WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (95)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porter, J. T.
Right arrow Articles by Audinat, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porter, J. T.
Right arrow Articles by Audinat, E.

 Previous Article  |  Next Article 

The Journal of Neuroscience, July 1, 1999, 19(13):5228-5235

Selective Excitation of Subtypes of Neocortical Interneurons by Nicotinic Receptors

James T. Porter, Bruno Cauli, Keisuke Tsuzuki, Bertrand Lambolez, Jean Rossier, and Etienne Audinat

Neurobiologie et Diversité Cellulaire, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 7637, Ecole Supérieure de Physique et de Chimie Industrielles, 75231 Paris Cedex 05, France


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The cellular mechanisms by which neuronal nicotinic cholinergic receptors influence many aspects of physiology and pathology in the neocortex remain primarily unknown. Whole-cell recordings and single-cell reverse transcription (RT)-PCR were combined to analyze the effect of nicotinic receptor agonists on different types of neurons in acute slices of rat neocortex. Nicotinic receptor agonists had no effect on pyramidal neurons and on most types of interneurons, including parvalbumin-expressing fast spiking interneurons and somatostatin-expressing interneurons, but selectively excited a subpopulation of interneurons coexpressing the neuropeptides vasoactive intestinal peptide (VIP) and cholecystokinin. This excitation persisted in the presence of glutamate, GABA, and muscarinic receptor antagonists and in the presence of tetrodotoxin and low extracellular calcium, suggesting that the depolarization was mediated through the direct activation of postsynaptic nicotinic receptors. The responses were blocked by the nicotinic receptor antagonists dihydro-beta -erythroidine and mecamylamine and persisted in the presence of the alpha 7 selective nicotinic receptor antagonist methyllycaconitine, suggesting that the involved nicotinic receptors lacked the alpha 7 subunit. Single-cell RT-PCR analysis indicated that the majority of the interneurons that responded to nicotinic stimulation coexpressed the alpha 4, alpha 5, and beta 2 nicotinic receptor subunits. Therefore, these results provide a role for non-alpha 7 nicotinic receptors in the selective excitation of a subpopulation of neocortical interneurons. Because the neocortical interneurons expressing VIP have been proposed previously to regulate regional cortical blood flow and metabolism, these results also provide a cellular basis for the neuronal regulation of cortical blood flow mediated by acetylcholine.

Key words: single-cell PCR; neuropeptides; calcium-binding proteins; methyllycaconitine; dihydro-beta -erythroidine; acetylcholine; mecamylamine


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Nicotinic receptors are implicated in many important functions of the mammalian neocortex, including memory formation (Granon et al., 1995) and neuronal regulation of regional cerebral blood flow (Gitelman and Prohovnik, 1992; Uchida et al., 1997), as well as cortical pathologies such as Alzheimer's disease (Whitehouse et al., 1988; Newhouse et al., 1997), epilepsy (Steinlein et al., 1995), and Tourette's syndrome (Sanberg et al., 1997, 1998). The cellular basis for the effects of nicotinic receptor stimulation is currently unknown but lies within its effects on the complex interactions between the excitatory glutamatergic pyramidal neurons and the inhibitory interneurons.

A variety of different neuronal nicotinic receptor subunits have been cloned and named alpha 2-alpha 9 and beta 2-beta 4 (Elgoyhen et al., 1994; Le Novere and Changeux, 1995). Classically, two broad subfamilies of nicotinic receptors have been characterized in neurons according to their sensitivity to alpha -bungarotoxin. Subunits alpha 7 and alpha 8 form a family of alpha -bungarotoxin-sensitive channels (Couturier et al., 1990), whereas subunits alpha 2-alpha 6 combine with subunits beta 2-beta 4 to produce alpha -bungarotoxin-insensitive channels (Sargent, 1993). In situ hybridization studies indicate that only alpha 3, alpha 4, alpha 5, alpha 7, and beta 2 subunits are expressed in the rat neocortex (Wada et al., 1989, 1990; Lena and Changeux, 1997). In this structure as in other brain areas, functional studies have suggested that alpha 7 nicotinic receptors present on the axonal terminals of excitatory neurons modulate the release of glutamate (Vidal and Changeux, 1993; McGehee et al., 1995; Gray et al., 1996; Role and Berg, 1996; Gil et al., 1997). In contrast, the functional role of non-alpha 7 nicotinic receptors, which are also widely expressed in the neocortex, is still unknown (Sivilotti and Colquhoun, 1995). In rodents, neocortical pyramidal cells are not directly depolarized by nicotinic agonists (Vidal and Changeux, 1993; Gil et al., 1997) (but see Roerig et al., 1997), suggesting that these non-alpha 7 nicotinic receptors may be expressed by interneurons. Despite the general use of GABA as a neurotransmitter, neocortical interneurons are widely heterogeneous in terms of morphological, physiological, and biochemical characteristics (McCormick et al., 1985; Kubota et al., 1994; Thomson and Deuchars, 1994; Kawaguchi, 1995; Angulo et al., 1997; Cauli et al., 1997; Porter et al., 1998; Xiang et al., 1998). Therefore, the stimulation of different types of neocortical interneurons can produce a large variety of functional outcomes. In the present work, we examined pyramidal and nonpyramidal neurons of rat neocortical slices for responsiveness to nicotinic receptor agonists to determine the neuronal types excited by nicotinic receptor stimulation and the nicotinic receptors involved. Responsive neurons were then identified using electrophysiological and molecular criteria. The results indicate that nicotinic receptor stimulation in the neocortex selectively excites an interneuronal population coexpressing vasoactive intestinal peptide (VIP) and cholecystokinin (CCK) through the activation of nicotinic receptors containing alpha 4, alpha 5, and beta 2 subunits.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The procedures for preparation of the brain slices and whole-cell recordings of visualized neurons have been described previously (Cauli et al., 1997; Porter et al., 1998). In brief, Wistar rats (13-36 postnatal days) were anesthetized with a mixture of xylazine (14 mg/kg) and ketamine (65 mg/kg) and killed by decapitation. Parasagittal sections (300-µm-thick) of cerebral cortex were prepared. The slices were incubated at room temperature (20-25°C) in artificial CSF (ACSF) containing (in mM): NaCl 121.0, KCl 2.5, NaH2PO4 1.25, CaCl2 2, MgCl2 1, NaHCO3 26, glucose 20, and pyruvate 5, which was bubbled with a mixture of 95% O2 and 5% CO2. Slices were transferred to a chamber and perfused at 1-2 ml/min with ACSF (34°C).

Neurons were recorded in layers II, III, and V of the motor cortex using the whole-cell configuration of the patch-clamp technique. Patch pipettes (3-5 MOmega ), pulled from borosilicate glass, were filled with 8 µl of internal solution containing (in mM): K gluconate 144, MgCl2 3, EGTA 0.2, and HEPES 10, pH 7.2 (285/295 mOsm). All membrane potential values obtained with this solution were corrected for the junction potential of -11 mV. The I-V relationship of the 1,1-dimethyl-4-phenyl-piperazinium iodide (DMPP)-induced currents was measured with an internal solution containing (in mM): CsGluconate 117, CsCl 12, HEPES 10, EGTA 0.2, and MgCl2 3, pH 7.2. The firing behavior of the neurons was tested by applying depolarizing current pulses at a membrane potential of -71 mV. Action potential discharges were recorded using the current-clamp fast mode of the Axopatch 200A amplifier (Axon instruments, Foster City, CA). Only cells with a resting membrane potential more negative than -50 mV were analyzed. In current-clamp and voltage-clamp experiments, the signals were filtered, respectively, at 5 and 1 kHz, digitized at 10-20 kHz, saved to a personal computer, and analyzed off-line with Acquis1 software (Gérard Sadoc, Gif/Yvette, France). The series resistance was not compensated but was monitored throughout the experiments. DMPP (100-500 µM) and acetylcholine (100 µM) in ACSF were applied by pressure from a large pipette onto the recorded neuron. All reported values are expressed as the mean ± SD of the mean. Antagonists were added directly to the bathing solution.

