 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 1999, 19(11):4280-4292
Cloning and Characterization of Aplysia Neutral
Endopeptidase, a Metallo-Endopeptidase Involved in the Extracellular
Metabolism of Neuropeptides in Aplysia californica
Jacques P.
Zappulla1,
Louise
Wickham1,
Wafa
Bawab1,
Xiao-Feng
Yang1,
Maksim V.
Storozhuk2,
Vincent F.
Castellucci2, 3, and
Luc
DesGroseillers1, 3
1 Département de Biochimie,
2 Département de Physiologie, and
3 Centre de Recherches en Sciences Neurologiques,
Université de Montréal, Montréal, Québec,
Canada, H3C 3J7
 |
ABSTRACT |
Cell surface metallo-endopeptidases play important roles in cell
communication by controlling the levels of bioactive peptides around
peptide receptors. To understand the relative relevance of these
enzymes in the CNS, we characterized a metallo-endopeptidase in the CNS
of Aplysia californica, whose peptidergic pathways are
well described at the molecular, cellular, and physiological levels.
The membrane-bound activity cleaved Leu-enkephalin at the
Gly3-Phe4 bond with an inhibitor
profile similar to that of the mammalian neutral endopeptidase (NEP).
This functional homology was supported by the molecular cloning of
cDNAs from the CNS, which demonstrated that the Aplysia
and mammalian NEPs share all the same amino acids that are essential
for the enzymatic activity. The protein is recognized both by specific
anti-Aplysia NEP (apNEP) antibodies and by the
[125I]-labeled NEP-specific inhibitor RB104,
demonstrating that the apNEP gene codes for the
RB104-binding protein. In situ hybridization experiments
on sections of the ganglia of the CNS revealed that apNEP is expressed
in neurons and that the mRNA is present both in the cell bodies and in
neurites that travel along the neuropil and peripheral nerves. When
incubated in the presence of a specific NEP inhibitor, many neurons of
the buccal ganglion showed a greatly prolonged physiological response
to stimulation, suggesting that NEP-like metallo-endopeptidases may
play a critical role in the regulation of the feeding behavior in
Aplysia. One of the putative targets of apNEP in this
behavior is the small cardioactive peptide, as suggested by RP-HPLC
experiments. More generally, the presence of apNEP in the CNS and
periphery may indicate that it could play a major role in the
modulation of synaptic transmission in Aplysia and in
the metabolism of neuropeptides close to their point of release.
Key words:
Aplysia; neutral endopeptidase; CNS; neuropeptide degradation; buccal ganglion; SCP
 |
INTRODUCTION |
Specific behaviors and various
physiological functions from yeast to mammals are controlled by a wide
range of bioactive peptide hormones. The use of peptides as messengers
usually involves the following steps: production and release of the
peptide by a specific cell, interaction of the peptide with a receptor
on the surface of the target cell, and degradation of the peptide to
terminate its action. The first and last steps of this scheme require
the participation of proteases/peptidases. It is now acknowledged that
a small number of membrane peptidases, with a broad range of
specificity, act together to put an end to the biological actions of
neuropeptides (McKelvy and Blumberg, 1986 ; Maroux, 1987 ; Turner, 1986 ;
Turner et al., 1987 ). Most of these neuropeptidases are zinc integral
membrane proteins with their active site facing the exoplasmic side of
the cell (Maroux, 1987 ). One of the best known of these peptidases is
probably neutral endopeptidase-24.11 (NEP, enkephalinase, neprilysin,
CALLA), which has been implicated in the physiological
degradation of several bioactive peptides (for review, see Kenny, 1993 ;
Roques et al., 1993 ).
To study the importance of neuropeptide-degrading enzymes in the CNS,
we used the marine snail Aplysia californica. This animal has been used extensively to study a wide range of behaviors and physiological functions. The simplicity and accessibility of its neuronal components contributed to link cellular, biochemical, molecular, and physiological studies and to finely characterize peptidergic pathways (Miller et al., 1993a ,b ; Brezina et al., 1995 ;
Byrne and Kandel, 1996 ).
So far, three peptidase activities have been characterized and linked
to the extracellular metabolism of peptides in Aplysia. A
leucine aminopeptidase activity (Squire et al., 1991 ), an
aminopeptidase N activity (Bawab et al., 1992 ), and a neutral
endopeptidase activity (Bawab et al., 1993 ). In mammals, NEP is a cell
surface metallo-endopeptidase ubiquitously distributed in the CNS and
the peripheral organs (Roques et al., 1993 ). Previous studies
demonstrated that NEP plays a critical role in atrial natriuretic
factor-mediated hypotension and diuresis (Gros et al., 1989 , 1990 ;
Seymour et al., 1995 ; Thompson and Morice, 1996 ), enkephalin-mediated
analgesia (Roques et al., 1980 ), tachykinin-mediated modulation of
synaptic transmission (Barnes et al., 1993 ; Saleh et al., 1996 ),
endothelin-mediated vasoconstriction (Vijayaraghavan et al., 1990 ), and
peptide-mediated inflammatory responses (for review, see Connelly et
al., 1985 ; Martins et al., 1990 ; Shipp et al., 1990 , 1991 ; for review,
see Kenny, 1993 ; Roques et al., 1993 ).
In a previous study, we identified and characterized a neutral
endopeptidase activity in the kidney membranes of A. californica (Bawab et al., 1993 ). As a means to better define the
physiological role of apNEP in Aplysia, we have
characterized a NEP-like activity in the CNS and cloned the
corresponding cDNA. We have characterized apNEP by Western blotting and
apNEP mRNA in the CNS by in situ hybridization. We have also
demonstrated that inhibitors of the NEP-like activity potentiate the
action of endogenous neuropeptides in the buccal ganglion, and in
particular of small cardioactive peptide (SCP). All together these
results support the importance of peptidases in the modulation of
synaptic transmission and will further our investigation into the role
of the extracellular regulation of neuropeptides in behavior.
 |
MATERIALS AND METHODS |
Peptides, chemicals, and solutions. Peptides
Tyr-Gly-Gly and [Leu]enkephalin were purchased from IAF Biochem
International (Montréal, Quebec, Canada), L-tyrosine
was from Life Technologies-BRL (Burlington, Ontario, Canada), and
amastatin, 1-10 phenanthroline, phosphoramidon, phenylmethyl-sulfonyl
fluoride (PMSF), and
1-O-n-octyl-B-D-glucopyranoside (octylglucoside)
were from Sigma (St. Louis, MO). Captopril was obtained from Squibb
(Princeton, NJ). Thiorphan,
(3-hydroxyamino-carbonyl-2-benzyl-1-oxopropyl)-glycine (HACBO-Gly) and
2[(3-iodo-hydroxy)phenylmethyl]-4-N-[3-(hydroxyamino-3-oxo-1-phenylmethyl)propyl]amino-4-oxobutanoic acid (RB104) were obtained from Bernard P. Roques (Université René Descartes, Paris, France). The labeled substrate
(tyrosyl-3,5-3H)[Leu]enkephalin was obtained from New
England Nuclear (Boston, MA). [125I]Na was
purchased from Amersham (Ontario, Canada). Phosphoramidon (Sigma) was
added directly to a static bath (2 ml volume) to obtain a final desired
concentration. Artificial seawater (ASW) contained (in mM):
NaCl 460, KCl 10, CaCl2 11, MgCl2 55, and HEPES
buffer 10, pH 7.6.
Animals and preparations. A. californica
(200-250 gm) were purchased from Marine Specimen Unlimited (Pacific
Palisades, CA) or from the Aplysia Resource Facility (Miami,
FL). They were maintained in a large 900 l tank at 15°C. All
physiological experiments were performed at room temperature (22°C)
on isolated buccal ganglia. Before dissection, the mollusks were
anesthetized with an injection of an isotonic MgCl2
solution (385 mM) corresponding to approximately one-third
of their volume. Dissection of the buccal ganglion was performed in an
extracellular medium made from equal volumes of isotonic
MgCl2 and ASW. The ganglia were pinned to the bottom of a
Sylgard-coated chamber (3 ml volume) filled with 2 ml of ASW. Both
branches of the radula nerve were aspirated into a suction electrode
for electrical stimulation. All preparations were rested under constant
superfusion of ASW for at least 90 min before the start of an experiment.
Enzyme assays and metabolite analysis. A. californica plasma membranes were prepared as described (Bawab et
al., 1992 ). For the enkephalin-degrading activity, 5-8 µg membrane
proteins were preincubated for 15 min at 25°C in 100 µl of 50 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH
6.5, in the presence of amastatin, at a concentration of 10 µM, alone or combined with different peptidase
inhibitors. The labeled substrate
[3H][Leu]enkephalin
[(tyrosyl-3,5-3H)leu-enkephalin] (30-40 Ci/mmol) was
added, and the metabolites were separated from the substrate by RP-HPLC
as described previously (Bawab et al., 1993 ). For the
SCPB-degrading activity, 50 µg membrane proteins were
preincubated for 15 min at 25°C in 100 µl of 50 mM MES,
pH 6.5, in the presence of 10 µM amastatin and 1 µM captopril. The substrate SCPB (10 µg)
was added and incubated for 1 hr at 25°C, and the metabolites were
separated from the substrate by RP-HPLC on a µBondapak C-18 column
(Waters). A linear gradient from 95% solvent A [0.1% trifluoroacetic
acid (TFA) in water]/5% solvent B (80% acetonitrile/0.1% TFA) to
100% solvent B was developed for 50 min at a flow rate of 1 ml/min.
