 |
Previous Article | Next Article 
The Journal of Neuroscience, June 15, 1999, 19(12):4938-4947
Netrin-3, a Mouse Homolog of Human NTN2L, Is Highly Expressed in
Sensory Ganglia and Shows Differential Binding to Netrin Receptors
Hao
Wang1,
Neal G.
Copeland2,
Debra J.
Gilbert2,
Nancy A.
Jenkins2, and
Marc
Tessier-Lavigne1
1 Departments of Anatomy, and Biochemistry and
Biophysics, Howard Hughes Medical Institute, University of California,
San Francisco, California 94143-0452, and 2 Mammalian
Genetics Laboratory, Advanced Bioscience Laboratories Basic Research
Program, Frederick Cancer Research and Development Center at the
National Cancer Institute, Frederick, Maryland 21702
 |
ABSTRACT |
The netrins comprise a small phylogenetically conserved family of
guidance cues important for guiding particular axonal growth cones to
their targets. Two netrin genes, netrin-1 and
netrin-2, have been described in chicken, but in mouse
so far a single netrin gene, an ortholog of chick
netrin-1, has been reported. We report the
identification of a second mouse netrin gene, which we name netrin-3. Netrin-3 does not appear to be
the ortholog of chick netrin-2 but is the ortholog of a
recently identified human netrin gene termed NTN2L
("netrin-2-like"), as evidenced by a high degree of sequence
conservation and by chromosomal localization. Netrin-3 is expressed in sensory ganglia, mesenchymal cells, and muscles during
the time of peripheral nerve development but is largely excluded from
the CNS at early stages of its development. The murine netrin-3
protein binds to netrin receptors of the DCC (deleted in colorectal
cancer) family [DCC and neogenin] and the UNC5 family (UNC5H1,
UNC5H2 and UNC5H3). Unlike chick netrin-1, however, murine netrin-3
binds to DCC with lower affinity than to the other four receptors.
Consistent with this finding, although murine netrin-3 can mimic the
outgrowth-promoting activity of netrin-1 on commissural axons, it has
lower specific activity than netrin-1. Thus, like netrin-1, netrin-3
may also function in axon guidance during development but may function
predominantly in the development of the peripheral nervous system and
may act primarily through netrin receptors other than DCC.
Key words:
netrin-3; axon guidance; sensory neurons; mouse
chromosome 17; peripheral nervous system; DCC
 |
INTRODUCTION |
An early step in the development of
the nervous system is the guidance of axonal growth cones to their
correct targets. Significant progress has been made in recent years in
identifying molecules that guide axons in a variety of organisms,
including nematodes, insects, and vertebrates. These molecules include
members of the cadherin and immunoglobulin superfamilies, ephrins,
semaphorins, and netrins, all of which appear to have phylogenetically
conserved functions (Tessier-Lavigne and Goodman, 1996 ).
The netrins play important roles in guiding various classes of axons in
all of these species. In particular, genetic and embryologial studies
have implicated netrins in attracting axons to the midline of the
nervous systems of worms, flies, and vertebrates and in repelling other
axons away from the midline, as well as in guiding other axons that do
not navigate close to the midline (for review, see Tessier-Lavigne and
Goodman, 1996 ; Culotti and Merz, 1998 ). The attractive effects of
netrins appear to be mediated by receptors that are members of the DCC
(deleted in colorectal cancer) subfamily of the immunoglobulin
superfamily, which include the UNC-40 protein of
Caenorhabditis elegans, the Frazzled protein of
Drosophila, and the DCC and neogenin proteins of vertebrates
(Chan et al., 1996 ; Keino-Masu et al., 1996 ; Kolodziej et al., 1996 ;
Fazeli et al., 1997 ). In the case of repulsion, genetic data implicate the UNC-5 protein of C. elegans as a strong candidate
receptor involved in mediating repulsive actions of the netrin
UNC-6 (Hedgecock et al., 1990 ; Leung-Hagesteijn et al., 1992 ;
Hamelin et al., 1993 ). In vertebrates, the UNC-5 homologs UNC5H1,
UNC5H2, and UNC5H3 are all netrin-binding proteins, consistent with the
possibility that they too function as repulsive netrin receptors
(Ackerman et al., 1997 ; Leonardo et al., 1997 ).
Within each species, netrins appear to be a small family. One netrin,
the UNC-6 gene product, has been described in the nematode C. elegans, and two in Drosophila (Netrin-A and Netrin-B)
(Ishii et al., 1992 ; Harris et al., 1996 ; Mitchell et al., 1996 ). In vertebrates, biochemical purification led to the identification of
chick netrin-1 and netrin-2 (Serafini et al., 1994 ). Orthologs of chick
netrin-1 have been identified in other vertebrate species, including mouse (Serafini et al., 1996 ), Xenopus (de la
Torre et al., 1997 ), zebrafish (Lauderdale et al., 1997 ; Strahle et al., 1997 ), and human (Meyerhardt et al., 1999 ). A netrin gene named
NTN2L ("netrin-2-like") (van Raay et al., 1997 ) has been reported in human as well; it does not appear to be the strict ortholog
of either chick netrin-1 or chick netrin-2.
Here, we describe the cloning, expression, binding properties, and
in vitro activities of a novel murine netrin, netrin-3, which is the ortholog of human NTN2L. Two properties of netrin-3 distinguish it from previously reported vertebrate netrins: its exclusion from the CNS at early stages of development and its selectivity in binding to various netrin receptors. These results suggest that netrin-3 may be more specialized for development of the
peripheral nervous system and for functioning through a subset of known
netrin receptors.
 |
MATERIALS AND METHODS |
Isolation of a murine netrin-3 cDNA. Two
million phage plaques from a neonatal mouse brain cDNA library
(Stratagene, La Jolla, CA) were screened with a
32P-labeled murine netrin-1 cDNA. Filters (Hybond-N;
Amersham, Arlington Heights, IL) were hybridized at 42°C in 0.4 M NaPO4, pH 7.2, 1% BSA, 1 mM EDTA, 7% SDS,
15% formamide, 250 µg/ml salmon sperm DNA, and 2 × 106 cpm/ml of the probe for 16 hr. The filters were
washed repeatedly at 55°C in 0.2× SSC and 0.1% SDS and
autoradiographed. Three positive clones were isolated and excised into
the phagemid vector pBluscript as directed by the manufacturer (Stratagene).