At the end of the recording, the content of the cell was aspirated under visual control into the recording pipette and expelled into a test tube, where reverse transcription (RT) was performed in a final volume of 10 µl (Lambolez et al., 1992). The two steps of multiplex PCR were performed essentially as described previously (Ruano et al., 1995). The cDNAs present in 10 µl of the reverse transcription reaction were first amplified simultaneously using the primer pairs described previously (Cauli et al., 1997). Taq polymerase (2.5 U; Perkin-Elmer, Emeryville, CA) and 10 pmol of each of the primers were added to the buffer supplied by the manufacturer (final volume of 100 µl), and 20 cycles (94°C, 30 sec; 60°C, 30 sec; 72°C, 35 sec) of PCR were run. Second rounds of PCR were then performed using 2 µl of the first PCR product as template. In this second round, each cDNA was individually amplified using its specific primer pair by performing 35 PCR cycles. Each individual PCR reaction (10 µl) was then run on a 1.5% agarose gel using Phi x174 digested by HaeIII as molecular weight markers and stained with ethidium bromide. To identify the PCR products, PCR-generated fragments obtained from each cell were transferred onto Hybond N+ (Amersham, Arlington Heights, IL). The Southern blots were probed with specific oligonucleotides (Cauli et al., 1997) using the ECL 3'-oligo labeling and detection kit (Amersham) according to the manufacturer's instructions.

To amplify the neuronal nicotinic receptor subunits by RT-multiplex PCR, the two steps of PCR were performed as described above using the following sets of primers (from 5' to 3', the numbers in brackets indicate the initial and final positions of the PCR primers): alpha 2 (GenBank accession number L10077): sense [158-175], antisense [440-457]; alpha 3 (GenBank accession number L32621): sense [44-66], antisense [242-264]; alpha 4 (GenBank accession number L31620): sense [347-366], antisense [591-611]; alpha 5 (GenBank accession number J05231): sense [1203-1222], antisense [1470-1493]; alpha 6 (GenBank accession number L08227): sense [127-148], antisense [474-493]; alpha 7 (GenBank accession number L31619): sense [36-53], antisense [385-404]; beta 2 (GenBank accession number L31622): sense [197-215], antisense [504-522]; beta 3 (GenBank accession number J04636): sense [220-239], antisense [539-559]; and beta 4: sense CTGCTATGAAGGGGTGAACATT, antisense CCGTCCTCCGTCC TGGG.

The predicted sizes of the PCR products were (in base pairs) alpha 2 (300), alpha 3 (221), alpha 4 (265), alpha 5 (291), alpha 6 (367), alpha 7 (369), beta 2 (326), beta 3 (340), and beta 4 (347). The efficiency of this RT-multiplex PCR protocol was tested on 2 ng of whole-brain total RNA (see Fig. 4A). The identity of the PCR-generated fragments were confirmed by restriction analysis (data not shown) and by Southern blot analysis (data not shown) using the following set of specific sense oligoprobes labeled with AlkPhos Direct labeling and detection kit (Amersham) according to manufacturer's instructions (from 5' to 3', the numbers in brackets indicate the initial and final positions of the oligoprobes): alpha 3, [ 112-132]; alpha 4, [ 511-532]; alpha 5, [ 1294-1315]; alpha 7, [ 123-134]; and beta 2, [ 477-468]. Genomic DNA amplifications, which sometimes occurred when the nucleus was harvested, could be easily differentiated from cDNA amplification by a size criterion. Indeed, for each primer pair, the sense and antisense primers were positioned on two different exons.

6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) and 2-amino-5-phosphonovalerate (D-APV) were obtained from Tocris Cookson (Bristol, UK). Picrotoxin, atropine, mecamylamine, and DMPP were obtained from Sigma (St Louis, MO). Acetylcholine, methyllycaconitine (MLA), and dihydro-beta -erythroidine were obtained from Research Biochemicals (Natick, MA).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Selective nicotinic excitation of subtypes of neocortical interneurons

To identify the neuronal targets of nicotine, pyramidal neurons and interneurons in rat neocortical slices were first visually identified with infrared video microscopy, recorded in whole-cell configuration, and classified as irregular-spiking (IS) interneurons, regular-spiking nonpyramidal (RSNP) neurons, fast-spiking (FS) interneurons, or pyramidal neurons according to their action potential firing behavior (McCormick et al., 1985; Kawaguchi, 1995; Cauli et al., 1997) (Fig. 1A-E, left column). Then, the sensitivity of these different types of neocortical neurons to the local pressure application of the selective nicotinic cholinergic receptor agonist DMPP (100-500 µM) was tested.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1.   Distinct electrophysiologically identified types of neocortical interneurons are excited by nicotinic receptor stimulation. The current-clamp recordings shown in the left column of each panel illustrate the voltage responses exhibited by an IS interneuron (A), two RSNP interneurons (B, C), an FS interneuron (D), and a pyramidal neuron (E) in response to hyperpolarizing and depolarizing current injections. The arrowhead in A denotes the presence of low-threshold Ca2+ spikes. In the right column of each panel are the responses of the same five neurons to the local pressure application of 100 µM DMPP (1 sec). Action potentials in the right column are truncated because of the sampling rate. The arrows indicate the beginning of the DMPP applications. The membrane potentials were adjusted to -71 mV.

In response to depolarizing pulses of current, IS interneurons typically exhibited an initial burst of action potentials, followed by discharges of action potentials at an irregular frequency (Fig. 1A, left). The majority of IS interneurons (77%; 17 of 22) were depolarized by DMPP sufficiently to reach action potential threshold and fired bursts of spikes (Fig. 1A, right). As shown in the example, some IS interneurons (4 of 22 neurons) exhibited low-threshold Ca2+ spikes at the end of a hyperpolarizing current pulse (Fig. 1A, arrowhead).

RSNP neurons exhibited continuous discharges of action potentials with varying amounts of frequency adaptation accompanied by decreases in action potential amplitude (Fig. 1B,C). Within our sample of RSNP neurons, 63 of 100 interneurons responded to the nicotinic agonist (Fig. 1B, right), whereas 37% did not respond (Fig. 1C, right). The majority of the DMPP-sensitive RSNP interneurons (94%; 59 of 63) did not exhibit low-threshold Ca2+ spikes.

FS interneurons were characterized by their fast action potentials discharged at high frequencies with little frequency adaptation or decrease in action potential amplitude (Fig. 1D, left). The majority (92%; 12 of 13) of FS interneurons were not affected by the application of DMPP (Fig. 1D, right).

The majority of these interneurons were recorded in layers II/III of the motor cortex. Twenty-two interneurons (7 FS and 15 RSNP neurons) were analyzed in layer V, among which only three RSNP neurons responded to DMPP.

