 |
 Previous Article | Next Article 
The Journal of Neuroscience, June 15, 1999, 19(12):4772-4777
Regulation of the UNC-18-Caenorhabditis elegans
Syntaxin Complex by UNC-13
Toshihiro
Sassa1,
Shin-ichi
Harada2,
Hisamitu
Ogawa4,
James B.
Rand5,
Ichiro N.
Maruyama6, and
Ryuji
Hosono3
1 Department of Nutrition, School of Medicine,
Tokushima University, Tokushima 770-0042, Japan, 2 Center
for Biomedical Research and Education and 3 Department of
Physical Information, Faculty of Medicine, Kanazawa University,
Kanazawa, Ishikawa 920-8640, Japan, 4 Department of
Biology, Fujita Health University, Aichi 470-1192, Japan,
5 Program in Molecular and Cell Biology, Oklahoma Medical
Research Foundation, Oklahoma City, Oklahoma 73104, and
6 Department of Cell Biology, The Scripps Research
Institute, La Jolla, California 92037
 |
ABSTRACT |
The Caenorhabditis elegans unc-13,
unc-18, and unc-64 genes are required for
normal synaptic transmission. The UNC-18 protein binds to the
unc-64 gene product C. elegans syntaxin
(Ce syntaxin). However, it is not clear how this protein
complex is regulated. We show that UNC-13 transiently interacts with
the UNC-18-Ce syntaxin complex, resulting in rapid
displacement of UNC-18 from the complex. Genetic and biochemical
evidence is presented that UNC-13 contributes to the modulation of the
interaction between UNC-18 and Ce syntaxin.
Key words:
UNC-18; Ce syntaxin; UNC-13; SNARE complex; synaptic vesicle; exocytosis
| |
INTRODUCTION |
At chemical synapses,
neurotransmitter release is accomplished by a series of interactive
steps between synaptic vesicles and plasma membrane, including
targeting, docking, fusion, and exocytosis (Kelly, 1993 ; Bennett and
Scheller, 1994; Südhof, 1995; Martin, 1997). The regulatory
targeting of synaptic vesicles to the plasma membrane requires a core
complex of neuronal synaptic proteins, soluble
N-ethylmaleimide-sensitive factor attachment protein (SNAP)
receptors, termed SNAREs (Söllner et al., 1993). These
synaptic proteins include syntaxin, vesicle-associated membrane protein
(VAMP) (also called synaptobrevin), and SNAP-25 (Calakos et al.,
1994; Chaoman et al., 1994; Pevsner et al., 1994a; Hayashi et
al., 1994).
In Caenorhabditis elegans, many potential presynaptic genes
have been identified (Rand and Russell, 1984, 1985; Hosono et al.,
1989; Hosono and Kamiya, 1991; Maruyama and Brenner, 1991; Nonet et
al., 1993, 1998; Jorgensen et al., 1995; Miller et al., 1996).
unc-18, one such candidate gene, is expressed in a
neuron-specific manner, and its gene product (UNC-18) is present in
presynaptic terminals (Hosono et al., 1992; Gengyo-Ando et al., 1993;
Ogawa et al., 1998). The UNC-18 homolog n-Sec1 tightly
associates with syntaxin (Hata et al., 1993; Pevsner et al.,
1994b; Kee et al., 1995). n-Sec1 is not a component of either
the 7S VAMP-SNAP-25 or 20S
SNARE-SNAP-N-ethylmaleimide-sensitive factor
protein complex, although syntaxin is present in both complexes
(Pevsner et al., 1994b; Garcia et al., 1995). Binding of
syntaxin to the component of the 7S complex is diminished in the
presence of increasing concentrations of n-Sec1 (Pevsner et al.,
1994a). From these results, it is hypothesized that n-Sec1 is
associated with syntaxin before synaptic vesicle docking and may be a
negative regulator of vesicle docking and/or release.
This hypothesis predicts that C. elegans null mutations of
the unc-18 gene would lead to increased neurotransmitter
release. However, unc-18 mutations have been shown to be
associated with decreased transmitter release and with the accumulation
of neurotransmitters at the presynaptic terminal (Hosono et al., 1987,
1989). These results are also consistent with observations in yeast
(Novick et al., 1980). To examine these apparently conflicting
observations, we analyzed unc-18 mutants. We (Ogawa et al.,
1998) and others (Saifee et al., 1998) found that unc-64
encodes the mammalian syntaxin 1A homolog C. elegans
(Ce syntaxin) and the product could bind to UNC-18.
