 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 1999, 19(13):5420-5428
Immortalized Human Dorsal Root Ganglion Cells Differentiate into
Neurons with Nociceptive Properties
Heather K.
Raymon1,
Silke
Thode1,
Jiuying
Zhou1,
Glenn C.
Friedman1,
Jose R.
Pardinas1,
Christian
Barrere1,
Randolph M.
Johnson2, and
Dinah W. Y.
Sah1
1 Signal Pharmaceuticals Incorporated, San
Diego, California 92121, and 2 Roche Bioscience, Palo Alto,
California 94304
 |
ABSTRACT |
A renewable source of human sensory neurons would greatly
facilitate basic research and drug development. We had established previously conditionally immortalized human CNS cell lines that can
differentiate into functional neurons (Sah et al., 1997 ). We report
here the development of an immortalized human dorsal root ganglion
(DRG) clonal cell line, HD10.6, with a tetracycline-regulatable v-myc oncogene. In the proliferative condition, HD10.6
cells have a doubling time of 1.2 d and exhibit a neuronal
precursor morphology. After differentiation of clone HD10.6 for 7 d in the presence of tetracycline, v-myc expression was
suppressed, and >50% of the cells exhibited typical neuronal
morphology, stained positively for neuronal cytoskeletal markers, and
fired action potentials in response to current injection. Furthermore,
this cell line was fate-restricted to a neuronal phenotype; even in
culture conditions that promote Schwann cell or smooth muscle
differentiation of neural crest stem cells, HD10.6 differentiated
exclusively into neurons. Moreover, differentiated HD10.6 cells
expressed sensory neuron-associated transcription factors and exhibited
capsaicin sensitivity. Taken together, these data indicate that we have established an immortalized human DRG cell line that can differentiate into sensory neurons with nociceptive properties. The cell line HD10.6
represents the first example of a human sensory neuronal line and will
be valuable for basic research, as well as for the discovery of novel
drug targets and clinical candidates.
Key words:
sensory neuron; pain; PNS cell line; precursor; DRG; human
 |
INTRODUCTION |
Nociceptive sensory neurons of the
dorsal root ganglion (DRG) are activated by painful or noxious stimuli
in the periphery and transmit this information to the CNS. The
highly specialized functions of these neurons are subserved by distinct
combinations of molecular and cellular properties, some of which are
unique to nociceptive neurons. These characteristics include the
expression of capsaicin receptors (Fitzgerald, 1983 ; Bevan et al.,
1987 ; Szallasi, 1994 ; Caterina et al., 1997 ), tetrodotoxin
(TTX)-resistant sodium channels (Kostyuk et al., 1981 ; Caffrey et al.,
1992 ; Roy and Narahashi, 1992 ; Elliott and Elliott, 1993 ; Ogata and
Tatebayashi, 1993 ; Akopian et al., 1996 ; Sangameswaran et al., 1996 ),
P2X3 purinoceptors (Chen et al., 1995 ; Lewis et al., 1995 ), sustained proton-gated current (Bevan and Yeats, 1991 ; Zeilhofer et al., 1996 ;
Waldmann et al., 1997a ,b ), neuropeptides (Hunt and Rossi, 1985 ; Holzer,
1988 ) such as substance P and calcitonin gene-related peptide,
TrkA receptors (Molliver et al., 1995 ), and c-Ret/glial cell
line-derived neurotrophic factor receptors (GDNFR)- (Molliver et
al., 1997 ).
Although these properties have been elucidated in primary DRG cultures,
such cultures contain relatively few neurons and are not easily
transfectable with exogenous genes. These limitations, which are
prohibitive for many biochemical and molecular studies, can be overcome
with immortalized cell lines that differentiate readily into sensory
neurons. Such cell lines will facilitate the identification and
validation of new targets for the treatment of pain, as well as the
study of mechanisms regulating sensory neuron differentiation,
maturation, and survival.
We report here the establishment of a stable immortalized clonal human
DRG cell line that differentiates into neurons with nociceptive
properties. These properties include expression of the sensory
neuron-selective transcription factor DRG11 (Saito et al., 1995 ),
sensitivity to capsaicin, and expression of a sustained proton-gated
current. Furthermore, using this cell line, we examined the relative
importance of extrinsic versus intrinsic determinants in sensory neuron
differentiation. Although previous reports had suggested that
peripheral neural progenitors undergo progressive restrictions in
developmental potential, the existence of committed sensory neuronal
progenitors in the DRG was controversial. The immortalization of a
fate-restricted sensory neuronal progenitor from human DRG establishes
the existence of such progenitor cells. The human cell line described
here represents the first example of a stable immortalized DRG cell
line that gives rise to neurons with nociceptive properties.
 |
MATERIALS AND METHODS |
Primary cell culture. Human DRGs from first
trimester embryos were dissected and maintained for ~48 hr at 4°C
before dissociation. Ganglia were dissociated by incubation at 37°C
for 20 min in an enzyme solution containing 1 mg/ml collagenase (type
4; Worthington, Freehold, NJ) and 4 mg/ml dispase (grade II;
Boehringer Mannheim, Indianapolis, IN) with occasional trituration. The
cell suspension was washed twice with L15 medium and subsequently
plated on a fibronectin (Life Technologies, Gaithersburg, MD) substrate
in L15 complete medium [L15-C; based on Stemple and Anderson (1992) ] with 40 ng/ml FGF-2 (human recombinant basic fibroblast growth factor;
Boehringer Mannheim).