Pyramidal neurons typically fired action potentials of longer duration, lower frequency, and with more frequency adaptation than interneurons (Fig. 1E, left). Consistent with previous reports (Vidal and Changeux, 1993; Gil et al., 1997), none of the pyramidal neurons (n = 12) recorded in layers II/III and V were directly depolarized by the application of DMPP. Although, DMPP induced a slight depolarization of some pyramidal neurons, these responses were blocked by glutamatergic and GABAergic receptor antagonists (see below), indicating that they were a result of presynaptic effects of DMPP (Fig. 1E, right). These results indicate that IS interneurons and a subpopulation of RSNP neurons are selectively activated by nicotinic stimulation.

Neocortical interneurons excited by nicotinic receptor stimulation express VIP and CCK

Neocortical interneurons can also be classified by the presence of the three calcium-binding proteins calretinin, calbindin, and parvalbumin, and the four neuropeptides VIP, somatostatin, CCK, and neuropeptide Y (Kubota et al., 1994; Kawaguchi, 1995; Cauli et al., 1997). Ninety-six interneurons (12 FS, 13 IS, and 71 RSNP neurons) that had been tested for sensitivity to DMPP were analyzed by single-cell RT-PCR to detect the presence of mRNAs encoding the above calcium binding proteins and neuropeptides, as well as the two isoforms of the GABA-synthesizing enzyme, glutamic acid decarboxylase (GAD65 and GAD67) (Cauli et al., 1997). The agarose gels of the RT-PCR products for the two RSNP neurons described in Figure 1, B and C, are shown in Figure 2, A and B, respectively. GAD65 and GAD67 mRNAs were detected in both interneurons. The RSNP neuron that was excited by DMPP also expressed VIP, CCK, and calretinin mRNAs (Fig. 2A). In contrast, the mRNAs for somatostatin, neuropeptide Y, calbindin, and calretinin were detected in the DMPP-insensitive neuron (Fig. 2B). All 96 neocortical interneurons examined expressed one or both isoforms of GAD, indicating that they were inhibitory interneurons. Eighty-one of the interneurons analyzed by single-cell RT-PCR were in layers II/III, and 15 interneurons were in layer V. In the population of DMPP-sensitive interneurons (9 IS, 1 FS, and 48 RSNP neurons), the most widely detected markers were VIP and CCK, which were expressed, respectively, by 51 and 45 of the 58 interneurons (Fig. 2C). VIP and CCK were coexpressed in 41 of the interneurons. In contrast, VIP and CCK were only detected in 8 and 15 of the 38 DMPP-insensitive interneurons (Fig. 2D). The majority of the insensitive interneurons expressed calbindin (26 neurons) and somatostatin (27 neurons). Therefore, the majority of the two populations of interneurons excited by nicotinic agonists, IS neurons and a fraction of RSNP neurons, coexpressed VIP and CCK.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2.   The majority of neocortical interneurons excited by nicotinic receptor stimulation coexpress VIP and CCK. A, B, Agarose gels of the PCR products obtained from the two RSNP interneurons described in Figure 1, B and C, respectively. The two interneurons expressed GAD65, GAD67, and calretinin (CR) mRNAs. The cell shown in A also expressed VIP and CCK, whereas the cell in B expressed calbindin (CB), neuropeptide Y (NPY), and somatostatin (SS). Neither of these two cells expressed parvalbumin (PV). The identity of all products was confirmed by Southern blot analysis. C, D, These graphs illustrate the percentage of DMPP-sensitive (n = 58) and DMPP-insensitive (n = 38) interneurons that expressed each of the markers detected by single-cell RT-PCR. The number of interneurons in each group is given in parentheses above the bars. The filled portions indicate the fraction of interneurons in each group that coexpressed VIP.

Direct stimulation of somatodendritic nicotinic receptors

To confirm that the responses to DMPP were caused by the direct activation of the interneurons and not by presynaptic effects of nicotinic receptor stimulation, the AMPA/kainate receptor antagonist CNQX (10 µM), the NMDA receptor antagonist D-APV (50 µM), the GABAA receptor antagonist picrotoxin (100 µM), and the muscarinic receptor antagonist atropine (5 µM) were added to the bathing solution. In the presence these receptor antagonists, 100 µM DMPP still depolarized neocortical interneurons sufficiently to discharge action potentials (data not shown) and, in voltage-clamp experiments, the currents induced by DMPP exhibited an inward rectification at depolarized potentials, with no current being detected at positive potentials (n = 5) (Fig. 3A). The DMPP-mediated currents also persisted when synaptic transmission was blocked with a bathing solution containing 0.5 mM Ca2+, 4 mM Mg2+, and 1 µM tetrodotoxin (n = 3; data not shown). These results indicate that the nicotinic receptor agonist directly activated the neocortical interneurons, probably through the stimulation of somatodendritic nicotinic receptors.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3.   Rectification and pharmacology of responses to nicotinic receptor activation in neocortical interneurons. A, In voltage clamp, 100 µM DMPP induced inward currents (inset) in an interneuron with a peak I-V relationship that showed inward rectification. B, The currents induced by 100 µM DMPP in an interneuron were antagonized by 500 nM dihydro-beta -erythroidine (DHbeta E). After washing out dihydro-beta -erythroidine, the DMPP-induced current partially recovered (Wash) and was almost abolished by 2 µM mecamylamine (MEC). The arrows indicate the beginning of the 1 sec pressure applications of DMPP. C, The DMPP-induced current in a neocortical interneuron (Control) was only slightly reduced by the application of 10 nM MLA. The remaining current was almost completely abolished by 500 nM dihydro-beta -erythroidine (DHbeta E). D, In current clamp, the application of 100 µM acetylcholine (Ach) depolarized an interneuron and induced a discharge of action potentials. Action potentials are truncated because of the sampling rate. E, In the same interneuron recorded in voltage clamp, acetylcholine induced an inward current (Control, bottom trace) that was blocked by 500 nM dihydro-beta -erythroidine (DHbeta E, top trace). All responses (A-E) were recorded in the presence of glutamatergic, GABAergic, and muscarinic receptor antagonists (see Results).

Interneuronal responses are mediated by non-alpha 7 nicotinic receptors

Because neuronal nicotinic responses mediated by receptors containing and lacking the alpha 7 subunit are pharmacologically distinct, we examined the sensitivity of the nicotinic responses to the nicotinic receptor antagonists dihydro-beta -erythroidine, mecamylamine, and MLA. Both dihydro-beta -erythroidine and mecamylamine selectively block non-alpha 7 nicotinic receptor, whereas MLA selectively blocks alpha 7 nicotinic receptors (Alkondon and Albuquerque, 1993; Palma et al., 1996; Zoli et al., 1998). Perfusion of either dihydro-beta -erythroidine (500 nM) or mecamylamine (2 µM) antagonized the currents mediated by 100 µM DMPP by an average of 80 ± 17 (n = 17) and 90 ± 7% (n = 14), respectively (Fig. 3B). In contrast, perfusion of MLA (10 nM) reduced the currents by only 30 ± 5% (n = 3). The remaining MLA-insensitive currents were sensitive to 500 nM dihydro-beta -erythroidine (84 ± 16% block; n = 3) (Fig. 3C). The endogenous nicotinic receptor agonist acetylcholine (100 µM) also activated neocortical interneurons (n = 6), and the pharmacological profile of these responses was similar to that of DMPP-induced currents (Fig. 3C). On the average, 86 ± 8% of the currents evoked by acetylcholine were reversibly antagonized by 500 nM dihydro-beta -erythroidine (n = 5) (Fig. 3D), whereas 10 nM MLA reduced the currents by only 22 ± 2% (n = 3). These results indicated that DMPP and acetylcholine directly excite neocortical interneurons mainly through the activation of nicotinic receptors lacking the alpha 7 subunit.

