral Cortex
J. Biol. Chem.,
February 25, 2005;
280(8):
6496 - 6503.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Thomas, L. J. M. Tosar, M. Loschi, J. M. Pasquini, J. Correale, S. Kindler, and G. L. Boccaccio
Staufen Recruitment into Stress Granules Does Not Affect Early mRNA Transport in Oligodendrocytes
Mol. Biol. Cell,
January 1, 2005;
16(1):
405 - 420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Bannai, K. Fukatsu, A. Mizutani, T. Natsume, S.-i. Iemura, T. Ikegami, T. Inoue, and K. Mikoshiba
An RNA-interacting Protein, SYNCRIP (Heterogeneous Nuclear Ribonuclear Protein Q1/NSAP1) Is a Component of mRNA Granule Transported with Inositol 1,4,5-Trisphosphate Receptor Type 1 mRNA in Neuronal Dendrites
J. Biol. Chem.,
December 17, 2004;
279(51):
53427 - 53434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. ALLISON, K. CZAPLINSKI, A. GIT, E. ADEGBENRO, F. STENNARD, E. HOULISTON, and N. STANDART
Two distinct Staufen isoforms in Xenopus are vegetally localized during oogenesis
RNA,
November 18, 2004;
10(11):
1751 - 1763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang and H. Tiedge
Translational Control at the Synapse
Neuroscientist,
October 1, 2004;
10(5):
456 - 466.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Macchi, A. M. Brownawell, B. Grunewald, L. DesGroseillers, I. G. Macara, and M. A. Kiebler
The Brain-specific Double-stranded RNA-binding Protein Staufen2: NUCLEOLAR ACCUMULATION AND ISOFORM-SPECIFIC EXPORTIN-5-DEPENDENT EXPORT
J. Biol. Chem.,
July 23, 2004;
279(30):
31440 - 31444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Mientjes, R. Willemsen, L. L. Kirkpatrick, I. M. Nieuwenhuizen, M. Hoogeveen-Westerveld, M. Verweij, S. Reis, B. Bardoni, A. T. Hoogeveen, B. A. Oostra, et al.
Fxr1 knockout mice show a striated muscle phenotype: implications for Fxr1p function in vivo
Hum. Mol. Genet.,
July 1, 2004;
13(13):
1291 - 1302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. J. Yoon and K. L. Mowry
Xenopus Staufen is a component of a ribonucleoprotein complex containing Vg1 RNA and kinesin
Development,
July 1, 2004;
131(13):
3035 - 3045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Villace, R. M. Marion, and J. Ortin
The composition of Staufen-containing RNA granules from human cells indicates their role in the regulated transport and translation of messenger RNAs
Nucleic Acids Res.,
April 30, 2004;
32(8):
2411 - 2420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Couve, S. Restituito, J. M. Brandon, K. J. Charles, H. Bawagan, K. B. Freeman, M. N. Pangalos, A. R. Calver, and S. J. Moss
Marlin-1, a Novel RNA-binding Protein Associates with GABA Receptors
J. Biol. Chem.,
April 2, 2004;
279(14):
13934 - 13943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. B. Fredj, J. Grange, R. Sadoul, S. Richard, Y. Goldberg, and V. Boyer
Depolarization-induced translocation of the RNA-binding protein Sam68 to the dendrites of hippocampal neurons
J. Cell Sci.,
March 1, 2004;
117(7):
1079 - 1090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Macchi, S. Kroening, I. M. Palacios, S. Baldassa, B. Grunewald, C. Ambrosino, B. Goetze, A. Lupas, D. St. Johnston, and M. Kiebler
Barentsz, a New Component of the Staufen-Containing Ribonucleoprotein Particles in Mammalian Cells, Interacts with Staufen in an RNA-Dependent Manner
J. Neurosci.,
July 2, 2003;
23(13):
5778 - 5788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. R. SAUNDERS and G. N. BARBER
The dsRNA binding protein family: critical roles, diverse cellular functions
FASEB J,
June 1, 2003;
17(9):
961 - 983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Tiruchinapalli, Y. Oleynikov, S. Kelic, S. M. Shenoy, A. Hartley, P. K. Stanton, R. H. Singer, and G. J. Bassell
Activity-Dependent Trafficking and Dynamic Localization of Zipcode Binding Protein 1 and beta -Actin mRNA in Dendrites and Spines of Hippocampal Neurons
J. Neurosci.,
April 15, 2003;
23(8):
3251 - 3261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Macchi, I. Hemraj, B. Goetze, B. Grunewald, M. Mallardo, and M. A. Kiebler
A GFP-based System to Uncouple mRNA Transport from Translation in a Single Living Neuron
Mol. Biol. Cell,
April 1, 2003;
14(4):
1570 - 1582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. E. Clark, K. C. Dobi, H. K. Duchow, A. N. Vlasak, and E. R. Gavis
A common translational control mechanism functions in axial patterning and neuroendocrine signaling in Drosophila
Development,
March 9, 2003;
129(14):
3325 - 3334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Huang, J. H. Carson, E. Barbarese, and J. D. Richter
Facilitation of dendritic mRNA transport by CPEB
Genes & Dev.,
March 1, 2003;
17(5):
638 - 653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mallardo, A. Deitinghoff, J. Muller, B. Goetze, P. Macchi, C. Peters, and M. A. Kiebler
From the Cover: Isolation and characterization of Staufen-containing ribonucleoprotein particles from rat brain
PNAS,
February 18, 2003;
100(4):
2100 - 2105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Roegiers
Insights into mRNA transport in neurons
PNAS,
February 18, 2003;
100(4):