To isolate the 5' end of the cDNA, two rounds of 5' rapid amplification
of cDNA ends (RACE) (Boehringer Mannheim, Indianapolis, IN) were
conducted according to the manufacturer's instructions. Two
micrograms of poly(A+) RNA from mouse
embryonic day 12.5 (E12.5) embryos were reverse transcribed
using a 3' primer complementary to the sequence
5'GGCACGAGCCCGTGCTCCAA3' contained in the 5' end of the available cDNA
sequence. A poly(A+) tail was then added
using terminal transferase. The cDNA was used as template to amplify
the 5' end, and a 0.5 kb PCR product was cloned into the pCRII vector
(Invitrogen, San Diego, CA). Because this fragment still did not
contain the entire open reading frame, a second round of 5' RACE was
conducted using a primer complementary to 5'CCGCAGCGGGCTACTCTGCAGAC3',
a sequence in the 5' end of the newly cloned fragment. This second
round of RACE resulted in the cloning of a 0.3 kb sequence, which
contains the 5' end of the gene, including the putative ATG and 150 bp
of 5'UTR. The continuity of these PCR products with the existing cDNA
clone was confirmed by sequence comparison with the genomic DNA.
Isolation of genomic DNA. One pair of primers
(5'ATCTTGGCACTGCAGACCCGGCACG3' and 5'GTCCGAGGAATCGCAGACGCGATT3') was
used to screen a mouse P1 genomic library by PCR (Genome Systems, Inc., St. Louis, MO). Two positive clones containing an 80 kb insert were
mapped, and the genomic DNA spanning the cDNA region was subcloned into
pBluscript SK( ).
Interspecific mouse backcross. Interspecific backcross
progeny were generated by mating (C57BL/6J × Mus spretus) F1 females and C57BL/6J males
as described previously (Copeland and Jenkins, 1991 ). A total of 205 N2
mice were used to map the NtN3 locus. DNA isolation,
restriction enzyme digestion, agarose gel electrophoresis, Southern
blot transfer, and hybridization were performed essentially as
described previously (Jenkins et al., 1982 ). All blots were prepared
with Hybond-N+ nylon membrane (Amersham). The probe,
an ~1.4 kb XbaI fragment of mouse genomic DNA from the 5'
UTR, was labeled with [ -32P] dCTP using a nick
translation labeling kit (Boehringer Mannheim); washing was done to a
final stringency of 1.0× SSCP and 0.1% SDS at 65°C. A
fragment of 4.8 kb was detected in ScaI digested C57BL/6J DNA, and a fragment of 3.1 kb was detected in a ScaI
digested M. spretus-specific fragment followed in
backcross mice.
A description of the probes and restriction fragment length
polymorphisms (RFLPs) for the loci linked to Ntn3,
including Masl, E4fl, and Piml,
has been reported previously (Rooney et al., 1998 ). Recombination
distances were calculated using Map Manager, version 2.6.5. Gene
order was determined by minimizing the number of recombination events
required to explain the allele distribution patterns.
Expression of mouse netrin-3 protein and netrin-3(VI.V)-Fc in 293 EBNA cells. The genomic sequences encoding the signal
peptide, domain VI and domain V, do not contain introns as revealed by sequence comparison to cDNA clones and 5' RACE products. Therefore, this region of the genomic DNA was fused with the cDNA and cloned into
the mammalian expression vector pCEP4 (Invitrogen). In addition, a
sequence encoding the myc epitope was also cloned in frame 5' to the
stop codon to generate a plasmid we named pMN3myc.
For netrin-3 (VI.V)-Fc, human Fc DNA was fused in frame to generate netrin-3 (VI.V)-Fc. Transfection of pMN3myc and
netrin-3 (VI.V)-Fc into 293 EBNA cells was performed using LipofectAMINE (Life Technologies, Gaithersburg, MD) as
directed by the manufacturer. Transfected cells were selected with
G418 (250 µg/ml) and hygromycin B (40 µg/ml). After 7 d,
the resistant cell colonies were pooled, expanded, and frozen as a
stable source of transfected cells.
Purification of murine netrin-3 from transfected cells.
Recombinant murine netrin-3 protein was purified from conditioned media
by heparin affinity chromatography to 75-85% homogeneity, as assessed
by silver staining. Netrin-3 (VI.V)-Fc protein was purified from
conditioned media by protein-A affinity chromatography (Harlow and
Lane, 1988 ) to greater than 90% homogeneity.
Northern blot analysis. Total RNA from various stages of
embryos and brains was extracted (Chomczynski and Sacchi, 1987 ). Poly(A+) RNA was isolated by oligo-dT cellulose
(Sambrook et al., 1989 ). For Northern analysis, 3 µg of
poly(A+) RNA was used. The blotted membrane was
hybridized with 32P-labeled cDNA in 0.32 M
NaPO4, pH7.2, 7% SDS, 1 mM EDTA, 1% BSA, and 250 µg/ml
salmon sperm DNA at 65°C for 16 hr. The membrane was washed
repeatedly in 0.1× SSC and 1% SDS at 65°C and exposed to x-ray film
at 80°C in the presence of an intensifying screen for 3 d.
In situ hybridization. Embryos from different stages were
fixed in 4% paraformaldehyde in PBS, cryoprotected in 30%
sucrose in PBS, embedded in O.C.T. compound, and cryostat
sectioned at 16 µm thickness. Antisense and sense RNA probes for
in situ hybridization were transcribed from linearized
plasmid using T7 or T3 RNA polymerase in the presence of
[35S]UTP. For murine netrin-3, a 1287 base probe spanning 1037 bases in the coding region and 250 bases in
the 3'UTR was used. Another 368 base probe corresponding to 118 bases
in the coding region and 250 bases in the 3'UTR gave similar patterns
as the 1037 base probe (data not shown). We routinely used the 1037 base probe for murine netrin-3 in situ hybridization.
The murine netrin-1 and chick netrin-1 probes
were the same as described previously (Kennedy et al., 1994 ; Serafini
et al., 1996 ). For chick netrin-2, a 1243 base probe
spanning 205 bases in the coding region and 1038 bases in the 3'UTR was
used. For each cDNA, a sense probe was also synthesized and showed no
signal under the same conditions as for the antisense probe. Sections
were processed, hybridized, and washed at high stringency as described
previously (Wang et al., 1994 ). Slides were coated with photographic
emulsion (K5; Polysciences, Warrington, PA), developed after 3-7 d,
stained with hemotoxylin, dehydrated and cleared with xylene, and
mounted in Permount (Fisher Scientific, Houston, TX).
Explant culture. E13 rat dorsal explant cultures with the
cell aggregates were as described previously (Kennedy et al., 1994 ; Serafini et al., 1994 ), with micrographs of explants taken 16 hr after
the onset of incubation of the cultures. Chemorepulsive activity was
assayed as described previously (Colamarino and Tessier-Lavigne, 1995 ),
with explants fixed 40 hr after the onset of incubation of the cultures
and trochlear motor axons stained with the F84.1 antibody.
Binding experiments. Transient transfections of expression
constructs encoding rat DCC, rat neogenin, rat UNC5H1, rat UNC5H2, mouse UNC5H3, and rat L1 were performed using LipofectAMINE (Life Technologies). Forty-eight hours after transfection, the cells were
incubated with 2 µg/ml purified murine netrin-3 protein in PBS
supplemented with 1% goat serum, 2 µg/ml heparin, and 0.05% sodium
azide at 37°C for 1 hr. After washing three times with PBS, the cells
were fixed with 4% paraformaldehyde at room temperature for 10 min.