We further searched for factors interacting with UNC-18 and found the
unc-13 gene product. UNC-13 has a potential phorbol ester
binding domain (C1) and two probable calcium phospholipid-binding domains (C2) (Ahmed et al., 1992; Brose et al., 1995; Kazanietz et al.,
1995). These structural features suggest that UNC-13 contributes to the
calcium- and diacylglycerol-dependent regulation of transmitter release. We therefore performed detailed genetic and biochemical analyses of the three genes and their products. We report here UNC-13
dissociates UNC-18 from the UNC-18-Ce syntaxin complex. We
propose that the three genes have a critical role in synaptic vesicle
docking and subsequent processes. During the preparation of our
manuscript, a factor from rat cerebral cytosol was found (tomosyn) that
dissociates Munc-18 from the syntaxin-1a-Munc-18 complex (Fujita et
al., 1998). Tomosyn differs from the mammalian UNC-13 homolog Munc-13
in protein structure.
| |
MATERIALS AND METHODS |
General handling. Culture, maintenance, and genetic
manipulation were essentially as described previously (Brenner,
1974).
C. elegans strains. The wild-type Bristol strain N2 and the
following mutations were used: LGI, unc-13
(n2823, e51) and dpy-5 (e61); LGIII, unc-64 (e246) and
dpy-18 (e364); LGX, unc-18
(cn347, md118, md183,
md193, b403, md1054,
md1412, md1417, e234,
md120, md1307, md1401, e81,
md1264, md426, md1094) and
lon-2 (e678).
Construction of unc double mutants. Double mutants of
unc-13, unc-18, and unc-64 were tested
by making hermaphrodites that are homozygous in one unc
mutation (u1) and heterozygous in another (u2). The u2 mutation is
linked to a Dpy or a Lon morphological marker (a). Self-progeny from
these hermaphrodites (u1/u1; + +/u2 a) were inspected to determine survival.
Analyses of mutant phenotypes and ACh assay. Locomotion,
trichlorfon resistance, and assays of ACh level of mutant alleles were
performed as described previously (Harada et al., 1994).
Sequence determination. To determine the mutation
sites, total RNA from mutant alleles was isolated by the CsCl gradient
method (Ogawa et al., 1998). Poly(A+) RNAs were
purified by Oligotex-dT30 (TaKaRa, Tokyo, Japan). The cDNAs
amplified by reverse transcription-PCR were cloned into the
pBluescript SK(+) vector and sequenced by the dye primer method or by
the dideoxy chain termination method. The following oligonucleotides were used to amplify cDNAs and to determine their sequences: CE1845, GAAAGCTTATGTCACTCAAACAAATCGTTGGGCA (+1 to +26); CE1846, TCTCTAGATCATATGTCACGCGGTTTGTTC (+1755 to +1776);
CE18SEQ2, AGCGTCGAGTTTTTGCTCAA (+608 to +627) ; CE18SEQ3,
TGAGAGAAATGTTGAGCTCG (+579 to +598) ; CE18SEQ4,
AACAGAATCAATCTGAGGCG (+1207 to +1226); and CE18SEQ5, GTTGATGGTGCCACTTTTGA (+1161 to +1180). Bold indicates a
HindIII site, and italics indicates a XbaI site.
Preparation of recombinant proteins. pGEX vectors (Pharmacia
Biotech, Uppsala, Sweden) for the bacterial expression of
glutathione S-transferase (GST) fusion proteins
containing the cytoplasmic domain of Ce syntaxin (amino
acids 1-267) and the N-terminal domain of UNC-13 (UNC-13N)
(amino acids 1-266) were constructed using PCR procedures. Expression
of GST fusion proteins and subsequent purification using
glutathione-Sepharose 4B beads were performed as described previously
(Ogawa et al., 1996). Soluble recombinant syntaxin or UNC-13N was
purified from the GST fusion protein by cleavage with Factor Xa or
thrombin, respectively, and these digestions were stopped by the
addition of 1 mM phenylmethylsulfonyl fluoride (PMSF).
UNC-18 was prepared using a baculovirus expression system as described
previously (Ogawa et al., 1996). Protein concentrations were estimated
by Coomassie blue staining of protein bands after SDS-PAGE with bovine
serum albumin as a standard.
In vitro binding assay. UNC-18 and GST fusion protein
(either Ce syntaxin or UNC-13N) were incubated in 50 mM HEPES, pH 7.4, 150 mM NaCl, 0.5 mM PMSF, 10 µg/ml leupeptin, and 0.1% NP-40 for 1 hr at
4°C, and then glutathione-Sepharose 4B beads were added. After a 1 hr incubation, the beads were washed three times with 1 ml of 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% NP-40,
and 0.5 mM PMSF and then washed once with 50 mM
Tris-HCl, pH 8.0. Proteins were eluted with 10 mM reduced
glutathione and then analyzed by Western blotting using antibodies to
UNC-18 after SDS-PAGE. The immunoreactive bands were visualized by
enhanced chemiluminescence (ECL system; Amersham, Arlington Heights,
IL). The binding ability was quantitated by using NIH Image software.