Molecular identification of [125I]RB104
binding proteins in Aplysia tissues. RB104 was
iodinated by the chloramine T method and purified as described
previously (Bawab et al., 1993 ). Membrane preparations from
Aplysia CNS were solubilized for 1 hr at 4°C in
Tris-buffered saline, pH 7.5, containing 1% (w/v) octylglucoside. The
solubilized proteins were separated by electrophoresis, electroblotted to a nitrocellulose membrane, and labeled with
[125I]RB104 as described previously (Bawab et al.,
1993 ).
Molecular cloning of the apNEP cDNA. Filter replicates of a
J1 genomic library were hybridized at low stringency with a 760 bp
HindIII-ApaI fragment (nucleotides 1616-2376)
isolated from the rabbit cDNA, in 6× SSC, 5× Denhardt's solution,
20% formamide, 0.5% SDS, and 100 µg/ml denatured salmon sperm DNA,
at 42°C for 16 hr. Filters were washed in 2× SSC, 0.1% SDS at
42°C for 1 hr. Restriction fragments of the genomic DNA were
subcloned into pUC19 and sequenced. To clone the corresponding cDNA, a
[32P]-labeled 68 bp genomic exon was used to
screen random-primed GT10 CNS and ovotestis cDNA libraries. Filters
were hybridized at 42°C for 16 hr in 6× SSC, 5× Denhardt's
solution, 0.5% SDS, 50% formamide, and 100 µg/ml denatured salmon
sperm DNA. After hybridization, filters were washed in 0.1× SSC, 0.1%
SDS at 55°C for 1 hr and exposed to Kodak x-ray film at 80°C.
Positive clones were identified, purified, and subcloned into
pBluescript (Stratagene, La Jolla, CA). Double-stranded DNA was
sequenced by the dideoxynucleotide method (Sanger et al., 1977 )
according to Sequenase protocols (United States Biochemical Corp.). The
5' end of the cDNA was cloned by 5'-RACE (rapid amplification of 5'
cDNA extremities) using Aplysia CNS
poly(A+) RNA as described by Chen (1996) . The
first-strand cDNA was synthesized with SuperScript reverse
transcriptase (Life Technologies, Burlington, ON) using a specific
primer CTTGACGATCCACTTTTTCCCC (nucleotides 639-660). An oligo (dA)
anchor was added to the 3' end of the first strand cDNA with terminal
deoxynucleotidyltransferase. A short 12-cycle round of PCR was
performed as described by Chen (1996) with the same specific 3' primer
and the 5' anchor primer TGAGGTGGTTGCCACAGGAGG(T)20.The
product of this PCR reaction was subjected to a second amplification
using a nested, specific 3' primer TCAAGGCTGCTGAGTCTTTGGG (nucleotides
601-622) and the 5' anchor primer TGAGGTGGTTGCCACAGGAGG. The product
was subcloned into the pCR II plasmid (Invitrogen, Carlsbad, CA) and sequenced.
cRNA probes. cRNA probes of 930 bp were obtained by in
vitro transcription of the HindIII-EcoRI
fragment of the apNEP cDNA, subcloned in pBluescript. Probes were
labeled with digoxigenin-UTP (Boehringer Mannheim, Laval, Quebec,
Canada) using T7 or T3 RNA polymerase (Pharmacia Biotechnology, Baie
d'Urfé, Quebec, Canada) according to the manufacturer's
instructions. The size and amounts of labeled RNAs were evaluated by
Northern blotting after separation on a formaldehyde-agarose gel.
Probes were aliquoted and stored at 80°C until use.
In situ hybridization. In situ hybridization
was performed essentially as described in Panoskaltsis-Mortari and Bucy
(1995) on either frozen or paraffin tissue sections. Sections were
hybridized with 3 ng of heat-denatured cRNA probe in 100 µl of 50%
deionized formamide, 2× SSC, 500 µg/ml heat-denatured herring sperm
DNA, 250 µg/ml yeast tRNA, 10% dextran sulfate, for 16 hr at 50°C. After hybridization, slides were successively washed in 2× SSC for 5 min at room temperature, treated with RNase A (40 mg/ml in 500 mM NaCl, 20 mM Tris-HCl, pH 7.5, 1 mM EDTA) at 37°C for 30 min, washed in 2× SSC, 50%
formamide at 50°C for 15 min, and in 1× and 0.5× SSC at room
temperature for 5 min each. Positive signals were detected using
anti-digoxigenin antibodies (Boehringer Mannheim). Tissues were
equilibrated for 1 min in antibody dilution buffer (100 mM
Tris-HCl, pH 7.5, 150 mM NaCl), blocked for 30 min in the
same buffer containing 2% normal goat serum, and incubated at room
temperature for at least 1 hr with sheep anti-digoxigenin antibodies
diluted 1:500. Sections were then washed in the antibody dilution
buffer for 5 min, transferred to the detection buffer (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM MgCl2) for 10 min, and incubated in
340 µg/ml nitroblue tetrazolium/175 µg/ml
5-bromo-4-chloro-3-indolyl-phosphate/4 toluidine salt (Boehringer
Mannheim) in detection buffer. Staining was allowed to proceed
overnight in the dark at 4°C. The coloring reaction was stopped in 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Sections were
mounted in 33% glycerol, 1× PBS, and stored at 4°C.
Antibodies and immunoblotting. Antibodies directed against
apNEP were produced by injecting rabbits with a pool of bacterially expressed C-terminal (amino acid 288-453) and N-terminal (amino acids
454-761) apNEP protein fragments fused to a 6-His tag (Qiagen, Mississauga, ON). Immunoblot analysis was performed using horseradish peroxidase-conjugated anti-rabbit IgG antibodies (Dako, Mississauga, ON) and the SuperSignal substrate (Pierce, Rockford, IL) as recommended by the manufacturer.
Electrophysiology. Intracellular microelectrodes were pulled
from omega-dot borosilicate glass (WPI, Sarasota, FL) and filled with 2 M KAc. Their resistances were between 10 and 20 M . The experiments were performed in current-clamp mode, and the voltage signals were amplified using Axoclamp 2B amplifiers (Axon Instruments). Neurons in the buccal ganglion were identified on the basis of the
classification suggested by Fiore and Meunier (1979) : these were A
neurons corresponding to cells B4 and B5 of Gardner's classification (Gardner, 1971 ), and B neurons. A and B neurons and one or two other
large silent neurons located near the B neurons were impaled in each
experiment. The radula nerve was stimulated with a suction electrode
with 3 msec pulses; at the beginning of the experiment, the stimulus
intensity was adjusted to evoke several spikes in A neurons (usually
2-3 V). Then the radula nerve was stimulated with trains of 30-50
stimuli (20 Hz) to evoke several (two to three) waves of synaptic and
electrotonic potentials in A and B neurons (see Fig. 9). The intertrain
interval was 10 min. The evoked responses as well as the spontaneous
background activity were continuously monitored during the experiment
using a DASH iV (Astro-Med) chart recorder (25 mm/min chart speed).
 |
RESULTS |
Evidence for a neutral endopeptidase-like activity in the
Aplysia CNS
To reveal the presence of a membrane-associated neutral
endopeptidase activity in the Aplysia CNS, we incubated
plasma membranes from pooled ganglia with
[3H][Leu]enkephalin. Amastatin was added at a
concentration of 10 µM to reduce as much as possible the
strong aminopeptidase N activity present in this tissue (Bawab et al.,
1992 ). The resulting metabolites were analyzed by RP-HPLC (Fig.
1). As expected for a NEP-like activity,
a peak that comigrated with the Tyr-Gly-Gly peptide is visible (Fig.
1A). It corresponds to the degradation of 1.6 pmol of
substrate per milligram of protein per minute. The tyrosine peak is
probably generated by the residual aminopeptidase N activity (Bawab et
al., 1992 ).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1.
RP-HPLC analysis of degradation metabolites of
[3H][Leu]enkephalin in the
Aplysia CNS. The substrate was incubated with CNS
plasma membranes, in the absence (A) or presence
of 1 µM RB104 (B) or 1 µM captopril (C).
Arrows indicate the elution position of standard
peptides. The dashed line represents the methanol
gradient used in the HPLC.
|
|
To characterize the nature of the [Leu]enkephalin-degrading activity,
we used various peptidase inhibitors. The cation chelating agent
1-10-phenanthroline completely inhibited the hydrolysis of
[3H][Leu]enkephalin (Table
1), suggesting that the activity is produced by a metallopeptidase. NEP inhibitors such as RB104 (Fig. 1B), HACBO-Gly, thiorphan, and phosphoramidon (Table
1) were shown to abolish the Tyr-Gly-Gly peak. In contrast, captopril, an inhibitor of the dipeptidylcarboxypeptidase (Fig. 1C),
and PMSF, an inhibitor of serine proteases (Table 1), had no effect on
the activity of our enzyme preparation. All of these results suggest
that a metallopeptidase with an inhibitor profile similar to that of
the NEPs found in Aplysia kidney and in mammals is present
in the CNS of Aplysia.