The cells were then stained using monoclonal antibody 9E10, followed by
a Cy 3-conjugated Goat anti-mouse IgG secondary antibody.
Equilibrium binding on 293T cells transiently expressing these
receptors was quantified essentially as described previously (Keino-Masu et al., 1996 ; Leonardo et al., 1997 ). Briefly, the transfected cells were plated on a poly-D-lysine-coated
48-well plate. After washing with PBS containing 1% BSA and 0.05%
sodium azide, followed by incubation with the ligand in binding buffer (PBS plus 1% BSA plus 0.05% sodium azide plus 2 µg/ml
heparin) for 3 hr on ice, the cells were washed twice with binding
buffer. The cells were then fixed with 50% methanol, 100% methanol,
and 4% paraformaldehyde sequentially. Fixed cells were washed three times before incubation with [125I]goat anti human
IgG (1 µCi/ml in 10% heat-inactivated goat serum) for 30 min at room
temperature. The activity was counted after washing with PBS three
times, followed by dissolving the cells in 1 M NaOH and 1%
Triton X-100. Experiments were performed in triplicate for each concentration.
 |
RESULTS |
Cloning of the murine netrin-3 gene
To search for other murine netrin homologs, we screened a neonatal
mouse brain cDNA library with a mouse netrin-1 probe.
Three positive clones were isolated and sequenced. The documented
netrins have a characteristic structure, comprising three domains
called VI, V, and C. Domains VI and V are so named because of their
homology to domains VI (a globular domain) and V (comprising epidermal growth factor-like repeats) of the laminin chains.
The C-terminal domain C is highly basic. The sequence of each of the
clones we obtained in our screen contained an open reading frame
homologous to domains V and C of murine netrin-1. All three clones
lacked sequences corresponding to domain VI and the signal peptide. The 5' end of the existing clones was obtained by two rounds of 5' RACE,
yielding regions homologous to domain VI and the signal peptide. We
later confirmed the continuity of these fragments with the cDNA clones
by Northern analysis and by comparison to genomic sequence (data not shown).
The predicted amino acid sequence of the murine netrin-3 protein shows
homology to all other known netrins (Fig.
1), including a high degree of homology
at the amino acid level to the human NTN2L gene product (87.2%
identity) and a lower level of homology to chick netrin-2 (71.6%) and
chick netrin-1 (52.4%). Therefore, murine netrin-3 is
likely the strict ortholog of human NTN2L. However, the
homology between mouse netrin-3 and chick netrin-2 is much lower,
indicating that netrin-3 is likely not the strict ortholog
of chick netrin-2, as previously noted also for
NTN2L (van Raay et al., 1997 ).

View larger version (132K):
[in this window]
[in a new window]
|
Figure 1.
Alignment of the predicted amino acid sequences of
murine netrin-3, human NTN2L, chick netrin-2, and chick netrin-1
proteins. Amino acid residues identical among other netrins and murine
netrin-3 are shaded in black. Similar residues are
shaded in gray. The different domains of mouse netrin-3
(domains VI, V-1, V-2,
V-3, and C) are indicated as defined by
homology with other netrins (Serafini et al., 1994 ; Harris et al.,
1996 ; Mitchell et al., 1996 ; de la Torre et al., 1997 ). The nucleotide
sequence of mouse netrin-3 has been submitted to GenBank.
|
|
Chromosomal localization of the murine
netrin-3 gene
The chromosomal location of murine netrin-3
(Ntn3) was determined by interspecific backcross
analysis using progeny derived from matings of [(C57BL/6J × M. spretus) F1 × C57BL/6J] mice. This interspecific
backcross mapping panel has been typed for over 2400 loci that are well
distributed among all the autosomes, as well as the X chromosome
(Copeland and Jenkins, 1991 ). C57BL/6J and M. spretus DNA was digested with several enzymes and analyzed by
Southern blot hybridization for informative RFLPs using a murine Ntn3 probe. The 3.1 kb ScaI M. spretus
RFLP (see Materials and Methods) was used to follow the segregation of
the murine netrin-3 locus in backcross mice. The mapping
results indicated that murine netrin-3 is located in the
proximal region of mouse chromosome 17 linked to Masl,
E4fl, and Piml. Although 130 mice were analyzed for every marker and are shown in the segregation analysis (Fig. 2), up to 192 mice were typed for some
pairs of markers. Each locus was analyzed in pairwise combinations for
recombination frequencies using additional data. The ratios of the
total number of mice exhibiting recombinant chromosomes to the total
number of mice analyzed for each pair of loci and the most likely gene order are as follows:
Centromere-Masl-2/192-Ntn30/160-E4fl-1/132-Piml. The recombination frequencies [expressed as genetic distances in
centimorgans (cM) plus the SE] are as follows:
Masl-1.0 ± 0.7-[Ntn3, E4fl]
-0.8 ± 0.8-Piml. No recombinants were detected between
Ntn3 and E4fl in 160 animals typed in common,
suggesting that the two loci are within 1.9 cM of each other (upper
95% confidence limit).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 2.
Ntn3 maps in the proximal region of
mouse chromosome 17. Ntn3 was placed on chromosome 17 by
interspecific backcross analysis. The segregation patterns of
Ntn3 and flanking genes in 130 backcross animals that
were typed for all loci are shown at the top. For
individual pairs of loci, >130 animals were typed (see Materials and
Methods). Each column represents the chromosome
identified in the backcross progeny that was inherited from the
(C57BL/6J × M. spretus) F1 parent. The
black boxes represent the presence of a C57BL/6J allele,
and the white boxes represent the presence of a
M. spretus allele. The number of offspring inheriting
each type of chromosomes is listed at the bottom of each
column. A partial chromosome 17 linkage map showing the
location of Ntn3 in relation to linked genes is shown at
the bottom. Recombination distances between loci in
centimorgans are shown to the left of the chromosome,
and the position of the loci in human chromosomes, where known, are
shown to the right. References for the human map
position of loci cited in this study can be obtained from Genome Data
Base, a computerized database of human linkage information maintained
by The William H. Welch Medical Library of the Johns Hopkins University
(Baltimore, MD).
|
|
Furthermore, we have compared the interspecific map of chromosome 17 with a composite mouse linkage map that reports the map location of
many uncloned mouse mutations (provided from the Mouse Genome Database,
maintained at The Jackson Laboratory, Bar Harber, ME). Ntn3
mapped in a region of the composite map that contains the t-complex, a
~12 cM interval that contains numerous mutations, including those
affecting tail length, male sterility, transmission ratio distortion,
and prenatal lethality (Green, 1989 ). Whether mutations in
Ntn3 result in any of the t-complex phenotypes remains to be determined.
