 |
Previous Article | Next Article 
The Journal of Neuroscience, June 15, 1999, 19(12):4815-4827
The Supporting-Cell Antigen: A Receptor-Like Protein Tyrosine
Phosphatase Expressed in the Sensory Epithelia of the Avian Inner
Ear
Robert P.
Kruger1,
Richard J.
Goodyear1,
P.
Kevin
Legan1,
Mark E.
Warchol2,
Yehoash
Raphael3,
Douglas A.
Cotanche4, and
Guy P.
Richardson1
1 School of Biological Sciences, The University of
Sussex, Falmer, Brighton, BN1 9QG, United Kingdom,
2 Central Institute for the Deaf, St. Louis, Missouri
63110, 3 Kresge Hearing Research Institute, Ann Arbor,
Michigan 48109-0648, and 4 Department of Otolaryngology and
Communication Disorders, The Children's Hospital, Boston Massachusetts
02115
 |
ABSTRACT |
After noise- or drug-induced hair-cell loss, the sensory epithelia
of the avian inner ear can regenerate new hair cells. Few molecular
markers are available for the supporting-cell precursors of the hair
cells that regenerate, and little is known about the signaling
mechanisms underlying this regenerative response. Hybridoma methodology
was used to obtain a monoclonal antibody (mAb) that stains the apical
surface of supporting cells in the sensory epithelia of the inner ear.
The mAb recognizes the supporting-cell antigen (SCA), a protein that is
also found on the apical surfaces of retinal Müller cells, renal
tubule cells, and intestinal brush border cells. Expression screening
and molecular cloning reveal that the SCA is a novel receptor-like
protein tyrosine phosphatase (RPTP), sharing similarity with human
density-enhanced phosphatase, an RPTP thought to have a role in the
density-dependent arrest of cell growth. In response to hair-cell
damage induced by noise in vivo or hair-cell loss caused
by ototoxic drug treatment in vitro, some supporting
cells show a dramatic decrease in SCA expression levels on their apical
surface. This decrease occurs before supporting cells are known to
first enter S-phase after trauma, indicating that it may be a primary
rather than a secondary response to injury. These results indicate that
the SCA is a signaling molecule that may influence the potential of
nonsensory supporting cells to either proliferate or differentiate into
hair cells.
Key words:
receptor protein tyrosine phosphatase; inner ear; hair
cell; supporting cell; development; regeneration
 |
INTRODUCTION |
The sensory epithelia of the inner
ear contain mechanosensitive hair cells that are surrounded and
isolated from each other by nonsensory supporting cells. In the avian
basilar papilla, these two cell types derive from a common embryonic
lineage (Fekete et al., 1998 ), and it is thought that the decision to
become either a hair cell or a supporting cell is made after the
progenitors have left the cell cycle. In the mature bird, the hair
cells are postmitotic, and the supporting cells are essentially
mitotically quiescent (Oesterle and Rubel, 1993 ). After noise- or
drug-induced hair-cell loss, some of the supporting cells reenter the
cell cycle and undergo one or more rounds of cell division, with the progeny then differentiating as either new hair cells or new supporting cells (Corwin and Cotanche, 1988 ; Ryals and Rubel, 1988 ; Raphael, 1992 ,
1993 ; Stone and Cotanche, 1994 ). Supporting cells in the basilar
papilla may also be able to convert directly into hair cells without
reentering the cell cycle after hair-cell loss (Adler and Raphael,
1996 ; Roberson et al., 1996 ), suggesting there could be two different
mechanisms whereby hair cells can be regenerated in the avian inner
ear. However, in both cases, the nonsensory supporting cells are
considered to be the progenitors for the new hair cells.
Hair-cell damage or loss may be the primary stimulus for the onset of
hair-cell regeneration, but little is known about the molecular
mechanisms and signaling pathways that underlie this response. Several
different growth factors have been shown to stimulate supporting-cell
proliferation in cultures of both the avian and mammalian vestibular
epithelia (Yamashita and Oesterle, 1995 : Oesterle et al., 1997 ; Zheng
et al., 1997 ), and immunohistochemical studies have indicated that
fibroblast growth factor (FGF) receptors rapidly appear on the apical
surfaces of supporting cells in the basilar papilla in response to
noise trauma in vivo (Lee and Cotanche, 1996 ). In
vitro studies have also shown that activation of a cyclic AMP
(cAMP)-dependent protein kinase A-mediated signaling pathway can
stimulate a proliferative response in the avian basilar papilla and
that protein kinase A inhibitors can block drug damage-induced cell
proliferation (Navaratnam et al., 1996 ). Thus there is evidence that
both cAMP and growth factor-mediated pathways can control supporting-cell proliferation, but knowledge of the signaling pathways
leading to hair-cell regeneration in vivo is both limited and fragmentary.
We have recently identified a monoclonal antibody (mAb) that
selectively stains the apical surface of supporting cells within the
sensory epithelia of the inner ear. The antigen recognized by this mAb
is referred to as the supporting-cell antigen (SCA), and cDNA cloning
reveals that it is a novel receptor-like protein tyrosine phosphatase
(RPTP) [for recent reviews on RPTPs, see Neel and Tonks (1997) and
Stoker and Dutta (1998) ]. The potential signaling ability of the SCA
and its rapid loss in response to hair-cell damage suggest that it may
influence supporting-cell proliferation or hair-cell differentiation in
the sensory epithelia of the inner ear.
 |
MATERIALS AND METHODS |
Preparation of monoclonal antibody. Lagenar maculae
were dissected from the inner ears of 1- to 3-d-old posthatch chicks in PBS (150 mM NaCl, 10 mM sodium phosphate, pH
7.2) containing 2 mM benzamidine, 10 µM
pepstatin, 1 µg/ml leupeptin, and 0.1 mM phenylmethylsulfonylfluoride, stored under liquid N2 until
required, and used to prepare a crude membrane fraction by differential centrifugation. The membrane fraction was suspended in PBS and used to
immunize a BALB/c mouse. The mouse was injected three times at 1 month
intervals using the material from ~250 lagenar maculae for each
injection. The mouse was then rested for a period of 5 months, boosted
with a membrane fraction prepared from ~350 lagenar maculae, and
7 d later the spleen was used for the preparation of hybridoma
cells using standard techniques (Kohler and Milstein, 1975 ). Animal
procedures were performed in accordance with UK Home Office guidelines.
Sp2/O-Ag14 cells were used as the myeloma cell fusion partner, and
cells were plated in Costar 24-well plates and selected with
hypoxanthine-aminopterin-thymidine growth medium containing 10% Doma
Drive (Immune Systems Ltd., Paignton, UK). Culture supernatants were
screened by immunofluorescence microscopy on cryosections of
formaldehyde-fixed chick inner ear tissues (see below). Clone D37,
secreting monoclonal antibodies that recognize the apical surface of
supporting cells, was cloned by limiting dilution on three separate
successive occasions to yield monoclonal hybridoma cell line D37.19.1.1
secreting mAb D37. Antibody isotype was determined using a mouse mAb
isotyping kit (Life Technologies Ltd., Paisley, UK). mAb D37 is an
IgG2b class antibody with light chains. Concentrations
of IgG in tissue culture supernatants were determined by quantitative
immunoblotting using mouse IgG2b purified from the ascites
fluid of mice carrying plasmocytoma line MOPC 141 (Sigma, Poole, UK) as
a standard.
Immunofluorescence microscopy. To prepare cryostat sections
for screening hybridoma supernatants, tissues were immersion-fixed in
3.7% formaldehyde in 0.1 M sodium phosphate buffer, pH
7.4, for 1 hr at room temperature, washed three times with PBS,
cryoprotected by overnight incubation in PBS containing 30% sucrose at
4°C, and mounted in 1% low melting point agar in PBS containing 18% sucrose. The agar blocks containing the tissue pieces were mounted onto
microtome chucks with TissueTek, frozen with Cryospray 134 (Bright
Instrument Co. Ltd., Huntingdon, UK), and sections 10 µm in thickness
were cut at a temperature of 30°C. The tissue sections were mounted
on gelatin-coated Multitest slides (ICN Biomedicals Ltd., Thame, UK)
and stored at 20°C until use. Hybridoma supernatants were applied
directly to the sections, and the slides were incubated in a humid
chamber overnight. The slides were washed three times in Tris-buffered
saline (TBS) (150 mM NaCl, 10 mM Tris-HCl, pH
7.4), and bound antibodies were detected by staining sequentially with
two layers of FITC-conjugated secondary antibodies, FITC-conjugated
rabbit anti-mouse Ig followed by FITC-conjugated swine anti-rabbit Ig
(Dako, High Wycombe, UK), both diluted 1:100 in TBS containing 10%
horse serum (TBS/HS).