Nicotinic receptors subunits expressed by responsive interneurons

The nicotinic receptor subunits expressed in the rat neocortex are alpha 3, alpha 4, alpha 5, alpha 7 and beta 2 (Wada et al., 1989, 1990). Because various combinations of these subunits have been shown to form functional non-alpha 7 nicotinic receptors (Papke et al., 1989; Boulter et al., 1990; Papke, 1993; Ramirez-Latorre et al., 1996), single-cell RT-PCR was used to determine which of these subunits were expressed in 17 interneurons that responded to DMPP. Consistent with the pharmacological data, single-cell RT-PCR analysis indicated that most of the interneurons that were excited by nicotinic agonists expressed the mRNAs for alpha 4, alpha 5, and beta 2 (Fig. 4B,C). In contrast, the majority (10 of 17 interneurons) of the DMPP-sensitive neocortical interneurons did not express alpha 7 subunits. Consistent with in situ hybridization studies (Wada et al., 1989; 1990; Lena and Changeux, 1997), the mRNAs encoding alpha 2, alpha 6, beta 3, and beta 4 were not detected in any of the interneurons. The mRNAs encoding the nine nicotinic receptor subunits, however, could be simultaneously detected in 2 ng of total brain RNA (Fig. 4A).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4.   Nicotinic receptor subunits expressed by neocortical interneurons sensitive to DMPP. A, Agarose gel electrophoresis of the products obtained from 2 mg of total brain RNA by an RT-PCR procedure designed to coamplify simultaneously the mRNAs encoding the alpha 2, alpha 3, alpha 4, alpha 5, alpha 6, alpha 7, beta 2, beta 3, and beta 4 subunits of nicotinic receptors. All nine nicotinic receptor subunits were detected. The faint bands in the beta 2 and beta 3 lanes correspond to nonspecific amplifications. B, Agarose gel electrophoresis of the PCR products obtained from an RSNP interneuron that responded to DMPP applications in the presence of glutamatergic, GABAergic, and muscarinic receptor antagonists. Only the alpha 4, alpha 5, and beta 2 subunits were detected in this interneuron. The faint and heavy bands in the alpha 2 and beta 2 lanes correspond to nonspecific amplifications. The identity of the PCR products was confirmed by Southern blot analysis. C, Number of DMPP-sensitive interneurons in which the mRNAs for the nicotinic receptor subunits were detected by single-cell RT-PCR (n = 17). Note that the majority of the tested interneurons expressed alpha 4, alpha 5, and beta 2 subunits.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results demonstrate that nicotinic agonists selectively excite two types of physiologically identified neocortical interneurons, IS and RSNP interneurons, both of which coexpress VIP and CCK. Unlike presynaptic nicotinic receptors modulating glutamate release in cortical areas (McGehee et al., 1995; Gil et al., 1997), nicotinic receptors located on the soma and/or the dendrites of neocortical VIP interneurons lack the alpha 7 subunit.

Expression of functional non-alpha 7 nicotinic receptors in the neocortex

Previous in situ hybridization studies indicate that alpha 3, alpha 4, alpha 5, alpha 7, and beta 2 subunits are expressed in the rat neocortex (Wada et al., 1989, 1990). The neocortical interneurons excited by nicotinic receptor stimulation predominately expressed the mRNAs for the alpha 4, alpha 5, and beta 2 subunits. Although the alpha 7 subunit was detected in some of the VIPergic interneurons excited by DMPP, the majority of the responsive interneurons did not express this subunit. Accordingly, the pharmacological profile of the nicotinic responses was typical of non-alpha 7 nicotinic receptors. The nicotinic currents in the neocortical interneurons were only slightly reduced by MLA, the selective antagonist of alpha 7 nicotinic receptors (Palma et al., 1996). On the other hand, the responses to DMPP were blocked by dihydro-beta -erythroidine and mecamylamine, two selective antagonists of non-alpha 7 nicotinic receptors (Alkondon and Albuquerque, 1993; Zoli et al., 1998). Thus, the molecular and pharmacological data indicate that the nicotinic excitation of VIPergic interneurons is mediated by nicotinic receptors composed of alpha 4, alpha 5, and beta 2 subunits. In heterologous expression systems, functional channels are formed by the coexpression of alpha 4 and beta 2 subunits (Papke et al., 1989; Boulter et al., 1990; Cooper et al., 1991; Luetje and Patrick, 1991; Papke, 1993) or by the coexpression of alpha 4, alpha 5, and beta 2 subunits (Ramirez-Latorre et al., 1996). The addition of the alpha 5 subunit to channels composed of alpha 4 and beta 2 increases the conductance of the channels (Ramirez-Latorre et al., 1996). In contrast, the expression of either of the three subunits alone, the coexpression of alpha 4 and alpha 5 subunits, or the coexpression of alpha 5 and beta 2 subunits (Boulter et al., 1990; Ramirez-Latorre et al., 1996) does not form functional nicotinic receptors. Thus, the responsive interneurons apparently contain nicotinic receptors composed of alpha 4 and beta 2 subunits and/or alpha 4, alpha 5, and beta 2 subunits.

Selective expression of postsynaptic nicotinic receptors by interneurons in cortical areas

Our results, together with previous observations (Vidal and Changeux, 1993; Jones and Yakel, 1997; Frazier et al., 1998; Xiang et al., 1998), suggest that somatodendritic nicotinic receptors are selectively expressed by interneurons and not by pyramidal neurons in the rat neocortex and hippocampus. There are, however, several differences in the expression of nicotinic receptors in the two structures. In the hippocampus, almost all of the interneurons tested responded to nicotinic stimulation apparently through alpha 7-containing nicotinic receptors (Jones and Yakel, 1997; Frazier et al., 1998). In contrast, in the neocortex, only VIP- and CCK-expressing interneurons responded to nicotinic stimulation, and this excitation was mediated by the activation of non-alpha 7 nicotinic receptors. A recent report indicates that, in the visual cortex, interneurons exhibiting low-threshold Ca2+ spikes are excited by nicotinic stimulation, whereas FS interneurons are insensitive to nicotinic stimulation (Xiang et al., 1998). Because the majority (90%; 77 of 85) of the neocortical interneurons excited by nicotinic stimulation in the present study did not exhibit low-threshold Ca2+ spikes, the presence of low-threshold Ca2+ spikes does not appear to be the best marker of nicotinic-sensitive interneurons in the motor cortex. Finally, the expression of nicotinic receptors in the neocortex may differ among species, because in the ferret neocortex both pyramidal neurons and interneurons have been shown to express functional nicotinic receptors (Roerig et al., 1997).