Proteins were also visualized by autoradiography of
125I-labeled sheep anti-rabbit secondary antisera
(Amersham) and by phosphorimaging.
| |
RESULTS |
Sequences and phenotypes of the unc-18 mutants
Mutation sites of the unc-18 alleles other than
cn347 had not been determined (Hosono et al., 1992). We
therefore analyzed all available unc-18 alleles by DNA
sequencing and compared their phenotypes. Interestingly, mutations were
all clustered in exons IV and IX (Fig.
1A). Three mutations,
md193, md426, and md1094, were found
to result from Tcl insertions as observed in cn347. Four
mutations, md118, md1264, md1307, and
md120, were small DNA rearrangements, including deletions
and insertions. The remaining five mutations were single base changes;
three mutations, e234, e81, and
md1412, had stop codons, and two, md1401 and
b403, had amino acid substitutions.
View larger version (17K):
[in this window]
[in a new window]
|
Figure 1.
Sequences of unc-18 mutant alleles.
A, Map of sequenced mutations at the
unc-18 locus. Boxes indicate coding
regions. B, The altered codons and positions of amino
acid substitutions are shown.
|
|
All unc-18 mutations had uncoordinated behaviors, abnormal
ACh accumulation, resistance to AChE inhibitors, and a significantly slower growth rate than wild type. However, the severity of the behavioral impairment of mutants varied; that is, some of these mutants
were quite uncoordinated (Table 1).
Putative null alleles (stop codons or frameshifts) showed the strongest
phenotype; that is, the animals were severely paralyzed, strongly
resistant to trichlorfon, and accumulated ACh. We were especially
interested in two missense mutations described in greater detail below;
md1401 leads to mild behavioral defects, whereas
b403 leads to a severe mutant phenotype.
Genetic interactions between unc-13,
unc-18, and unc-64 mutations
Genetic, molecular, and biochemical analyses suggest that
unc-13, unc-18, and unc-64 gene
products are all involved in neurotransmitter release (Miller et al.,
1996). We therefore constructed double mutants to examine possible
genetic interactions among these three genes. For these constructions,
we used a mild (md1094) and a severe
(cn347) allele of unc-18, a mild
(n2823) and a severe (e51) allele of
unc-13, and the relatively mild (e246)
allele of unc-64 (Table 2).
The double mutants of unc-13 and unc-18 had
phenotypes suggesting approximate additivity. Thus, the strain
containing the two mild mutations was somewhat more severe than either
of the single mutants, but not markedly so, and the strain containing the two severe mutations was lethal. In contrast, although the unc-64 (e246) allele is relatively mild,
it greatly enhanced the phenotype of mutation with which it was
combined, i.e., the unc-64 (e246) mutation
in combination with either the mild unc-13 or the mild
unc-18 mutations led to a severely paralyzed phenotype and,
when combined with either the severe unc-13 allele or the severe unc-18 allele, led to a synthetic lethality.
In addition, the extent of the elevation of ACh levels in double
mutants is not comparable with the extent of the loss of coordination.
Although the ACh level is only slightly elevated in unc-13
(n2823) animals, in the double mutants with
unc-18 (md1094) and unc-64
(e246), it was quite high.
UNC-18 binds to an UNC-13 fragment in addition to
Ce syntaxin
We have shown previously that UNC-18 binds to the
unc-64 gene product Ce syntaxin (Ogawa et al.,
1996, 1998). We tested interaction between UNC-13, UNC-18, and
Ce syntaxin. In a preliminary work, proteins were
visualized both by ECL and 125I-labeled secondary antisera
(T. Sassa, unpublished results). Here, we present the former results
because significant difference between the methods was not observed. A
half-maximal binding (ED50) of UNC-18 to
Ce syntaxin occurred at 0.08 µM. Furthermore,
we found that UNC-13N also bound to UNC-18 (Fig.
2), with an ED50 of 0.04 µM. Parallel incubations with GST alone demonstrated that the binding was dependent on the fusion protein (data not shown).
View larger version (41K):
[in this window]
[in a new window]
|
Figure 2.
Binding of UNC-18 to UNC-13 and to
Ce syntaxin. One micromolar GST alone or the GST fusion
proteins consisting of the UNC-13N (top column,
GST-UNC13N) or the cytoplasmic domain of
Ce syntaxin (bottom column, GST-Ce
syntaxin) was incubated with concentrations of UNC-18 ranging
from 0.02 to 0.5 µM (A) and from
0.02 to 0.1 µM (B). Amounts of
bound UNC-18 were determined by SDS-PAGE and immunoblotting. The ECL
signal intensities were quantitated using NIH Image software, and the
total value of each band was converted to picomoles on standard
curves for UNC-18. The results are the mean of three experiments.