Cryosections for detailed morphological analysis were prepared in the
same manner except that 0.025% glutaraldehyde was added to the
fixative to enhance tissue preservation, and the sections were
preblocked by incubating them in TBS/HS for 1 hr before the addition of
the primary antibody. Whole-mount preparations were fixed in 3.7%
formaldehyde in 0.1 M sodium phosphate for 1 hr at room
temperature, washed in PBS, and then preblocked and permeabilized in
TBS/HS containing 0.1% Triton X-100 for 1 hr before use.
Polyclonal rabbit antibodies to the tight junction-associated protein
cingulin were a kind gift from Dr. Sandra Citi (Universita' di Padova, Italy) (Citi et al., 1988 ). These antibodies stain the tight junctions around the apex of the cells and were used to clearly define the boundaries between adjacent cells. Monoclonal IgG1 antibody
to the 275 kDa hair-cell antigen (HCA) has been described previously (Richardson et al., 1990 ). For double labels with monoclonal anti-HCA and mAb D37, after labeling with a mixture of the two hybridoma supernatants both diluted 1:10 in TBS/HS, samples were incubated sequentially in (1) a mixture of FITC-conjugated sheep anti-mouse IgG2b (Serotec, Kidlington, UK) and unlabeled rabbit
anti-mouse IgG1 (Zymed, Cambridge, UK), (2) FITC-conjugated
donkey anti-sheep Ig (Sigma), and (3) rhodamine-conjugated swine
anti-rabbit Ig. For double labels with mAb D37 and rabbit
anti-cingulin, after labeling with mAb D37 supernatant (1:10 dilution)
containing rabbit anti-cingulin at a dilution of 1:1000, the samples
were incubated sequentially in (1) rhodamine-conjugated swine
anti-rabbit Ig, (2) FITC-conjugated sheep anti-mouse
IgG2b, and (3) FITC-conjugated donkey anti-sheep Ig.
To triple-label with mAb D37, monoclonal anti-HCA, and rabbit
anti-cingulin, after labeling with a mixture of the two monoclonal
supernatants (both at 1:10 dilution) containing rabbit anti-cingulin at
a dilution of 1:1000, the samples were incubated sequentially in (1) a
mixture of FITC-conjugated sheep anti-mouse IgG2b and
unconjugated rabbit anti-mouse IgG1, (2) FITC-conjugated donkey anti-sheep Ig, and (3) rhodamine-conjugated swine anti-rabbit Ig. This procedure enabled the HCA and cingulin to be
observed simultaneously through the rhodamine channel and the SCA to be
observed through the FITC channel. All secondary antibodies were used
at a dilution of 1:100 in TBS/HS. To visualize F-actin, tetramethyl
rhodamine isothiocyanate-phalloidin was added to the secondary
antibodies at a concentration of 20 ng/ml. To improve permeability of
the anti-cingulin and secondary antibodies in whole mounts, all
solutions additionally contained 0.1% Triton X-100. As a control for
the immunofluorescence procedure with mAb D37, samples were stained
with an irrelevant mouse IgG2b (MOPC 141) at a
concentration of 5 µg/ml, a concentration 2.5-fold higher than that
present in the diluted mAb D37 tissue culture supernatant.
Immunoelectron microscopy. Inner ear and eye tissues were
dissected in PBS and immersion-fixed in 3.7% formaldehyde/0.025% glutaraldehyde in 0.1 M sodium phosphate buffer for 1 hr at
room temperature. Tissue samples were then washed three times with PBS,
preblocked with TBS/HS for 1 hr, and incubated in mAb D37 tissue
culture supernatant (1:10 dilution) overnight at 4°C. Samples were
then washed extensively with TBS/0.05% Tween, incubated in rabbit
anti-mouse IgG2b diluted 1:100 in TBS/HS/0.05% Tween
overnight at 4°C, washed again with TBS/0.05% Tween, and incubated
in 10 nm gold-conjugated rabbit anti-mouse Ig (British BioCell
International Ltd., Cardiff, UK) overnight at 4°C. After gold
labeling, samples were washed five times with TBS/0.5% Tween, five
times with PBS, fixed with 2.5% glutaraldehyde in 0.1 M
sodium cacodylate buffer, pH 7.4 for 1 hr, washed with cacodylate
buffer, and post-fixed with 1% OsO4 in 0.1 M
sodium cacodylate buffer for 1 hr. Samples were then washed briefly in
H2O, dehydrated through a series of ascending
concentrations of ethanol, equilibrated with propylene oxide, and
embedded in Epon 812 resin. Blocks were cured for 2 d at 60°C
and sectioned at a thickness of 90 nm. Sections were counterstained
with uranyl acetate and lead citrate and viewed in a Hitachi
transmission electron microscope. Samples incubated either in hybridoma
medium that had not been used for cell growth or irrelevant monoclonal
supernatant (mAb E40) (Goodyear and Richardson, 1999 ) diluted 1:10 were
used as controls for the immunogold-labeling procedure.
Western blotting. Frozen tissue samples were thawed on ice,
homogenized, and sequentially extracted in 1 ml vol of ice-cold TBS,
high-salt buffer (1.0 M NaCl, 10 mM Tris-HCl,
pH 7.4), low-salt buffer (10 mM Tris-HCl, pH 7.4), and
Triton X-100 (1% Triton X-100 in 10 mM Tris-HCl, pH 7.4).
All buffers contained a mixture of protease inhibitors (2 mM benzamidine, 10 µM pepstatin, 1 µg/ml leupeptin, 1 mM phenylmethylsulfonylfluoride, and 2 mM N-ethyl maleimide). The homogenates were
centrifuged for 15 min at 100,000 rpm in a TLA100 rotor using a Beckman
TLS benchtop ultracentrifuge to produce soluble, high-salt-soluble,
low-salt-soluble, Triton X-100-soluble, and insoluble fractions. The
soluble, high-salt-soluble, and low-salt-soluble fractions were
precipitated by adding TCA to a final concentration of 20% and leaving
them on ice for 30 min. The Triton X-100-soluble fraction was
precipitated by adding 9 vol of cold acetone and holding it at 20°C
for 30 min. Precipitated proteins were collected by centrifugation,
solubilized in reducing SDS-PAGE sample buffer, boiled for 4 min, and
run on 7.5% acrylamide gels. To visualize proteins the gels were
stained with Coomassie brilliant blue. For immunoblotting, the
separated proteins were transferred to nitrocellulose by semi-dry
electrophoresis. The nitrocellulose blots were preblocked with 3%
Marvel in TBS containing 0.05% Tween for 1 hr, incubated overnight
with rabbit antibodies (1:100 dilution in preblock solution) or mAb D37
supernatant, washed with TBS/0.05% Tween, and then incubated in
alkaline phosphatase-conjugated rabbit anti-mouse Ig or alkaline
phosphatase-conjugated goat anti-rabbit Ig for 2 hr. After washes with
TBS/0.05% Tween, blots were rinsed briefly with alkaline phosphatase
buffer (0.1 M NaCl, 0.05 M
MgCl2, 0.1 M Tris-HCl, pH 9.5) and
reacted with alkaline phosphatase buffer containing 0.34 mg/ml
nitroblue tetrazolium and 0.175 mg/ml 5-bromo-4-chloro-3-indolyl
phosphate. Tissue culture supernatants containing irrelevant monoclonal
antibody (mAb E40) (Goodyear and Richardson, 1999 ) or rabbit preimmune
serum diluted 1:100 were used as controls for the immunoblotting procedures.
Preparation of a chick intestine cDNA library.
Poly(A)+ RNA was prepared from the small intestine of
2-d-old posthatch chicks using a Quick-Prep micro kit (Pharmacia,
Milton Keynes, UK). First-strand cDNA synthesis was primed with a
mixture of random hexamers (Promega, Southampton, UK). The resultant
single-strand cDNA was rendered double-stranded and, after the addition
of EcoRI adaptors, ligated into the EcoRI site of
the Zap II vector (Stratagene, Cambridge, UK). The cDNA library was
amplified before screening.
