 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 1999, 19(13):5228-5235
Selective Excitation of Subtypes of Neocortical Interneurons by
Nicotinic Receptors
James T.
Porter,
Bruno
Cauli,
Keisuke
Tsuzuki,
Bertrand
Lambolez,
Jean
Rossier, and
Etienne
Audinat
Neurobiologie et Diversité Cellulaire, Centre National de la
Recherche Scientifique, Unité Mixte de Recherche 7637, Ecole
Supérieure de Physique et de Chimie Industrielles, 75231 Paris
Cedex 05, France
 |
ABSTRACT |
The cellular mechanisms by which neuronal nicotinic cholinergic
receptors influence many aspects of physiology and pathology in the
neocortex remain primarily unknown. Whole-cell recordings and
single-cell reverse transcription (RT)-PCR were combined to analyze the
effect of nicotinic receptor agonists on different types of neurons in
acute slices of rat neocortex. Nicotinic receptor agonists had no
effect on pyramidal neurons and on most types of interneurons,
including parvalbumin-expressing fast spiking interneurons and
somatostatin-expressing interneurons, but selectively excited a
subpopulation of interneurons coexpressing the neuropeptides vasoactive
intestinal peptide (VIP) and cholecystokinin. This excitation
persisted in the presence of glutamate, GABA, and muscarinic receptor
antagonists and in the presence of tetrodotoxin and low extracellular
calcium, suggesting that the depolarization was mediated through the
direct activation of postsynaptic nicotinic receptors. The responses
were blocked by the nicotinic receptor antagonists
dihydro- -erythroidine and mecamylamine and persisted in the presence
of the 7 selective nicotinic receptor antagonist methyllycaconitine,
suggesting that the involved nicotinic receptors lacked the 7
subunit. Single-cell RT-PCR analysis indicated that the majority of the
interneurons that responded to nicotinic stimulation coexpressed the
4, 5, and 2 nicotinic receptor subunits. Therefore, these
results provide a role for non- 7 nicotinic receptors in the
selective excitation of a subpopulation of neocortical interneurons. Because the neocortical interneurons expressing VIP have been proposed
previously to regulate regional cortical blood flow and metabolism,
these results also provide a cellular basis for the neuronal regulation
of cortical blood flow mediated by acetylcholine.
Key words:
single-cell PCR; neuropeptides; calcium-binding proteins; methyllycaconitine; dihydro- -erythroidine; acetylcholine; mecamylamine
 |
INTRODUCTION |
Nicotinic receptors are implicated
in many important functions of the mammalian neocortex, including
memory formation (Granon et al., 1995 ) and neuronal regulation of
regional cerebral blood flow (Gitelman and Prohovnik, 1992 ; Uchida et
al., 1997 ), as well as cortical pathologies such as Alzheimer's
disease (Whitehouse et al., 1988 ; Newhouse et al., 1997 ), epilepsy
(Steinlein et al., 1995 ), and Tourette's syndrome (Sanberg et al.,
1997 , 1998 ). The cellular basis for the effects of nicotinic receptor
stimulation is currently unknown but lies within its effects on the
complex interactions between the excitatory glutamatergic pyramidal
neurons and the inhibitory interneurons.
A variety of different neuronal nicotinic receptor subunits have been
cloned and named 2- 9 and 2- 4 (Elgoyhen et al., 1994 ; Le
Novere and Changeux, 1995 ). Classically, two broad subfamilies of
nicotinic receptors have been characterized in neurons according to
their sensitivity to -bungarotoxin. Subunits 7 and 8 form a
family of -bungarotoxin-sensitive channels (Couturier et al., 1990 ),
whereas subunits 2- 6 combine with subunits 2- 4 to produce -bungarotoxin-insensitive channels (Sargent, 1993 ). In
situ hybridization studies indicate that only 3, 4, 5,
7, and 2 subunits are expressed in the rat neocortex (Wada et
al., 1989 , 1990 ; Lena and Changeux, 1997 ). In this structure as in
other brain areas, functional studies have suggested that 7
nicotinic receptors present on the axonal terminals of excitatory
neurons modulate the release of glutamate (Vidal and Changeux, 1993 ;
McGehee et al., 1995 ; Gray et al., 1996 ; Role and Berg, 1996 ; Gil et
al., 1997 ). In contrast, the functional role of non- 7 nicotinic
receptors, which are also widely expressed in the neocortex, is still
unknown (Sivilotti and Colquhoun, 1995 ). In rodents, neocortical
pyramidal cells are not directly depolarized by nicotinic agonists
(Vidal and Changeux, 1993 ; Gil et al., 1997 ) (but see Roerig et al., 1997 ), suggesting that these non- 7 nicotinic receptors may be expressed by interneurons. Despite the general use of GABA as a
neurotransmitter, neocortical interneurons are widely heterogeneous in
terms of morphological, physiological, and biochemical characteristics (McCormick et al., 1985 ; Kubota et al., 1994 ; Thomson and Deuchars, 1994 ; Kawaguchi, 1995 ; Angulo et al., 1997 ; Cauli et al., 1997 ; Porter
et al., 1998 ; Xiang et al., 1998 ). Therefore, the stimulation of
different types of neocortical interneurons can produce a large variety
of functional outcomes. In the present work, we examined pyramidal and
nonpyramidal neurons of rat neocortical slices for responsiveness to
nicotinic receptor agonists to determine the neuronal types excited by
nicotinic receptor stimulation and the nicotinic receptors involved.
Responsive neurons were then identified using electrophysiological and
molecular criteria. The results indicate that nicotinic receptor
stimulation in the neocortex selectively excites an interneuronal
population coexpressing vasoactive intestinal peptide (VIP) and
cholecystokinin (CCK) through the activation of nicotinic receptors
containing 4, 5, and 2 subunits.
 |
MATERIALS AND METHODS |
The procedures for preparation of the brain slices and
whole-cell recordings of visualized neurons have been described
previously (Cauli et al., 1997 ; Porter et al., 1998 ). In brief, Wistar
rats (13-36 postnatal days) were anesthetized with a mixture of
xylazine (14 mg/kg) and ketamine (65 mg/kg) and killed by decapitation. Parasagittal sections (300-µm-thick) of cerebral cortex were
prepared. The slices were incubated at room temperature (20-25°C) in
artificial CSF (ACSF) containing (in mM): NaCl
121.0, KCl 2.5, NaH2PO4 1.25, CaCl2
2, MgCl2 1, NaHCO3 26, glucose 20, and pyruvate
5, which was bubbled with a mixture of 95% O2 and 5%
CO2. Slices were transferred to a chamber and perfused at
1-2 ml/min with ACSF (34°C).
Neurons were recorded in layers II, III, and V of the motor cortex
using the whole-cell configuration of the patch-clamp technique. Patch
pipettes (3-5 M ), pulled from borosilicate glass, were filled with
8 µl of internal solution containing (in mM): K gluconate 144, MgCl2 3, EGTA 0.2, and HEPES 10, pH 7.2 (285/295 mOsm). All membrane potential values obtained with this
solution were corrected for the junction potential of 11 mV. The
I-V relationship of the
1,1-dimethyl-4-phenyl-piperazinium iodide (DMPP)-induced currents was
measured with an internal solution containing (in mM):
CsGluconate 117, CsCl 12, HEPES 10, EGTA 0.2, and MgCl2 3, pH 7.2. The firing behavior of the neurons was tested by applying
depolarizing current pulses at a membrane potential of 71 mV. Action
potential discharges were recorded using the current-clamp fast
mode of the Axopatch 200A amplifier (Axon instruments, Foster City,
CA). Only cells with a resting membrane potential more negative than
50 mV were analyzed. In current-clamp and voltage-clamp experiments,
the signals were filtered, respectively, at 5 and 1 kHz, digitized at
10-20 kHz, saved to a personal computer, and analyzed off-line with
Acquis1 software (Gérard Sadoc, Gif/Yvette, France). The series
resistance was not compensated but was monitored throughout the
experiments. DMPP (100-500 µM) and acetylcholine (100 µM) in ACSF were applied by pressure from a large pipette
onto the recorded neuron. All reported values are expressed as the
mean ± SD of the mean. Antagonists were added directly to
the bathing solution.