Top, Immunoblot results from a single experiment.
Ce syntaxin,  ; UNC-13N,  .
|
|
The binding ability of mutant UNC-18 proteins derived from
b403 and md1401 was also tested. The
md1401 UNC-18 protein bound normally to both UNC-13N and
Ce syntaxin, whereas UNC-18 from the b403 mutant
was defective in binding to Ce syntaxin and had greatly
reduced ability to bind to UNC-13N (Fig.
3).
View larger version (25K):
[in this window]
[in a new window]
|
Figure 3.
Binding of md1401 and
b403 mutant UNC-18 proteins to GST-Ce
syntaxin (B) and GST-UNC-13N
(C). A, The protein structure of
UNC-18. The mutation sites of md1401 at 133 and
b403 at 549 are indicated by arrows.
B, C, Amounts of UNC-18 in bound forms
(top) and used for the incubations
(bottom) were determined by Western blotting.
|
|
An UNC-13 fragment can regulate the UNC-18-Ce
syntaxin complex
Ce syntaxin did not interfere with the formation of the
UNC-13N-UNC-18 complex (Fig.
4A). However, the
amount of UNC-18-Ce syntaxin complex decreased when
incubated with UNC-13N (Fig. 4B). These results
suggest that UNC-13N either functions as an inhibitor of the complex
formation or causes the displacement of UNC-18 from the complex.
View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
Interaction of UNC-13N, UNC-18, and
Ce syntaxin. A, Binding of UNC-18 to
GST-UNC-13N in the presence of Ce syntaxin. UNC-18 (0.2 µM) and GST-UNC-13N (1.2 µM) were incubated
with the indicated concentrations of Ce syntaxin.
B, UNC-18 (0.2 µM) and
GST-Ce syntaxin (1.0 µM) were incubated
with the indicated amount of UNC-13N. The value of each band of UNC-18
bound to immobilized GST-UNC-13N (A) or
GST-Ce syntaxin (B) was
expressed relative to that bound without Ce syntaxin
(A) or UNC-13N (B).
Top, Immunoblot results from a single experiment.
|
|
To know whether UNC-13N displaces UNC-18, we assayed the amount of
UNC-18 released in the soluble fraction (Fig.
5A). The amount of UNC-18 in
the soluble fraction increased depending on the concentration of added
UNC-13N. We then assayed the velocity of the release of UNC-18 from the
UNC-18-Ce syntaxin complex. The release is very rapid, with
most UNC-18 released within 1 min (Fig. 5B). The amount of
UNC-18 released from the complex by UNC-13N (2 µM) is the
same as that released by adding 10 mM reduced glutathione
(data not shown).
View larger version (37K):
[in this window]
[in a new window]
|
Figure 5.
Dissociation of UNC-18 from the
UNC-18-Ce syntaxin complex by UNC-13N.
A, UNC-18-Ce syntaxin complex
immobilized to GST beads was prepared using UNC-18 (0.2 µM) and GST-Ce syntaxin (1.0 µM) as described in Materials and Methods. The GST beads
were incubated with the indicated concentrations of UNC-13N at 30°C
for 10 min. B, Time course of the displacement of UNC-18
by UNC-13N. The UNC-18-GST-Ce syntaxin complex was
incubated with UNC-13N (2.0 µM) at 30°C and then
centrifuged at the indicated times. The concentration of the released
UNC-18 in the supernatant was expressed relative to the concentration
of the released UNC-18 when the complex was incubated with 10 mM reduced glutathione.
|
|
| |
DISCUSSION |
Some synaptic genes, such as cha-1, snb-1,
unc-17, and unc-64, are lethal if they are
completely defective (Rand, 1989; Alfonso et al., 1993; Nonet et al.,
1998; Saifee et al., 1998). In contrast, null mutations of
snt-1 are viable but uncoordinated (Nonet et al., 1993). The
unc-18 gene appears to fall into the latter category because
null mutations, although causing severe paralysis, were viable.
To explore the function of the unc-18 gene, we first
analyzed the different mutations and their mutant phenotypes. Among
them, we found two missense mutations, md1401 and
b403. These mutation sites are located at the N and C
terminal of UNC-18, respectively. However, although both of these
mutations occur in predicted  -helices, they have very different
amino acid substitutions, and they lead to quite different phenotypes.