Potential implications of nicotinic receptor-mediated excitation of interneurons expressing VIP and CCK

Nicotinic receptors are important for maintaining performance in a variety of cognitive tasks involving cortical areas (Changeux et al., 1998). In the neocortex, functional postsynaptic nicotinic receptors are selectively expressed by a subpopulation of interneurons coexpressing VIP and CCK. We and others have shown previously that VIP is expressed by subsets of bipolar and bitufted neocortical interneurons (Eckenstein and Baughman, 1984; Morrison et al., 1984; Cauli et al., 1997; Porter et al., 1998) and immunocytochemical data also indicates that CCK is often co-expressed with VIP in these interneurons (Papadopoulos et al., 1987; Kubota and Kawaguchi, 1997). Given the primarily columnarly restricted axonal arbors of interneurons expressing VIP and CCK (Hendry et al., 1983; Connor and Peters, 1984; Magistretti et al., 1984; Kawaguchi and Kubota, 1996; Porter et al., 1998), nicotinic receptor-mediated stimulation of these interneurons may provide a selective increase in the columnar inhibition involved in neocortical information processing (Xiang et al., 1998).

In addition, several lines of evidence suggest that VIP-expressing interneurons are involved in the regulation of regional cerebral blood flow and metabolism in the neocortex (Itakura et al., 1987; Yaksh et al., 1987; Magistretti, 1990). First, VIP-containing neuronal fibers are intimately associated with the intracortical blood vessels (Eckenstein and Baughman, 1984; Chédotal et al., 1994a, 1994b). Second, the application of VIP induces a dilatation of pial arteries (Yaksh et al., 1987). Third, the injection of VIP into the cortex increase the cerebral blood flow (Itakura et al., 1987). Fourth, VIP activates glycogenolysis in neocortical slices (Magistretti et al., 1981). Therefore, the nicotinic excitation of VIPergic interneurons reported in this study may be critical for locally increasing the energy supply in the neocortex during periods of increased neuronal activity. Furthermore, disorders in this homeostatic mechanism for balancing the energy supply with the energy demand may be involved in diseases associated with cholinergic deficits, as indicated by the finding that there is a decrease in cerebral glucose utilization and blood flow in patients with Alzheimer's disease (Eberling et al., 1992; Swerdlow et al., 1994) that can be reversed by increasing cholinergic excitation (Wilson et al., 1991; Parks et al., 1996). The high level of expression of alpha 5 subunits in VIP interneurons may confer a unique pharmacological profile to their nicotinic receptors (Yu and Role, 1998) that could be used to selectively excite this class of neocortical interneurons.


    FOOTNOTES

Received Jan. 19, 1999; revised March 15, 1999; accepted April 12, 1999.

This work was supported by the Centre National de la Recherche Scientifique and European Union Biotech Grants 960382 and 960589. J.T.P. was supported by a Human Frontier Science Program Organization fellowship. We thank Serge Charpak and Shaul Hestrin for insightful discussions, Samia Ben Ammou for technical assistance, and Elodie Christophe for her help during some experiments.

Correspondence should be addressed to Dr. Etienne Audinat, Neurobiologie et Diversité Cellulaire, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 7637, Ecole Supérieure de Physique et de Chimie Industrielles, 10 rue Vauquelin, 75231 Paris Cedex 05, France.

Dr. Porter's present address: Department of Anatomy, Box 9128, West Virginia University, Morgantown, WV 26506-9128.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