At the end of the recording, the content of the cell was
aspirated under visual control into the recording pipette and expelled into a test tube, where reverse transcription (RT) was performed in a
final volume of 10 µl (Lambolez et al., 1992 ). The two steps of
multiplex PCR were performed essentially as described previously (Ruano
et al., 1995 ). The cDNAs present in 10 µl of the reverse transcription reaction were first amplified simultaneously using the
primer pairs described previously (Cauli et al., 1997 ). Taq polymerase (2.5 U; Perkin-Elmer, Emeryville, CA) and 10 pmol of each of
the primers were added to the buffer supplied by the manufacturer (final volume of 100 µl), and 20 cycles (94°C, 30 sec; 60°C, 30 sec; 72°C, 35 sec) of PCR were run. Second rounds of PCR were then
performed using 2 µl of the first PCR product as template. In this
second round, each cDNA was individually amplified using its specific
primer pair by performing 35 PCR cycles. Each individual PCR reaction
(10 µl) was then run on a 1.5% agarose gel using x174
digested by HaeIII as molecular weight markers and stained with ethidium bromide. To identify the PCR products, PCR-generated fragments obtained from each cell were transferred onto Hybond N+ (Amersham, Arlington Heights, IL). The Southern
blots were probed with specific oligonucleotides (Cauli et al., 1997 )
using the ECL 3'-oligo labeling and detection kit (Amersham)
according to the manufacturer's instructions.
To amplify the neuronal nicotinic receptor subunits by RT-multiplex
PCR, the two steps of PCR were performed as described above using the
following sets of primers (from 5' to 3', the numbers in brackets
indicate the initial and final positions of the PCR primers): 2
(GenBank accession number L10077): sense [158-175], antisense
[440-457]; 3 (GenBank accession number L32621): sense [44-66],
antisense [242-264]; 4 (GenBank accession number L31620): sense
[347-366], antisense [591-611]; 5 (GenBank accession number
J05231): sense [1203-1222], antisense [1470-1493]; 6 (GenBank
accession number L08227): sense [127-148], antisense [474-493];
7 (GenBank accession number L31619): sense [36-53], antisense
[385-404]; 2 (GenBank accession number L31622): sense
[197-215], antisense [504-522]; 3 (GenBank accession number J04636): sense [220-239], antisense [539-559]; and 4: sense CTGCTATGAAGGGGTGAACATT, antisense CCGTCCTCCGTCC TGGG.
The predicted sizes of the PCR products were (in base pairs)
2 (300), 3 (221), 4 (265), 5 (291), 6 (367), 7 (369),
2 (326), 3 (340), and 4 (347). The efficiency of this
RT-multiplex PCR protocol was tested on 2 ng of whole-brain total RNA
(see Fig. 4A). The identity of the PCR-generated
fragments were confirmed by restriction analysis (data not
shown) and by Southern blot analysis (data not shown) using the
following set of specific sense oligoprobes labeled with AlkPhos Direct
labeling and detection kit (Amersham) according to manufacturer's
instructions (from 5' to 3', the numbers in brackets indicate the
initial and final positions of the oligoprobes): 3, [ 112-132];
4, [ 511-532]; 5, [ 1294-1315]; 7, [ 123-134]; and
2, [ 477-468]. Genomic DNA amplifications, which sometimes
occurred when the nucleus was harvested, could be easily differentiated
from cDNA amplification by a size criterion. Indeed, for each primer
pair, the sense and antisense primers were positioned on two different exons.
6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) and
2-amino-5-phosphonovalerate (D-APV) were obtained from
Tocris Cookson (Bristol, UK). Picrotoxin, atropine, mecamylamine, and
DMPP were obtained from Sigma (St Louis, MO). Acetylcholine,
methyllycaconitine (MLA), and dihydro- -erythroidine were obtained
from Research Biochemicals (Natick, MA).
 |
RESULTS |
Selective nicotinic excitation of subtypes of
neocortical interneurons
To identify the neuronal targets of nicotine, pyramidal neurons
and interneurons in rat neocortical slices were first visually identified with infrared video microscopy, recorded in whole-cell configuration, and classified as irregular-spiking (IS) interneurons, regular-spiking nonpyramidal (RSNP) neurons, fast-spiking (FS) interneurons, or pyramidal neurons according to their action potential firing behavior (McCormick et al., 1985 ; Kawaguchi, 1995 ; Cauli et al.,
1997 ) (Fig. 1A-E,
left column). Then, the sensitivity of these different types
of neocortical neurons to the local pressure application of the
selective nicotinic cholinergic receptor agonist DMPP (100-500
µM) was tested.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
Distinct electrophysiologically identified types
of neocortical interneurons are excited by nicotinic receptor
stimulation. The current-clamp recordings shown in the left
column of each panel illustrate the voltage
responses exhibited by an IS interneuron (A), two
RSNP interneurons (B, C), an FS
interneuron (D), and a pyramidal neuron
(E) in response to hyperpolarizing and
depolarizing current injections. The arrowhead in
A denotes the presence of low-threshold
Ca2+ spikes. In the right column of
each panel are the responses of the same five neurons to
the local pressure application of 100 µM DMPP (1 sec).
Action potentials in the right column are truncated
because of the sampling rate. The arrows indicate the
beginning of the DMPP applications. The membrane potentials were
adjusted to 71 mV.
|
|
In response to depolarizing pulses of current, IS interneurons
typically exhibited an initial burst of action potentials, followed by
discharges of action potentials at an irregular frequency (Fig.
1A, left). The majority of IS interneurons
(77%; 17 of 22) were depolarized by DMPP sufficiently to reach action
potential threshold and fired bursts of spikes (Fig.
1A, right). As shown in the example, some
IS interneurons (4 of 22 neurons) exhibited low-threshold
Ca2+ spikes at the end of a hyperpolarizing current
pulse (Fig. 1A, arrowhead).
RSNP neurons exhibited continuous discharges of action potentials with
varying amounts of frequency adaptation accompanied by decreases in
action potential amplitude (Fig.
1B,C). Within our sample of RSNP
neurons, 63 of 100 interneurons responded to the nicotinic agonist
(Fig. 1B, right), whereas 37% did not
respond (Fig. 1C, right). The majority of the
DMPP-sensitive RSNP interneurons (94%; 59 of 63) did not exhibit
low-threshold Ca2+ spikes.
FS interneurons were characterized by their fast action potentials
discharged at high frequencies with little frequency adaptation or
decrease in action potential amplitude (Fig. 1D,
left). The majority (92%; 12 of 13) of FS interneurons were
not affected by the application of DMPP (Fig. 1D,
right).
The majority of these interneurons were recorded in layers II/III of
the motor cortex. Twenty-two interneurons (7 FS and 15 RSNP neurons)
were analyzed in layer V, among which only three RSNP neurons responded
to DMPP.