Isolation of cDNA clones. A total of 1.5 × 106 clones was immunoscreened with mAb D37 using
alkaline phosphatase-conjugated goat anti-mouse IgG to detect
immunopositive plaques. A single phage clone was isolated through three
successive rounds of immunoscreening and converted to a plasmid
(pBluescript SK+) by helper phage rescue. Additional
clones encoding the entire open reading frame were isolated by
high-stringency screening with 32P-labeled DNA probes (see
below) derived from the initial immunopositive clone by PCR
amplification with sequence-specific primers.
Preparation of 32P-labeled probes. PCR products
were generated from cDNA clones, separated by gel electrophoresis,
purified from the gel using GeneClean (Stratatech Scientific, Luton,
UK) and random primer-labeled (Feinberg and Vogelstein, 1984 )
with 32P-dCTP using a MegaPrime labeling kit (Amersham
International, Little Chalfont, UK). Unincorporated label was removed
using Sephadex G50 columns (Pharmacia), and the probes were denatured
before they were added to the hybridization mix.
DNA sequencing and analysis. Double-stranded plasmid DNA was
prepared using Wizard Plus minipreps (Promega) and sequenced with T7
DNA polymerase by the dideoxy-chain termination method of Sanger et al.
(1977) using T3, T7, and specific oligonucleotide primers. Some plasmid
DNA samples were also sequenced on an ABI 370A automatic sequencer.
Sequence analysis was performed using the DNA Star package (DNA Star,
London, UK). Protein and DNA sequence database searches were performed
using the BLAST network service at the National Center for
Biotechnology Information (Altschul et al., 1997 ).
Preparation of antibodies to an extracellular domain bacterial
fusion protein. Primers with an internal XhoI
restriction site (forward F1: CGTACAGGCTCGAGGTTAGGAATGCTACT; reverse
R1: CTCCCCTCGAGTTGACTCTGTTGCTT) were used to amplify a 1635 bp
fragment from cDNA clone A corresponding to amino acids 294-838 in the
extracellular domain of the SCA. The PCR product was separated by gel
electrophoresis in a Tris borate-EDTA-agarose gel, recovered from the
gel using GeneClean, digested with XhoI, extracted with
phenol/chloroform, and precipitated with ethanol. The PCR product was
ligated into a XhoI cut, dephosphorylated pET15b vector
(Novagen, Abingdon, UK) using T4 DNA ligase, and transformed into
Escherichia coli XL1-blue cells. A plasmid containing the
cDNA insert in the correct orientation was transformed into E. coli BL21 cells, and expression of the His-tagged fusion protein was induced with iso-propyl -D-thiogalactopyranoside.
The fusion protein was purified from bacterial lysates using His-bind
resin (Novagen), dialyzed against H2O, lyophilized, and
resuspended in PBS. A rabbit was immunized with ~0.5 mg of the fusion
protein on four separate occasions at 1 month intervals, using
Freund's complete adjuvant for the first immunization and Freund's
incomplete adjuvant for the later boosts. Antibodies were
affinity-purified on a column of the fusion protein coupled to
Sepharose 4B (Sigma).
Immunoprecipitation. Triton X-100-soluble fractions were
prepared from frozen samples of small intestine, kidney, retina, and
utricular maculae as described above for Western blotting using EDTA (2 mM) as an additional protease inhibitor and sodium phosphate (20 mM, pH 7.4) in place of Tris-HCl to buffer
the solutions. Protein content of the extracts was determined using the
bicinchoninic acid protein assay reagent (Pierce, Chester, UK). Rabbit
immune serum to the extracellular domain fusion protein or preimmune serum (4 µl) was added to 400 µl aliquots of the extracts, each containing 72 µg of protein, and the samples were incubated overnight at 4°C. Immune complexes were collected by adding a 20 µl vol of
protein A-agarose beads [prepared as a 1:1 (v/v) suspension in the
Triton X-100 extraction buffer] and incubating the samples for 1 hr at
4°C on a rotator. The beads were then washed three times with cold
PBS containing 1% Triton X-100 and one time with cold PBS and then
boiled in a 15 µl vol of reducing SDS-PAGE sample buffer. Aliquots of
the eluted samples (10 µl) were run on 7.5% polyacrylamide gels,
transferred to nitrocellulose membranes, and immunoblotted with the mAb
D37 supernatant as described above.
RT-PCR. Poly(A)+ mRNA was isolated from chick small
intestine, kidney, retina, and utricular macula as described above and used to synthesize randomly primed first-strand cDNA using avian myeloblastosis virus reverse transcriptase (Promega). The resultant cDNA was used in RT-PCR reactions with oligonucleotide primer pairs
designed to amplify bases 2887-4310 of the cDNA sequence (forward F2:
CATATGCTCGAGATGACAGCCACCTATGTGAC; reverse R2:
GGATCCTCGAGCTTTCTCATGCACAGACAAC). The 50 µl reactions contained 50 pmol each primer and were hot-started with 4 U of TaqExpress (Genpak
Ltd., Brighton, UK) followed by 35 cycles of 94°C for 15 sec, 57°C
for 15 sec, and 68°C for 90 sec. The reactions were terminated with a
5 min incubation at 68°C. PCR reactions were analyzed by agarose gel
electrophoresis followed by transfer to Hybond-N membrane (Amersham
International) and UV cross-linking. Membranes were then hybridized
with a 32P-labeled DNA probe derived by PCR of cDNA clone C
with primers lying internal to those used for the RT-PCR reactions
(forward F3: ACACAATGGAGAGCCACACA; reverse R3: TCCATGACACACTGGTTTAG).
Hybridization of the membranes and washing to high stringency were
performed as described by the manufacturer (Amersham International). In addition the 1.4 kbp product was purified using GeneClean and directly
sequenced on an ABI 370A automatic sequencer to confirm its identity in
all four tissues.
Preparation of noise- and drug-damaged auditory papillae.
One-week-old chicks were exposed to 120 dB sound pressure level (SPL)
octave band noise centered around a frequency of 2.0 kHz for 14 hr and
killed 1 hr after the end of the exposure period [see Raphael (1993)
for a description of the noise exposure setup]. Also, 2-week-old
chicks were exposed to a 900 Hz tone at 120 dB SPL for 12 hr and killed
4 hr after the end of the exposure period [for details, see Cotanche
et al. (1995) ]. Pieces of skull containing the labyrinth were
immersion-fixed as described above, basilar papillae were dissected,
and whole-mount preparations were double-labeled with monoclonal
anti-HCA and mAb D37, or triple-labeled with monoclonal anti-HCA, mAb
D37, and cingulin, as described earlier. Papillae from a total of eight
noise-damaged animals and three age-matched controls were examined. The
noise exposure procedures and animal handling were approved by the
University of Michigan's Committee on the Use and Care of Animals
(UCUCA, approval 6981A) and the Institutional Animal Care and Use
Committee at The Children's Hospital (Boston, MA) and were performed
in a manner consistent with the National Institutes of Health
Guide for Care and Use of Laboratory Animals.
Basilar papillae from 14-d-old posthatch chicks were dissected in
Medium 199 with HBSS and additional HEPES buffer and placed in
MatTek culture wells in Medium 199 with Earle's salts supplemented with 10% fetal bovine serum. To induce hair-cell loss, neomycin was
added to a final concentration of either 0.2 or 1.0 mM.
Cultures were maintained for 24 hr in vitro at 37°C in an
atmosphere of 95% air/5% CO2, washed with
serum-free medium, and fixed in 4% paraformaldehyde buffered with 0.1 M sodium phosphate, pH 7.2, for 30 min. Cultures were then
washed in PBS and prepared for cryosectioning as described above, and
20-µm-thick sections were cut in a plane parallel to the apical
surface of the papilla. Sections were triple-labeled for the HCA, SCA,
and cingulin as described above. A total of eight papillae exposed to
1.0 mM neomycin, three exposed to 0.2 mM
neomycin, and eight unexposed controls were examined.
 |
RESULTS |
mAb D37 recognizes a Triton X-100-soluble protein of ~220 kDa
present on the apical surface of supporting cells
Whole mounts of the posthatch basilar papilla double-labeled with
mAb D37 and monoclonal anti-HCA reveal that mAb D37 specifically stains
the narrow, compacted apical surfaces of the supporting cells that
surround each hair cell but not the apical surfaces of the hair cells
(Fig. 1a,a'). Cryosections of
the cochlear duct that have been double-labeled with mAb D37 and
rhodamine- phalloidin show that the apical surface of the
basilar papilla is intensely stained by the antibody (Fig.