View this table:
[in this window]
[in a new window]
|
Table 1.
Comparison of the action of peptidase inhibitors on apNEP
activity present in Aplysia californica CNS and kidney
membranes
|
|
Binding of the highly specific NEP inhibitor
[125I]RB104 to NEP-like proteins in the
Aplysia CNS
RB104 is a highly specific NEP inhibitor that was shown to detect
as little as 2 ng of rat NEP on a Western blot (Fournié-Zaluski et al., 1992 ). We first tested the affinity of the enkephalin-degrading enzyme in CNS plasma membranes for [125I]RB104 and
found that the KD is similar to that of the rat
NEP and the Aplysia kidney enzyme (Table
2) (Fournié-Zaluski et al., 1992 ;
Bawab et al., 1993 ). [125I]RB104 was then used in
inhibitor gel electrophoresis experiments. Solubilized CNS membrane
proteins or purified rabbit NEP, which was used as a control, were
separated by SDS-PAGE, transferred to nitrocellulose membranes, and
incubated with [125I]RB104. As shown in Figure
2, [125I]RB104 binds
to proteins of 100 and 200 kDa in the Aplysia CNS membranes
and to the 94 kDa rabbit protein; this binding was completely abolished
by NEP inhibitors such as HACBO-Gly (10 µM) and
phosphoramidon (10 µM). In contrast, the labeling was not
affected by specific inhibitors of other peptidases such as captopril
(10 µM) or amastatin (10 µM). These results
demonstrate that NEP-like proteins are expressed in the CNS and that
their molecular sizes are different from that of the 140 kDa NEP-like
enzyme already observed in the Aplysia kidney membranes.
However, their active site is likely to be structurally and
functionally similar, because they all bind
[125I]RB104 with high affinity. These results
raise the question of whether the NEP-like proteins in the kidney and
CNS are differentially glycosylated isoforms of the same protein or
whether they are expressed from two closely related NEP-like genes.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2.
Inhibitor gel electrophoresis with
[125I]RB104 and different peptidase inhibitors.
Solubilized Aplysia CNS membrane proteins (top
panel) and purified rabbit NEP (bottom
panel) were separated by SDS-PAGE and transferred onto
nitrocellulose membranes. NEP-like proteins were labeled with 100 pM [125I]RB104 in the presence or
absence of peptidase inhibitors: absence of inhibitor
(Control); HACBO-gly at 10 µM; Phosphoramidon at 10 µM;
Amastatin at 10 µM;
Captopril at 10 µM.
|
|
Isolation of cDNA clones encoding an apNEP
To answer this question, we cloned cDNAs coding for the NEP-like
activity. We first screened an Aplysia genomic library at low stringency, using a 760 bp rabbit NEP cDNA fragment as a probe (Devault et al., 1987 ). One of the 13 clones ( NEPg1) found was further characterized, and a 400 bp fragment was subcloned and sequenced. A short segment of 68 bp, flanked by splicing consensus sequences, showed high sequence similarity to the rabbit NEP sequence (Fig. 3). Interestingly, the 3' splicing
site is identical to the one described for all of the NEP-like family
members, and the 5' splicing site is common to endothelin-converting
enzyme (ECE), a human phosphate-regulating gene with homologies to
endopeptidases on the X-chromosome (PHEX) and kell blood group
protein (KELL) but not to NEP (Fig. 3). Considering the high level of
conservation of exon/intron boundaries, these results not only suggest
that apNEP is a member of the NEP family, but also indicate that the apNEP and mammalian NEP-like enzymes are likely to be derived from a
common ancestor (see also below).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 3.
Comparison of the apNEP ( NEPg1 clone), hNEP,
hECE1, hKELL, and hPHEX exons that code for the zinc-binding domain.
Nucleotide sequences of exons and flanking introns are shown in
capital and small letters, respectively.
Splicing consensus sequences are underlined. The deduced
amino acid sequence of the apNEP exon is shown above the
nucleotide sequence. The codons for identical amino acids are in
bold type, and the pentapeptide consensus sequences
(His-Glu-Xaa-Xaa-His) that are part of the metalloprotease zinc-binding
domain are boxed.
|
|
This 68 bp segment was PCR-amplified, subcloned, and used as a probe to
screen Aplysia CNS and ovotestis cDNA libraries by plaque
hybridization. Of eight positive recombinant phages, the inserts of the
5.1, NEPc, NEPe, and NEPf clones were sequenced. Their
sequences indicated that they represented overlapping cDNAs derived
from the same apNEP mRNA but that the 5' region of the coding region
was missing. Because we did not succeed in cloning the 5' part of the
cDNA by rescreening the libraries, we performed a 5'-RACE protocol
using a set of nested specific internal primers and mRNA isolated from
the CNS. This yielded one overlapping PCR product that covered the
missing coding sequence and part of the 5' UTR. The first ATG is found
at position 164 and is followed by an open reading frame of 2361 nucleotides that codes for a putative apNEP protein of 787 amino acids
(Fig. 4). This protein is ~35%
identical to human NEP.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 4.
Nucleotide and deduced amino acid sequence of the
Aplysia neutral endopeptidase. Amino acids are numbered
starting at the first ATG of the open reading frame. The putative
transmembrane region is underlined. Potential sites of
N-glycosylation are indicated by an
asterisk, and the cysteine residues are
bold. The zinc-binding signature HEXXH is
boxed. The nucleotide sequence has been submitted to the
GenBank Data Bank with accession number AF104361.
|
|
Southern blot analysis of the apNEP gene
The cloning of one small exon of the apNEP gene
suggests that it could be fragmented into many exons as observed for
the mammalian homologs. To assess this point, a Southern blot of
A. californica genomic DNA was digested with
BglII, EcoRI, HindIII,
SacI, and XbaI and hybridized with a short probe.
Considering the fact that no SacI or BglII site
and only one XbaI restriction site exists in this probe, the
multiple bands that hybridized in each lane indicate that this small
cDNA region corresponds to at least three exons in the genomic DNA
(Fig. 5A). Consistent with the
cloning of a small exon (see above), this result suggests that the
genomic organization of the apNEP gene may be similar to
that of the members of the NEP-like family, which are all fragmented
into several exons (D'Adamio et al., 1989 ).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 5.
Southern and Northern blot analysis of the
apNEP gene. A, Genomic DNA was isolated
from ovotestis and digested with either BglII
(lane 1), EcoRI (lane 2),
HindIII (lane 3), SacI
(lane 4), or XbaI (lane
5). Digested DNA (10 µg/lane) was run on a 0.8% agarose gel,
transferred to a nitrocellulose membrane, and hybridized at high
stringency with the [32P]-labeled
HindIII-AccI apNEP fragment (nucleotides
1142-1458) as described previously (Wickham and DesGroseillers, 1991 ).
DNA molecular weight markers are indicated in kilobase pairs
(kbp) on the left. B,
Northern blot analysis of the apNEP transcript. Total RNA was extracted
from different tissues, and poly(A+) RNA (5 µg)
isolated from gill (lane 1), heart (lane
2), ovotestis (lane 3), kidney (lane
4), and CNS (lane 5) was fractionated on
a 1% formaldehyde/agarose gel, blotted to a nitrocellulose membrane,
and hybridized at high stringency with the
[32P]-(HindIII-AccI)
apNEP fragment, as performed previously (Auclair et al., 1994 ). RNA
molecular weight markers are indicated in kilobases (kb)
on the left. To control the amounts of RNA in each lane,
filters were stripped and rehybridized with an Aplysia
actin probe (data not shown).
|
|
Tissue expression of the apNEP mRNA, and cellular localization in
the Aplysia CNS
Northern blots of poly(A+) RNA extracted from
various tissues were probed with a 316 bp apNEP cDNA fragment and used
to determine the size of the apNEP transcript and its specificity of
expression (Fig. 5B). A single transcript of ~3.8 kb was
abundantly present in ovotestis and kidney and very little was
expressed in the CNS, gill, and heart where the signal could only be
detected after a long period of exposure. By comparison with the size
of the cDNA, it is likely that additional 5' and/or 3' untranslated
sequences are present in the transcript. The presence of apNEP in these tissues was confirmed by Western blot experiments (see below). These
results confirm that apNEP is expressed in both the CNS and kidney as
well as in many other organs.
To determine the type(s) of cells that express apNEP in the
Aplysia CNS, we performed preliminary in situ
hybridization experiments on paraffined sections of the ganglia. A
positive signal can be observed with a cRNA probe in many neurons of
all the ganglia (Fig.