Pyramidal neurons typically fired action potentials of longer duration,
lower frequency, and with more frequency adaptation than interneurons
(Fig. 1E, left). Consistent with previous
reports (Vidal and Changeux, 1993 ; Gil et al., 1997 ), none of the
pyramidal neurons (n = 12) recorded in layers
II/III and V were directly depolarized by the application of
DMPP. Although, DMPP induced a slight depolarization of some pyramidal
neurons, these responses were blocked by glutamatergic and GABAergic
receptor antagonists (see below), indicating that they were a result
of presynaptic effects of DMPP (Fig. 1E,
right). These results indicate that IS interneurons and a
subpopulation of RSNP neurons are selectively activated by nicotinic stimulation.
Neocortical interneurons excited by nicotinic receptor stimulation
express VIP and CCK
Neocortical interneurons can also be classified by the presence of
the three calcium-binding proteins calretinin, calbindin, and
parvalbumin, and the four neuropeptides VIP, somatostatin, CCK, and
neuropeptide Y (Kubota et al., 1994 ; Kawaguchi, 1995 ; Cauli et al.,
1997 ). Ninety-six interneurons (12 FS, 13 IS, and 71 RSNP neurons) that
had been tested for sensitivity to DMPP were analyzed by
single-cell RT-PCR to detect the presence of mRNAs encoding the
above calcium binding proteins and neuropeptides, as well as the two
isoforms of the GABA-synthesizing enzyme, glutamic acid decarboxylase
(GAD65 and GAD67) (Cauli et al., 1997 ). The agarose gels of the RT-PCR
products for the two RSNP neurons described in Figure 1, B
and C, are shown in Figure 2,
A and B, respectively. GAD65 and GAD67 mRNAs were
detected in both interneurons. The RSNP neuron that was excited by DMPP
also expressed VIP, CCK, and calretinin mRNAs (Fig.
2A). In contrast, the mRNAs for somatostatin, neuropeptide Y, calbindin, and calretinin were detected in the DMPP-insensitive neuron (Fig. 2B). All 96 neocortical
interneurons examined expressed one or both isoforms of GAD, indicating
that they were inhibitory interneurons. Eighty-one of the interneurons analyzed by single-cell RT-PCR were in layers II/III, and 15 interneurons were in layer V. In the population of DMPP-sensitive
interneurons (9 IS, 1 FS, and 48 RSNP neurons), the most widely
detected markers were VIP and CCK, which were expressed, respectively,
by 51 and 45 of the 58 interneurons (Fig. 2C). VIP and CCK
were coexpressed in 41 of the interneurons. In contrast, VIP and CCK
were only detected in 8 and 15 of the 38 DMPP-insensitive interneurons
(Fig. 2D). The majority of the insensitive
interneurons expressed calbindin (26 neurons) and somatostatin (27 neurons). Therefore, the majority of the two populations of
interneurons excited by nicotinic agonists, IS neurons and a
fraction of RSNP neurons, coexpressed VIP and CCK.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
The majority of neocortical interneurons excited
by nicotinic receptor stimulation coexpress VIP and CCK.
A, B, Agarose gels of the PCR products
obtained from the two RSNP interneurons described in Figure 1,
B and C, respectively. The two
interneurons expressed GAD65, GAD67, and calretinin (CR)
mRNAs. The cell shown in A also expressed VIP and CCK,
whereas the cell in B expressed calbindin
(CB), neuropeptide Y (NPY), and
somatostatin (SS). Neither of these two cells expressed
parvalbumin (PV). The identity of all products
was confirmed by Southern blot analysis. C,
D, These graphs illustrate the percentage of
DMPP-sensitive (n = 58) and DMPP-insensitive
(n = 38) interneurons that expressed each of the
markers detected by single-cell RT-PCR. The number of interneurons in
each group is given in parentheses above the
bars. The filled portions indicate the
fraction of interneurons in each group that coexpressed VIP.
|
|
Direct stimulation of somatodendritic nicotinic receptors
To confirm that the responses to DMPP were caused by the direct
activation of the interneurons and not by presynaptic effects of
nicotinic receptor stimulation, the AMPA/kainate receptor antagonist CNQX (10 µM), the NMDA receptor antagonist
D-APV (50 µM), the GABAA receptor
antagonist picrotoxin (100 µM), and the muscarinic receptor antagonist atropine (5 µM) were added to the
bathing solution. In the presence these receptor antagonists,
100 µM DMPP still depolarized neocortical interneurons
sufficiently to discharge action potentials (data not shown) and, in
voltage-clamp experiments, the currents induced by DMPP exhibited an
inward rectification at depolarized potentials, with no current being
detected at positive potentials (n = 5) (Fig.
3A). The DMPP-mediated
currents also persisted when synaptic transmission was blocked with a
bathing solution containing 0.5 mM Ca2+,
4 mM Mg2+, and 1 µM
tetrodotoxin (n = 3; data not shown). These results indicate that the nicotinic receptor agonist directly activated the
neocortical interneurons, probably through the stimulation of
somatodendritic nicotinic receptors.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3.
Rectification and pharmacology of responses to
nicotinic receptor activation in neocortical interneurons.
A, In voltage clamp, 100 µM DMPP induced
inward currents (inset) in an interneuron with a peak
I-V relationship that showed inward rectification.
B, The currents induced by 100 µM DMPP in
an interneuron were antagonized by 500 nM
dihydro- -erythroidine (DH E). After washing out
dihydro- -erythroidine, the DMPP-induced current partially recovered
(Wash) and was almost abolished by 2 µM
mecamylamine (MEC). The arrows indicate
the beginning of the 1 sec pressure applications of DMPP.
C, The DMPP-induced current in a neocortical interneuron
(Control) was only slightly reduced by the
application of 10 nM MLA. The remaining current was almost
completely abolished by 500 nM dihydro- -erythroidine
(DH E). D, In current clamp, the
application of 100 µM acetylcholine (Ach)
depolarized an interneuron and induced a discharge of action
potentials. Action potentials are truncated because of the sampling
rate. E, In the same interneuron recorded in voltage
clamp, acetylcholine induced an inward current (Control,
bottom trace) that was blocked by 500 nM
dihydro- -erythroidine (DH E, top
trace). All responses (A-E) were
recorded in the presence of glutamatergic, GABAergic, and muscarinic
receptor antagonists (see Results).
|
|
Interneuronal responses are mediated by non- 7
nicotinic receptors
Because neuronal nicotinic responses mediated by receptors
containing and lacking the 7 subunit are pharmacologically distinct, we examined the sensitivity of the nicotinic responses to the nicotinic
receptor antagonists dihydro- -erythroidine, mecamylamine, and MLA.
Both dihydro- -erythroidine and mecamylamine selectively block
non- 7 nicotinic receptor, whereas MLA selectively blocks 7
nicotinic receptors (Alkondon and Albuquerque, 1993 ; Palma et al.,
1996 ; Zoli et al., 1998 ). Perfusion of either dihydro- -erythroidine (500 nM) or mecamylamine (2 µM) antagonized
the currents mediated by 100 µM DMPP by an average of
80 ± 17 (n = 17) and 90 ± 7%
(n = 14), respectively (Fig. 3B). In
contrast, perfusion of MLA (10 nM) reduced the currents by
only 30 ± 5% (n = 3). The remaining MLA-insensitive currents were sensitive to 500 nM
dihydro- -erythroidine (84 ± 16% block; n = 3)
(Fig. 3C). The endogenous nicotinic receptor agonist
acetylcholine (100 µM) also activated neocortical
interneurons (n = 6), and the pharmacological profile
of these responses was similar to that of DMPP-induced currents (Fig.