  • Alkondon M, Albuquerque EX (1993) Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes. J Pharmacol Exp Ther 265:1455-1473[Abstract/Free Full Text].
  • Angulo MC, Lambolez B, Audinat E, Hestrin S, Rossier J (1997) Subunit composition, kinetic, and permeation properties of AMPA receptors in single neocortical nonpyramidal cells. J Neurosci 17:6685-6696[Abstract/Free Full Text].
  • Boulter J, O'Shea-Greenfield A, Duvoisin RM, Connolly JG, Wada E, Jensen A, Gardner PD, Ballivet M, Deneris ES, McKinnon D (1990) alpha 3, alpha 5, and beta 4: three members of the rat neuronal nicotinic acetylcholine receptor-related gene family form a gene cluster. J Biol Chem 265:4472-4482[Abstract/Free Full Text].
  • Cauli B, Audinat E, Lambolez B, Angulo M-C, Ropert N, Tsuzuki K, Hestrin S, Rossier J (1997) Molecular and physiological diversity of cortical nonpyramidal cells. J Neurosci 17:3894-3906[Abstract/Free Full Text].
  • Changeux JP, Bertrand D, Corringer PJ, Dehaene S, Edelstein S, Lena C, Le Novere N, Marubio L, Picciotto M, Zoli M (1998) Brain nicotinic receptors: structure and regulation, role in learning and reinforcement. Brain Res Brain Res Rev 26:198-216[Medline].
  • Chédotal A, Cozzari C, Faure MP, Hartman BK, Hamel E (1994a) Distinct choline acetyltransferase (ChAT) and vasoactive intestinal polypeptide (VIP) bipolar neurons project to local blood vessels in the rat cerebral cortex. Brain Res 646:181-193[Web of Science][Medline].
  • Chédotal A, Umbriaco D, Descarries L, Hartman BK, Hamel E (1994b) Light and electron microscopic immunocytochemical analysis of the neurovascular relationships of choline acetyltransferase and vasoactive intestinal polypeptide nerve terminals in the rat cerebral cortex. J Comp Neurol 343:57-71[Web of Science][Medline].
  • Connor JR, Peters A (1984) Vasoactive intestinal polypeptide-immunoreactive neurons in rat visual cortex. Neuroscience 12:1027-1044[Web of Science][Medline].
  • Cooper E, Couturier S, Ballivet M (1991) Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor. Nature 350:235-238[Medline].
  • Couturier S, Bertrand D, Matter JM, Hernandez MC, Bertrand S, Millar N, Valera S, Barkas T, Ballivet M (1990) A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha -BTX. Neuron 5:847-856[Web of Science][Medline].
  • Eberling JL, Jagust WJ, Reed BR, Baker MG (1992) Reduced temporal lobe blood flow in Alzheimer's disease. Neurobiol Aging 13:483-491[Web of Science][Medline].
  • Eckenstein F, Baughman RW (1984) Two types of cholinergic innervation in cortex, one co-localized with vasoactive intestinal polypeptide. Nature 309:153-155[Medline].
  • Elgoyhen AB, Johnson DS, Boulter J, Vetter DE, Heinemann S (1994) alpha 9: an acetylcholine receptor with novel pharmacological properties expressed in rat cochlear hair cells. Cell 79:705-715[Web of Science][Medline].
  • Frazier CJ, Rollins YD, Breese CR, Leonard S, Freedman R, Dunwiddie TV (1998) Acetylcholine activates an alpha -bungarotoxin-sensitive nicotinic current in rat hippocampal interneurons, but not pyramidal cells. J Neurosci 18:1187-1195[Abstract/Free Full Text].
  • Gil Z, Connors BW, Amitai Y (1997) Differential regulation of neocortical synapses by neuromodulators and activity. Neuron 19:679-686[Web of Science][Medline].
  • Gitelman DR, Prohovnik I (1992) Muscarinic and nicotinic contributions to cognitive function and cortical blood flow. Neurobiol Aging 13:313-318[Web of Science][Medline].
  • Granon S, Poucet B, Thinus-Blanc C, Changeux JP, Vidal C (1995) Nicotinic and muscarinic receptors in the rat prefrontal cortex: differential roles in working memory, response selection and effortful processing. Psychopharmacology 119:139-144[Medline].
  • Gray R, Rajan AS, Radcliffe KA, Yakehiro M, Dani JA (1996) Hippocampal synaptic transmission enhanced by low concentrations of nicotine. Nature 383:713-716[Medline].
  • Hendry SH, Jones EG, Beinfeld MC (1983) Cholecystokinin-immunoreactive neurons in rat and monkey cerebral cortex make symmetric synapses and have intimate associations with blood vessels. Proc Natl Acad Sci USA 80:2400-2404[Abstract/Free Full Text].
  • Itakura T, Yokote H, Okuno T, Naka Y, Nakakita K, Kamei I, Nakai K, Imai H, Komai N (1987) Regulation of rCBF by intracortical vasoactive intestinal polypeptide-containing neurons. Immunohistochemical and hydrogen clearance study in rats. J Neurosurg 67:93-96[Web of Science][Medline].
  • Jones S, Yakel JL (1997) Functional nicotinic ACh receptors on interneurones in the rat hippocampus. J Physiol (Lond) 504:603-610[Abstract/Free Full Text].
  • Kawaguchi Y (1995) Physiological subgroups of nonpyramidal cells with specific morphological characteristics in layer II/III of rat frontal cortex. J Neurosci 15:2638-2655[Abstract].
  • Kawaguchi Y, Kubota Y (1996) Physiological and morphological identification of somatostatin- or vasoactive intestinal polypeptide-containing cells among GABAergic cell subtypes in rat frontal cortex. J Neurosci 16:2701-2715[Abstract/Free Full Text].
  • Kubota Y, Kawaguchi Y (1997) Two distinct subgroups of cholecystokinin-immunoreactive cortical interneurons. Brain Res 752:175-183[Web of Science][Medline].
  • Kubota Y, Hattori R, Yui Y (1994) Three distinct subpopulations of GABAergic neurons in rat frontal agranular cortex. Brain Res 649:159-173[Web of Science][Medline].
  • Lambolez B, Audinat E, Bochet P, Crépel F, Rossier J (1992) AMPA receptor subunits expressed by single Purkinje cells. Neuron 9:247-258[Web of Science][Medline].
  • Le Novere N, Changeux JP (1995) Molecular evolution of the nicotinic acetylcholine receptor: an example of multigene family in excitable cells. J Mol Evol 40:155-172[Web of Science][Medline].
  • Lena C, Changeux JP (1997) Pathological mutations of nicotinic receptors and nicotine-based therapies for brain disorders. Curr Opin Neurobiol 7:674-682[Web of Science][Medline].
  • Luetje CW, Patrick J (1991) Both alpha - and beta -subunits contribute to the agonist sensitivity of neuronal nicotinic acetylcholine receptors. J Neurosci 11:837-845[Abstract].
  • Magistretti PJ (1990) VIP neurons in the cerebral cortex. Trends Pharmacol Sci 11:250-254[Medline].
  • Magistretti PJ, Morrison JH, Shoemaker WJ, Sapin V, Bloom FE (1981) Vasoactive intestinal polypeptide induces glycogenolysis in mouse cortical slices: a possible regulatory mechanism for the local control of energy metabolism. Proc Natl Acad Sci USA 78:6535-6539[Abstract/Free Full Text].
  • Magistretti PJ, Morrison JH, Shoemaker WJ, Bloom FE (1984) Morphological and functional correlates of VIP neurons in cerebral cortex. Peptides 5:213-218[Web of Science][Medline].
  • McCormick DA, Connors BW, Lighthall JW, Prince DA (1985) Comparative electrophysiology of pyramidal and sparsely spiny stellate neurons of the neocortex. J Neurophysiol 54:782-806[Abstract/Free Full Text].
  • McGehee DS, Heath MJ, Gelber S, Devay P, Role LW (1995) Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269:1692-1696[Abstract/Free Full Text].
  • Morrison JH, Magistretti PJ, Benoit R, Bloom FE (1984) The distribution and morphological characteristics of the intracortical VIP-positive cell: an immunohistochemical analysis. Brain Res 292:269-282[Web of Science][Medline].
  • Newhouse PA, Potter A, Levin ED (1997) Nicotinic system involvement in Alzheimer's and Parkinson's diseases. Implications for therapeutics. Drugs Aging 11:206-228[Web of Science][Medline].
  • Palma E, Bertrand S, Binzoni T, Bertrand D (1996) Neuronal nicotinic alpha 7 receptor expressed in Xenopus oocytes presents five putative binding sites for methyllycaconitine. J Physiol (Lond) 491:151-161[Abstract/Free Full Text].
  • Papadopoulos GC, Parnavelas JG, Cavanagh ME (1987) Extensive co-existence of neuropeptides in the rat visual cortex. Brain Res 420:95-99[Web of Science][Medline].
  • Papke RL (1993) The kinetic properties of neuronal nicotinic receptors: genetic basis of functional diversity. Prog Neurobiol 41:509-531[Web of Science][Medline].
  • Papke RL, Boulter J, Patrick J, Heinemann S (1989) Single-channel currents of rat neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes. Neuron 3:589-596[Web of Science][Medline].
  • Parks RW, Becker RE, Rippey RF, Gilbert DG, Matthews JR, Kabatay E, Young CS, Vohs C, Danz V, Keim P, Collins GT, Zigler SS, Urycki PG (1996) Increased regional cerebral glucose metabolism and semantic memory performance in Alzheimer's disease: a pilot double blind transdermal nicotine positron emission tomography study. Neuropsychol Rev 6:61-79[Web of Science][Medline].
  • Porter JT, Cauli B, Staiger JF, Lambolez B, Rossier J, Audinat E (1998) Properties of bipolar VIPergic interneurons and their excitation by pyramidal neurons in the rat neocortex. Eur J Neurosci 10:3617-3628[Web of Science][Medline].
  • Ramirez-Latorre J, Yu CR, Qu X, Perin F, Karlin A, Role L (1996) Functional contributions of alpha 5 subunit to neuronal acetylcholine receptor channels. Nature 380:347-351[Medline].
  • Roerig B, Nelson DA, Katz LC (1997) Fast synaptic signaling by nicotinic acetylcholine and serotonin 5-HT3 receptors in developing visual cortex. J Neurosci 17:8353-8362[Abstract/Free Full Text].
  • Role LW, Berg DK (1996) Nicotinic receptors in the development and modulation of CNS synapses. Neuron 16:1077-1085[Web of Science][Medline].
  • Ruano D, Lambolez B, Rossier J, Paternain AV, Lerma J (1995) Kainate receptor subunits expressed in single cultured hippocampal neurons: molecular and functional variants by RNA editing. Neuron 14:1009-1017[Web of Science][Medline].
  • Sanberg PR, Silver AA, Shytle RD, Philipp MK, Cahill DW, Fogelson HM, McConville BJ (1997) Nicotine for the treatment of Tourette's syndrome. Pharmacol Ther 74:21-25[Web of Science][Medline].
  • Sanberg PR, Shytle RD, Silver AA (1998) Treatment of Tourette's syndrome with mecamylamine [letter]. Lancet 352:705-706[Web of Science][Medline].
  • Sargent PB (1993) The diversity of neuronal nicotinic acetylcholine receptors. Annu Rev Neurosci 16:403-443[Web of Science][Medline].
  • Sivilotti L, Colquhoun D (1995) Acetylcholine receptors: too many channels, too few functions. Science 269:1681-1682[Free Full Text].
  • Steinlein OK, Mulley JC, Propping P, Wallace RH, Phillips HA, Sutherland GR, Scheffer IE, Berkovic SF (1995) A missense mutation in the neuronal nicotinic acetylcholine receptor alpha 4 subunit is associated with autosomal dominant nocturnal frontal lobe epilepsy. Nat Genet 11:201-203[Web of Science][Medline].
  • Swerdlow R, Marcus DL, Landman J, Kooby D, Frey W, Freedman ML (1994) Brain glucose metabolism in Alzheimer's disease. Am J Med Sci 308:141-144[Web of Science][Medline].
  • Thomson AM, Deuchars J (1994) Temporal and spatial properties of local circuits in neocortex. Trends Neurosci 17:119-126[Web of Science][Medline].
  • Uchida S, Kagitani F, Nakayama H, Sato A (1997) Effect of stimulation of nicotinic cholinergic receptors on cortical cerebral blood flow and changes in the effect during aging in anesthetized rats. Neurosci Lett 228:203-206[Web of Science][Medline].
  • Vidal C, Changeux JP (1993) Nicotinic and muscarinic modulations of excitatory synaptic transmission in the rat prefrontal cortex in vitro. Neuroscience 56:23-32[Web of Science][Medline].
  • Wada E, Wada K, Boulter J, Deneris E, Heinemann S, Patrick J, Swanson LW (1989) Distribution of alpha 2, alpha 3, alpha 4, and beta 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat. J Comp Neurol 284:314-335[Web of Science][Medline].
  • Wada E, McKinnon D, Heinemann S, Patrick J, Swanson LW (1990) The distribution of mRNA encoded by a new member of the neuronal nicotinic acetylcholine receptor gene family (alpha 5) in the rat central nervous system. Brain Res 526:45-53[Web of Science][Medline].
  • Whitehouse PJ, Martino AM, Wagster MV, Price DL, Mayeux R, Atack JR, Kellar KJ (1988) Reductions in [3H]nicotinic acetylcholine binding in Alzheimer's disease and Parkinson's disease: an autoradiographic study. Neurology 38:720-723[Abstract/Free Full Text].
  • Wilson K, Bowen D, Francis P, Tyrrell P (1991) Effect of central cholinergic stimulation on regional cerebral blood flow in Alzheimer's disease. Br J Psychiatry 158:558-562[Abstract/Free Full Text].
  • Xiang Z, Huguenard JR, Prince DA (1998) Cholinergic switching within neocortical inhibitory networks. Science 281:985-988[Abstract/Free Full Text].
  • Yaksh TL, Wang JY, Go VL (1987) Cortical vasodilatation produced by vasoactive intestinal polypeptide (VIP) and by physiological stimuli in the cat. J Cereb Blood Flow Metab 7:315-326[Web of Science][Medline].
  • Yu CR, Role LW (1998) Functional contribution of the alpha 5 subunit to neuronal nicotinic channels expressed by chick sympathetic ganglion neurones. J Physiol (Lond) 509:667-681[Abstract/Free Full Text].
  • Zoli M, Lena C, Picciotto MR, Changeux JP (1998) Identification of four classes of brain nicotinic receptors using beta 2 mutant mice. J Neurosci 18:4461-4472[Abstract/Free Full Text].