The N-terminal mutation md1401 is mildly defective, whereas
the C-terminal mutation b403 shows a severely defective
phenotype. Based on the computational three-dimensional structure, N. Hayashi (Fujita Health University, Aichi, Japan) predicted that
the conformation is lost by the E-to-K substitution in the
b403 mutation (personal communication). I-to-V
substitution in the md1401 mutation may not bring out great
conformational alteration, and the ability of the mutant UNC-18 to bind
Ce syntaxin and UNC-13 appears intact.
We have shown that UNC-18 has the ability to bind to UNC-13N, in
addition to Ce syntaxin. A mammalian UNC-18 homolog,
Munc-l8, can bind the Doc2 and Mint proteins, in addition to syntaxin
(Okamoto and Südhof, 1997; Verhage et al., 1997). Therefore,
UNC-18 also may bind to multiple proteins. The function of such
interactions is not clear at present. It is noteworthy that UNC-18,
once bound to Ce syntaxin, can lose its syntaxin-binding
ability by interaction with UNC-13N. This step may be important for the
late stage of synaptic transmission, including fusion and/or
exocytosis. We suggest that UNC-18 induces a conformational change in
Ce syntaxin, which then acquires the ability to bind
synaptic vesicles after the UNC-13N-dependent release of UNC-18 from
the complex. The mammalian homolog Munc-13-1 has been shown to bind
both syntaxin and Doc2 (Betz et al., 1997; Orita et al., 1997). Assays
with full-length UNC-13 and UNC-18 were not done, however, because we
have not yet established a method for preparation of the recombinant UNC-13 corresponding to the C-terminal region. Betz et al. (1997) performed coprecipitation and yeast two-hybrid experiments with Munc-13-1 and Munc-18-1. However, they did not observe the interaction.
We have found that UNC-13N, UNC-18, and Ce syntaxin form
complexes with each other, although stable complex formation between UNC-13N and Ce syntaxin was not observed. We were unable to
detect a ternary complex consisting of the three proteins. Instead, we observed that the UNC-18-Ce syntaxin complex is dissociated
by UNC-13N. Recently, Betz et al. (1998) found that UNC-13 has binding ability to phorbor ester and diacylglycerol. Therefore, it is likely
that UNC-13 activated by either Ca2+ or
diacylglycerol dissociates UNC-18 from the UNC-18-Ce
syntaxin complex.
In summary, we have demonstrated directly that the
UNC-18-Ce syntaxin complex is dissociated by UNC-13N
without forming a stable ternary complex. However, our findings do not
exclude additional roles for the three proteins in synaptic
transmission, given that the three proteins interact with numerous
synaptic factors. For example, the syntaxin-1a-Munc-18 complex is
dissociated by tomosyn (Fujita et al., 1998).
| |
FOOTNOTES |
Received Jan. 15, 1999; revised March 15, 1999; accepted April 5, 1999.
This work was supported in part by a Grant-in-Aid for Scientific
Research from the Ministry of Education, Science, and Culture of Japan,
the Japan Society for the Promotion of Science (Research for the Future
Grant 97L00401) to R.H., and National Institutes of Health Grant
NS31439 to I.N.M. We thank S. Matsudaira and R. Kitamura for technical assistance.
Drs. Sassa and Harada contributed equally to this work.
Correspondence should be addressed to Ryuji Hosono, Department of
Physical Information, Faculty of Medicine, Kanazawa University 5-11-80 Kodatsuno, Kanazawa, Ishikawa 920, Japan.
| |
REFERENCES |
-
Ahmed S,
Maruyama IN,
Kozma R,
Lee J,
Brenner S,
Lim L
(1992)
The Caenorhabditis elegans unc-13 gene product is a phospholipid-dependent high-affinity phorbol ester receptor.
Biochem J
287:995-999.
-
Alfonso A,
Grundahl K,
Duerr JS,
Han HP,
Rand JB
(1993)
The Caenorhabditis elegans unc-17 gene: a putative vesicular acetylcholine transporter.
Science
261:617-619[Abstract/Free Full Text].
-
Bennett MK,
Scheller RH
(1994)
A molecular description of synaptic vesicle membrane trafficking.
Annu Rev Biochem
63:63-100[Web of Science][Medline].
-
Betz A,
Okamoto M,
Benseler F,
Brose N
(1997)
Direct interaction of the rat unc-13 homologue Munc13-1 with the N terminus of syntaxin.
J Biol Chem
272:2520-2526[Abstract/Free Full Text].
-
Betz A,
Ashery U,
Rickmann M,
Augustin I,
Neher E,
Südhof TC,
Rettig J,
Brose N
(1998)
Munc13-1 is a presynaptic phorbol ester receptor that enhances neurotransmitter release.