3C). On the average, 86 ± 8% of the currents evoked
by acetylcholine were reversibly antagonized by 500 nM
dihydro- -erythroidine (n = 5) (Fig. 3D), whereas 10 nM MLA reduced the currents by only 22 ± 2% (n = 3). These results indicated that DMPP and
acetylcholine directly excite neocortical interneurons mainly through
the activation of nicotinic receptors lacking the 7 subunit.
Nicotinic receptors subunits expressed by
responsive interneurons
The nicotinic receptor subunits expressed in the rat neocortex are
3, 4, 5, 7 and 2 (Wada et al., 1989 , 1990 ). Because various combinations of these subunits have been shown to form functional non- 7 nicotinic receptors (Papke et al., 1989 ; Boulter et
al., 1990 ; Papke, 1993 ; Ramirez-Latorre et al., 1996 ), single-cell RT-PCR was used to determine which of these subunits were expressed in
17 interneurons that responded to DMPP. Consistent with the pharmacological data, single-cell RT-PCR analysis indicated that most
of the interneurons that were excited by nicotinic agonists expressed
the mRNAs for 4, 5, and 2 (Fig.
4B,C).
In contrast, the majority (10 of 17 interneurons) of the DMPP-sensitive
neocortical interneurons did not express 7 subunits. Consistent with
in situ hybridization studies (Wada et al., 1989 ; 1990 ; Lena
and Changeux, 1997 ), the mRNAs encoding 2, 6, 3, and 4
were not detected in any of the interneurons. The mRNAs encoding the
nine nicotinic receptor subunits, however, could be simultaneously
detected in 2 ng of total brain RNA (Fig. 4A).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 4.
Nicotinic receptor subunits expressed by
neocortical interneurons sensitive to DMPP. A, Agarose
gel electrophoresis of the products obtained from 2 mg of total brain
RNA by an RT-PCR procedure designed to coamplify simultaneously the
mRNAs encoding the 2, 3, 4, 5, 6, 7, 2, 3, and
4 subunits of nicotinic receptors. All nine nicotinic receptor
subunits were detected. The faint bands in the
2 and 3 lanes correspond to
nonspecific amplifications. B, Agarose gel
electrophoresis of the PCR products obtained from an RSNP interneuron
that responded to DMPP applications in the presence of glutamatergic,
GABAergic, and muscarinic receptor antagonists. Only the 4, 5,
and 2 subunits were detected in this interneuron. The
faint and heavy bands in the
2 and 2 lanes correspond to
nonspecific amplifications. The identity of the PCR products was
confirmed by Southern blot analysis. C, Number of
DMPP-sensitive interneurons in which the mRNAs for the nicotinic
receptor subunits were detected by single-cell RT-PCR
(n = 17). Note that the majority of the tested
interneurons expressed 4, 5, and 2 subunits.
|
|
 |
DISCUSSION |
Our results demonstrate that nicotinic agonists selectively excite
two types of physiologically identified neocortical interneurons, IS
and RSNP interneurons, both of which coexpress VIP and CCK. Unlike
presynaptic nicotinic receptors modulating glutamate release in
cortical areas (McGehee et al., 1995 ; Gil et al., 1997 ), nicotinic receptors located on the soma and/or the dendrites of neocortical VIP
interneurons lack the 7 subunit.
Expression of functional non- 7 nicotinic receptors in
the neocortex
Previous in situ hybridization studies indicate that
3, 4, 5, 7, and 2 subunits are expressed in the rat
neocortex (Wada et al., 1989 , 1990 ). The neocortical interneurons
excited by nicotinic receptor stimulation predominately expressed the
mRNAs for the 4, 5, and 2 subunits. Although the 7 subunit
was detected in some of the VIPergic interneurons excited by DMPP, the
majority of the responsive interneurons did not express this subunit.
Accordingly, the pharmacological profile of the nicotinic responses was
typical of non- 7 nicotinic receptors. The nicotinic currents in the
neocortical interneurons were only slightly reduced by MLA, the
selective antagonist of 7 nicotinic receptors (Palma et al., 1996 ).
On the other hand, the responses to DMPP were blocked by
dihydro- -erythroidine and mecamylamine, two selective antagonists of
non- 7 nicotinic receptors (Alkondon and Albuquerque, 1993 ; Zoli et
al., 1998 ). Thus, the molecular and pharmacological data indicate that
the nicotinic excitation of VIPergic interneurons is mediated by
nicotinic receptors composed of 4, 5, and 2 subunits. In
heterologous expression systems, functional channels are formed by the
coexpression of 4 and 2 subunits (Papke et al., 1989 ; Boulter et
al., 1990 ; Cooper et al., 1991 ; Luetje and Patrick, 1991 ; Papke, 1993 )
or by the coexpression of 4, 5, and 2 subunits
(Ramirez-Latorre et al., 1996 ). The addition of the 5 subunit to
channels composed of 4 and 2 increases the conductance of the
channels (Ramirez-Latorre et al., 1996 ). In contrast, the expression of
either of the three subunits alone, the coexpression of 4 and 5
subunits, or the coexpression of 5 and 2 subunits (Boulter et
al., 1990 ; Ramirez-Latorre et al., 1996 ) does not form functional
nicotinic receptors. Thus, the responsive interneurons apparently
contain nicotinic receptors composed of 4 and 2 subunits and/or
4, 5, and 2 subunits.
Selective expression of postsynaptic nicotinic receptors by
interneurons in cortical areas
Our results, together with previous observations (Vidal and
Changeux, 1993 ; Jones and Yakel, 1997 ; Frazier et al., 1998 ; Xiang et
al., 1998 ), suggest that somatodendritic nicotinic receptors are
selectively expressed by interneurons and not by pyramidal neurons in
the rat neocortex and hippocampus. There are, however, several
differences in the expression of nicotinic receptors in the two
structures. In the hippocampus, almost all of the interneurons tested
responded to nicotinic stimulation apparently through 7-containing nicotinic receptors (Jones and Yakel, 1997 ; Frazier et al., 1998 ). In
contrast, in the neocortex, only VIP- and CCK-expressing interneurons responded to nicotinic stimulation, and this excitation was mediated by
the activation of non- 7 nicotinic receptors. A recent report indicates that, in the visual cortex, interneurons exhibiting low-threshold Ca2+ spikes are excited by nicotinic
stimulation, whereas FS interneurons are insensitive to nicotinic
stimulation (Xiang et al., 1998 ). Because the majority (90%; 77 of 85)
of the neocortical interneurons excited by nicotinic stimulation in the
present study did not exhibit low-threshold Ca2+
spikes, the presence of low-threshold Ca2+ spikes
does not appear to be the best marker of nicotinic-sensitive interneurons in the motor cortex. Finally, the expression of nicotinic receptors in the neocortex may differ among species, because in the
ferret neocortex both pyramidal neurons and interneurons have been
shown to express functional nicotinic receptors (Roerig et al.,
1997 ).