6A), demonstrating that
neurons are the source of apNEP in the CNS. The signal is not
restricted to the cell bodies and can also be observed in the neuropil
and ganglion peripheral nerves in structures that look like neurites
(Fig. 6C). The specificity of the signal was confirmed by
the absence of any signal when the same experiments were performed on
adjacent sections using a sense probe (Fig. 6B). At
this point we did not try to identify individual neurons.

View larger version (88K):
[in this window]
[in a new window]
|
Figure 6.
In situ hybridization of apNEP on
paraffined sections of Aplysia ganglia. Sections of the
abdominal ganglion (A, B) and of a buccal ganglion nerve
(C, D) were hybridized with either an apNEP cRNA
antisense (A, C, D) or sense (B)
probe. Positive signal is seen in neurons (A) and
neurites (Nt) extending into the nerve. No signal is
detected in the sheath (Sh). The same results were
obtained with sections from all the major ganglia. Scale bar, 100 µm.
|
|
Primary structure of apNEP
The apNEP cDNA sequence encodes a putative protein of 88 kDa,
which shares important structural features with mammalian NEP. (1) As
predicted by the Kyte and Doolittle (1982) hydrophobicity plot (Fig.
7A), apNEP is a type II
integral membrane protein with a short N-terminal cytoplasmic tail of
31 amino acids, a hydrophobic region of 23 residues, which represents a
putative transmembrane helix, and a large extracellular C-terminal
domain of 686 amino acids. (2) The extracellular portion of apNEP
contains the highly conserved zinc-binding motif (residues 622-626)
(Fig. 6B) and thus probably constitutes the catalytic
domain. (3) apNEP contains 10 putative sites for N-glycosylation
(Asn-Xxx-Ser/Thr), suggesting that apNEP is highly glycosylated. (4)
The 10 cysteine residues found in the extracellular domain of apNEP
coalign with those of the mammalian NEP (Fig. 7B). (5)
Nearly all of the amino acids that are essential for the enzymatic
activity of the mammalian NEP (for review, see Roques et al., 1993 ) are
found in the same position on the cDNA encoding apNEP (Table
3). All together, these results suggest
that the apNEP cDNA codes for an Aplysia neutral
endopeptidase homolog.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7.
Molecular structure of apNEP. A,
Hydropathy analysis of apNEP. The 787 amino acid-long apNEP sequence
was scanned using the computer program of Kyte and Doolittle (1982) .
Numbers on the horizontal axis refer to the amino acid
sequence. Negative values correspond to hydrophilic regions and
positive values to hydrophobic regions. The arrowhead
indicates the only potential membrane-spanning segment of apNEP.
B, Schematic representation of the primary sequences of
the human and Aplysia NEP proteins. The cysteine
residues in the two proteins are indicated by the one-letter code
C. The black rectangle represents the
transmembrane region, and the thin rectangle represents
the HEXXH gluzincin domain. The position of the possible
N-glycosylation sites is indicated by open
lollipops.
|
|
View this table:
[in this window]
[in a new window]
|
Table 3.
Comparison of the essential amino acids of thermolysin
(TLN), mammalian neutral endopeptidase (mamNEP), and Aplysia
californica neutral endopeptidase (apNEP)
|
|
The CNS 100 kDa and the kidney 140 kDa
[125I]RB104-binding proteins are likely to be
coded by the apNEP gene
To determine whether the NEP-like molecules in the CNS and kidney
membranes are both expressed from the apNEP gene,
immunoblots of membrane extracts from the kidney and CNS were
performed, using anti-apNEP antibodies. As expected from the inhibitor
gel electrophoresis experiment, a band of 140 kDa was detected in the
kidney plasma membranes, whereas a single band of 100 kDa was detected
in the membranes of the CNS (Fig.
8A). Under nonreducing
electrophoresis conditions, an additional band of ~200 kDa was
detected in the membranes of the CNS (Fig. 8C), suggesting
strongly that the 200 kDa protein is a dimer of the 100 kDa protein, as
observed in mammals (Kenny and Maroux, 1982 ). These results demonstrate
the presence of apNEP in both tissues and clearly link the
RB104-binding proteins in the membranes of both the CNS and kidney to
the product of the apNEP gene.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 8.
Immunoblot analysis of the expression and
glycosylation of apNEP in different A. californica
tissues. A, Twenty micrograms of solubilized membrane
proteins (salivary gland, heart, gill, kidney, and CNS) and 30 µg of
total protein extracts (buccal ganglion and bag cells) were separated
on a 6% SDS-polyacrylamide gel under reducing conditions, blotted, and
detected with an anti-apNEP antisera. B, Plasma membrane
protein extracts isolated from Aplysia tissues (kidney,
CNS) or from transiently transfected mammalian HEK293 cells
(HEK293) were incubated in the absence ( ) or presence
(F) of PNGase F, before loading on the gel.
C, SDS-PAGE under nonreducing conditions. The
arrow indicates the position of the 200 kDa band.
|
|
The discrepancy in the apparent molecular mass of the CNS and kidney
NEP-like enzymes in Aplysia membranes may be the result of
post-translational modifications, such as glycosylation. To examine
this point, membrane extracts from these tissues were deglycosylated
with PNGase F; the resulting proteins were separated by SDS-PAGE
and detected by Western blotting. After PNGase F treatment, the
molecular size of apNEP in the kidney was reduced to ~88 kDa (Fig.
8B), which is the predicted size from the cDNA
sequence. This demonstrates that the 140 kDa protein is highly
glycosylated and confirms that it is probably the product of the
apNEP gene. On the other hand, the size of the 100 kDa
protein in the CNS (Fig. 8B), heart, and gill was
unchanged. To determine whether PNGase F can remove sugars from
glycoproteins expressed in the CNS membranes of Aplysia, we
probed the blot with antibodies directed against
5-HTap1, another highly glycosylated protein (Angers
et al., 1998 ). This protein was not deglycosylated either (data not shown), indicating that several glycosylated proteins in the CNS are
PNGase F resistant.
We cloned the apNEP cDNA from the CNS in pCDNA3/RSV, and the
recombinant plasmid was introduced into mammalian HEK 293 cells, as
reported previously (Angers et al., 1998 ). Plasma membranes were
purified and the protein was detected by Western blotting after PNGase
F treatment. As seen in Figure 8B, the results
suggest that the enzyme found in Aplysia kidneys is likely
to be coded by the same gene as the cDNA we isolated from the CNS
because they are of the same size.
The application of a NEP-specific inhibitor potentiates the action
of endogenous neuropeptides on the buccal ganglion and prevents the
in vitro degradation of SCPB by
Aplysia CNS membranes
In situ hybridization and Western blotting experiments
(Fig. 8A) showed that apNEP is present in the buccal
ganglion of Aplysia. To determine whether apNEP could be
responsible for the inactivation of neuropeptides in vivo,
we studied a well understood behavior in invertebrates, which is
feeding. In Aplysia, feeding consists of a number of
different rhythmic motor patterns, including biting, swallowing, and
rejection (Kupfermann, 1974 ; Weiss et al., 1986 ). Different reports
have characterized the critical roles of several neuropeptides,
including SCPB, FMRFamide, egg-laying hormone (ELH), buccalin, and myomodulin, as well as serotonin and acetylcholine, in
the modulation of various aspects of the feeding behavior (Kreiner et
al., 1987 ; Lloyd et al., 1987 ; Sossin et al., 1987 ; Lloyd, 1988 ; Miller
et al., 1993a ,b ). Inhibition of apNEP by an apNEP-specific inhibitor
should potentiate the action of secreted peptides that are normally
substrates for this enzyme. Therefore, to recruit at least some of the
peptidergic neurons in the ganglion, we decided to stimulate the radula
nerve, because this nerve contains processes of SCP-containing neurons
(Miller et al., 1994 ). Trains of stimuli to the radula nerve were
delivered every 10 min (see Materials and Methods for more details);
the evoked responses were recorded in A and B neurons and one or two
other large cells located near the B cells. After three to four control
responses, phosphoramidon (10-100 µM) was added to the
bath, and three to four responses were monitored in the presence of the
drug; 5-10 more responses were recorded after the inhibitor was washed
out. The results of an experiment, in which 10 µM
phosphoramidon was added, are shown in Figure
9. In the control period during the
stimulation itself, there was in general a burst of action potentials
and a burst of PSPs with oscillations of membrane potentials in the monitored neurons (Fig. 9A). The later parts of the evoked
responses were greatly prolonged in the presence of phosphoramidon. In
the example in Figure 9A, one can notice that the delayed
firing is increased in three of the neurons. These effects were
reversible after washout. The summary of five experiments (18 neurons)
is shown in Figure 9B. These results suggest that the action
of several endogenous peptides in the buccal ganglia can be enhanced
because of the decrease of their degradation by a NEP-like enzyme
present in this ganglion.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 9.
Phosphoramidon prolongs the responses of the
buccal neurons to radula nerve stimulation. A,
Simultaneous recordings from four neurons before, during, and after
exposure to phosphoramidon (10 µM). In all cases the
activity evoked is prolonged: trace 1, B neuron; trace
2, A neuron; trace 3, B neuron; trace
4, unidentified cell (see Results for details).