1b,b'). Labeling is also observed on the apical surfaces
of the homogene cells and, to a much lower extent, on the lumenal
surface of the cells in the tegmentum vasculosum (Fig. 1b).
Cryosections also indicate that mAb D37 labeling is restricted to the
apical surface of cells in the cochlear duct; staining is not observed
on the basolateral membranes of cells in these epithelia. mAb D37 also
reacts with the apical surfaces of supporting cells in the vestibular
epithelia of the inner ear, where the supporting-cell surfaces are
larger and less regular in shape and size than they are in the basilar
papilla (Fig. 1c,c').

View larger version (148K):
[in this window]
[in a new window]
|
Figure 1.
a, a', A whole-mount preparation of
the basilar papilla double-labeled with mAb D37
(a) and monoclonal anti-hair cell antigen
(a'). The image is focused on the apical surface of the
epithelium, in an area from the inferior region of the papilla where
the short hair cells are located. MAb D37 stains the narrow compacted
surfaces of the supporting cells that surround each hair cell. The
anti-HCA mAb stains the base of the hair bundle and most of the apical,
nonstereociliary surface of the cell except for a small patch lying
behind the hair bundle where the kinocilium is located. b,
b', A cryosection of the basilar papilla double-labeled with
mAb D37 (b) and rhodamine-phalloidin
(b') to reveal the distribution of the SCA and F-actin,
respectively. Note how the surface of the basilar papilla
(BP) is intensely stained by mAb D37. Staining is also
observed on the surfaces of the homogene cells
(H). The lumenal surface of the tegmentum
vasculosum (TV) is only very weakly labeled.
c, c', A whole-mount preparation of the utricular macula
double-labeled with mAb D37 to reveal the distribution of the SCA
(c) and rabbit anti-cingulin to distinguish the
boundaries of the cells (c'). The apical surfaces of the
hair cells (HC) are not labeled by mAb D37 and appear as
dark holes (c). Scale bars: a,
a', c, c', 10 µm;
b, b', 100 µm.
|
|
The mAb D37 reacts with a protein band of 220 kDa (Fig.
2) on immunoblots of protein fractions
prepared from the lagenar macula, a vestibular organ found at the end
of the cochlear duct. Immunoreactivity is not detected in either the
soluble or low-salt-soluble fractions. Traces of immunoreactive protein
can be detected in the high-salt-soluble fraction, and a large
proportion of the 220 kDa protein is soluble in the nonionic detergent
Triton X-100. However, significant amounts of the protein are found in
the insoluble fraction that remains after extraction with Triton X-100
(Fig. 2). Because the 220 kDa protein recognized by mAb D37 is
localized on the apical surfaces of supporting cells within the sensory
epithelia of the inner ear, it is referred to as the SCA.

View larger version (77K):
[in this window]
[in a new window]
|
Figure 2.
a, b, Coomassie brilliant
blue-stained gel (a) and an immunoblot stained
with mAb D37 (b) of soluble
(1), high-salt-soluble (2),
low-salt-soluble (3), Triton X-100-soluble
(4), and insoluble (5)
fractions prepared from lagenar maculae. Lanes 1 and
5 contain protein from the equivalent of two lagenar
maculae; lanes 2-4 contain protein from 10 lagenar
maculae.
|
|
mAb D37 also recognizes the apical membranes of epithelial cells in
kidney, gut, and retina
Cryosections of brain, gizzard, heart, intestine, kidney, liver,
lung, skeletal muscle, and retina were screened for immunoreactivity with mAb D37. Staining was not detected in brain, gizzard, heart, liver, lung, or muscle. In the intestine, kidney, and retina strong immunoreactivity was observed (Fig.
3b-d). As in the basilar
papilla (Fig. 3a), the staining seen in these tissues with
mAb D37 is associated with the apical surfaces of the epithelia (Fig.
3b-d). In the kidney and intestine, mAb D37 stains the
brush borders (Fig. 3b,c), and in the retina it stains the
external limiting membrane (Fig. 3d). Specific
immunostaining was not observed when cryosections of basilar papilla,
kidney, intestine, and retina were stained with an irrelevant mouse
IgG2b monoclonal antibody at a concentration 2.5-fold
higher than that estimated to be present in the diluted mAb D37
supernatants (Fig. 3e-h).

View larger version (101K):
[in this window]
[in a new window]
|
Figure 3.
Immunofluorescence micrographs
(a-d) and the corresponding phase-contrast images
(a'-d') of cryosections from the basilar papilla
(a), kidney (b), intestine
(c), and retina (d) stained
with mAb D37. In a, the surfaces of the supporting cells
in the basilar papilla give a honeycomb staining pattern. In
b, the brush borders of tubules in the kidney are
stained but the glomerulus (G) is unstained. In
c, the brush borders of the intestinal villi
(V) are stained, and in d,
the external limiting membrane (E) marking the
boundary of the outer nuclear layer is stained. e-h,
Immunofluorescence micrographs of cryosections of basilar papilla
(e), kidney (f),
intestine (g), and retina
(h) stained with an irrelevant IgG2b
mAb, MOPC 141. Scale bar, 50 µm (applies to
a-h).
|
|
Immunoelectron microscopy reveals that the epitope recognized by mAb
D37 is located on the external surface of the plasma membrane (Fig.
4). In the ear, the antigen is associated
with the microvillar and nonmicrovillar membrane of the supporting-cell surface (Fig. 4a). The SCA is not present on the kinocilia
of the supporting cells (Fig. 4a). In the retina, the SCA is
distributed along the microvilli of the Müller cells that
surround the photoreceptors to form the external limiting membrane
(Fig. 4b). Gold labeling of supporting cell surfaces and
Müller cell microvilli was not observed when the primary antibody
was omitted or irrelevant mAb supernatant was used in place of mAb D37.

View larger version (200K):
[in this window]
[in a new window]
|
Figure 4.
a, b, Electron
micrographs of the utricular macula (a) and
retina (b) immunolabeled with mAb D37, rabbit
anti-mouse IgG2b, and 10 nm gold-conjugated goat
anti-rabbit Ig before imbedding. a, Gold particles are
associated with the apical surfaces of the supporting cells
(S) and their microvilli
(V) but not the kinocilium
(K). The apical surface of the hair cell
(H) is unlabeled. b, In the
retina the gold particles are present on the long microvilli emanating
from the Müller cells (M) but are
not found on the inner segments of the photoreceptors
(IS). Scale bars: a, 200 nm;
b, 400 nm.
|
|
Immunoblots of Triton X-100-soluble fractions prepared from the lagenar
macula, kidney, intestine, and retina reveal that mAb D37 recognizes
bands of similar but not identical apparent molecular mass in all four
tissues (Fig. 5a). The size of
the band varies from 205 kDa in the retina to 270 kDa in the intestine, as determined by back-extrapolating from the highest molecular size
marker used (myosin, 205 kDa). Single bands are consistently observed
in fractions prepared from maculae (220 kDa), retina (205 kDa), and
kidney (230 kDa), and up to three bands can be detected in the
intestinal fraction (270, 240, 220 kDa). These differences in the
apparent molecular mass of the antigen found in the different tissue
types are observed consistently from one preparation to another and may
result from variations in post-translational modification in the
different tissues or from the presence of alternative splice
variants.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 5.
a, b, Immunoblots of
Triton X-100-soluble fractions prepared from the lagenar macula
(1), retina (2), kidney
(3), and intestine (4) that
have been stained with mAb D37 (a) and
affinity-purified rabbit antibodies raised to a bacterially expressed
fusion protein containing part of the extracellular domain of the SCA
(b). Arrowheads indicate the
positions of markers with molecular masses (from top to
bottom) of 205, 116, 96, 66, and 45 kDa.
c-f, Immunofluorescence micrographs of cryosections
from the basilar papilla (c), retina
(d), kidney (e), and small
intestine (f) that have been stained with
the affinity-purified rabbit antibody directed against the
extracellular domain of the SCA. The staining patterns are identical to
those observed with the mAb D37 shown in Figure 3. Scale bar, 50 µm.
g, Immunoblot stained with mAb D37 of proteins
immunoprecipitated from Triton X-100-soluble fractions of lagenar
macula (1, 2), retina (3, 4),
kidney (4, 5), and small intestine (7, 8)
with rabbit preimmune serum (lanes 1, 3, 5, 7) or
rabbit immune serum to the extracellular domain of the SCA
(lanes 2, 4, 6, and 8).