Immortalization. Cultures were immortalized with the
retroviral vector LINX v-myc, using methods similar
to those described previously (Sah et al., 1997 ). In this system,
expression of the v-myc oncogene is controlled by a
tetracycline-sensitive transactivator that binds to a minimal
cytomegalovirus promoter in the absence of tetracycline, driving
transcription of the oncogene. Tetracycline (0.01-1.0 µg/ml; Sigma,
St. Louis, MO) almost completely abolishes transcriptional activation
by the tetracycline-sensitive transactivator, thereby blocking
transcription of the v-myc oncogene. A gene conferring neomycin resistance is also present in the vector, permitting selection
of infected cells by exposure to G418 (100-200 µg/ml).
Expansion and passaging of immortalized cultures. After
retroviral infection and G418 selection, human DRG cultures were
expanded. Cultures approaching confluency were passaged by
trypsinization and typically replated at 7 × 103 cells/cm2.
Isolation of clonal cell lines. Clones were isolated by
limiting dilution in 96-well plates. Cultures were maintained and passaged as described above.
Genomic Southern blot analysis. Total DNA was prepared from
~1.5 × 106 cells using standard methods and
was digested with restriction enzymes that cut in the integrated
provirus (BamHI, EcoRI, BstEII, or HindIII; New England Biolabs, Beverly, MA). The
digested DNA was resolved on a 0.8% agarose gel, transferred to a
nylon membrane, and hybridized to a random-primed
32P-labeled PstI-PstI fragment from
MC29 virus that contains v-myc (Lofstrand Labs Limited,
Gaithersburg, MD).
Differentiation of immortalized cultures and clonal cell
lines. For differentiation, immortalized cells were plated onto
polyornithine- and laminin-coated tissue culture plastic and then
switched to differentiation medium. The differentiation medium
consisted of L15-C (without chick embryo extract or FGF-2) or
Ultraculture medium (BioWhittaker, Walkersville, MD) plus tetracycline
(1 µg/ml). In addition, the following factors were included in the
differentiation medium alone or in combination: human serum (2.5%),
fetal bovine serum (10%), retinoic acid (0.5 µM),
forskolin (5-10 µM), GDNF (25 ng/ml; Promega, Madison,
WI), CNTF (25 ng/ml; R & D Systems, Minneapolis, MN), NGF (25 ng/ml; R
& D Systems), and heregulin 1 (80 ng/ml; R & D Systems). In some
differentiation experiments, tetracycline was added to the
proliferation medium, which also contained epidermal growth factor
(EGF; 100 ng/ml; Life Technologies), FGF-2 (4 ng/ml; Boehringer
Mannheim), and NGF (20 ng/ml; R & D Systems). In a few experiments,
cells were differentiated on the fibronectin substrate.
Immunofluorescence. Cultures were fixed and stained using
methods described previously (Sah et al., 1997 ). Representative fields
from at least two independent experiments were imaged using a
Photometrics Sensys 12-bit digital camera and IPLAB
Spectrum imaging software and then were scored.
4',6-Diamidino-2-phenylindole (DAPI) counterstaining of nuclei was used
to determine the total number of cells within a field. Primary
antibodies used for immunofluorescent detection included polyclonal
antibodies against glial fibrillary acidic protein (GFAP;
Chemicon, Temecula, CA), substance P (Chemicon), TrkA (Santa Cruz
Biotechnology, Santa Cruz, CA), TrkC (Santa Cruz Biotechnology),
tyrosine hydroxylase (TH; Chemicon), and v-myc (Caltag,
South San Francisco, CA) and monoclonal antibodies against Islet-1
(Developmental Hybridoma Bank, Iowa City, IA), NF160 (Sigma), p75
(clone 8211; Accurate Chemicals, Westbury, NY), peripherin (Chemicon),
and -III tubulin (Sigma). Secondary antibodies (Jackson ImmunoResearch, West Grove, PA) used for immunofluorescent detection were donkey anti-mouse antibodies conjugated to Texas Red or Cy3 and
donkey anti-rabbit antibodies conjugated to FITC or Cy3. The specificity of all primary and secondary antibodies was confirmed on
appropriate positive and negative control cultures.
Cobalt histology. Cobalt histology was performed as
described previously (Wood et al., 1988 ) with the following slight
modification. The cells were exposed to Ringer's solution containing 1 µM capsaicin and 10 mM CoCl2 for
8 min in the presence or absence of the antagonist capsazepine (10 µM). After histological processing, cultures were coverslipped with polyvinyl alcohol and
1,4-diazabicyclo[2,2,2]octane.