B, Summary of five experiments (18 neurons) with
phosphoramidon (10 or 100 µM). Prolongation of the
responses evoked by radula nerve stimulation was observed in all the
monitored neurons. The duration of the recruited activity was
normalized to each respective control. The percentage average of every
neuron in one experiment contributed to the average score of that
experiment.
|
|
Because exogenous applications of SCPB induce the same
physiological responses on these neurons as those obtained after radula nerve stimulation (data not shown), we tested whether SCPB
is a substrate for apNEP in vitro. Using RP-HPLC, we showed
that SCPB is cleaved by Aplysia CNS membrane
extracts and that this cleavage is inhibited by the NEP inhibitor
phosphoramidon (10 µM). As seen in Figure
10, the peak corresponding to the
uncleaved SCP peptide is clearly preserved in the presence of
phosphoramidon. In the absence of the inhibitor, this peak is strongly
reduced, and other peaks appeared, probably corresponding to the
metabolites resulting from the degradation of SCPB by
a NEP-like enzyme present in the membrane protein extract.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 10.
SCPB is degraded by an
Aplysia CNS NEP-like enzyme. SCPB was
incubated with CNS plasma membranes, in the absence
(A) or presence of 10 µM
phosphoramidon (B). The arrow
indicates the elution position of the uncleaved SCPB. The
dashed line represents the acetonitrile gradient used in
the HPLC.
|
|
 |
DISCUSSION |
Endopeptidase activity in the CNS
Previous studies showed that an endopeptidase with catalytic
properties similar to those of neutral endopeptidase-24.11 is present
in the kidney of A. californica (Bawab et al., 1993 ). In
this paper, we demonstrate that this activity also exists in the CNS of
this mollusk. The HPLC profiles of [Leu]enkephalin degradation, the
sensitivity of this activity to specific NEP inhibitors, and the
binding of [125I]RB104 to the protein all strongly
suggest that the CNS and kidney endopeptidases are similar. However,
the CNS endopeptidase migrates as a 100 kDa protein band on a Western
blot. Although consistent with the size of the mammalian (Kenny et al.,
1987 ; Fournié-Zaluski et al., 1992 ) and the mollusk Mytilus
edulis (Shipp et al., 1990 ) NEPs, the CNS protease is much smaller
than the one found in the Aplysia kidney (Bawab et al.,
1993 ). Our results demonstrate that not only is the pattern of
glycosylation of apNEP different in the kidney and CNS, as observed in
mammals (Roques et al., 1993 ), but the nature of the sugars that are
added to the glycoproteins is likely to be different in these tissues.
This could be attributable to the presence of a fucose residue on the
first N-acetylglucosamine of the oligosaccharide chain in
the CNS; this addition is known to inhibit the cleavage of sugar chains
by PNGase F, and fucose residues have been reported in different
glycoproteins isolated from the CNS of Aplysia (Thompson et
al., 1976 ; Ambron et al., 1985 ; Goldberg and Ambron, 1986 ; Cleary and
Schwartz, 1987 ). The meaning of this differential glycosylation is
unknown because both proteins seem to exhibit similar
[Leu]enkephalin-degradation activities, affinities for RB104 (Table
2), and responses to different NEP inhibitors (Table 1).
More significantly, our results with [125I]RB104
and the anti-apNEP antibodies clearly link the RB104-binding protein in
the plasma membranes of both the kidney and CNS to the product of the
apNEP gene. We do not yet know whether the
enkephalin-degrading activity in these membranes is generated by apNEP,
although the binding of [125I]RB104 to a single
protein in both the CNS and kidney is a strong indication for the
expression of a single NEP-like gene in these tissues.
Structure/function of apNEP
As described previously for the kidney endopeptidase, the activity
of the CNS enzyme is low and does not allow us to fully characterize
it. The molecular cloning of the apNEP cDNA represents a first step
toward achieving this goal. The predicted molecular size, topological
localization in the membranes, and peptidic sequence of the protein
places apNEP in the large family of NEP-like enzymes (Turner and
Tanzawa, 1997 ). Indeed, a phylogenetic analysis localizes apNEP at the
branching point of mammalian NEP-like enzymes, suggesting that
apNEP may be considered as the ancestor of these genes (Fig.
11). After the separation of
vertebrates from invertebrates, it is likely that the ancestor
NEP gene duplicated and diverged to generate peptidases
involved in several physiological processes (NEP) (Roques et al.,
1993 ), in bone and tooth mineralization processes (PHEX) (The HYP
Consortium, 1995 ; Ruchon et al., 1998 ), in the control of blood
pressure (ECEs) (Turner and Murphy, 1996 ; Webb et al., 1997 ), or in a
still uncharacterized function in erythrocytes (KELL) (Lee et al.,
1991 ). Consistent with this hypothesis, most of the residues that have
been shown to be essential for the activity and/or conformation of
human NEP are conserved at the same position in apNEP (Table 3). Such
high conservation in the nature and position of all these residues
is very significant when we consider that the two proteins originated
from organisms whose ancestors diverged 600 million years ago, and it
suggests that these residues were subjected to severe evolutionary
constraints to keep the proper folding of its active site. In
particular, the 10 cysteine residues in the ectodomain of apNEP and
PHEX, which contribute to the stabilization of the active enzyme's
conformation (Tam et al., 1985 ), not only align perfectly in each
protein but are also conserved in NEP, ECEs, and KELL. This again
suggests that the structure of apNEP is close to that of the ancestor
protein and that some of the mammalian NEP-like enzymes may have
evolved by acquiring extra pairs of cysteine residues. Interestingly, the cluster of four cysteines
(C-X4-C-X17-C-X7-C), which is
located a few amino acids downstream from the transmembrane domain in all members of the NEP-like family, is separated from the transmembrane domain by a spacer of 50 amino acids in apNEP. This spacer contains many serine and threonine residues, suggesting that it may allow O-glycosylation of the protein and/or a better exposure of the active
site at the cell surface. Alternatively, it may promote the cleavage of
apNEP by a specific protease. Such a feature, which would either
modulate the activity of apNEP at the membrane or liberate the protein
into the extracellular fluid, has been described for human NEP (hNEP)
(Almenoff et al., 1984 ; Johnson et al., 1985 ; Deschodt-Lanckman et al.,
1989 ; Soleilhac et al., 1996 ). This may be particularly useful in
Aplysia, which has an open circulatory system with arteries
leading directly to open tissue spaces (Kandel, 1979 ). The presence of
soluble peptidases in the hemocel may be a more efficient way to
degrade peptides, a possibility supported by the description of
metallopeptidase activities in Aplysia hemolymph (Squire et
al., 1991 ; Bawab et al., 1992 ; Owens et al., 1992 ; Rothman et al.,
1992 ).

View larger version (9K):
[in this window]
[in a new window]
|
Figure 11.
Phylogenetic analysis of the members of the
NEP-like family. Sequences were aligned using the Clustal V program
(Thompson et al., 1994 ). The phylogenetic tree was constructed using
the Neighbor Joining method (Saitou and Nei, 1987 ) with a bootstrap
analysis that calculates the probability of occurrence of the presented
branching for 100 possible trees (Felsenstein, 1993 ).
hNEP, Human neutral endopeptidase (accession number
M26605); hECE-1, human endothelin-converting enzyme 1 (accession number Z35307); hECE-2, human
endothelin-converting enzyme 2 (accession number AB011179);
apNEP, A. californica neutral
endopeptidase (accession number AF104361); hPHEX, human
phosphate-regulating gene with homologies to endopeptidases on the
X-chromosome (accession number Y10196); hKELL, human
kell blood group protein (accession number M64934);
pepO, lactococcus lactis PepO gene
(accession number L04938). Sequences were aligned, and only the peptide
regions that could be aligned with the PepO sequence were retained for
the analysis; this roughly corresponds to the extracellular parts of
the human and mollusk enzymes.
|
|
Arg102 is the only functional residue that is not
shared by apNEP and mammalian NEP. It is known to play a role in
substrate binding and to interact with the free carboxy group of the
P'2 residue of some substrates (e.g., enkephalins), allowing a
dipeptidyl-carboxypeptidase-like activity (Beaumont et al., 1991 ). The
absence of this arginine in the active site of apNEP could explain the
weak enzymatic activity of apNEP toward enkephalins. In addition, we
demonstrated previously that the enkephalin-degrading enzyme in kidney
plasma membranes is a real endopeptidase because it degrades
[Leu]enkephalinamide, a peptide that is protected from degradation by
carboxypeptidases (Bawab et al., 1993 ).
Physiological role of apNEP
As observed in mammals (Roques et al., 1993 ), apNEP is found in
many tissues, suggesting that it could be involved in the regulation of
different peptidergic pathways. Indeed, neuropeptides are ubiquitously
present in Aplysia, and many of them are potential substrates for apNEP. Localization of apNEP by in situ
hybridization and/or immunohistochemistry can provide important clues
concerning its physiological roles and may guide the search for its
physiologically relevant substrates. Colocalization of apNEP and
specific peptides, and potentialization of the action of the peptides
by specific enzyme inhibitors in vivo, are the two most
important criteria to establish the physiological relevance of a
peptidase in the regulation of a peptidergic pathway.