Copyright © 1999 Society for Neuroscience  0270-6474/99/19135228-08$05.00/0


This article has been cited by other articles:


Home page
Cereb CortexHome page
P. Aracri, S. Consonni, R. Morini, M. Perrella, S. Rodighiero, A. Amadeo, and A. Becchetti
Tonic Modulation of GABA Release by Nicotinic Acetylcholine Receptors in Layer V of the Murine Prefrontal Cortex
Cereb Cortex, October 7, 2009; (2009) bhp214v1.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
E. Lucas-Meunier, C. Monier, M. Amar, G. Baux, Y. Fregnac, and P. Fossier
Involvement of Nicotinic and Muscarinic Receptors in the Endogenous Cholinergic Modulation of the Balance between Excitation and Inhibition in the Young Rat Visual Cortex
Cereb Cortex, October 1, 2009; 19(10): 2411 - 2427.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. T. Gulledge, D. J. Bucci, S. S. Zhang, M. Matsui, and H. H. Yeh
M1 Receptors Mediate Cholinergic Modulation of Excitability in Neocortical Pyramidal Neurons
J. Neurosci., August 5, 2009; 29(31): 9888 - 9902.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
G. Zolles, E. Wagner, A. Lampert, and B. Sutor
Functional Expression of Nicotinic Acetylcholine Receptors in Rat Neocortical Layer 5 Pyramidal Cells
Cereb Cortex, May 1, 2009; 19(5): 1079 - 1091.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. D. McClure-Begley, N. M. King, A. C. Collins, J. A. Stitzel, J. M. Wehner, and C. M. Butt
Acetylcholine-Stimulated [3H]GABA Release from Mouse Brain Synaptosomes is Modulated by {alpha}4{beta}2 and {alpha}4{alpha}5{beta}2 Nicotinic Receptor Subtypes
Mol. Pharmacol., April 1, 2009; 75(4): 918 - 926.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Karagiannis, T. Gallopin, C. David, D. Battaglia, H. Geoffroy, J. Rossier, E. M. C. Hillman, J. F. Staiger, and B. Cauli
Classification of NPY-Expressing Neocortical Interneurons
J. Neurosci., March 18, 2009; 29(11): 3642 - 3659.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
E. Guntz, H. Dumont, E. Pastijn, A. de Kerchove d'Exaerde, K. Azdad, M. Sosnowski, S. N. Schiffmann, and D. Gall
Expression of Adenosine A2A Receptors in the Rat Lumbar Spinal Cord and Implications in the Modulation of N-Methyl-d-Aspartate Receptor Currents
Anesth. Analg., June 1, 2008; 106(6): 1882 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Lendvai and E. S. Vizi
Nonsynaptic Chemical Transmission Through Nicotinic Acetylcholine Receptors
Physiol Rev, April 1, 2008; 88(2): 333 - 349.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
M. Uematsu, Y. Hirai, F. Karube, S. Ebihara, M. Kato, K. Abe, K. Obata, S. Yoshida, M. Hirabayashi, Y. Yanagawa, et al.
Quantitative Chemical Composition of Cortical GABAergic Neurons Revealed in Transgenic Venus-Expressing Rats
Cereb Cortex, February 1, 2008; 18(2): 315 - 330.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. Tricoire and C. A. Cea-Del Rio
Illuminating Cholinergic Microcircuits in the Neocortex
J. Neurosci., November 7, 2007; 27(45): 12119 - 12120.
[Full Text] [PDF]