Neuron
21:123-136[Web of Science][Medline].
-
Brenner S
(1974)
The genetics of Caenorhabditis elegans.
Genetics
77:71-93[Abstract/Free Full Text].
-
Brose N,
Hofmann K,
Hata Y,
Südhof TC
(1995)
Mammalian homo- logues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins.
J Biol Chem
270:25273-25280[Abstract/Free Full Text].
-
Calakos M,
Bennett MK,
Peterson KE,
Scheller RH
(1994)
Protein-protein interactions contributing to the specificity of intracellular vesicular trafficking.
Science
263:1146-1149[Abstract/Free Full Text].
-
Chaoman ER,
An S,
Barton N,
Jahn R
(1994)
SNAP-25, a t-SNARE which binds to both syntaxin and synaptobrevin via domains that may form coiled coils.
J Biol Chem
269:27427-27432[Abstract/Free Full Text].
-
Fujita Y,
Shirataki H,
Sakisaka T,
Asakura T,
Ohya T,
Kotani H,
Yokoyama S,
Nishioka H,
Matsuura Y,
Mizoguchi A,
Scheller RH,
Takai Y
(1998)
Tomosyn: a syntaxin-1-binding protein that forms a novel complex in the neurotransmitter release process.
Neuron
20:905-915[Web of Science][Medline].
-
Garcia E,
McPherson PS,
Chilcote TJ,
Takei K,
De Camilli P
(1995)
rbSec1A and B colocalize with syntaxin 1 and SNAP-25 throughout the axon, but are not in a stable complex with syntaxin.
J Cell Biol
129:105-120[Abstract/Free Full Text].
-
Gengyo-Ando K,
Kamiya Y,
Yamakawa A,
Kodaira K,
Nishiwaki K,
Miwa J,
Hori I,
Hosono R
(1993)
The C. elegans unc-18 gene encodes a protein expressed in motor neurons.
Neuron
11:703-711[Web of Science][Medline].
-
Harada S,
Hori I,
Yamamoto H,
Hosono R
(1994)
Mutations in the unc-41 gene cause elevation of acetylcholine levels.
J Neurochem
63:439-446[Web of Science][Medline].
-
Hata Y,
Slaughter CA,
Südhof TC
(1993)
Synaptic vesicle fusion complex contains unc-18 homologue bound to syntaxin.
Nature
366:347-350[Medline].
-
Hayashi T,
McMahon H,
Yamasaki S,
Binz T,
Hata Y,
Südhof TC,
Niemann H
(1994)
Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on assembly.
EMBO J
13:5051-5061[Web of Science][Medline].
-
Hosono R,
Kamiya Y
(1991)
Additional genes which result in an elevation of acetylcholine levels by mutations in Caenorhabditis elegans.
Neurosci Lett
128:243-244[Web of Science][Medline].
-
Hosono R,
Sassa T,
Kuno S
(1987)
Mutations affecting acetylcholine levels in the nematode Caenorhabditis elegans.
J Neurochem
49:1820-1823[Web of Science][Medline].
-
Hosono R,
Sassa T,
Kuno S
(1989)
Spontaneous mutations of trichlorfon resistance in the nematode Caenorhabditis elegans.
Zool Sci
6:697-708[Web of Science].
-
Hosono R,
Hekimi S,
Kamiya Y,
Sassa T,
Murakami S,
Nishiwaki S,
Miwa J,
Taketo A,
Kodaira K-I
(1992)
The unc-18 gene encodes a novel protein affecting the kinetics of acetylcholine metabolism in the nematode Caenorhabditis elegans.
J Neurochem
58:1517-1525[Web of Science][Medline].
-
Jorgensen EM,
Hartwieg E,
Schuske K,
Nonet ML,
Jin Y,
Horvitz HR
(1995)
Defective recycling of synaptic vesicles in synaptotagmin mutants of Caenorhabditis elegans.
Nature
378:196-199[Medline].
-
Kazanietz MG,
Lewin NE,
Bruns JD,
Blumberg PM
(1995)
Characterization of the cysteine-rich region of the Caenorhabditis elegans protein UNC-13 as a high affinity phorbol ester receptor.
J Biol Chem
270:10777-10783[Abstract/Free Full Text].
-
Kee Y,
Lin RC,
Hsu S-C,
Scheller RH
(1995)
Distinct domains of syntaxin are required for synaptic vesicle fusion complex formation and dissociation.
Neuron
14:991-998[Web of Science][Medline].
-
Kelly RB
(1993)
Storage and release of neurotransmitters.
Cell
72:43-53.
-
Martin TFJ
(1997)
Stages of regulated exocytosis.