Our results suggest that apNEP-like peptidases in the buccal ganglion
may be involved in the regulation of the feeding behavior. apNEP is
expressed in this ganglion, and NEP-inhibitors potentiate the action of
the peptides, most likely by controlling their rate of degradation. In
this pathway, SCPs, myomodulin, and buccalin are potential substrates
(Kreiner et al., 1987 ; Lloyd et al., 1987 ; Sossin et al., 1987 ; Miller
et al., 1992 ). We have shown that one of these peptides,
SCPB, is effectively degraded by a CNS NEP-like
enzyme. Similarly, in the abdominal ganglion, -bag cell peptide
( -BCP) (Owens et al., 1992 ), which is a neuropeptide that mediates
the bag cell-induced inhibition of left upper quadrant cells (LUQ) and
acts together with ELH to coordinate long- and short-lasting events in
the egg-laying program (Rothman et al., 1985 ), was reported to be
rapidly degraded by endogenous peptidases when applied to the abdominal
ganglion in the absence of peptidase inhibitors (Rothman et al., 1985 ).
Analysis of the metabolites revealed that among other peptidases, a
NEP-like activity is involved in -BCP degradation. The expression of
apNEP by the LUQ cells (data not shown) and the presence of apNEP in
the bag cell extracts (Fig. 7A) is consistent with the
possibility that it could be involved in this -BCP-degrading activity.
As observed in mammals (Barnes et al., 1988 ; Roques et al., 1993 ), the
apNEP gene is expressed in neurons. This suggests that the
protein may be present in proximity to peptide receptors where it can
play a major role in the modulation of synaptic transmission by
controlling the metabolism of neuropeptides close to their site of
action. The presence of apNEP mRNA in neurites that come from the ganglia via peripheral nerves suggests that a finer regulation in the level of apNEP may be exerted by local translation of the transcript in neurites. Transport and local translation of mRNAs is now
well documented (Wilhelm and Vale, 1993 ; Steward, 1997 ), although the
significance of this phenomenon is not completely understood. There is
building evidence that local translation of mRNA in neurites serves to
locally modulate the action of the translated product in response to
changing physiological conditions (Van Minnen, 1994 ; Martin et al.,
1997 ).
The Aplysia nervous system uses a wide variety of
neuropeptides to modulate its behavior and physiological functions, and several peptidases are responsible for the regulation of the actions of
these peptides. A global understanding of the function of any neuropeptide requires knowledge of its synthesis, release, target tissues, and regulation. The present study provides insight into the
nature and distribution of the Aplysia neuropeptidase apNEP and provides the necessary tools to further investigate the role that
the extracellular regulation of neuropeptides plays in behavior.
 |
FOOTNOTES |
Received Nov. 10, 1998; revised March 8, 1999; accepted March 19, 1999.
This work was supported by grants from the Medical Research Council of
Canada (MRC) and Fonds pour la Formation de Chercheurs et l'Aide
á la Recherche (FCAR) to L.D.G. and V.F.C. We thank Jeanne Lavoie
and Mireille Fyfe for excellent technical support, as well as Manon
Moreau and Gaston Lambert for expert photographic work. We thank Dr.
Philippe Crine for providing us with purified rabbit NEP, Dr. Richard
H. Scheller for the generous gift of the Aplysia genomic
library, and Dr. Bernard P. Roques for generously providing RB104,
HACBO-Gly, and thiorphan. We also thank Dr. Hervé Le Moual for
critical reading of this manuscript.
Correspondence should be addressed to Dr. Luc DesGroseillers,
Département de Biochimie, Université de Montréal,
C.P. 6128, Succursale Centre-Ville, Montréal, Québec,
Canada H3C 3J7.
Dr. Yang's present address: Department of Cancer Immunology and AIDS,
Dana-Farber Institute, Harvard Medical School, Boston, MA 02115.
Dr. Storozhuk's present address: Bogomoletz Institute of Physiology,
Kiev, Ukraine.
 |
REFERENCES |
-
Almenoff J,
Teirstein AS,
Thornton JC,
Orlowski M
(1984)
Identification of a thermolysin-like metallo-endopeptidase in serum: activity in normal subjects and in patients with sarcoidosis.
J Lab Clin Med
103:420-431[Medline].
-
Ambron RT,
Schachen S,
Rayport SG
(1985)
Proteins rapidly transported to the synapses of a single identified neuron of Aplysia californica.
J Neurosci
5:2866-2873[Abstract].
-
Angers A,
Storozhuk MV,
Duchaine T,
Catellucci VF,
DesGroseillers L
(1998)
Cloning and functional expression of an Aplysia 5-HT receptor negatively coupled to adenylate cyclase.
J Neurosci
18:5586-5593[Abstract/Free Full Text].
-
Auclair D,
Lang BF,
Forest P,
DesGroseillers L
(1994)
Analysis of genes encoding highly conserved lysine-rich proteins in Aplysia californica and Saccharomyces cerevisiae.
Eur J Biochem
220:997-1003[Medline].
-
Barnes K,
Turner AJ,
Kenny AJ
(1988)
Electromicroscopic immunocytochemistry of pig brain shows that endopeptidase-24.11 is localized in neuronal membranes.
Neurosci Lett
94:64-69[Medline].
-
Barnes K,
Turner AJ,
Kenny AJ
(1993)
An immunoelectron microscopic study of pig substantia nigra shows co-localization of endopeptidase-24.11 with substance P.
Neuroscience
53:1073-1082[Medline].
-
Bateman Jr RC,
Jackson D,
Slaughter CA,
Unnithan S,
Chai YG,
Moomaw C,
Hersh LB
(1989)
Identification of the active-site arginine in rat neutral endopeptidase 24.11 (enkephalinase) as arginine 102 and analysis of a glutamine 102 mutant.
J Biol Chem
264:6151-6157[Abstract/Free Full Text].
-
Bawab W,
Querido E,
Crine P,
DesGroseillers L
(1992)
Identification and characterization of aminopeptidases from Aplysia californica.
Biochem J
286:967-975.
-
Bawab W,
Aloyz RS,
Crine P,
Roques BP,
DesGroseillers L
(1993)
Identification and characterization of a neutral endopeptidase activity in Aplysia californica.
Biochem J
296:459-465.
-
Beaumont A,
Le Moual H,
Boileau G,
Crine P,
Roques BP
(1991)
Evidence that both arginine 102 and arginine 747 are involved in substrate binding to neutral endopeptidase (EC 3.4.24.11).
J Biol Chem
266:214-220[Abstract/Free Full Text].
-
Brezina V,
Bank B,
Cropper EC,
Rosen C,
Vilim FS,
Kupfermann I
(1995)
Nine members of the myomodulin family of peptide cotransmitters at the B16-ARC neuromuscular junction of Aplysia.
J Neurophysiol
74:54-72[Abstract/Free Full Text].
-
Byrne JH,
Kandel ER
(1996)
Presynaptic facilitation revisited: state and time dependence.
J Neurosci
16:425-435[Abstract/Free Full Text].
-
Chen Z
(1996)
Simple modifications to increase specificity of the 5'RACE procedure.
Trends Genet
12:87-88[Web of Science][Medline].
-
Christianson DW,
Alexander RS
(1990)
Another catalytic triad?
Nature
346:225[Medline].
-
Cleary LJ,
Schwartz JH
(1987)
Movement of newly synthesized membrane by fast transport along the axon of an identified Aplysia neuron.
J Comp Neurol
263:92-105[Medline].
-
Colman PM,
Jansonius JN,
Matthews BW
(1972)
The structure of thermolysin: an electron density map at 2-3 A resolution.
J Mol Biol
70:701-724[Web of Science][Medline].
-
Connelly JC,
Skidgel RA,
Schulz WW,
Johnson AR,
Erdos EG
(1985)
Neutral endopeptidase 24.11 in human neutrophils: cleavage of chemotactic peptide.
Proc Natl Acad Sci USA
82:8737-8741[Abstract/Free Full Text].
-
D'Adamio L,
Shipp MA,
Masteller EL,
Reinherz EL
(1989)
Organization of the gene encoding common acute lymphoblastic leukemia antigen (neutral endopeptidase 24.11): multiple miniexons and separate 5' untranslated regions.
Proc Natl Acad Sci USA
86:7103-7107[Abstract/Free Full Text].
-
Deschodt-Lanckman M,
Michaux F,
DePrez E,
Abramovicz D,
Vanherweghem JL,
Goldman M
(1989)
Increased serum levels of endopeptidase 24.11 ("enkephalinase") in patients with end-stage renal failure.
Life Sci
45:133-141[Web of Science][Medline].
-
Devault A,
Lazure C,
Nault C,
Le Moual H,
Seidah NG,
Chretien M,
Kahn P,
Powell J,
Mallet J,
Beaumont A,
Roques BP,
Crine P,
Boileau G
(1987)
Amino acid sequence of rabbit kidney neutral endopeptidase 24.11 (enkephalinase) deduced from a complementary DNA.