The proximal region of mouse chromosome 17 shares regions of homology
with human chromosome 6 and 16 (Fig. 2). The placement of
Ntn3 in this interval in mouse is consistent with the human localization of NTN2L, 16p13.3 (van Raay et al., 1997 ).
Sites of expression of murine netrin-3
Northern analysis shows that several transcripts are made from the
murine netrin-3 gene (Fig. 3).
The major transcripts are 6.5, 4.0, and 3.0 kb, respectively. In mRNA
derived from whole embryos during early stages of nervous system
development, the expression of murine netrin-3 is highest at
approximately E12.5. Expression in brain tissue was also detected from
E14.5 (the earliest stage examined) into adulthood (Fig. 3). In adult
brain, the 3.0 kb transcript predominates.

View larger version (88K):
[in this window]
[in a new window]
|
Figure 3.
Northern analysis of murine
netrin-3 expression in mRNA extracted from E9.5, E10.5,
E11.5, and E12.5 whole embryos and E14.5, E16.5, and E18.5 neonatal and
adult brain. The position of RNA molecular weight markers on the gel is
indicated on the right. Elongation factor 1 a
(EF1a) was used as a control for loading of mRNA.
|
|
To determine the regional distribution of murine netrin-3
transcripts at early embryonic stages and whether, like
netrin-1, it could play a role in axon guidance, we
performed in situ hybridization analysis of murine
netrin-3 expression on sections of E9.5-E14.5 mouse
embryos. In contrast to the two chicken netrin genes and murine
netrin-1, murine netrin-3 is not detected at
early stages of spinal cord development (E9.5 and E10.5 in the mouse)
(Fig. 4A-H).
Instead, the highest signal is detected in the dorsal root ganglia
(Fig. 4B,F). At E11.5,
murine netrin-3 mRNA is also detected at low levels in the
motor column in the ventral spinal cord (Fig. 4J). At
all these developmental stages, no signal was detected in the floor
plate or in the ventricular zone, two sites of expression of the chick
netrin-1, chick netrin-2, and mouse
netrin-1 genes. The murine netrin-3 signal in the
ventral spinal cord is maintained at a low level through E14.5 (Figs.
5B,C,
6D).

View larger version (79K):
[in this window]
[in a new window]
|
Figure 4.
Comparison of expression of murine
netrin-1 (A, E,
I), murine netrin-3
(B, F, J), chick
netrin-1 (C, G,
K), and chick netrin-2
(D, H, L) in the spinal
cord by in situ hybridization. Comparable developmental
stages in mouse and chick are illustrated: A-D, E9.5 in
mouse (A, B) and stage 18 in
chick (C, D); E-H, E10.5
in mouse (E, F) and stage 22 in
chick (G, H); I-L,
E11.5 in mouse (I, J) and stage 26 in chick (K, L). (Note that the signal
along the edge of the ventricular zone and in the central canal in
I and J represents an edge effect and not
a real signal). sc, Spinal cord; d,
dorsal root ganglion; fp, floor plate;
vz, ventricular zone; dm, dermomyotome;
s, somite. Scale bar, 0.25 mm.
|
|

View larger version (123K):
[in this window]
[in a new window]
|
Figure 5.
Expression of murine netrin-3 and
murine netrin-1 at different stages at the forelimb
level. A-C, Murine netrin-3 at E10.5
(A), E11.5 (B), and E12.5
(C). D-F, Expression of murine
netrin-3 at E14.5 in transverse sections
(D), with higher magnification showing expression
in the lung (E) and in the muscles
(E, F). G-I,
Expression of murine netrin-1 at E14.5 in sections
adjacent to those in D-F, respectively. Note that the
expression patterns of netrin-1 and
netrin-3 are similar in muscles and the lung.
d, Dorsal root ganglion; lb, limb bud;
o, oesophagus; cm, condensing mesenchyme;
m, muscle; l, lung; sc,
spinal cord. Scale bar: A-D, G, 1.4 mm;
E, F, H, I,
0.33 mm.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
Figure 6.
Expression of murine netrin-3 in
the head region of the mouse embryo at E9.5 (A),
E10.5 (B), E11.5 (C), and
E12.5 (D). V, Trigeminal ganglion;
VII, geniculate ganglion; VIII,
vestibular ganglion; IX, glossopharyngeal ganglion;
f, forebrain; h, hindbrain;
m, mesenchyme. Arrows, Thalamus;
arrowheads, positive signal in the ventral aspect of the
neural tube in the hindbrain. Scale bar, 1.4 mm.
|
|
At E9.5, the expression of netrin-3 visualized on transverse
sections at the forelimb level was highest in condensing dorsal root
ganglia (Fig. 4A). This expression in the dorsal root
ganglia persists through E12.5 (Fig. 5A-C) but then reduces
in intensity by E14.5 (Fig. 5D). We also observed expression
in mesenchymal tissues. At E9.5 and E10.5, low diffuse signals were
seen in the mesenchyme (Fig. 5A). At E11.5 and E12.5, this
signal is mostly localized in the condensing mesenchyme (Fig.
5B,C). At E14.5, the expression of
netrin-3 was found in the differentiating myotubes (Fig.
5D-F). The expression of murine netrin-1
was also examined at E14.5 and compared with that of murine
netrin-3. Interestingly, at this later stage of development,
with the exception of the spinal cord, murine netrin-3 and
murine netrin-1 have very similar expression patterns,
especially in the muscles and in the bronchi of the lung (Fig.
5G-I), indicating that the two genes may have similar or redundant functions in these tissues at this stage of development.
In the head region, expression at E9.5 is highest in the
differentiating trigeminal (V) ganglion, the geniculate (VII) ganglion, the vestibular (VIII) ganglion, the glossopharyngeal (IX) ganglion, and
the nodose and jugular (X) ganglia (Fig. 6A and data
not shown). This expression persists through E12.5 (Fig. 6) and is
reduced by E14.5 (data not shown). At E11.5 and E12.5, the murine
netrin-3 gene is also expressed in the developing thalamus
(Fig. 6C,D). In addition, a lower level of
expression was also observed in mesenchymal tissues at all these
stages. At later stages (after E16.5), expression of
netrin-3 is still observed in many regions of the brain but
at moderate or low levels and very diffusely (data not shown).
Murine netrin-3 binds to known netrin receptors
To help elucidate the possible function of murine netrin-3, we
examined whether the netrin-3 protein binds to known netrin receptors.
Murine netrin-3 protein was expressed with a C-terminal c-myc epitope
tag in 293 EBNA cells (see Materials and Methods). The expression of
the protein was confirmed by Western analysis using monoclonal antibody
9E10, which recognizes the myc epitope (data not shown). Netrin-3
protein was purified and used in binding assays (see Materials and
Methods). Netrin-3 was found to bind all the receptors to which
netrin-1 binds, including DCC, neogenin, UNC5H1, UNC5H2, and UNC5H3
(Fig. 7), suggesting that netrin-3 may
function through these receptors.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 7.