Trends Cell Biol
7:271-276.[Medline]
-
Maruyama IN,
Brenner S
(1991)
A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans.
Proc Natl Acad Sci USA
88:5729-5733[Abstract/Free Full Text].
-
Miller KG,
Alfonso A,
Nguyen M,
Crowell JA,
Johnson CD,
Rand JB
(1996)
A genetic selection for Caenorhabditis elegans synaptic transmission mutants.
Proc Natl Acad Sci USA
93:12593-12598[Abstract/Free Full Text].
-
Nonet ML,
Grundahl K,
Meyer BJ,
Rand JB
(1993)
Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin.
Cell
73:1291-1305[Web of Science][Medline].
-
Nonet ML,
Saifee O,
Zhao H,
Rand JB,
Wei L
(1998)
Synaptic transmission deficits in Caenorhabditis elegans synaptobrevin mutants.
J Neurosci
18:70-80[Abstract/Free Full Text].
-
Novick PJ,
Field C,
Schekman R
(1980)
Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway.
Cell
21:205-215[Web of Science][Medline].
-
Ogawa H,
Hayashi N,
Hori I,
Kobayashi T,
Hosono R
(1996)
Expression, purification and characterization of recombinant C. elegans UNC-18.
Neurochem Int
29:553-563[Web of Science][Medline].
-
Ogawa H,
Harada S,
Sassa T,
Yamamoto H,
Hosono R
(1998)
Functional properties of the unc-64 gene encoding a Caenorhabditis elegans syntaxin.
J Biol Chem
273:2192-2198[Abstract/Free Full Text].
-
Okamoto M,
Südhof TC
(1997)
Mints, Munc18-interacting proteins in synaptic vesicle exocytosis.
J Biol Chem
272:31459-31464[Abstract/Free Full Text].
-
Orita S,
Naito A,
Sakaguchi G,
Maeda M,
Igarashi H,
Sasaki T,
Takai Y
(1997)
Physical and functional interactions of DOC2 and Munc13 in Ca2+ dependent exocytotic machinery.
J Biol Chem
272:16081-16084[Abstract/Free Full Text].
-
Pevsner J,
Hsu S-C,
Braun JEA,
Calakos N,
Ting AE,
Bennett MK,
Scheller RH
(1994a)
Specificity and regulation of a synaptic vesicle docking complex.
Neuron
13:353-361[Web of Science][Medline].
-
Pevsner J,
Hsu S-C,
Scheller RH
(1994b)
n-Sec1: a neural-specific syntaxin-binding protein.
Proc Natl Acad Sci USA
91:1445-1449[Abstract/Free Full Text].
-
Rand JB
(1989)
Genetic analysis of the cha-1-unc-17 gene complex in Caenorhabditis.
Genetics
122:73-80[Abstract/Free Full Text].
-
Rand JB,
Russell RL
(1984)
Choline acetyltransferase-deficient mutants of the nematode Caenorhabditis elegans.
Genetics
106:227-248[Abstract/Free Full Text].
-
Rand JB,
Russell RL
(1985)
Molecular basis of drug-resistance mutations in C. elegans.
Psychopharmacol Bull
21:623-630[Web of Science][Medline].
-
Saifee O,
Wei L,
Nonet ML
(1998)
The Caenorhabditis elegans unc-64 encodes a syntaxin that interacts genetically with synaptobrevin.
Mol Biol Cell
9:1235-1252[Abstract/Free Full Text].
-
Söllner T,
Whiteheart SW,
Brunner M,
Erdjument-Bromage H,
Geromanos S,
Tempst P,
Rothman JE
(1993)
SNAP receptors implicated in vesicle targeting and fusion.
Nature
362:318-324[Medline].
-
Südhof TC
(1995)
The synaptic vesicle cycle: a cascade of protein-protein interactions.
Nature
375:645-653[Medline].
-
Verhage MJ,
de Vries KJ,
Roshol H,
Burbach PH,
Gispen WH,
Südhof TC
(1997)
DOC2 proteins in rat brain: complementary distribution and proposed function as vesicular adaptor proteins in early stages of secretion.