Arrowheads indicate the positions of markers with
molecular masses (from top to bottom) of
205, 116, and 96 kDa.
|
|
The supporting-cell antigen is a receptor-like protein
tyrosine phosphatase
An immunoscreen of a randomly primed chick intestine cDNA library
with mAb D37 resulted in the isolation of a single immunopositive clone, clone A, which is 2.3 kbp in size and contains an uninterrupted open reading frame. A 1635 bp 5' fragment of this clone was used to
generate a bacterial fusion protein of 545 amino acids for the
preparation of polyclonal antibodies. The rabbit immune serum directed
against this fusion protein stained bands of 205-270 kDa with
electrophoretic mobilities the same as those recognized by mAb D37 in
Triton X-100-soluble fractions prepared from the lagenar macula,
retina, kidney, and intestine (Fig. 5a,b). This rabbit
antiserum also stained cryosections of the inner ear, retina, kidney,
and intestine in a manner identical to mAb D37 (Fig.
5c-f). Although mAb D37 did not react with this
fusion protein in immunoblotting (data not shown), the proteins
immunoprecipitated from Triton X-100-soluble fractions of lagenar
macula, retina, kidney, and small intestine by the polyclonal rabbit
serum directed against the fusion protein all reacted with mAb D37 in
immunoblots (Fig. 5g). These results provide good evidence
that clone A, isolated with mAb D37, encodes the SCA.
Clones encoding the entire open reading frame of the SCA were isolated
by screening the library with DNA probes generated by PCR from the 5'
and 3' ends of clone A. Two additional clones, clones AA and C, were
obtained. The three clones provide a composite cDNA sequence of 5515 bp, with an open reading frame of 4218 bp (Fig.
6a). The open reading frame
encodes a protein of 1406 amino acids (Fig. 6b) with a
calculated molecular mass of 154.2 kDa. Database searches show that the
SCA is a member of the RPTP family, sharing 49.8% maximal
identity with murine Byp (Kuramochi et al., 1996 ), 48.7% with rat
vascular density-enhanced phosphatase-1 (rDEP-1) (Borges et
al., 1996 ), 45.7% with human density-enhanced phosphatase
(DEP-1) (Östman et al., 1994 ), and 35.3% with human PTP
(HPTP ) (Krueger et al., 1990 ). Other RPTPs have considerably less
similarity to the SCA. The derived amino acid sequence of the SCA
begins with a hydrophobic signal sequence and a region of 58 amino
acids that shows no significant similarity to other known proteins.
This region is followed by eight highly similar fibronectin type III
(FN-III) repeats (Figs. 6b,
7), a membrane proximal region, a
hydrophobic transmembrane domain, and a cytoplasmic domain containing
the 11 amino acid consensus sequence [(I/V)HCXAGXXR(S/T)G] for
tyrosine phosphatase activity (Fig. 6b,c). This catalytic site is highly conserved and shares 100% identity with the catalytic sites of human DEP-1 and mouse Byp.

View larger version (97K):
[in this window]
[in a new window]
|
Figure 6.
a, A schematic diagram illustrating
the relative sizes and positions of the three cDNA clones sequenced to
obtain the complete coding region of the SCA. Filled horizontal
bars indicate the open reading frame, and open
horizontal bars represent the noncoding regions. The
region used to make a bacterial fusion protein construct is indicated
by the horizontal gray bar. b, The cDNA
and derived amino acid sequences for the SCA. The hydrophobic leader
sequence is underlined, consensus N-glycosylation sites
are marked with , the transmembrane domain is
underlined in bold, the charged stop
transfer sequence is double underlined, and the
conserved catalytic site is shaded. The boundaries of
the eight FN-III repeats are marked. Positions of the primers used to
amplify the fragment used to generate a bacterial fusion protein from
the extracellular domain (F1, R1), to amplify a region
comprising the intracellular domain and the membrane proximal region by
RT-PCR (F2, R2), and to prepare a probe for Southern
screening the resultant RT-PCR products (F3, R3) are
indicated. c, Diagram illustrating the structural
organization of the SCA. The hydrophobic signal sequence and the
transmembrane domain are indicated by black vertical
bars. The lightly shaded rectangle indicates the
N-terminal region with no similarity to other proteins, the FN-III
repeats are represented by dark ovoids, and the membrane
proximal region with similarity to DEP-1 and Byp is shown by the
cross-hatching. The intracellular domain is shown by the
open ovoid, and the position of the catalytic site
within this region is indicated by a vertical
line.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7.
Sequence alignments of the eight fibronectin type
III repeats in the extracellular domain of the SCA. Conserved residues
are shaded gray. Numbers to the
left and right indicate amino acid
numbers.
|
|
RT-PCR with primers designed to amplify a 1.4 kbp region of the cDNA
encoding the entire membrane proximal region and the intracellular
domain of the protein indicate that the mRNA for the SCA found in the
inner ear, retina, kidney, and small intestine is the product of the
same gene (Fig. 8). The major PCR product amplified in each of these four tissues was of the size predicted from
the intestinal cDNA sequence. These PCR products hybridized at high
stringency with an internal probe derived from the intestinal cDNA
clone C. Direct sequencing of these PCR products yielded identical
sequences from all four tissues. RT-PCR with a primer pair designed to
amplify the entire extracellular domain including the region encoding
the FN-III repeats also amplified a major fragment with the size
predicted from the intestinal cDNA clone, but with yields that were
insufficient for direct sequencing.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 8.
Southern blot of products obtained by RT-PCR of
mRNA from the utricular macula (lanes 1-3), retina
(lanes 4-6), kidney (lanes
8-10), and gut (lanes 11-13) using primers
designed to amplify a 1.4 kbp product comprising the entire
intracellular domain and the membrane proximal region of the SCA.
Positions of markers are indicated in kilobase pairs. Lanes 1, 4, 8, and 11 are controls without RNA;
lanes 2, 5, 9, and 12 are controls
without RT; and lanes 3, 6, 10, and 13
are the products of complete RT-PCR reactions. Size markers were run in
lane 7.
|
|
Supporting cells downregulate the SCA in response to noise- and
drug-induced hair-cell damage
In whole-mount preparations of noise-damaged basilar papillae that
have been double-labeled with monoclonal anti-HCA and mAb D37, it can
be seen that the intensity of the mAb D37 labeling on the
supporting-cell surfaces decreases in areas of hair-cell damage (Fig.
9). These areas could be readily
identified by the disruption of the normal regular mosaic of hair and
supporting cells, by supporting cells exhibiting varying degrees of
expansion of their apical surface, and the presence of hair cells with
small punctate spots of HCA around their perimeter (Fig. 9). Outside the noise-damaged patch, supporting-cell surfaces have characteristic, narrow, compacted surfaces that stain fairly uniformly for the SCA
(Fig. 9a,a'). On the edge of and within the damaged patch, some of the supporting cells exhibit substantially lower levels of
labeling than neighboring supporting cells (Fig.
9b,b',c,c').

View larger version (171K):
[in this window]
[in a new window]
|
Figure 9.
Whole-mount preparations from noise-damaged
basilar papillae that have been double-labeled with mAb D37 (a,
b) and monoclonal anti-HCA (a', b'), or
triple-labeled with mAb D37 (c) and a mixture of
monoclonal anti-HCA and cingulin (c'). Images in
a and b are from a papilla exposed to
octave band noise centered around 2.0 kHz at 120 dB SPL for 14 hr; the
image in c is from a papilla exposed to a 900 Hz tone at
120 dB SPL for 12 hr. a, a', Area of the inferior
basilar papilla just outside the noise-damaged region, showing narrow
supporting-cell apical surfaces strongly labeled for the SCA
(a) and structurally normal, HCA-positive hair
cells (a'). b, b', Edge of the
noise-damaged region showing hair cells with varying degrees of damage.