Murine netrin-3 protein binds to the netrin
receptors DCC (A), neogenin
(B), UNC5H1 (D), UNC5H2
(E), and UNC5H3 (F) but not
a control protein of the immunoglobulin gene superfamily, L1
(C). Scale bar, 40 µm.
|
|
The affinity of the receptors for murine netrin-3 was estimated in
equilibrium binding experiments using netrin-3(VI.V)-Fc, a fusion of
the N-terminal two-thirds of netrin-3 to the constant portion of human
IgG. A similar fusion of chick netrin-1 to Fc, the netrin-1(VI.V)-Fc
protein, has been used to estimate the affinity of the receptors for
netrin-1. This netrin-1 derivative is bioactive but, unlike full-length
netrin-1, it does not aggregate at high concentrations, thereby
improving the reliability of binding estimates (Keino-Masu et al.,
1996 ; Leonardo et al., 1997 ). Specific binding of netrin-3(VI.V)-Fc to
each of the receptors showed saturation, and binding curves were fitted
to the Hill equation, yielding Kd values
of 11.5, 3.0, 6.2, 3.3, and 4.5 nM for DCC, neogenin, UNC5H1, UNC5H2, and UNC5H3, respectively (Fig.
8). These values are comparable with
those observed for the binding of netrin-1(VI.V)-Fc to its receptors
(Keino-Masu et al., 1996 ; Leonardo et al., 1997 ), with the exception of
the affinity for DCC, which is four times lower for netrin-3(VI.V)-Fc
than for netrin-1(VI.V)-Fc. We were not able to perform binding
experiments with full-length netrin-3 because it also aggregates at
high concentrations, particularly those necessary to evaluate binding
to DCC. However, it seems reasonable to make use of the estimates
obtained using netrin-3(VI.V)-Fc because the (VI.V)-Fc construct has
been shown to be a reliable indicator of binding interactions in the
case of netrin-1 (Keino-Masu et al., 1996 ).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 8.
Equilibrium binding of the
netrin-3(VI.V)-Fc fusion protein to UNC5H1, UNC5H2, UNC5H3, neogenin,
and DCC. Binding of netrin-3(VI.V)-Fc was determined by measuring the
radioactivity associated with cells after subsequent incubation with
radiolabeled anti-human IgG antibody. Specific binding curves were
fitted using the Hill equation. Kd values
for the interaction of netrin-3(VI.V)-Fc with UNC5H1, UNC5H2, UNC5H3,
neogenin, and DCC are 6.2, 3.3, 4.5, 3.0, and 11.5 nM,
respectively.
|
|
Murine netrin-3 has outgrowth-promoting activity for spinal
commissural axons and chemorepulsive activity for trochlear motor
axons
Given that netrin-3 and netrin-1 bind to the same receptors, we
examined further whether murine netrin-3 can mimic the previously documented activities of chick netrin-1 in vitro. We
therefore first tested whether cells expressing murine netrin-3 or
purified murine netrin-3 protein can also elicit commissural axon
outgrowth from E13 dorsal explants, an activity that in the case of
netrin-1 requires the function of the DCC receptor (Keino-Masu et al., 1996 ). Aggregates of transfected cells secreting recombinant murine netrin-3 always elicited directional axon outgrowth (n > 20) (Fig. 9B), whereas
purified murine netrin-3 protein always elicited radial axon outgrowth
from spinal cord explants (n > 15) (Fig. 9C). However, the concentration of murine netrin-3 required
to elicit optimal commissural axon outgrowth from E13 explants is 120 µg/ml (data not shown), approximately fourfold higher than that of
netrin-1 (Kennedy et al., 1994 ), consistent with the lower apparent
affinity of netrin-3(VI.V)-Fc for DCC.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 9.
Outgrowth-promoting and chemorepulsive
actions of netrin-3 in vitro.
A-C, E13 dorsal spinal cord explants
were cocultured with 293 EBNA cells mock-transfected with the vector
pCEP4 (A), with transfected 293 EBNA cells
expressing netrin-3 (B) or with purified netrin-3
protein (120 µg/ml) (C). Netrin-3 promoted the outgrowth
of spinal commissural axons from these explants. D,
E, Explants of the ventral half of the HMJ of
E11 rat embryos were cultured with 293 EBNA cells mock-transfected with
the vector pCEP4 (D) or with transfected 293 EBNA
cells expressing netrin-3 (E). Trochlear motor
axons (arrows) originating from cell bodies in the
trochlear nucleus (IV) extended dorsally away
from the floor plate (FP) and into the collagen matrix.
They continued to grow dorsally in the presence of control cells
(D) but were repelled by netrin-3-secreting cells
(E). In D and E,
dots show the outline of aggregates of transfected
cells. Scale bar, 33 µm.
|
|
We next examined whether netrin-3 also possesses chemorepulsive
activity toward trochlear motor axons, an activity previously demonstrated for netrin-1 (Colamarino and Tessier-Lavigne, 1995 ). We
therefore cocultured aggregates of transfected cells expressing netrin-3 with explants of ventral neural tube taken from the
hindbrain-midbrain junction (HMJ) from E11 rats, which contain the
cell bodies of trochlear motor neurons, as well as floor plate cells.
In control cultures, trochlear motoneurons extend axons along a
dorsally directed trajectory away from the floor plate within the
explant. When they reach the cut edge of the explant, they project out into the collagen matrix and continue along their dorsal trajectory, unimpeded by control cells (n = 9 of 10 explants with a
large axon bundle directed to the cells) (Fig. 9D)
(Colamarino and Tessier-Lavigne, 1995 ). In contrast, when cultured with
cells expressing netrin-3, the axons grew dorsally within the explant
but, as they emerged into the collagen, they redirected their growth
away from the exogenous source of netrin-3 (n = 0 of 10 explants with large bundles; two of these had short and splayed
bundles, whereas the other eight had redirected their axons completely,
as in Fig. 9E). These effects were similar to those observed
with cells secreting netrin-1 (Colamarino and Tessier-Lavigne, 1995 ).
Thus, netrin-3 also possesses chemorepulsive activity. Unfortunately,
the qualitative nature of the assay did not make it possible to assess
the specific activity of netrin-3 in repulsion.
 |
DISCUSSION |
We have described the cloning, expression, binding properties, and
in vitro outgrowth-promoting activity of murine netrin-3. We
found that this netrin gene is expressed in sensory ganglia, some CNS
regions, mesenchymal tissues, and differentiating muscles. In addition,
murine netrin-3 binds to all the receptor molecules to which netrin-1
is known to bind and mimics the outgrowth-promoting activity of
netrin-1 on spinal cord commissural neurons and its chemorepulsive
activity on trochlear motor axons. However, unlike netrin-1, netrin-3
binds to these receptors differentially, showing lower affinity for DCC
and, presumably as a consequence, lower specific activity than netrin-1
in the commissural axon outgrowth assay (its specific activity in the
chemorepulsive assay has not been assessed).