EMBO J
6:1317-1322[Web of Science][Medline].
-
Devault A,
Sales V,
Nault C,
Beaumont A,
Roques BP,
Crine P,
Boileau G
(1988)
Exploration of the catalytic site of endopeptidase 24.11 by site-directed mutagenesis. Histidine residues 583 and 587 are essential for catalysis.
FEBS Lett
231:54-58[Web of Science][Medline].
-
Dion N,
Le Moual H,
Crine P,
Boileau G
(1993)
Kinetic evidence that His-711 of neutral endopeptidase 24.11 is involved in stabilization of the transition state.
FEBS Lett
318:301-304[Web of Science][Medline].
-
Dion N,
Le Moual H,
Fournié-Zaluski MC,
Roques BP,
Crine P,
Boileau G
(1995)
Evidence that Asn542 of neprilysin (EC 3.4.24.11) is involved in binding of the P2' residue of substrates and inhibitors.
Biochem J
311:623-627.
-
Felsenstein J
(1993)
In: PHYLIP (phylogeny inference package) 3.5.1c. Seattle, WA: University of Washington.
-
Fiore L,
Meunier JM
(1979)
Synaptic connections and functional organization in Aplysia buccal ganglia.
J Neurobiol
10:13-29[Web of Science][Medline].
-
Fournié-Zaluski MC,
Soleilhac JM,
Turcaud S,
Laï-Kuen R,
Crine P,
Beaumont A,
Roques BP
(1992)
Development of [125I]RB104, a potent inhibitor of neutral endopeptidase 24.11, and its use in detecting nanogram quantities of the enzyme by "inhibitor gel electrophoresis."
Proc Natl Acad Sci USA
89:6388-6392[Abstract/Free Full Text].
-
Gardner D
(1971)
Bilateral symmetry and interneuronal organization in the buccal ganglia of Aplysia.
Science
173:550-553[Abstract/Free Full Text].
-
Goldberg DJ,
Ambron RT
(1986)
Consequences of partial axotomy for production of neurotransmitter vesicles and routing of rapidly transported membrane glycoproteins in the axonal tree.
J Neurosci
6:1712-1718[Abstract].
-
Gros C,
Souque A,
Schwartz JC,
Duchier J,
Cournot A,
Baumer P,
Lecomte JM
(1989)
Protection of atrial natriuretic factor against degradation: diuretic and natriuretic responses after in vivo inhibition of enkephalinase (EC 3.4.24.11).
Proc Natl Acad Sci USA
86:7580-7584[Abstract/Free Full Text].
-
Gros C,
Souque A,
Schwartz JC
(1990)
Inactivation of atrial natriuretic factor in mice in vivo: crucial role of enkephalinase (EC 3.4.24.11).
Eur J Pharmacol
179:45-56[Medline].
-
Hangauer DG,
Monzigo AF,
Matthews BW
(1984)
An interactive computer graphics study of thermolysin-catalysed peptide cleavage and inhibition by N-carboxymethyl dipeptides.
Biochemistry
23:5730-5741[Medline].
-
Holmes MA,
Matthews BW
(1982)
Structure of thermolysin refined at 1.6 A resolution.
J Mol Biol
160:623-639[Web of Science][Medline].
-
Johnson AR,
Coalson JJ,
Ashton J,
Larumbide M,
Erdos EG
(1985)
Neutral endopeptidase in serum samples of patients with adult respiratory distress syndrome. Comparison with angiotensin-converting enzyme.
Am Rev Respir Dis
132:1262-1267[Web of Science][Medline].
-
Kandel ER
(1979)
In: Behavioral biology of Aplysia. San Francisco: W. H. Freeman.
-
Kenny AJ
(1993)
Endopeptidase-24.11: putative substrate and possible roles.
Biochem Soc Trans
21:663-668.
-
Kenny AJ,
Maroux S
(1982)
Topology of microvillar membrane hydrolases of kidney and intestine.
Physiol Rev
62:91-128[Free Full Text].
-
Kenny AJ,
Stephenson SL,
Turner AJ
(1987)
Cell surface peptidases.
In: Mammalian ectoenzymes (Kenny AJ,
Turner AJ,
eds), pp 169-210. London: Elsevier Science Publishers.
-
Kim YA,
Shriver B,
Quay T,
Hersh LB
(1992)
Analysis of the importance of arginine 102 in neutral endopeptidase (enkephalinase) catalysis.
J Biol Chem
267:12330-12335[Abstract/Free Full Text].
-
Kreiner T,
Kirk MD,
Scheller RH
(1987)
Cellular and synaptic morphology of a feeding motor circuit in Aplysia.
J Comp Neurol
264:311-325[Web of Science][Medline].
-
Kupfermann I
(1974)
Feeding behavior in Aplysia: a simple system for the study of motivation.
Behav Biol
10:1-26[Web of Science][Medline].
-
Kyte J,
Doolittle RF
(1982)
A simple method for displaying the hydropathic character of a protein.
J Mol Biol
157:105-132[Web of Science][Medline].
-
Lee S,
Zambas E,
Marsh WL,
Redman CM
(1991)
Molecular cloning and primary structure of Kell blood group protein.
Proc Natl Acad Sci USA
88:6353-6357[Abstract/Free Full Text].
-
Le Moual H,
Devault A,
Roques BP,
Crine P,
Boileau G
(1991)
Identification of glutamic acid 646 as a zinc-coordinating residue in endopeptidase-24.11.
J Biol Chem
266:15670-15674[Abstract/Free Full Text].
-
Le Moual H,
Roques BP,
Crine P,
Boileau G
(1993)
Substitution of potential metal-coordinating amino acid residues in the zinc-binding site of endopeptidase 24.11.
FEBS Lett
324:196-200[Medline].
-
Le Moual H,
Dion N,
Roques BP,
Crine P,
Boileau G
(1994)
Asp650 is crucial for catalytic activity of neutral endopeptidase 24.11.
Eur J Biochem
221:475-480[Web of Science][Medline].
-
Lloyd PE
(1988)
Fast axonal transport of modulatory neuropeptides from central ganglia to components of the feeding system in Aplysia.
J Neurosci
8:3507-3514[Abstract].
-
Lloyd PE,
Frankfurt M,
Stevens P,
Kupfermann I,
Weiss KR
(1987)
Biochemical and immunocytological localization of the neuropeptides FMRFamide, SCPA, SCPB, to neurons involved in the regulation of feeding in Aplysia.
J Neurosci
7:1123-1132[Abstract].
-
Marie-Claire C,
Ruffet E,
Antonczak S,
Beaumont A,
O'Donohue M,
Roques BP,
Fournié-Zaluski MC
(1997)
Evidence by site-directed mutagenesis that arginine 203 of thermolysin and arginine 717 of neprilysin (neutral endopeptidase) play equivalent critical roles in substrate hydrolysis and inhibitor binding.
Biochemistry
36:13938-13945[Medline].
-
Maroux S
(1987)
Structural and topological aspects.
In: Mammalian ectoenzymes (Kenny AJ,
Turner AJ,
eds), pp 15-45. London: Elsevier Science Publishers.
-
Martin KC,
Casadio A,
Huixiang Z,
Yaping E,
Rose JC,
Chen M,
Bailey CH,
Kandel ER
(1997)
Synapse specific long-term facilitation of Aplysia sensory to motor synapses: a function for local protein synthesis in memory storage.
Cell
91:927-938[Web of Science][Medline].
-
Martins MA,
Shore SA,
Gerard NP,
Gerard C,
Drazen JM
(1990)
Peptidase modulation of the pulmonary effects of tachykinins in tracheal superfused guinea pig lungs.
J Clin Invest
85:170-176.
-
McKelvy JF,
Blumberg S
(1986)
Inactivation and metabolism of neuropeptides.
Annu Rev Neurosci
9:415-434[Medline].
-
Miller MW,
Alevizos A,
Cropper EC,
Kupfermann I,
Weiss KR
(1992)
Distribution of buccalin-like immunoreactivity in the central nervous system and peripheral tissues of Aplysia californica.
J Comp Neurol
320:182-195[Web of Science][Medline].
-
Miller MW,
Beuchausen S,
Cropper EC,
Eisenger K,
Stamm S,
Vilim FS,
Vitek A,
Zajc A,
Kupfermann I,
Brosius J,
Weiss KR
(1993a)
The buccalin-related neuropeptides: isolation and characterization of an Aplysia cDNA clone encoding a family of peptides cotransmitters.
J Neurosci
13:3346-3357[Abstract].
-
Miller MW,
Beuchausen S,
Vitek A,
Stamm S,
Kupfermann I,
Brosius J,
Weiss KR
(1993b)
The myomodulin-related neuropeptides: characterization of a gene encoding a family of peptides cotransmitters in Aplysia.
J Neurosci
13:3358-3367[Abstract].
-
Miller MW,
Rosen SC,
Schissel SL,
Cropper EC,
Kupfermann I,
Weiss WR
(1994)
A population of SCP-containing neurons in the buccal ganglion of Aplysia are radula mechanoafferents and receive excitation of central origin (1994).