Note that supporting cells further into the damaged region express less
SCA (small arrowheads) than supporting cells at the edge
of the damaged region (large arrowheads). c,
c', Region of a noise-damaged basilar papilla showing
supporting-cell surfaces (c) that label strongly
(large arrowheads) or very weakly for the SCA
(small arrowheads). Note the speckled appearance of the
HCA staining around the perimeter of the noise-damaged hair cells
(b', c'). Scale bar (shown in b'):
a-b', 10 µm; (shown in c'): c,
c', 10 µm.
|
|
In control basilar papillae that have been maintained in
vitro for 24 hr, the supporting-cell surfaces show a small amount of expansion relative to their in vivo counterparts but
otherwise stain intensely for the SCA (Fig.
10a). The hair cells retain
a normal morphology (Fig. 10a'). After treatment with 1 mM neomycin for 24 hr, most hair cells are lost, and in
many areas no immunoreactivity can be detected with the monoclonal
anti-HCA (Fig. 10b',c'). In these drug-damaged areas where
the hair cells have been lost, although many of the supporting cells
maintain high levels of SCA expression, cell surface profiles can be
observed that contact one another and do not stain with either mAb D37
or the monoclonal anti-HCA (Fig. 10b-c'). Many of the other
supporting cell surfaces have reduced levels of mAb D37 staining
relative to those in control cultures.

View larger version (179K):
[in this window]
[in a new window]
|
Figure 10.
In vitro preparations of a control
basilar papilla (a, a') and basilar papillae that have
been treated with either 1.0 mM (b, b') or
0.2 mM (c, c') neomycin for 24 hr and
triple-labeled to visualize the SCA through one channel
(a-c), and both cingulin and the HCA simultaneously
through the other channel (a'-c'). a,
a', In control papillae, strong staining for the SCA is seen on
the supporting cells (a) that surround the
HCA-positive hair cells (a'). Arrowheads
in a and a' point to the same supporting
cell; arrows point to the same hair cells. b, b',
c, c', In neomycin-treated papillae, SCA-negative cells are
seen that are in contact with each other (arrowheads).
These cells are also HCA-negative and do not have the circular apical
surfaces typical of hair cells (a'). Scale bar (shown in
c' and applies to all panels): 10 µm.
|
|
 |
DISCUSSION |
The results of this study describe the identification and
characterization of the SCA as an RPTP that is associated with the apical surface of supporting cells in the sensory epithelia of the
inner ear. The SCA is not unique to the inner ear and can be detected
by immunofluorescence microscopy in a number of other tissues including
retina, intestine, and kidney, where it is also associated with the
apical membranes of polarized epithelial cells. The SCA can be detected
in the brain by immunoblotting (data not shown) but not by
immunofluorescence microscopy, indicating either that it is widely
distributed in a diffuse, nonlocalized manner or that the relevant
epitope is masked in brain sections. The presence of the SCA in brain
is further confirmed by the observation that a partial clone of ~300
bp derived from brain by degenerate RT-PCR has sequence identical to
the SCA (Bodden and Bixby, 1996 ).
The derived amino acid sequence of the SCA predicts a transmembrane
protein with a large extracellular domain containing eight FN-III
repeats and an intracellular domain with a single catalytic site. The
SCA is therefore a class III RPTP, according to the classification
system of Tonks and colleagues (Fischer et al., 1991 ; Brady-Kalnay and
Tonks, 1995 ). A number of other class III RPTPs have been described
that only have FN-III repeats in their extracellular domains and a
single intracellular catalytic domain. These include the
Drosophila RPTPs DPTP10D and DPTP4E (Shin-Shay et al., 1991 ;
Yang et al., 1991 ), chick CRYP-2 (Bodden and Bixby, 1996 ), rabbit
GLEPP1 (Thomas et al., 1994 ), murine Byp (Kuramochi et al., 1996 ), rat
DEP-1 (Borges et al., 1996 ), and, from human, HPTP (Krueger et al.,
1990 ), DEP-1 (Östman et al., 1994 ), HPTP (Honda et al., 1994 ),
PTP-U2 (Seimiya et al., 1995 ), and SAP-1 (Matozaki et al., 1994 ).
HPTP and PTP-U2 are 97-99.5% similar to DEP-1, and all three
molecules may therefore be the product of a single gene. The SCA is
closely related to murine Byp and to DEP-1 from both human and rat, but
differs from them in that the extracellular FN-III repeats show an
unusual and much higher degree of internal similarity (Fig. 7). The
FN-III repeats of the SCA share 54-94% identity, whereas the FN-III
repeats of human DEP-1 have only 12-28% identity. The similarity of
the FN-III repeats in the SCA indicates that they are derived from a
recent exon duplication event or have been highly conserved to maintain function.
The ligand for the SCA is not known, and thus far only a few RPTP
ligands have been identified. RPTPµ interacts with itself, acting as
a homophilic cell-cell adhesion molecule (Brady-Kalnay et al., 1993 ;
Gebbink et al., 1993 ). RPTP / probably interacts with a complex
composed of contactin, Nr CAM, and the contactin-associated protein
caspr (Peles et al., 1995 ; Sakurai et al., 1997 ; Peles et al., 1997 ;
for review, see Peles et al., 1998 ), and the laminin-nidogen complex
can act as a ligand for the leukocyte common antigen-related receptor
(O'Grady et al., 1998 ). The SCA cannot act as a homophilic cell-cell
adhesion molecule on the apical surfaces of polarized epithelia, but
the apical membranes of the supporting cells in the avian inner ear are
in intimate contact with the extracellular matrices that overlie the
sensory epithelia. Components of these matrices, such as chick - and
-tectorin (Killick et al., 1995 ; Coutinho et al., 1999 ), are
therefore candidate ligands. Although the tectorins are expressed only
in the inner ear and cannot be ligands in the other organs where the
SCA is found, other extracellular molecules may interact with the SCA
in these tissues. For example, the interphotoreceptor matrix, an
extracellular matrix composed of glycoproteins and proteoglycans that
surrounds the outer segments of the photoreceptors (Hageman and
Johnson, 1991 ), contacts the Müller cell microvilli in the eye,
and molecules that have regions of sequence similarity with the
tectorins, such as the urinary protein uromodulin and the mucins
(Killick et al., 1995 ; Legan et al., 1997 ), are associated with the
brush borders in the kidney and intestine.
The proliferation of normal, nontransformed cell types requires the
presence of exogenous growth factors, many of which operate via
receptor tyrosine kinases, and it is the balance of protein tyrosyl
phosphorylation that influences the growth state of a cell. Supporting
cells proliferate when explants of the sensory epithelia of the avian
inner ear are grown in serum-free medium (Warchol and Corwin, 1993 ),
even if the epithelia are completely isolated from underlying stromal
tissue, indicating that they can produce growth factors that act in an
autocrine manner (Warchol, 1995 ). Growth factors that have been shown
to influence supporting-cell proliferation include TGF , epidermal
growth factor (in combination with insulin), FGF2, and IGF1
(Yamashita and Oesterle, 1995 ; Oesterle et al., 1997 ; Zheng et al.,
1997 ), and mRNAs for the receptors of all of these factors, including
the insulin receptor, are present in the chick inner ear (Lee and
Cotanche, 1996 ). Although it is not known which growth factors are
operational in the ear in vivo, there is recent evidence
that RPTPs can negatively regulate both insulin receptor (Kulas et al.,
1995 ) and FGF receptor signaling pathways (Kokel et al., 1998 ).
Interaction of the SCA with either of these two receptor tyrosine
kinase pathways could control the level of protein phosphorylation in
the supporting cells of the ear. Furthermore, a number of lines of
evidence from in vitro studies indicate that some of the
class III RPTPs with which the SCA shares sequence identity are
involved in the control of cell growth and differentiation
(Östman et al., 1994 ; Gaits et al., 1995 ; Borges et al., 1996 ;
Keane et al., 1996 ). For example, human DEP-1 is upregulated when
fibroblast cell lines reach density-dependent arrest of cell growth
(Östman et al., 1994 ), and expression levels of mRNA for human
DEP-1 and SAP increase when breast cancer cell lines are treated with
sodium butyrate, a compound that induces cell differentiation and
inhibits cell growth (Keane et al., 1996 ). Together these data prompt
the hypothesis that the SCA controls either the proliferation or
differentiation of supporting cells in the sensory epithelia of the
inner ear.