The high level of homology between murine netrin-3 and human
NTN2L indicates that murine netrin-3 is likely to
be the ortholog of human NTN2L. This conclusion is further
supported by the fact that murine netrin-3 maps to a region
of mouse chromosome 17 that is syntenic to the region of human
chromosome 16p13.3 to which NTN2L maps. In contrast, the
lower homology between murine netrin-3 and chick
netrin-2 suggests that murine netrin-3 may not be
an ortholog of chick netrin-2. In agreement with this, we
found that the expression pattern of murine netrin-3,
especially during early stages of development, does not correspond to
that of chick netrin-2. One important difference is that
chick netrin-2 is expressed in the ventral two-thirds of the
spinal cord at approximately the time when commissural axons extend to
the midline and has been suggested to form with netrin-1
(which is expressed in the floor plate), a gradient of netrin protein
in the chick spinal cord (Kennedy et al., 1994 ). In contrast, in the
mouse, netrin-3 is not expressed in the ventral spinal cord
at early stages. Instead, murine netrin-1 alone is expressed
both in the floor plate and the ventral two-thirds of the spinal cord
(Serafini et al., 1996 ), suggesting that it may subserve the functions
of both chick netrin-1 and chick netrin-2.
Outside the spinal cord, the distribution pattern of murine
netrin-3 is similar to that of chick netrin-2 in
some respects but different in others. For example, both chick netrin-2 and murine netrin-3 are expressed in
dorsal root ganglia; however, the onset of expression of chick
netrin-2 occurs at a later developmental stage than that of
mouse netrin-3, which appears to be expressed as soon as
neuronal differentiation commences in the ganglia. Similarly, murine
netrin-3 is expressed as soon as neuronal differentiation
starts in condensing cranial sensory ganglia, whereas no expression of
chick netrin-2 was detected in cranial ganglia at comparable
developmental stages (stages 16 to 26; data not shown). Other
differences include the expression pattern in the dermomyotome and
mesenchymal cells.
In addition to differences in sites of expression, a further apparent
difference is that murine netrin-3 protein has a lower affinity for DCC
than does netrin-1. Presumably as a consequence, murine netrin-3 has a
lower specific activity in promoting commissural axon outgrowth in cell
culture. It is difficult to make a precise comparison between
affinities of chicken netrin-2 and mouse netrin-3 because the
Kd for interaction of chick netrin-2 with DCC
has not been measured. However, during the purification of the netrins from chick brain no striking difference in specific activity of the two
chick proteins was observed (Serafini et al., 1994 ), suggesting that
chick netrin-1 and netrin-2 likely have similar affinities for DCC and
that chick netrin-2 may also bind DCC with higher affinity than does
mouse netrin-3. Together, the differences in sequence, in expression
pattern, and possibly in binding characteristics suggest that murine
netrin-3 is neither the ortholog nor the functional homolog
of chick netrin-2. It will be of interest to determine whether there is a mouse ortholog of chick netrin-2 and,
conversely, whether there is a chick ortholog of mouse
netrin-3.
Particularly striking sites of expression of murine netrin-3
are in sensory ganglia and, to a lesser extent, in the developing motor
columns. Although we do not know whether it is expressed by neurons or
by glia in the sensory ganglia and motor column, the onset of
expression in the sensory ganglia correlates with the onset of neuronal
differentiation in these ganglia. If it is expressed by the neurons, it
is possible that the neurons secrete netrin-3 and that secreted
netrin-3 is displayed on axonal surfaces. It is known that the
receptors neogenin, UNC5H1, and UNC5H2 are also expressed in the dorsal
root ganglia and that DCC, neogenin, and UNC5H1 are expressed in the
motor column (Keino-Masu et al., 1996 ; Leonardo et al., 1997 ). Netrin-3
protein produced by sensory neurons and motoneurons might therefore in
principle bind to peripheral sensory and motor axons via these
receptors. Indeed, in Drosophila, netrins are expressed in
neurons throughout the CNS, and netrin protein can be detected
immunohistochemically associated with axon tracts (Harris et al., 1996 ;
Mitchell et al., 1996 ). Interestingly, in Drosophila mutants
that carry a deletion of both netrin genes, occasional
breaks in the longitudinal axon tracts are observed, suggesting that
proper fasciculation may require netrin expression (Mitchell et al.,
1996 ). Similarly, expression of UNC-6 in neurons in C. elegans is consistent with the hypothesis that netrin may produce
some of its effects locally by being presented on axonal surfaces
(Wadsworth et al., 1996 ). Thus, if netrin-3 is expressed on sensory
axons in the mouse, it may regulate the fasciculation of axons or
provide a guidance cue for later developing axons that encounter the
axons of netrin-3-expressing neurons.
In addition to its expression in sensory ganglia, murine
netrin-3 is also expressed in a striking pattern in the
differentiating muscles. Murine netrin-3 mRNA is first
detected in myoblasts at low levels at approximately E10.5, and by
E14.5, it is clearly expressed in the muscle cells. Interestingly,
murine netrin-1 shows similar expression in muscles at
E14.5, although a much higher level expression of murine
netrin-1 is detected in the migrating myoblasts at E10.5
(Fig. 4). Although we do not know whether both genes are coexpressed in
the same muscle cells at E14.5, the fact that they are both expressed
in muscles suggests that mammalian netrin-1 and netrin-3 may both play
a role in guiding peripheral axons to their correct muscle targets. A
precedent for this is provided by the expression of netrin genes by
subsets of muscle cells in Drosophila, and the demonstration
that loss of netrin function, as well as ectopic expression of netrins
in inappropriate muscles, can cause targeting defects for subsets of
motor axons (Mitchell et al., 1996 ; Winberg et al., 1998 ). Whether
netrins are required for peripheral motor axon guidance in mammals will
require the examination of axon trajectories in mice lacking the
function of netrin-1 and netrin-3.
In vitro murine netrin-3 protein appears to bind all the
receptor proteins to which netrin-1 binds and can mimic both the outgrowth-promoting activity of netrin-1 on commissural axons and the
chemorepulsive activity of netrin-1 on trochlear motor axons. The
affinity with which netrin-3(VI.V)-Fc binds to neogenin, UNC5H1,
UNC5H2, and UNC5H3 is comparable with that of netrin-1(VI.V)-Fc (Keino-Masu et al., 1996 ; Leonardo et al., 1997 ). However, the affinity
of netrin-3(VI.V)-Fc for DCC is lower than for all other netrin
receptors we tested and is approximately fourfold lower than that of
netrin-1(VI.V)-Fc. It will therefore be of interest to determine
whether netrin-3 in vivo is specialized for interactions with netrin receptors other than DCC and, in particular, for
chemorepulsion. Examination of the loss-of-function phenotype of
netrin-3 mutant mice should help address this issue and determine its
role in axon guidance and in the development of non-neural tissues.
 |
FOOTNOTES |
Received Jan. 7, 1999; revised April 2, 1999; accepted April 7, 1999.