J Neurosci
14:7008-7023[Abstract].
-
Owens DF,
Menon JG,
Rothman BS
(1992)
Structure-activity relationship of neurotransmitter alpha-bag cell peptide on Aplysia LUQ neurons: implications regarding its inactivation in the extracellular space.
J Neurobiol
23:656-670[Medline].
-
Panoskaltsis-Mortari A,
Bucy RP
(1995)
In situ hybridization with digoxigenin-labeled RNA probes: facts and artifacts.
Biotechniques
18:300-307[Web of Science][Medline].
-
Roderick SL,
Fournié-Zaluski MC,
Roques BP,
Matthews BW
(1989)
Thiorphan and retro-thiorphan display equivalent interactions when bound to crystalline thermolysin.
Biochemistry
28:1493-1497[Medline].
-
Roques BP,
Fournié-Zaluski MC,
Soroca E,
Lecomte JM,
Malfroy B,
Llorens C,
Schwartz JC
(1980)
The enkephalinase inhibitor thiorphan shows antinociceptive activity in mice.
Nature
288:286-288[Medline].
-
Roques BP,
Noble F,
Daugé V,
Fournié-Zaluski MC,
Beaumont A
(1993)
Neutral endopeptidase 24.11: structure, inhibition, and experimental and clinical pharmacology.
Pharmacol Rev
45:87-146[Web of Science][Medline].
-
Rothman BS,
Mayeri E,
Scheller RH
(1985)
The bag cell neurons of Aplysia as a possible peptidergic multitransmitter system: from genes to behavior.
In: Gene expression in brain (Zomzely-Neurath C,
Walker WA,
eds), pp 235-274. New York: Wiley.
-
Rothman BS,
Dekruyff S,
Talebian M,
Menon JG,
Squire CR,
Yeh CH,
Lee TD
(1992)
Aplysia peptide neurotransmitters beta-bag cell peptide, Phe-Met-Arg-Phe-amide, and small cardioexcitatory peptide B are rapidly degraded by a leucine amino-like activity in hemolymph.
J Biol Chem
267:25135-25140[Abstract/Free Full Text].
-
Ruchon AF,
Marcinkiewicz M,
Siegfried G,
Tenenhouse HS,
Desgroseillers L,
Crine P,
Boileau G
(1998)
PEX mRNA is localized in developing mouse osteoblasts and odontoblasts.
J Histochem Cytochem
48:459-468[Free Full Text].
-
Saitou N,
Nei M
(1987)
The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Mol Biol Evol
4:406-425[Abstract].
-
Saleh TM,
Kombian SB,
Zidichouski JA,
Pittman QJ
(1996)
Peptidergic modulation of synaptic transmission in the parabrachial nucleus in vitro: importance of degradative enzymes in regulating synaptic efficacy.
J Neurosci
16:6046-6055[Abstract/Free Full Text].
-
Sanger F,
Nicklen S,
Coulson AR
(1977)
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463-5467[Abstract/Free Full Text].
-
Seymour AA,
Abboa-Offei BE,
Smith PL,
Mathers PD,
Asaad MM,
Rogers WL
(1995)
Potentiation of natriuretic peptides by neutral endopeptidase inhibitors.
Clin Exp Pharmacol Physiol
22:63-69[Web of Science][Medline].
-
Shipp MA,
Stephano GB,
D'Adamio L,
Switzer SN,
Howard FD,
Sinisterra J,
Scharrer B,
Reinhertz EL
(1990)
Downregulation of enkephalin-mediated inflammatory responses by CD10/neutral endopeptidase 24.11.
Nature
347:394-396[Medline].
-
Shipp MA,
Stephano GB,
Switzer SN,
Griffin JD,
Reinhertz EL
(1991)
CD10 (CALLA)/neutral endopeptidase 24.11 modulates inflammatory peptide-induced changes in neutrophil morphology, migration, and adhesion proteins and is itself regulated by neutrophil activation.
Blood
78:1834-1841[Abstract/Free Full Text].
-
Soleilhac JM,
Lafuma C,
Porcher JM,
Auburtin G,
Roques BP
(1996)
Characterization of a soluble form of neutral endopeptidase-24.11 (EC 3.4.24.11) in human serum: enhancement of its activity in serum of underground miners exposed to coal dust particles.
Eur J Clin Invest
26:1011-1017[Medline].
-
Sossin WS,
Kirk MD,
Scheller RH
(1987)
Peptidergic modulation of neuronal circuitry controlling feeding in Aplysia.
J Neurosci
7:671-681[Abstract].
-
Squire CR,
Talebian M,
Menon JG,
Dekruyff S,
Lee TD,
Shively JE,
Rothman BS
(1991)
Leucine aminopeptidase-like activity in Aplysia hemolymph rapidly degrades biologically active alpha-bag cell peptide fragments.
J Biol Chem
266:22355-22363[Abstract/Free Full Text].
-
Steward O
(1997)
mRNA localization in neurons: a multipurpose mechanism?
Neuron
18:9-12[Web of Science][Medline].
-
Tam LT,
Engelbrecht S,
Talent JM,
Gracy RW,
Erdos EG
(1985)
The importance of disulfide bridges in human endopeptidase (enkephalinase) after proteolytic cleavage.
Biochem Biophys Res Commun
133:1187-1198[Web of Science][Medline].
-
The HYP consortium
(1995)
A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets.
Nat Genet
11:130-135[Web of Science][Medline].
-
Thompson EB,
Schwartz JH,
Kandel ER
(1976)
A radioautographic analysis in the light and electron microscope of identified Aplysia neurons and their processes after intrasomatic injection of L-(3H)fucose.
Brain Res
112:251-281[Web of Science][Medline].
-
Thompson JD,
Higgins DG,
Gibson TJ
(1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22:4673-4680[Abstract/Free Full Text].
-
Thompson JS,
Morice AH
(1996)
Neutral endopeptidase inhibitors and the pulmonary circulation.
Gen Pharmacol
27:581-585[Medline].
-
Turner AJ
(1986)
Processing and metabolism of neuropeptides.
Essays Biochem
22:69-119[Web of Science][Medline].
-
Turner AJ,
Murphy LJ
(1996)
Molecular pharmacology of endothelin converting enzymes.
Biochem Pharmacol
51:91-102[Web of Science][Medline].
-
Turner AJ,
Tanzawa K
(1997)
Mammalian membrane metallopeptidases: NEP, ECE, KELL, and PEX.
FASEB J
11:355-364[Abstract].
-
Turner AJ,
Hooper NM,
Kenny AJ
(1987)
Metabolism of neuropeptides.
In: Mammalian ectoenzymes (Kenny AJ,
Turner AJ,
eds), pp 211-248. London: Elsevier Science Publishers.
-
Van Minnen J
(1994)
RNA in the axonal domain: a new dimension in neuronal functioning?
Histochem J
26:377-391[Web of Science][Medline].
-
Vijayaraghavan J,
Scicli AG,
Carretero OA,
Slaughter C,
Moomaw C,
Hersh LB
(1990)
The hydrolysis of endothelins by neutral endopeptidase 24.11 (enkephalinase).
J Biol Chem
265:14150-14155[Abstract/Free Full Text].
-
Weaver LH,
Kester WR,
Matthews BW
(1977)
A crystallographic study of the complex of phosphoramidon with thermolysin. A model for the presumed catalytic transition state and for the binding of extended substances.
J Mol Biol
114:119-132[Web of Science][Medline].
-
Webb DJ,
Monge JC,
Rabelink TJ,
Yanagisawa M
(1997)
Endothelin: new discoveries and rapid progress in the clinic.
Trends Pharmacol Sci
19:5-8.
-
Weiss KR,
Chiel HJ,
Koch U,
Kupfermann I
(1986)
Activity of an identified histaminergic neuron, and its possible role in arousal of feeding behavior in semi-intact Aplysia.
J Neurosci
6:2403-2415[Abstract].
-
Wickham L,
DesGroseillers L
(1991)
A bradykinin-like neuropeptide precursor gene is expressed in neuron L5 of Aplysia californica.
DNA Cell Biol
10:249-258[Medline].
-
Wilhelm JE,
Vale RD
(1993)
RNA on the move: the mRNA localization pathway.
J Cell Biol
2:269-274.
Copyright © 1999 Society for Neuroscience 0270-6474/99/19114280-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
D. E. Wood and M. P. Nusbaum
Extracellular Peptidase Activity Tunes Motor Pattern Modulation
J. Neurosci.,
May 15, 2002;
22(10):
4185 - 4195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Guo, S. Liu, R. F. Spurney, and L. D. Quarles
Analysis of recombinant Phex: an endopeptidase in search of a substrate
Am J Physiol Endocrinol Metab,
October 1, 2001;
281(4):
E837 - E847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Wood, W. Stein, and M. P. Nusbaum
Projection Neurons with Shared Cotransmitters Elicit Different Motor Patterns from the Same Neural Circuit
J. Neurosci.,
December 1, 2000;
20(23):
8943 - 8953.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|