If the SCA does play a role in controlling supporting-cell
proliferation in the inner ear, levels of either SCA mRNA or protein may be expected to correlate with the proliferative state of the supporting cell, as described above for related RPTPs in dissociated cell culture. After hair-cell loss induced by either ototoxic drug
treatment in vitro or noise damage in vivo, SCA
expression levels clearly decrease on the apical surfaces of some, but
not all, of the supporting cells in the basilar papilla. For the
noise-damaged tissue, this decrease occurs before the time at which
supporting cells first enter S-phase [18 hr after the onset of noise
exposure (Stone and Cotanche, 1994 )] and may therefore be a primary
rather than a secondary response to hair-cell injury. High levels of SCA expression may block cell proliferation but could also prevent cells from adopting the hair-cell phenotype. Whether these cells with
decreased levels of SCA expression then go on to reenter the cell cycle
and give rise to new hair and supporting cells, or differentiate
directly into hair cells, remains to be determined and will be the
focus of future studies.
 |
FOOTNOTES |
Received Dec. 23, 1998; revised March 29, 1999; accepted April 7, 1999.
This work was supported by grants from the Wellcome Trust, the Medical
Research Council, Defeating Deafness, the National Organization for
Hearing Research (D.A.C.), and National Institutes of Health/National
Institute on Deafness and Other Communication Disorders Grants DC02291
(M.E.W.), DC03568 (Y.R.), and DC01689 (D.A.C.). The authors thank
Cecylia Malenczak, Laura Perry, and Elizabeth Messana for excellent
technical assistance, and Jonathan Gale for his helpful criticism of
this manuscript.
The nucleotide sequence reported in this paper has been submitted to
the EMBL Nucleotide Sequence Database with accession number AJ238216.
Correspondence should be addressed to Dr. Guy P. Richardson, School of
Biological Sciences, The University of Sussex, Falmer, Brighton, BN1
9QG, UK.
 |
REFERENCES |
-
Adler HY,
Raphael Y
(1996)
New hair cells arise from supporting cell conversion in the acoustically damaged chick inner ear.
Neurosci Lett
205:17-20[Web of Science][Medline].
-
Altschul SF,
Madden TL,
Schaffer AA,
Zhang J,
Zheng Z,
Miller W,
Lipman DJ
(1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res
25:3389-3402[Abstract/Free Full Text].
-
Bodden K,
Bixby JL
(1996)
CRYP-2: a receptor-type tyrosine phosphatase selectively expressed by developing vertebrate neurons.
J Neurobiol
31:309-324[Web of Science][Medline].
-
Borges LG,
Seifert RA,
Grant FJ,
Hart CE,
Disteche CM,
Edelhoff S,
Solca FF,
Lieberman MA,
Linder V,
Fischer EH,
Lok S,
Bowen-Pope DF
(1996)
Cloning and characterization of rat density-enhanced phosphatase-1, a protein tyrosine phosphatase expressed by vascular cells.
Circ Res
79:570-580[Abstract/Free Full Text].
-
Brady-Kalnay SM,
Tonks NK
(1995)
Protein tyrosine phosphatases as adhesion receptors.
Curr Biol
7:650-657.
-
Brady-Kalnay SM,
Flint AJ,
Tonks NK
(1993)
Homophilic binding of PTPµ, a receptor protein tyrosine phosphatase, can mediate cell-cell aggregation.
J Cell Biol
122:961-972[Abstract/Free Full Text].
-
Citi S,
Sabanay H,
Jakes R,
Geiger B,
Kendrick-Jones J
(1988)
Cingulin, a new peripheral component of tight junctions.
Nature
333:272-276[Medline].
-
Corwin JT,
Cotanche DA
(1988)
Regeneration of sensory hair cells after acoustic trauma.
Science
240:1772-1774[Abstract/Free Full Text].
-
Cotanche DA,
Messana EP,
Ofsie MS
(1995)
Migration of hyaline cells into the chick basilar papilla during severe noise damage.
Hear Res
91:148-159[Web of Science][Medline].
-
Coutinho P,
Goodyear R,
Legan PK,
Richardson GP
(1999)
Chick
-tectorin: molecular cloning and expression during embryogenesis.
Hear Res
130:62-74[Web of Science][Medline]. -
Feinberg AP,
Vogelstein B
(1984)
A technique for labelling DNA restriction endonuclease fragments to high specific activity.
Ann Biochem
132:6-13.
-
Fekete DM,
Muthukumar S,
Karagogeos D
(1998)
Hair and supporting cells share a common progenitor in the avian inner ear.
J Neurosci
18:7811-7821[Abstract/Free Full Text].
-
Fischer EH,
Charbonneau H,
Tonks NK
(1991)
Protein tyrosine phosphatases: a diverse family of intracellular and transmembrane enzymes.
Science
253:401-406[Abstract/Free Full Text].
-
Gaits F,
Li RY,
Ragab A,
Ragab-Thomas JMF,
Chap H
(1995)
Increase in receptor-like protein tyrosine phosphatase activity and expression level in density-dependent growth of endothelial cells.
Biochem J
311:97-103.
-
Gebbink MFBG,
Zondag GCM,
Wubbolts RW,
Beijersbergen RL,
van Etten I,
Moolenaar WH
(1993)
Cell-cell adhesion mediated by a receptor-like tyrosine phosphatase.
J Biol Chem
268:16101-16104[Abstract/Free Full Text].
-
Goodyear R,
Richardson G
(1999)
The ankle link antigen: an epitope sensitive to calcium chelation associated with the hair-cell surface and the calycal processes of photoreceptors.
J Neurosci
19:3761-3772[Abstract/Free Full Text].
-
Hageman GS,
Johnson LV
(1991)
Structure, composition and function of the retinal interphotoreceptor matrix.
In: Progress in retinal research (Osborne N,
Chader GJ,
eds), pp 207-250. Oxford: Pergammon.
-
Honda H,
Inazawa J,
Nishida J,
Yazaki Y,
Hirai H
(1994)
Molecular cloning, characterization, and chromosomal localization of a novel protein-tyrosine phosphatase, HPTP
.
Blood
12:4186-4194. -
Keane MM,
Lowrey GA,
Ettenberg SA,
Dayton MA,
Lipkowitz S
(1996)
The protein tyrosine phosphatase DEP-1 is induced during differentiation and inhibits growth arrest of breast cancer cells.
Cancer Res
56:4236-4243[Abstract/Free Full Text].
-
Killick R,
Legan PK,
Malenczak C,
Richardson GP
(1995)
Molecular cloning of chick
-tectorin, an extracellular matrix molecule of the inner ear.
J Cell Biol
129:535-547[Abstract/Free Full Text]. -
Kohler G,
Milstein C
(1975)
Continuous culture of fused cells secreting antibody of predefined specificity.
Nature
256:495-497[Medline].
-
Kokel M,
Borland CZ,
DeLong L,
Horvitz HR,
Stern MJ
(1998)
clr-1 encodes a receptor tyrosine phosphatase that negatively regulates an FGF receptor signalling pathway in Caenorhabditis elegans.
Genes Dev
12:1425-1437[Abstract/Free Full Text].
-
Krueger NX,
Streuli M,
Saito H
(1990)
Structural diversity and evolution of human receptor-like protein tyrosine phosphatase.
EMBO J
9:3241-3252[Web of Science][Medline].
-
Kulas DT,
Zhang W-R,
Goldstein BJ,
Furlanetto RW,
Mooney RA
(1995)
Insulin receptor signalling is augmented by antisense inhibition of the protein tyrosine phosphatase LAR.
J Biol Chem
270:2435-2438[Abstract/Free Full Text].
-
Kuramochi S,
Matsuda S,
Matsuda Y,
Saitoh T,
Ohsugi M,
Yamamoto T
(1996)
Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1.
FEBS Lett
378:7-14[Web of Science][Medline].
-
Lee KH,
Cotanche DA
(1996)
Potential role of bFGF and retinoic acid in the regeneration of chicken cochlear hair cells.
Hear Res
94:1-13[Web of Science][Medline].