This work was supported by a fellowship from the American Cancer
Society to H.W. and a grant from the National Institutes of Health to
M.T.L. M.T.L. is an Investigator of the Howard Hughes Medical
Institute. N.G.C., D.J.G., and N.A.J. were supported by the National
Cancer Institute, the Department of Health and Human Services,
under contract with Advanced Bioscience Laboratories. We thank Drs.
Yuan Zhang and Tim Kennedy for participating in initial experiments and
Sasha Faynboym for technical assistance.
Correspondence should be addressed to Marc Tessier-Lavigne, Department
of Anatomy, University of California, 513 Parnassus Avenue, Room
S-1479, San Francisco, CA 94143-0452.
 |
REFERENCES |
-
Ackerman SL,
Kozak LP,
Przyborski SA,
Rund LA,
Boyer BB,
Knowles BB
(1997)
The mouse rostral cerebellar malformation gene encodes an UNC-5-like protein.
Nature
386:838-842[Medline].
-
Chan SS,
Zheng H,
Su MW,
Wilk R,
Killeen MT,
Hedgecock EM,
Culotti JG
(1996)
UNC-40, a C. elegans homolog of DCC (deleted in colorectal cancer), is required in motile cells responding to UNC-6 netrin cues.
Cell
87:187-195[Web of Science][Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenochloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Colamarino SA,
Tessier-Lavigne M
(1995)
The axonal chemoattractant netrin-1 is also a chemorepellent for trochlear motor axons.
Cell
81:621-629[Web of Science][Medline].
-
Copeland NG,
Jenkins N
(1991)
Development and applications of a molecular genetic linkage map of the mouse genome.
Trends Genet
7:113-118[Web of Science][Medline].
-
Culotti J,
Merz D
(1998)
DCC and netrins.
Curr Opin Cell Biol
10:609-613[Web of Science][Medline].
-
de la Torre J,
Hopker V,
Ming G,
Poo M,
Tessier-Lavigne M,
Hemmati-Brivanlou A,
Holt C
(1997)
Turning of retinal growth cones in a netrin-1 gradient mediated by the netrin receptor DCC.
Neuron
19:1211-1224[Web of Science][Medline].
-
Fazeli A,
Dickinson S,
Hermiston M,
Tighe R,
Steen R,
CG S,
Stoeckli E,
Keino-Masu K,
Masu M,
Rayburn H
(1997)
Phenotype of mice lacking functional deleted in colorectal cancer (DCC) gene.
Nature
386:796-804[Medline].
-
Green MC
(1989)
Catalog of mutant genes and polymorphic loci.
In: Genetic variants and strains of the laboratory mouse (Lyon MF,
Searle AG,
eds), pp 12-403. Oxford: Oxford UP.
-
Hamelin M,
Zhou Y,
Su MW,
Scott IM,
Culotti JG
(1993)
Expression of the UNC-5 guidance receptor in the touch neurons of C. elegans steers their axons dorsally.
Nature
364:327-330[Medline].
-
Harlow E,
Lane D
(1988)
In: Antibodies. Plainview, NY: Cold Spring Harbor Laboratory.
-
Harris R,
Sabatelli L,
Seeger M
(1996)
Guidance cues at the Drosophila CNS midline: identification and characterization of two Drosophila Netrin/UNC-6 homologs.
Neuron
17:217-228[Web of Science][Medline].
-
Hedgecock EM,
Culotti JG,
Hall DH
(1990)
The unc-5, unc-6, and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans.
Neuron
4:61-85[Web of Science][Medline].
-
Ishii N,
Wadsworth WG,
Stern BD,
Culotti JG,
Hedgecock EM
(1992)
UNC-6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans.
Neuron
9:873-881[Web of Science][Medline].
-
Jenkins NA,
Copeland NG,
Taylor BA,
Lee BK
(1982)
Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus.
J Virol
43:26-36[Abstract/Free Full Text].
-
Keino-Masu K,
Masu M,
Hinck L,
Leonardo ED,
Chan SS,
Culotti JG,
Tessier-Lavigne M
(1996)
Deleted in colorectal cancer (DCC) encodes a netrin receptor.
Cell
87:175-185[Web of Science][Medline].
-
Kennedy TE,
Serafini T,
de la Torre JR,
Tessier-Lavigne M
(1994)
Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord.
Cell
78:425-435[Web of Science][Medline].
-
Kolodziej PA,
Timpe LC,
Mitchell KJ,
Fried SR,
Goodman CS,
Jan LY,
Jan YN
(1996)
frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance.
Cell
87:197-204[Web of Science][Medline].
-
Lauderdale J,
Davis N,
Kuwada J
(1997)
Axon tracts correlate with netrin-1a expression in the zebrafish embryo.
Mol Cell Neurosci
9:293-313[Web of Science][Medline].
-
Leonardo ED,
Hinck L,
Masu M,
Keino-Masu K,
Ackerman SL,
Tessier-Lavigne M
(1997)
Vertebrate homologues of C. elegans UNC-5 are candidate netrin receptors.
Nature
386:833-838[Medline].
-
Leung-Hagesteijn C,
Spence AM,
Stern BD,
Zhou Y,
Su MW,
Hedgecock EM,
Culotti JG
(1992)
UNC-5, a transmembrane protein with immunoglobulin and thrombospondin type 1 domains, guides cell and pioneer axon migrations in C. elegans.
Cell
71:289-299[Web of Science][Medline].
-
Meyerhardt JA,
Caca K,
Eckstrand BC,
Hu G,
Lengauer C,
Banavali S,
Look AT,
Fearon ER
(1999)
Netrin-1 interaction with deleted in colorectal cancer (DCC) and alterations in brain tumors and neuroblastomas.
Cell Growth Differ
10:35-42[Abstract/Free Full Text].
-
Mitchell KJ,
Doyle JL,
Serafini T,
Kennedy TE,
Tessier-Lavigne M,
Goodman CS,
Dickson BJ
(1996)
Genetic analysis of Netrin genes in Drosophila: netrins guide CNS commissural axons and peripheral motor axons.
Neuron
17:203-215[Web of Science][Medline].
-
Rooney RJ,
Daniels R,
Jenkins NA,
Gilbert DJ,
Rothammer K,
Morris SW,
Higgs DR,
Copeland NG
(1998)
Chromosomal location and tissue expression of the gene encoding the adenovirus E1A-regulated transcription factor E4F in humans and mice.