Potential implications of nicotinic receptor-mediated excitation of
interneurons expressing VIP and CCK
Nicotinic receptors are important for maintaining performance in a
variety of cognitive tasks involving cortical areas (Changeux et al.,
1998 ). In the neocortex, functional postsynaptic nicotinic receptors
are selectively expressed by a subpopulation of interneurons coexpressing VIP and CCK. We and others have shown previously that VIP
is expressed by subsets of bipolar and bitufted neocortical interneurons (Eckenstein and Baughman, 1984 ; Morrison et al., 1984 ;
Cauli et al., 1997 ; Porter et al., 1998 ) and immunocytochemical data
also indicates that CCK is often co-expressed with VIP in these
interneurons (Papadopoulos et al., 1987 ; Kubota and Kawaguchi, 1997 ).
Given the primarily columnarly restricted axonal arbors of interneurons
expressing VIP and CCK (Hendry et al., 1983 ; Connor and Peters, 1984 ;
Magistretti et al., 1984 ; Kawaguchi and Kubota, 1996 ; Porter et al.,
1998 ), nicotinic receptor-mediated stimulation of these interneurons
may provide a selective increase in the columnar inhibition involved in
neocortical information processing (Xiang et al., 1998 ).
In addition, several lines of evidence suggest that VIP-expressing
interneurons are involved in the regulation of regional cerebral blood
flow and metabolism in the neocortex (Itakura et al., 1987 ; Yaksh et
al., 1987 ; Magistretti, 1990 ). First, VIP-containing neuronal fibers
are intimately associated with the intracortical blood vessels
(Eckenstein and Baughman, 1984 ; Chédotal et al., 1994a , 1994b ).
Second, the application of VIP induces a dilatation of pial arteries
(Yaksh et al., 1987 ). Third, the injection of VIP into the cortex
increase the cerebral blood flow (Itakura et al., 1987 ). Fourth, VIP
activates glycogenolysis in neocortical slices (Magistretti et al.,
1981 ). Therefore, the nicotinic excitation of VIPergic interneurons
reported in this study may be critical for locally increasing the
energy supply in the neocortex during periods of increased neuronal
activity. Furthermore, disorders in this homeostatic mechanism for
balancing the energy supply with the energy demand may be involved in
diseases associated with cholinergic deficits, as indicated by the
finding that there is a decrease in cerebral glucose utilization and
blood flow in patients with Alzheimer's disease (Eberling et al.,
1992 ; Swerdlow et al., 1994 ) that can be reversed by increasing
cholinergic excitation (Wilson et al., 1991 ; Parks et al., 1996 ). The
high level of expression of 5 subunits in VIP interneurons may
confer a unique pharmacological profile to their nicotinic receptors
(Yu and Role, 1998 ) that could be used to selectively excite this class
of neocortical interneurons.
 |
FOOTNOTES |
Received Jan. 19, 1999; revised March 15, 1999; accepted April 12, 1999.
This work was supported by the Centre National de la Recherche
Scientifique and European Union Biotech Grants 960382 and 960589. J.T.P. was supported by a Human Frontier Science Program Organization fellowship. We thank Serge Charpak and Shaul Hestrin for insightful discussions, Samia Ben Ammou for technical assistance, and Elodie Christophe for her help during some experiments.
Correspondence should be addressed to Dr. Etienne Audinat,
Neurobiologie et Diversité Cellulaire, Centre National de la
Recherche Scientifique, Unité Mixte de Recherche 7637, Ecole
Supérieure de Physique et de Chimie Industrielles, 10 rue
Vauquelin, 75231 Paris Cedex 05, France.
Dr. Porter's present address: Department of Anatomy, Box 9128, West
Virginia University, Morgantown, WV 26506-9128.
 |
REFERENCES |
-
Alkondon M,
Albuquerque EX
(1993)
Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes.
J Pharmacol Exp Ther
265:1455-1473[Abstract/Free Full Text].
-
Angulo MC,
Lambolez B,
Audinat E,
Hestrin S,
Rossier J
(1997)
Subunit composition, kinetic, and permeation properties of AMPA receptors in single neocortical nonpyramidal cells.
J Neurosci
17:6685-6696[Abstract/Free Full Text].
-
Boulter J,
O'Shea-Greenfield A,
Duvoisin RM,
Connolly JG,
Wada E,
Jensen A,
Gardner PD,
Ballivet M,
Deneris ES,
McKinnon D
(1990)
3, 5, and 4: three members of the rat neuronal nicotinic acetylcholine receptor-related gene family form a gene cluster.
J Biol Chem
265:4472-4482[Abstract/Free Full Text]. -
Cauli B,
Audinat E,
Lambolez B,
Angulo M-C,
Ropert N,
Tsuzuki K,
Hestrin S,
Rossier J
(1997)
Molecular and physiological diversity of cortical nonpyramidal cells.
J Neurosci
17:3894-3906[Abstract/Free Full Text].
-
Changeux JP,
Bertrand D,
Corringer PJ,
Dehaene S,
Edelstein S,
Lena C,
Le Novere N,
Marubio L,
Picciotto M,
Zoli M
(1998)
Brain nicotinic receptors: structure and regulation, role in learning and reinforcement.
Brain Res Brain Res Rev
26:198-216[Medline].
-
Chédotal A,
Cozzari C,
Faure MP,
Hartman BK,
Hamel E
(1994a)
Distinct choline acetyltransferase (ChAT) and vasoactive intestinal polypeptide (VIP) bipolar neurons project to local blood vessels in the rat cerebral cortex.
Brain Res
646:181-193[Web of Science][Medline].
-
Chédotal A,
Umbriaco D,
Descarries L,
Hartman BK,
Hamel E
(1994b)
Light and electron microscopic immunocytochemical analysis of the neurovascular relationships of choline acetyltransferase and vasoactive intestinal polypeptide nerve terminals in the rat cerebral cortex.
J Comp Neurol
343:57-71[Web of Science][Medline].
-
Connor JR,
Peters A
(1984)
Vasoactive intestinal polypeptide-immunoreactive neurons in rat visual cortex.
Neuroscience
12:1027-1044[Web of Science][Medline].
-
Cooper E,
Couturier S,
Ballivet M
(1991)
Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor.
Nature
350:235-238[Medline].
-
Couturier S,
Bertrand D,
Matter JM,
Hernandez MC,
Bertrand S,
Millar N,
Valera S,
Barkas T,
Ballivet M
(1990)
A neuronal nicotinic acetylcholine receptor subunit (
7) is developmentally regulated and forms a homo-oligomeric channel blocked by -BTX.
Neuron
5:847-856[Web of Science][Medline]. -
Eberling JL,
Jagust WJ,
Reed BR,
Baker MG
(1992)
Reduced temporal lobe blood flow in Alzheimer's disease.
Neurobiol Aging
13:483-491[Web of Science][Medline].
-
Eckenstein F,
Baughman RW
(1984)
Two types of cholinergic innervation in cortex, one co-localized with vasoactive intestinal polypeptide.
Nature
309:153-155[Medline].
-
Elgoyhen AB,
Johnson DS,
Boulter J,
Vetter DE,
Heinemann S
(1994)
9: an acetylcholine receptor with novel pharmacological properties expressed in rat cochlear hair cells.
Cell
79:705-715[Web of Science][Medline]. -
Frazier CJ,
Rollins YD,
Breese CR,
Leonard S,
Freedman R,
Dunwiddie TV
(1998)
Acetylcholine activates an
-bungarotoxin-sensitive nicotinic current in rat hippocampal interneurons, but not pyramidal cells.
J Neurosci
18:1187-1195[Abstract/Free Full Text]. -
Gil Z,
Connors BW,
Amitai Y
(1997)
Differential regulation of neocortical synapses by neuromodulators and activity.
Neuron
19:679-686[Web of Science][Medline].