-
Legan PK,
Rau A,
Keen JN,
Richardson GP
(1997)
The mouse tectorins: modular matrix molecules of the inner ear homologous to components of the sperm-egg adhesion system.
J Biol Chem
272:8791-8801[Abstract/Free Full Text].
-
Matozaki T,
Suzuki T,
Uchida T,
Inazawa J,
Ariyama T,
Matsuda K,
Horita K,
Noguchi H,
Mizuno H,
Sakamoto C,
Kasuga M
(1994)
Molecular cloning of a human transmembrane-type protein tyrosine phosphatase and its expression in gastrointestinal cancers.
J Biol Chem
269:2075-2081[Abstract/Free Full Text].
-
Navaratnam DS,
Su HS,
Scott S-P,
Oberholtzer JC
(1996)
Proliferation in the auditory receptor epithelium mediated by cyclic AMP-dependent signalling pathway.
Nat Med
2:1136-1139[Web of Science][Medline].
-
Neel BG,
Tonks NK
(1997)
Protein tyrosine phosphatases in signal transduction.
Curr Opin Cell Biol
9:193-204[Web of Science][Medline].
-
Oesterle EC,
Rubel EW
(1993)
Postnatal production of supporting cells in the chick cochlea.
Hear Res
66:213-224[Web of Science][Medline].
-
Oesterle EC,
Tsue TT,
Rubel EW
(1997)
Induction of cell proliferation in avian inner ear sensory epithelia by insulin-like growth factor-I and insulin.
J Comp Neurol
380:262-274[Web of Science][Medline].
-
O'Grady P,
Thai TC,
Saito H
(1998)
The laminin-nidogen complex is a ligand for a specific splice isoform of the transmembrane protein tyrosine phosphatase LAR.
J Cell Biol
141:1675-1684[Abstract/Free Full Text].
-
Östman A,
Yang Q,
Tonks NK
(1994)
Expression of DEP-1, a receptor-like protein-tyrosine-phosphatase, is enhanced with increasing cell density.
Proc Natl Acad Sci USA
91:9680-9684[Abstract/Free Full Text].
-
Peles E,
Nativ M,
Campbell PL,
Sakurai T,
Martinez R,
Lev DO,
Clary J,
Schilling G,
Barnea G,
Plowman GD,
Grumet M,
Schlessinger J
(1995)
The carbonic anhydrase domain of receptor tyrosine phosphatase
is a functional ligand for the axonal cell recognition molecule contactin.
Cell
82:251-260[Web of Science][Medline]. -
Peles E,
Nativ M,
Lustig M,
Grumet M,
Schilling J,
Martinez R,
Plowman GD,
Schlessinger J
(1997)
Identification of a novel contactin-associated transmembrane receptor with multiple domains implicated in protein-protein interactions.
EMBO J
16:978-988[Web of Science][Medline].
-
Peles E,
Schlessinger J,
Grumet M
(1998)
Multi-ligand interactions with receptor-like protein tyrosine phosphatase
: implications for intercellular signalling.
Trends Biochem Sci
23:121-124[Web of Science][Medline]. -
Raphael Y
(1992)
Evidence for supporting cell mitosis in response to acoustic trauma in the avian inner ear.
J Neurocytol
21:663-671[Web of Science][Medline].
-
Raphael Y
(1993)
Reorganization of the chick basilar papilla following acoustic trauma.
J Comp Neurol
330:521-532[Web of Science][Medline].
-
Richardson GP,
Bartolami S,
Russell IJ
(1990)
Identification of a 275 kDa protein associated with the apical surfaces of sensory hair cells in the avian inner ear.
J Cell Biol
110:1055-1066[Abstract/Free Full Text].
-
Roberson DW,
Kreig CS,
Rubel EW
(1996)
Light microscopic evidence that direct transdifferentiation gives rise to new hair cells in regenerating avian auditory epithelium.
Aud Neurosci
2:195-205.
-
Ryals BM,
Rubel EW
(1988)
Hair cell regeneration after acoustic trauma in adult Cortinix quail.
Science
240:1774-1776[Abstract/Free Full Text].
-
Sakurai T,
Lustig M,
Nativ M,
Hemperly JJ,
Schlessinger J,
Peles E,
Grumet M
(1997)
Induction of neurite outgrowth through contactin and Nr-CAM by extracellular regions of glial receptor tyrosine phosphatase
.
J Cell Biol
136:907-918[Abstract/Free Full Text]. -
Sanger F,
Nicklen S,
Coulson AR
(1977)
DNA sequencing with chain terminating inhibitors.
Proc Natl Acad Sci USA
74:5463-5467[Abstract/Free Full Text].
-
Seimiya H,
Sawabe T,
Inazawa J,
Tsuruo T
(1995)
Cloning, expression and chromosomal localization of a novel gene for protein tyrosine phosphatase (PTP-U2) induced by various differentiation agents.
Oncogene
10:1731-1738[Web of Science][Medline].
-
Shin-Shay T,
Tsoulfas P,
Zinn K
(1991)
Three receptor-linked protein-tyrosine phosphatases are selectively expressed on central nervous system axons in the Drosophila embryo.
Cell
67:675-685[Web of Science][Medline].
-
Stoker A,
Dutta R
(1998)
Protein tyrosine phosphatases and neural development.
BioEssays
20:463-472[Web of Science][Medline].
-
Stone JS,
Cotanche DA
(1994)
Identification of the timing of S-phase and the patterns of cell proliferation during hair cell regeneration in the chick cochlea.
J Comp Neurol
341:50-67[Web of Science][Medline].
-
Thomas PE,
Wharram BL,
Goyal M,
Wiggins JE,
Holzman LB,
Wiggins RC
(1994)
GLEPP1, a renal glomerular epithelial cell (podocyte) membrane protein-tyrosine phosphatase.
J Biol Chem
269:19953-19962[Abstract/Free Full Text].
-
Yamashita H,
Oesterle EC
(1995)
Induction of cell proliferation in mammalian inner-ear sensory epithelia by transforming growth factor alpha and epidermal growth factor.
Proc Natl Acad Sci USA
92:3152-3155[Abstract/Free Full Text].
-
Yang X,
Seow KT,
Bahri SM,
Oon SH,
Chia W
(1991)
Two Drosophila receptor-like tyrosine phosphatase genes are expressed in a subset of developing axons and pioneer neurons in the embryonic CNS.
Cell
67:661-673[Web of Science][Medline].
-
Warchol ME
(1995)
Supporting cells in isolated sensory epithelia of avian utricles proliferate in serum free culture.
NeuroReport
6:981-984[Web of Science][Medline].
-
Warchol ME,
Corwin JT
(1993)
Supporting cells in avian vestibular organs proliferate in serum-free culture.
Hear Res
71:28-36[Web of Science][Medline].
-
Zheng JL,
Helbig C,
Gao W-Q
(1997)
Induction of cell proliferation by fibroblast and insulin-like growth factors in pure rat inner ear epithelial cell cultures.
J Neurosci
17:216-226[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19124815-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Z. Hu and J. T. Corwin
Inner ear hair cells produced in vitro by a mesenchymal-to-epithelial transition
PNAS,
October 16, 2007;
104(42):
16675 - 16680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. S. Nair, K. E. Kozma, N. L. Hoefling, P. K. Kommareddi, Y. Ueda, T.-W. Gong, M. I. Lomax, C. D. Lansford, S. A. Telian, B. Satar, et al.
Identification and Characterization of Choline Transporter-Like Protein 2, an Inner Ear Glycoprotein of 68 and 72 kDa That Is the Target of Antibody-Induced Hearing Loss
J. Neurosci.,
February 18, 2004;
24(7):
1772 - 1779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Goodyear, P. K. Legan, M. B. Wright, W. Marcotti, A. Oganesian, S. A. Coats, C. J. Booth, C. J. Kros, R. A. Seifert, D. F. Bowen-Pope, et al.
A Receptor-Like Inositol Lipid Phosphatase Is Required for the Maturation of Developing Cochlear Hair Bundles
J. Neurosci.,
October 8, 2003;
23(27):
9208 - 9219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C Holley
Application of new biological approaches to stimulate sensory repair and protection
Br. Med. Bull.,
October 1, 2002;
63(1):
157 - 169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Stone and E. W Rubel
Cellular studies of auditory hair cell regeneration in birds
PNAS,
October 24, 2000;
97(22):
11714 - 11721.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|