Neuron
18:453-461[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19124772-06$05.00/0
This article has been cited by other articles:
|
|
|
|
 
M. E. Graham, M. R. Edwards, L. Holden-Dye, A. Morgan, R. D. Burgoyne, and J. W. Barclay
UNC-18 Modulates Ethanol Sensitivity in Caenorhabditis elegans
Mol. Biol. Cell,
January 1, 2009;
20(1):
43 - 55.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Jewell, E. Oh, S. M. Bennett, S. O. Meroueh, and D. C. Thurmond
The Tyrosine Phosphorylation of Munc18c Induces a Switch in Binding Specificity from Syntaxin 4 to Doc2{beta}
J. Biol. Chem.,
August 1, 2008;
283(31):
21734 - 21746.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Basu, A. Betz, N. Brose, and C. Rosenmund
Munc13-1 C1 Domain Activation Lowers the Energy Barrier for Synaptic Vesicle Fusion
J. Neurosci.,
January 31, 2007;
27(5):
1200 - 1210.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Castillo-Flores, A. Weinberger, M. Robinson, and J. E. Gerst
Mso1 Is a Novel Component of the Yeast Exocytic SNARE Complex
J. Biol. Chem.,
October 7, 2005;
280(40):
34033 - 34041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Seino and T. Shibasaki
PKA-Dependent and PKA-Independent Pathways for cAMP-Regulated Exocytosis
Physiol Rev,
October 1, 2005;
85(4):
1303 - 1342.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Schade, N. K. Reynolds, C. M. Dollins, and K. G. Miller
Mutations That Rescue the Paralysis of Caenorhabditis elegans ric-8 (Synembryn) Mutants Activate the G{alpha}s Pathway and Define a Third Major Branch of the Synaptic Signaling Network
Genetics,
February 1, 2005;
169(2):
631 - 649.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. K. Reynolds, M. A. Schade, and K. G. Miller
Convergent, RIC-8-Dependent G{alpha} Signaling Pathways in the Caenorhabditis elegans Synaptic Signaling Network
Genetics,
February 1, 2005;
169(2):
651 - 670.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. F. Ciufo, J. W. Barclay, R. D. Burgoyne, and A. Morgan
Munc18-1 Regulates Early and Late Stages of Exocytosis via Syntaxin-independent Protein Interactions
Mol. Biol. Cell,
February 1, 2005;
16(2):
470 - 482.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. E. Gladycheva, C. S. Ho, Y. Y. F. Lee, and E. L. Stuenkel
Regulation of syntaxin1A-munc18 complex for SNARE pairing in HEK293 cells
J. Physiol.,
August 1, 2004;
558(3):
857 - 871.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Shirakawa, T. Higashi, A. Tabuchi, A. Yoshioka, H. Nishioka, M. Fukuda, T. Kita, and H. Horiuchi
Munc13-4 Is a GTP-Rab27-binding Protein Regulating Dense Core Granule Secretion in Platelets
J. Biol. Chem.,
March 12, 2004;
279(11):
10730 - 10737.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Yizhar, U. Matti, R. Melamed, Y. Hagalili, D. Bruns, J. Rettig, and U. Ashery
Tomosyn inhibits priming of large dense-core vesicles in a calcium-dependent manner
PNAS,
February 24, 2004;
101(8):
2578 - 2583.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Sheu, E. A. Pasyk, J. Ji, X. Huang, X. Gao, F. Varoqueaux, N. Brose, and H. Y. Gaisano
Regulation of Insulin Exocytosis by Munc13-1
J. Biol. Chem.,
July 18, 2003;
278(30):
27556 - 27563.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Houng, J. Polgar, and G. L. Reed
Munc18-Syntaxin Complexes and Exocytosis in Human Platelets
J. Biol. Chem.,
May 23, 2003;
278(22):
19627 - 19633.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. van Swinderen, L. B. Metz, L. D. Shebester, J. E. Mendel, P. W. Sternberg, and C. M. Crowder
Go{{alpha}} Regulates Volatile Anesthetic Action in Caenorhabditis elegans
Genetics,
June 1, 2001;
158(2):
643 - 655.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. J. Yook, S. R. Proulx, and E. M. Jorgensen
Rules of Nonallelic Noncomplementation at the Synapse in Caenorhabditis elegans
Genetics,
May 1, 2001;
158(1):
209 - 220.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
G. L. Reed, M. L. Fitzgerald, and J. Polgar
Molecular mechanisms of platelet exocytosis: insights into the "secrete" life of thrombocytes
Blood,
November 15, 2000;
96(10):
3334 - 3342.
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. E. Kohn, J. S. Duerr, J. R. McManus, A. Duke, T. L. Rakow, H. Maruyama, G. Moulder, I. N. Maruyama, R. J. Barstead, and J. B. Rand
Expression of Multiple UNC-13 Proteins in the Caenorhabditis elegans Nervous System
Mol. Biol. Cell,
October 1, 2000;
11(10):
3441 - 3452.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
N. Szewczyk, J. Hartman, S. Barmada, and L. Jacobson
Genetic defects in acetylcholine signalling promote protein degradation in muscle cells of Caenorhabditis elegans
J. Cell Sci.,
January 6, 2000;
113(11):
2003 - 2010.
[Abstract]
[PDF]
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