-
Gitelman DR,
Prohovnik I
(1992)
Muscarinic and nicotinic contributions to cognitive function and cortical blood flow.
Neurobiol Aging
13:313-318[Web of Science][Medline].
-
Granon S,
Poucet B,
Thinus-Blanc C,
Changeux JP,
Vidal C
(1995)
Nicotinic and muscarinic receptors in the rat prefrontal cortex: differential roles in working memory, response selection and effortful processing.
Psychopharmacology
119:139-144[Medline].
-
Gray R,
Rajan AS,
Radcliffe KA,
Yakehiro M,
Dani JA
(1996)
Hippocampal synaptic transmission enhanced by low concentrations of nicotine.
Nature
383:713-716[Medline].
-
Hendry SH,
Jones EG,
Beinfeld MC
(1983)
Cholecystokinin-immunoreactive neurons in rat and monkey cerebral cortex make symmetric synapses and have intimate associations with blood vessels.
Proc Natl Acad Sci USA
80:2400-2404[Abstract/Free Full Text].
-
Itakura T,
Yokote H,
Okuno T,
Naka Y,
Nakakita K,
Kamei I,
Nakai K,
Imai H,
Komai N
(1987)
Regulation of rCBF by intracortical vasoactive intestinal polypeptide-containing neurons. Immunohistochemical and hydrogen clearance study in rats.
J Neurosurg
67:93-96[Web of Science][Medline].
-
Jones S,
Yakel JL
(1997)
Functional nicotinic ACh receptors on interneurones in the rat hippocampus.
J Physiol (Lond)
504:603-610[Abstract/Free Full Text].
-
Kawaguchi Y
(1995)
Physiological subgroups of nonpyramidal cells with specific morphological characteristics in layer II/III of rat frontal cortex.
J Neurosci
15:2638-2655[Abstract].
-
Kawaguchi Y,
Kubota Y
(1996)
Physiological and morphological identification of somatostatin- or vasoactive intestinal polypeptide-containing cells among GABAergic cell subtypes in rat frontal cortex.
J Neurosci
16:2701-2715[Abstract/Free Full Text].
-
Kubota Y,
Kawaguchi Y
(1997)
Two distinct subgroups of cholecystokinin-immunoreactive cortical interneurons.
Brain Res
752:175-183[Web of Science][Medline].
-
Kubota Y,
Hattori R,
Yui Y
(1994)
Three distinct subpopulations of GABAergic neurons in rat frontal agranular cortex.
Brain Res
649:159-173[Web of Science][Medline].
-
Lambolez B,
Audinat E,
Bochet P,
Crépel F,
Rossier J
(1992)
AMPA receptor subunits expressed by single Purkinje cells.
Neuron
9:247-258[Web of Science][Medline].
-
Le Novere N,
Changeux JP
(1995)
Molecular evolution of the nicotinic acetylcholine receptor: an example of multigene family in excitable cells.
J Mol Evol
40:155-172[Web of Science][Medline].
-
Lena C,
Changeux JP
(1997)
Pathological mutations of nicotinic receptors and nicotine-based therapies for brain disorders.
Curr Opin Neurobiol
7:674-682[Web of Science][Medline].
-
Luetje CW,
Patrick J
(1991)
Both
- and -subunits contribute to the agonist sensitivity of neuronal nicotinic acetylcholine receptors.
J Neurosci
11:837-845[Abstract]. -
Magistretti PJ
(1990)
VIP neurons in the cerebral cortex.
Trends Pharmacol Sci
11:250-254[Medline].
-
Magistretti PJ,
Morrison JH,
Shoemaker WJ,
Sapin V,
Bloom FE
(1981)
Vasoactive intestinal polypeptide induces glycogenolysis in mouse cortical slices: a possible regulatory mechanism for the local control of energy metabolism.
Proc Natl Acad Sci USA
78:6535-6539[Abstract/Free Full Text].
-
Magistretti PJ,
Morrison JH,
Shoemaker WJ,
Bloom FE
(1984)
Morphological and functional correlates of VIP neurons in cerebral cortex.
Peptides
5:213-218[Web of Science][Medline].
-
McCormick DA,
Connors BW,
Lighthall JW,
Prince DA
(1985)
Comparative electrophysiology of pyramidal and sparsely spiny stellate neurons of the neocortex.
J Neurophysiol
54:782-806[Abstract/Free Full Text].
-
McGehee DS,
Heath MJ,
Gelber S,
Devay P,
Role LW
(1995)
Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors.
Science
269:1692-1696[Abstract/Free Full Text].
-
Morrison JH,
Magistretti PJ,
Benoit R,
Bloom FE
(1984)
The distribution and morphological characteristics of the intracortical VIP-positive cell: an immunohistochemical analysis.
Brain Res
292:269-282[Web of Science][Medline].
-
Newhouse PA,
Potter A,
Levin ED
(1997)
Nicotinic system involvement in Alzheimer's and Parkinson's diseases. Implications for therapeutics.
Drugs Aging
11:206-228[Web of Science][Medline].
-
Palma E,
Bertrand S,
Binzoni T,
Bertrand D
(1996)
Neuronal nicotinic
7 receptor expressed in Xenopus oocytes presents five putative binding sites for methyllycaconitine.
J Physiol (Lond)
491:151-161[Abstract/Free Full Text]. -
Papadopoulos GC,
Parnavelas JG,
Cavanagh ME
(1987)
Extensive co-existence of neuropeptides in the rat visual cortex.
Brain Res
420:95-99[Web of Science][Medline].
-
Papke RL
(1993)
The kinetic properties of neuronal nicotinic receptors: genetic basis of functional diversity.
Prog Neurobiol
41:509-531[Web of Science][Medline].
-
Papke RL,
Boulter J,
Patrick J,
Heinemann S
(1989)
Single-channel currents of rat neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes.
Neuron
3:589-596[Web of Science][Medline].
-
Parks RW,
Becker RE,
Rippey RF,
Gilbert DG,
Matthews JR,
Kabatay E,
Young CS,
Vohs C,
Danz V,
Keim P,
Collins GT,
Zigler SS,
Urycki PG
(1996)
Increased regional cerebral glucose metabolism and semantic memory performance in Alzheimer's disease: a pilot double blind transdermal nicotine positron emission tomography study.
Neuropsychol Rev
6:61-79[Web of Science][Medline].
-
Porter JT,
Cauli B,
Staiger JF,
Lambolez B,
Rossier J,
Audinat E
(1998)
Properties of bipolar VIPergic interneurons and their excitation by pyramidal neurons in the rat neocortex.
Eur J Neurosci
10:3617-3628[Web of Science][Medline].
-
Ramirez-Latorre J,
Yu CR,
Qu X,
Perin F,
Karlin A,
Role L
(1996)
Functional contributions of
5 subunit to neuronal acetylcholine receptor channels.
Nature
380:347-351[Medline]. -
Roerig B,
Nelson DA,
Katz LC
(1997)
Fast synaptic signaling by nicotinic acetylcholine and serotonin 5-HT3 receptors in developing visual cortex.
J Neurosci
17:8353-8362[Abstract/Free Full Text].
-
Role LW,
Berg DK
(1996)
Nicotinic receptors in the development and modulation of CNS synapses.
Neuron
16:1077-1085[Web of Science][Medline].
-
Ruano D,
Lambolez B,
Rossier J,
Paternain AV,
Lerma J
(1995)
Kainate receptor subunits expressed in single cultured hippocampal neurons: molecular and functional variants by RNA editing.
Neuron
14:1009-1017[Web of Science][Medline].