1465 - 1466.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Angenstein, A. M. Evans, R. E. Settlage, S. T. Moran, S.-C. Ling, A. Y. Klintsova, J. Shabanowitz, D. F. Hunt, and W. T. Greenough
A Receptor for Activated C Kinase Is Part of Messenger Ribonucleoprotein Complexes Associated with PolyA-mRNAs in Neurons
J. Neurosci.,
October 15, 2002;
22(20):
8827 - 8837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ohashi, K. Koike, A. Omori, S. Ichinose, S. Ohara, S. Kobayashi, T.-A. Sato, and K. Anzai
Identification of mRNA/Protein (mRNP) Complexes Containing Puralpha , mStaufen, Fragile X Protein, and Myosin Va and their Association with Rough Endoplasmic Reticulum Equipped with a Kinesin Motor
J. Biol. Chem.,
September 27, 2002;
277(40):
37804 - 37810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. F. Duchaine, I. Hemraj, L. Furic, A. Deitinghoff, M. A. Kiebler, and L. DesGroseillers
Staufen2 isoforms localize to the somatodendritic domain of neurons and interact with different organelles
J. Cell Sci.,
August 15, 2002;
115(16):
3285 - 3295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Drahushuk, T. D. Connell, and D. Higgins
Pituitary Adenylate Cyclase-Activating Polypeptide and Vasoactive Intestinal Peptide Inhibit Dendritic Growth in Cultured Sympathetic Neurons
J. Neurosci.,
August 1, 2002;
22(15):
6560 - 6569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Hu, X. Meng, and S. Schacher
Target Interaction Regulates Distribution and Stability of Specific mRNAs
J. Neurosci.,
April 1, 2002;
22(7):
2669 - 2678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Snee, G. J. Kidd, T. P. Munro, and R. Smith
RNA trafficking and stabilization elements associate with multiple brain proteins
J. Cell Sci.,
January 12, 2002;
115(23):
4661 - 4669.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. M. Palacios and D. S. Johnston
Kinesin light chain-independent function of the Kinesin heavy chain in cytoplasmic streaming and posterior localisation in the Drosophila oocyte
Development,
January 12, 2002;
129(23):
5473 - 5485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Aronov, G. Aranda, L. Behar, and I. Ginzburg
Visualization of translated tau protein in the axons of neuronal P19 cells and characterization of tau RNP granules
J. Cell Sci.,
January 10, 2002;
115(19):
3817 - 3827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-N. Jan and L. Y. Jan
Dendrites
Genes & Dev.,
October 15, 2001;
15(20):
2627 - 2641.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Aronov, G. Aranda, L. Behar, and I. Ginzburg
Axonal Tau mRNA Localization Coincides with Tau Protein in Living Neuronal Cells and Depends on Axonal Targeting Signal
J. Neurosci.,
September 1, 2001;
21(17):
6577 - 6587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.T.K. Saunders, S. Pathirana, S.M. Maguire, M. Doyle, T. Wood, and M. Bownes
Mouse staufen genes are expressed in germ cells during oogenesis and spermatogenesis
Mol. Hum. Reprod.,
November 1, 2000;
6(11):
983 - 991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Rook, M. Lu, and K. S. Kosik
CaMKIIalpha 3' Untranslated Region-Directed mRNA Translocation in Living Neurons: Visualization by GFP Linkage
J. Neurosci.,
September 1, 2000;
20(17):
6385 - 6393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Duchaîne, H.-J. Wang, M. Luo, S. V. Steinberg, I. R. Nabi, and L. DesGroseillers
A Novel Murine Staufen Isoform Modulates the RNA Content of Staufen Complexes
Mol. Cell. Biol.,
August 1, 2000;
20(15):
5592 - 5601.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. J. Mouland, J. Mercier, M. Luo, L. Bernier, L. DesGroseillers, and E. A. Cohen
The Double-Stranded RNA-Binding Protein Staufen Is Incorporated in Human Immunodeficiency Virus Type 1: Evidence for a Role in Genomic RNA Encapsidation
J. Virol.,
June 15, 2000;
74(12):
5441 - 5451.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
X.-Q. Wu and N. B. Hecht
Mouse Testis Brain Ribonucleic Acid-Binding Protein/Translin Colocalizes with Microtubules and Is Immunoprecipitated with Messenger Ribonucleic Acids Encoding Myelin Basic Protein, {alpha} Calmodulin Kinase II, and Protamines 1 and 2
Biol Reprod,
March 1, 2000;
62(3):
720 - 725.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Köhrmann, M. Luo, C. Kaether, L. DesGroseillers, C. G. Dotti, and M. A. Kiebler
Microtubule-dependent Recruitment of Staufen-Green Fluorescent Protein into Large RNA-containing Granules and Subsequent Dendritic Transport in Living Hippocampal Neurons
Mol. Biol. Cell,
September 1, 1999;
10(9):
2945 - 2953.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Frey, M. Pool, and M. Seedorf
Scp160p, an RNA-binding, Polysome-associated Protein, Localizes to the Endoplasmic Reticulum of Saccharomyces cerevisiae in a Microtubule-dependent Manner
J. Biol. Chem.,
May 4, 2001;
276(19):
15905 - 15912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-D. Delcroix, S. Averill, K. Fernandes, D. R. Tomlinson, J. V. Priestley, and P. Fernyhough
Axonal Transport of Activating Transcription Factor-2 Is Modulated by Nerve Growth Factor in Nociceptive Neurons
J. Neurosci.,
September 15, 1999;
19(18):
RC24 - RC24.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|