Home page
Cereb CortexHome page
I. Ferezou, E. L. Hill, B. Cauli, N. Gibelin, T. Kaneko, J. Rossier, and B. Lambolez
Extensive Overlap of Mu-Opioid and Nicotinic Sensitivity in Cortical Interneurons
Cereb Cortex, August 1, 2007; 17(8): 1948 - 1957.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. von Engelhardt, M. Eliava, A. H. Meyer, A. Rozov, and H. Monyer
Functional Characterization of Intrinsic Cholinergic Interneurons in the Cortex
J. Neurosci., May 23, 2007; 27(21): 5633 - 5642.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
E. L. Hill, T. Gallopin, I. Ferezou, B. Cauli, J. Rossier, P. Schweitzer, and B. Lambolez
Functional CB1 Receptors Are Broadly Expressed in Neocortical GABAergic and Glutamatergic Neurons
J Neurophysiol, April 1, 2007; 97(4): 2580 - 2589.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
A. T. Gulledge, S. B. Park, Y. Kawaguchi, and G. J. Stuart
Heterogeneity of Phasic Cholinergic Signaling in Neocortical Neurons
J Neurophysiol, March 1, 2007; 97(3): 2215 - 2229.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
S. Yamamoto, J. Yamada, S. Ueno, H. Kubota, T. Furukawa, S. Yamamoto, and A. Fukuda
Insertion of {alpha}7 Nicotinic Receptors at Neocortical Layer V GABAergic Synapses Is Induced by a Benzodiazepine, Midazolam
Cereb Cortex, March 1, 2007; 17(3): 653 - 660.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Klaassen, J. Glykys, J. Maguire, C. Labarca, I. Mody, and J. Boulter
Seizures and enhanced cortical GABAergic inhibition in two mouse models of human autosomal dominant nocturnal frontal lobe epilepsy
PNAS, December 12, 2006; 103(50): 19152 - 19157.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. C. Klein and J. L. Yakel
Functional somato-dendritic {alpha}7-containing nicotinic acetylcholine receptors in the rat basolateral amygdala complex
J. Physiol., November 1, 2006; 576(3): 865 - 872.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
T. Gallopin, H. Geoffroy, J. Rossier, and B. Lambolez
Cortical Sources of CRF, NKB, and CCK and Their Effects on Pyramidal Cells in the Neocortex
Cereb Cortex, October 1, 2006; 16(10): 1440 - 1452.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
R. B. Levy, A. D. Reyes, and C. Aoki
Nicotinic and Muscarinic Reduction of Unitary Excitatory Postsynaptic Potentials in Sensory Cortex; Dual Intracellular Recording In Vitro
J Neurophysiol, April 1, 2006; 95(4): 2155 - 2166.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
S. Bandyopadhyay, B. Sutor, and J. J. Hablitz
Endogenous Acetylcholine Enhances Synchronized Interneuron Activity in Rat Neocortex
J Neurophysiol, March 1, 2006; 95(3): 1908 - 1916.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. E. Strang, M. E. Andison, F. R. Amthor, and K. T. Keyser
Rabbit retinal ganglion cells express functional {alpha}7 nicotinic acetylcholine receptors
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C644 - C655.
[Abstract] [Full Text] [PDF]


Home page
Learn. Mem.Home page
T. J. Gould and M. C. Lewis
Coantagonism of glutamate receptors and nicotinic acetylcholinergic receptors disrupts fear conditioning and latent inhibition of fear conditioning
Learn. Mem., July 1, 2005; 12(4): 389 - 398.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Blatow, A. Caputi, and H. Monyer
Molecular diversity of neocortical GABAergic interneurones
J. Physiol., January 1, 2005; 562(1): 99 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Y. Wang, M. Toledo-Rodriguez, A. Gupta, C. Wu, G. Silberberg, J. Luo, and H. Markram
Anatomical, physiological and molecular properties of Martinotti cells in the somatosensory cortex of the juvenile rat
J. Physiol., November 15, 2004; 561(1): 65 - 90.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
J. T. Porter and D. Nieves
Presynaptic GABAB Receptors Modulate Thalamic Excitation of Inhibitory and Excitatory Neurons in the Mouse Barrel Cortex
J Neurophysiol, November 1, 2004; 92(5): 2762 - 2770.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. Cauli, X.-K. Tong, A. Rancillac, N. Serluca, B. Lambolez, J. Rossier, and E. Hamel
Cortical GABA Interneurons in Neurovascular Coupling: Relays for Subcortical Vasoactive Pathways
J. Neurosci., October 13, 2004; 24(41): 8940 - 8949.
[Abstract] [Full Text] [PDF]


Home page
Learn. Mem.Home page
R. Metherate
Nicotinic Acetylcholine Receptors in Sensory Cortex
Learn. Mem., January 1, 2004; 11(1): 50 - 59.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
I. D. Manns, A. Alonso, and B. E. Jones
Rhythmically Discharging Basal Forebrain Units Comprise Cholinergic, GABAergic, and Putative Glutamatergic Cells
J Neurophysiol, February 1, 2003; 89(2): 1057 - 1066.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
L. Zhang and R. A. Warren
Muscarinic and Nicotinic Presynaptic Modulation of EPSCs in the Nucleus Accumbens During Postnatal Development
J Neurophysiol, December 1, 2002; 88(6): 3315 - 3330.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
E. Christophe, A. Roebuck, J. F. Staiger, D. J. Lavery, S. Charpak, and E. Audinat
Two Types of Nicotinic Receptors Mediate an Excitation of Neocortical Layer I Interneurons
J Neurophysiol, September 1, 2002; 88(3): 1318 - 1327.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
I. Ferezou, B. Cauli, E. L. Hill, J. Rossier, E. Hamel, and B. Lambolez
5-HT3 Receptors Mediate Serotonergic Fast Synaptic Excitation of Neocortical Vasoactive Intestinal Peptide/Cholecystokinin Interneurons
J. Neurosci., September 1, 2002; 22(17): 7389 - 7397.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. T. Porter, C. K. Johnson, and A. Agmon
Diverse Types of Interneurons Generate Thalamus-Evoked Feedforward Inhibition in the Mouse Barrel Cortex
J. Neurosci., April 15, 2001; 21(8): 2699 - 2710.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Klink, A. d. K. d'Exaerde, M. Zoli, and J.-P. Changeux
Molecular and Physiological Diversity of Nicotinic Acetylcholine Receptors in the Midbrain Dopaminergic Nuclei
J. Neurosci., March 1, 2001; 21(5): 1452 - 1463.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
E. G. Cape, I. D. Manns, A. Alonso, A. Beaudet, and B. E. Jones
Neurotensin-Induced Bursting of Cholinergic Basal Forebrain Neurons Promotes gamma and theta Cortical Activity Together with Waking and Paradoxical Sleep
J. Neurosci., November 15, 2000; 20(22): 8452 - 8461.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Z. Shao and J. L Yakel
Single channel properties of neuronal nicotinic ACh receptors in stratum radiatum interneurons of rat hippocampal slices
J. Physiol., September 15, 2000; 527(3): 507 - 513.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. N Sudweeks and J. L Yakel
Functional and molecular characterization of neuronal nicotinic ACh receptors in rat CA1 hippocampal neurons
J. Physiol., September 15, 2000; 527(3): 515 - 528.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Cauli, J. T. Porter, K. Tsuzuki, B. Lambolez, J. Rossier, B. Quenet, and E. Audinat
Classification of fusiform neocortical interneurons based on unsupervised clustering
PNAS, May 23, 2000; 97(11): 6144 - 6149.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
I. D. Manns, A. Alonso, and B. E. Jones
Discharge Properties of Juxtacellularly Labeled and Immunohistochemically Identified Cholinergic Basal Forebrain Neurons Recorded in Association with the Electroencephalogram in Anesthetized Rats
J. Neurosci., February 15, 2000; 20(4): 1505 - 1518.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (95)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porter, J. T.
Right arrow Articles by Audinat, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porter, J. T.
Right arrow Articles by Audinat, E.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-