-
Sanberg PR,
Silver AA,
Shytle RD,
Philipp MK,
Cahill DW,
Fogelson HM,
McConville BJ
(1997)
Nicotine for the treatment of Tourette's syndrome.
Pharmacol Ther
74:21-25[Web of Science][Medline].
-
Sanberg PR,
Shytle RD,
Silver AA
(1998)
Treatment of Tourette's syndrome with mecamylamine [letter].
Lancet
352:705-706[Web of Science][Medline].
-
Sargent PB
(1993)
The diversity of neuronal nicotinic acetylcholine receptors.
Annu Rev Neurosci
16:403-443[Web of Science][Medline].
-
Sivilotti L,
Colquhoun D
(1995)
Acetylcholine receptors: too many channels, too few functions.
Science
269:1681-1682[Free Full Text].
-
Steinlein OK,
Mulley JC,
Propping P,
Wallace RH,
Phillips HA,
Sutherland GR,
Scheffer IE,
Berkovic SF
(1995)
A missense mutation in the neuronal nicotinic acetylcholine receptor
4 subunit is associated with autosomal dominant nocturnal frontal lobe epilepsy.
Nat Genet
11:201-203[Web of Science][Medline]. -
Swerdlow R,
Marcus DL,
Landman J,
Kooby D,
Frey W,
Freedman ML
(1994)
Brain glucose metabolism in Alzheimer's disease.
Am J Med Sci
308:141-144[Web of Science][Medline].
-
Thomson AM,
Deuchars J
(1994)
Temporal and spatial properties of local circuits in neocortex.
Trends Neurosci
17:119-126[Web of Science][Medline].
-
Uchida S,
Kagitani F,
Nakayama H,
Sato A
(1997)
Effect of stimulation of nicotinic cholinergic receptors on cortical cerebral blood flow and changes in the effect during aging in anesthetized rats.
Neurosci Lett
228:203-206[Web of Science][Medline].
-
Vidal C,
Changeux JP
(1993)
Nicotinic and muscarinic modulations of excitatory synaptic transmission in the rat prefrontal cortex in vitro.
Neuroscience
56:23-32[Web of Science][Medline].
-
Wada E,
Wada K,
Boulter J,
Deneris E,
Heinemann S,
Patrick J,
Swanson LW
(1989)
Distribution of
2, 3, 4, and 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat.
J Comp Neurol
284:314-335[Web of Science][Medline]. -
Wada E,
McKinnon D,
Heinemann S,
Patrick J,
Swanson LW
(1990)
The distribution of mRNA encoded by a new member of the neuronal nicotinic acetylcholine receptor gene family (
5) in the rat central nervous system.
Brain Res
526:45-53[Web of Science][Medline]. -
Whitehouse PJ,
Martino AM,
Wagster MV,
Price DL,
Mayeux R,
Atack JR,
Kellar KJ
(1988)
Reductions in [3H]nicotinic acetylcholine binding in Alzheimer's disease and Parkinson's disease: an autoradiographic study.
Neurology
38:720-723[Abstract/Free Full Text].
-
Wilson K,
Bowen D,
Francis P,
Tyrrell P
(1991)
Effect of central cholinergic stimulation on regional cerebral blood flow in Alzheimer's disease.
Br J Psychiatry
158:558-562[Abstract/Free Full Text].
-
Xiang Z,
Huguenard JR,
Prince DA
(1998)
Cholinergic switching within neocortical inhibitory networks.
Science
281:985-988[Abstract/Free Full Text].
-
Yaksh TL,
Wang JY,
Go VL
(1987)
Cortical vasodilatation produced by vasoactive intestinal polypeptide (VIP) and by physiological stimuli in the cat.
J Cereb Blood Flow Metab
7:315-326[Web of Science][Medline].
-
Yu CR,
Role LW
(1998)
Functional contribution of the
5 subunit to neuronal nicotinic channels expressed by chick sympathetic ganglion neurones.
J Physiol (Lond)
509:667-681[Abstract/Free Full Text]. -
Zoli M,
Lena C,
Picciotto MR,
Changeux JP
(1998)
Identification of four classes of brain nicotinic receptors using
2 mutant mice.
J Neurosci
18:4461-4472[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19135228-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
P. Aracri, S. Consonni, R. Morini, M. Perrella, S. Rodighiero, A. Amadeo, and A. Becchetti
Tonic Modulation of GABA Release by Nicotinic Acetylcholine Receptors in Layer V of the Murine Prefrontal Cortex
Cereb Cortex,
October 7, 2009;
(2009)
bhp214v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lucas-Meunier, C. Monier, M. Amar, G. Baux, Y. Fregnac, and P. Fossier
Involvement of Nicotinic and Muscarinic Receptors in the Endogenous Cholinergic Modulation of the Balance between Excitation and Inhibition in the Young Rat Visual Cortex
Cereb Cortex,
October 1, 2009;
19(10):
2411 - 2427.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Gulledge, D. J. Bucci, S. S. Zhang, M. Matsui, and H. H. Yeh
M1 Receptors Mediate Cholinergic Modulation of Excitability in Neocortical Pyramidal Neurons
J. Neurosci.,
August 5, 2009;
29(31):
9888 - 9902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Zolles, E. Wagner, A. Lampert, and B. Sutor
Functional Expression of Nicotinic Acetylcholine Receptors in Rat Neocortical Layer 5 Pyramidal Cells
Cereb Cortex,
May 1, 2009;
19(5):
1079 - 1091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. McClure-Begley, N. M. King, A. C. Collins, J. A. Stitzel, J. M. Wehner, and C. M. Butt
Acetylcholine-Stimulated [3H]GABA Release from Mouse Brain Synaptosomes is Modulated by {alpha}4{beta}2 and {alpha}4{alpha}5{beta}2 Nicotinic Receptor Subtypes
Mol. Pharmacol.,
April 1, 2009;
75(4):
918 - 926.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Karagiannis, T. Gallopin, C. David, D. Battaglia, H. Geoffroy, J. Rossier, E. M. C. Hillman, J. F. Staiger, and B. Cauli
Classification of NPY-Expressing Neocortical Interneurons
J. Neurosci.,
March 18, 2009;
29(11):
3642 - 3659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Guntz, H. Dumont, E. Pastijn, A. de Kerchove d'Exaerde, K. Azdad, M. Sosnowski, S. N. Schiffmann, and D. Gall
Expression of Adenosine A2A Receptors in the Rat Lumbar Spinal Cord and Implications in the Modulation of N-Methyl-d-Aspartate Receptor Currents
Anesth. Analg.,
June 1, 2008;
106(6):
1882 - 1889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Lendvai and E. S. Vizi
Nonsynaptic Chemical Transmission Through Nicotinic Acetylcholine Receptors
Physiol Rev,
April 1, 2008;
88(2):
333 - 349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Uematsu, Y. Hirai, F. Karube, S. Ebihara, M. Kato, K. Abe, K. Obata, S. Yoshida, M. Hirabayashi, Y. Yanagawa, et al.