Mamm Genome
9:320-323[Medline].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning, a laboratory manual. Plainview, NY: Cold Spring Harbor Laboratory.
-
Serafini T,
Kennedy TE,
Galko MJ,
Mirzayan C,
Jessell TM,
Tessier-Lavigne M
(1994)
The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6.
Cell
78:409-424[Web of Science][Medline].
-
Serafini T,
Colamarino SA,
Leonardo ED,
Wang H,
Beddington R,
Skarnes WC,
Tessier-Lavigne M
(1996)
Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system.
Cell
87:1001-1014[Web of Science][Medline].
-
Strahle U,
Fischer N,
Blader P
(1997)
Expression and regulation of a netrin homologue in the zebrafish embryo.
Mech Dev
62:147-160[Web of Science][Medline].
-
Tessier-Lavigne M,
Goodman CS
(1996)
The molecular biology of axon guidance.
Science
274:1123-1133[Abstract/Free Full Text].
-
van Raay TJ,
Foskett SM,
Connors TD,
Klinger KW,
Landes GM,
Burn TC
(1997)
The NTN2L gene encoding a novel human netrin maps to the autosomal dominant polycyctic kidney disease region on chromosome 16p13.3.
Genomics
41:279-282[Medline].
-
Wadsworth W,
Bhatt H,
Hedgecock E
(1996)
Neuroglia and pioneer neurons express UNC-6 to provide global and local netrin cues for guiding migrations in C. elegans.
Neuron
16:35-46[Web of Science][Medline].
-
Wang H,
Kunkel DD,
Schwartzkrion PA,
Tempel BL
(1994)
Localization of Kv1.1 and Kv1.2, two K channel proteins, to synaptic terminals, somata and dendrites in the mouse brain.
J Neurosci
14:4588-4599[Abstract].
-
Winberg M,
Mitchell K,
Goodman C
(1998)
Genetic analysis of the mechanisms controlling target selection: complementary and combinatorial functions of netrins, semaphorins, and IgCAMs.
Cell
93:581-591[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19124938-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. H. Conrad, M. Albrecht, M. Pettit-Scott, and G. W. Conrad
Embryonic Corneal Schwann Cells Express Some Schwann Cell Marker mRNAs, but No Mature Schwann Cell Marker Proteins
Invest. Ophthalmol. Vis. Sci.,
September 1, 2009;
50(9):
4173 - 4184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Larrivee, C. Freitas, S. Suchting, I. Brunet, and A. Eichmann
Guidance of Vascular Development: Lessons From the Nervous System
Circ. Res.,
February 27, 2009;
104(4):
428 - 441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Masuda, K. Watanabe, C. Sakuma, K. Ikenaka, K. Ono, and H. Yaginuma
Netrin-1 Acts as a Repulsive Guidance Cue for Sensory Axonal Projections toward the Spinal Cord
J. Neurosci.,
October 8, 2008;
28(41):
10380 - 10385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Larrivee, C. Freitas, M. Trombe, X. Lv, B. DeLafarge, L. Yuan, K. Bouvree, C. Breant, R. Del Toro, N. Brechot, et al.
Activation of the UNC5B receptor by Netrin-1 inhibits sprouting angiogenesis
Genes & Dev.,
October 1, 2007;
21(19):
2433 - 2447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. I. Schneiders, B. Maertens, K. Bose, Y. Li, W. J. Brunken, M. Paulsson, N. Smyth, and M. Koch
Binding of Netrin-4 to Laminin Short Arms Regulates Basement Membrane Assembly
J. Biol. Chem.,
August 17, 2007;
282(33):
23750 - 23758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Kennedy, H. Wang, W. Marshall, and M. Tessier-Lavigne
Axon Guidance by Diffusible Chemoattractants: A Gradient of Netrin Protein in the Developing Spinal Cord.
J. Neurosci.,
August 23, 2006;
26(34):
8866 - 8874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. Burgess, T. J. Jucius, and S. L. Ackerman
Motor Axon Guidance of the Mammalian Trochlear and Phrenic Nerves: Dependence on the Netrin Receptor Unc5c and Modifier Loci
J. Neurosci.,
May 24, 2006;
26(21):
5756 - 5766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Krauss, F. Cole, U. Gaio, G. Takaesu, W. Zhang, and J.-S. Kang
Close encounters: regulation of vertebrate skeletal myogenesis by cell-cell contact
J. Cell Sci.,
June 1, 2005;
118(11):
2355 - 2362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Eichmann, T. Makinen, and K. Alitalo
Neural guidance molecules regulate vascular remodeling and vessel navigation
Genes & Dev.,
May 1, 2005;
19(9):
1013 - 1021.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Autiero, F. De Smet, F. Claes, and P. Carmeliet
Role of neural guidance signals in blood vessel navigation
Cardiovasc Res,
February 15, 2005;
65(3):
629 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Park, D. Crouse, M. Lee, S. K. Karnik, L. K. Sorensen, K. J. Murphy, C. J. Kuo, and D. Y. Li
The axonal attractant Netrin-1 is an angiogenic factor
PNAS,
November 16, 2004;
101(46):
16210 - 16215.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-S. Kang, M.-J. Yi, W. Zhang, J. L. Feinleib, F. Cole, and R. S. Krauss
Netrins and neogenin promote myotube formation
J. Cell Biol.,
November 8, 2004;
167(3):
493 - 504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Mehlen and E. R. Fearon
Role of the Dependence Receptor DCC in Colorectal Cancer Pathogenesis
J. Clin. Oncol.,
August 15, 2004;
22(16):
3420 - 3428.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-i. Murase and A. F. Horwitz
Deleted in Colorectal Carcinoma and Differentially Expressed Integrins Mediate the Directional Migration of Neural Precursors in the Rostral Migratory Stream
J. Neurosci.,
May 1, 2002;
22(9):
3568 - 3579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Manitt, M. A. Colicos, K. M. Thompson, E. Rousselle, A. C. Peterson, and T. E. Kennedy
Widespread Expression of Netrin-1 by Neurons and Oligodendrocytes in the Adult Mammalian Spinal Cord
J. Neurosci.,
June 1, 2001;
21(11):
3911 - 3922.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koch, J. R. Murrell, D. D. Hunter, P. F. Olson, W. Jin, D. R. Keene, W. J. Brunken, and R. E. Burgeson
A Novel Member of the Netrin Family, {beta}-Netrin, Shares Homology with the {beta} Chain of Laminin: Identification, Expression, and Functional Characterization
J. Cell Biol.,
October 16, 2000;
151(2):
221 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakashiba, T. Ikeda, S. Nishimura, K. Tashiro, T. Honjo, J. G. Culotti, and S. Itohara
Netrin-G1: a Novel Glycosyl Phosphatidylinositol-Linked Mammalian Netrin That Is Functionally Divergent from Classical Netrins
J. Neurosci.,
September 1, 2000;
20(17):
6540 - 6550.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|