Quantitative Chemical Composition of Cortical GABAergic Neurons Revealed in Transgenic Venus-Expressing Rats
Cereb Cortex,
February 1, 2008;
18(2):
315 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tricoire and C. A. Cea-Del Rio
Illuminating Cholinergic Microcircuits in the Neocortex
J. Neurosci.,
November 7, 2007;
27(45):
12119 - 12120.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ferezou, E. L. Hill, B. Cauli, N. Gibelin, T. Kaneko, J. Rossier, and B. Lambolez
Extensive Overlap of Mu-Opioid and Nicotinic Sensitivity in Cortical Interneurons
Cereb Cortex,
August 1, 2007;
17(8):
1948 - 1957.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. von Engelhardt, M. Eliava, A. H. Meyer, A. Rozov, and H. Monyer
Functional Characterization of Intrinsic Cholinergic Interneurons in the Cortex
J. Neurosci.,
May 23, 2007;
27(21):
5633 - 5642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Hill, T. Gallopin, I. Ferezou, B. Cauli, J. Rossier, P. Schweitzer, and B. Lambolez
Functional CB1 Receptors Are Broadly Expressed in Neocortical GABAergic and Glutamatergic Neurons
J Neurophysiol,
April 1, 2007;
97(4):
2580 - 2589.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Gulledge, S. B. Park, Y. Kawaguchi, and G. J. Stuart
Heterogeneity of Phasic Cholinergic Signaling in Neocortical Neurons
J Neurophysiol,
March 1, 2007;
97(3):
2215 - 2229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yamamoto, J. Yamada, S. Ueno, H. Kubota, T. Furukawa, S. Yamamoto, and A. Fukuda
Insertion of {alpha}7 Nicotinic Receptors at Neocortical Layer V GABAergic Synapses Is Induced by a Benzodiazepine, Midazolam
Cereb Cortex,
March 1, 2007;
17(3):
653 - 660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Klaassen, J. Glykys, J. Maguire, C. Labarca, I. Mody, and J. Boulter
Seizures and enhanced cortical GABAergic inhibition in two mouse models of human autosomal dominant nocturnal frontal lobe epilepsy
PNAS,
December 12, 2006;
103(50):
19152 - 19157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Klein and J. L. Yakel
Functional somato-dendritic {alpha}7-containing nicotinic acetylcholine receptors in the rat basolateral amygdala complex
J. Physiol.,
November 1, 2006;
576(3):
865 - 872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Gallopin, H. Geoffroy, J. Rossier, and B. Lambolez
Cortical Sources of CRF, NKB, and CCK and Their Effects on Pyramidal Cells in the Neocortex
Cereb Cortex,
October 1, 2006;
16(10):
1440 - 1452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Levy, A. D. Reyes, and C. Aoki
Nicotinic and Muscarinic Reduction of Unitary Excitatory Postsynaptic Potentials in Sensory Cortex; Dual Intracellular Recording In Vitro
J Neurophysiol,
April 1, 2006;
95(4):
2155 - 2166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bandyopadhyay, B. Sutor, and J. J. Hablitz
Endogenous Acetylcholine Enhances Synchronized Interneuron Activity in Rat Neocortex
J Neurophysiol,
March 1, 2006;
95(3):
1908 - 1916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Strang, M. E. Andison, F. R. Amthor, and K. T. Keyser
Rabbit retinal ganglion cells express functional {alpha}7 nicotinic acetylcholine receptors
Am J Physiol Cell Physiol,
September 1, 2005;
289(3):
C644 - C655.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Gould and M. C. Lewis
Coantagonism of glutamate receptors and nicotinic acetylcholinergic receptors disrupts fear conditioning and latent inhibition of fear conditioning
Learn. Mem.,
July 1, 2005;
12(4):
389 - 398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Blatow, A. Caputi, and H. Monyer
Molecular diversity of neocortical GABAergic interneurones
J. Physiol.,
January 1, 2005;
562(1):
99 - 105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, M. Toledo-Rodriguez, A. Gupta, C. Wu, G. Silberberg, J. Luo, and H. Markram
Anatomical, physiological and molecular properties of Martinotti cells in the somatosensory cortex of the juvenile rat
J. Physiol.,
November 15, 2004;
561(1):
65 - 90.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Porter and D. Nieves
Presynaptic GABAB Receptors Modulate Thalamic Excitation of Inhibitory and Excitatory Neurons in the Mouse Barrel Cortex
J Neurophysiol,
November 1, 2004;
92(5):
2762 - 2770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Cauli, X.-K. Tong, A. Rancillac, N. Serluca, B. Lambolez, J. Rossier, and E. Hamel
Cortical GABA Interneurons in Neurovascular Coupling: Relays for Subcortical Vasoactive Pathways
J. Neurosci.,
October 13, 2004;
24(41):
8940 - 8949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Metherate
Nicotinic Acetylcholine Receptors in Sensory Cortex
Learn. Mem.,
January 1, 2004;
11(1):
50 - 59.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. D. Manns, A. Alonso, and B. E. Jones
Rhythmically Discharging Basal Forebrain Units Comprise Cholinergic, GABAergic, and Putative Glutamatergic Cells
J Neurophysiol,
February 1, 2003;
89(2):
1057 - 1066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhang and R. A. Warren
Muscarinic and Nicotinic Presynaptic Modulation of EPSCs in the Nucleus Accumbens During Postnatal Development
J Neurophysiol,
December 1, 2002;
88(6):
3315 - 3330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Christophe, A. Roebuck, J. F. Staiger, D. J. Lavery, S. Charpak, and E. Audinat
Two Types of Nicotinic Receptors Mediate an Excitation of Neocortical Layer I Interneurons
J Neurophysiol,
September 1, 2002;
88(3):
1318 - 1327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ferezou, B. Cauli, E. L. Hill, J. Rossier, E. Hamel, and B. Lambolez
5-HT3 Receptors Mediate Serotonergic Fast Synaptic Excitation of Neocortical Vasoactive Intestinal Peptide/Cholecystokinin Interneurons
J. Neurosci.,
September 1, 2002;
22(17):
7389 - 7397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Porter, C. K. Johnson, and A. Agmon
Diverse Types of Interneurons Generate Thalamus-Evoked Feedforward Inhibition in the Mouse Barrel Cortex
J. Neurosci.,
April 15, 2001;
21(8):
2699 - 2710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Klink, A. d. K. d'Exaerde, M. Zoli, and J.-P. Changeux
Molecular and Physiological Diversity of Nicotinic Acetylcholine Receptors in the Midbrain Dopaminergic Nuclei
J. Neurosci.,
March 1, 2001;
21(5):
1452 - 1463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. G. Cape, I. D. Manns, A. Alonso, A. Beaudet, and B. E. Jones
Neurotensin-Induced Bursting of Cholinergic Basal Forebrain Neurons Promotes gamma and theta Cortical Activity Together with Waking and Paradoxical Sleep
J. Neurosci.,
November 15, 2000;
20(22):
8452 - 8461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Shao and J. L Yakel
Single channel properties of neuronal nicotinic ACh receptors in stratum radiatum interneurons of rat hippocampal slices
J. Physiol.,
September 15, 2000;
527(3):
507 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N Sudweeks and J. L Yakel
Functional and molecular characterization of neuronal nicotinic ACh receptors in rat CA1 hippocampal neurons
J. Physiol.,
September 15, 2000;
527(3):
515 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Cauli, J. T. Porter, K. Tsuzuki, B. Lambolez, J. Rossier, B. Quenet, and E. Audinat
Classification of fusiform neocortical interneurons based on unsupervised clustering
PNAS,
May 23, 2000;
97(11):
6144 - 6149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. D. Manns, A. Alonso, and B. E. Jones
Discharge Properties of Juxtacellularly Labeled and Immunohistochemically Identified Cholinergic Basal Forebrain Neurons Recorded in Association with the Electroencephalogram in Anesthetized Rats
J. Neurosci.,
February 15, 2000;
20(4):
1505 - 1518.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|