PCR. mRNA was extracted from tissue samples and frozen cell
pellets using the MicroFastTrack kit (Invitrogen, San Diego, CA) according to the manufacturer's protocol. The RNA was then reverse transcribed using the cDNA Cycle kit (Invitrogen).
Non-reverse-transcribed control samples were generated by omitting the
AMV reverse transcriptase. One microliter of cDNA template was
amplified in a total reaction volume of 100 µl containing 10 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 5 units of Taq
polymerase (Boehringer Mannheim), each analytical primer at 0.5 µM, each internal control primer at 0.1 µM,
and each dNTP at 0.2 mM. Amplifications using DRG11 primers
included each RPL27 control primer at 0.1 µM in the same reaction using the following conditions: initial denaturation for 2 min
at 94°C and 35 cycles of 94°C for 30 sec, 60°C for 30 sec, and
72°C for 1 min followed by a final elongation step of 7 min at
72°C. Amplifications using human achaete-scute homolog-1 (hASH1) primers were performed with an initial denaturation for 2 min
at 94°C and 40 cycles of 94°C for 30 sec and 72°C for 1.5 min
followed by a final elongation step of 7 min at 72°C. In this case,
reactions with each RPL27 control primer at 0.1 µM were done separately with an initial denaturation for 2 min at 94°C and 40 cycles of 94°C for 30 sec, 60°C for 30 sec, and 72°C for 1 min
followed by a final elongation step of 7 min at 72°C. Reaction products were resolved on 2-3% agarose gels in Tris-borate and EDTA.
Analytical restriction digests were used to confirm the specificity of
the products.
Primer sequences were as follows: RPL27 forward (F),
GAACATTGATGATGGCACCTC; RPL27 reverse (R), GGGGATATCCACAGAGTACC;
hASH1 F, TTCAGCGGCTTTGGCTACAG; hASH1 R, GAGATGGTGGGCGACAGGAC; DRG11 F,
ACCAGGAACCAGGGGCTAAGGA; and DRG11 R, GACGGCAGAAGGTTGGCAGACT.
Electrophysiology. Whole-cell recording was performed as
described in Sah et al. (1997) with slight modifications. For recording action potentials as well as sodium and potassium currents, the external solution was 2 mM Ca2+
Tyrode's solution containing 150 mM NaCl, 4 mM
KCl, 2 mM MgCl2, 10 mM
glucose, and 10 mM HEPES, pH 7.4 with NaOH, with 2 mM CaCl2 added. Action potentials were elicited
by current injection with the internal solution containing 130 mM KCl, 5 mM MgCl2, 10 mM EGTA, and 10 mM HEPES, pH 7.4 with KOH.
Potassium currents were also recorded with this potassium
chloride-based internal solution as well as 1 µM TTX in
the external solution to block sodium currents. For isolating
voltage-gated sodium currents, cesium-containing internal solution was
used to block voltage-gated potassium currents. Voltage-gated sodium
and calcium currents and ligand-gated currents were recorded with an
internal solution containing 108 mM
cesium-methanesulfonate, 4 mM MgCl2, 9 mM EGTA, 9 mM HEPES, and, in some
cases, 4 mM ATP, 14 mM creatine phosphate (Tris
salt), and 0.3 mM GTP (Tris salt), pH 7.4 with CsOH. For
recording calcium channel current, the external solution was 160 mM tetraethylammonium chloride (TEA-Cl) with 5 mM BaCl2, 10 mM HEPES, pH
7.40 with TEA-OH, and 1 µM TTX added. Proton currents
were elicited with 2 mM
Ca2+Tyrode's external solution adjusted to pH 5.1 containing 2-[N-morpholino]ethanesulfonic acid in place of
HEPES. Responses to  -methylene-ATP (20 or 100 µM,
diluted from 100 mM stock in H20; Research
Biochemicals, Natick, MA) and capsaicin (1 µM, diluted
from 10 mM stock in DMSO; Research Biochemicals) were
elicited by applying agonist in Tyrode's solution containing 0.5 mM Ca2+.
 |
RESULTS |
Immortalization of human DRG progenitors
Human embryonic DRG cultures were infected with the
tetracycline-regulatable v-myc oncogene, using methods
similar to those described previously (Sah et al., 1997 ). After 3 d of G418 selection, clusters of 5-14 cells were present. These
proliferating cells were polygonal in shape and phase-dark, exhibiting
a morphology similar to that of rat neural crest stem cells (Stemple
and Anderson, 1992 ).
Characterization of retrovirally infected human
DRG progenitors
As expected, the majority of G418-resistant cells were
immunoreactive for the v-myc oncoprotein, as determined
relative to positive and negative controls run in parallel. The
proliferative cultures were examined with immunocytochemical methods
for expression of the cell type-specific markers -III tubulin
(neuronal precursor marker), p75 (the low-affinity NGF receptor;
expressed by neural crest stem cells), and GFAP (Schwann cell marker).
Only -III tubulin immunoreactivity was present (0.3 ± 0.2% of the
cells), suggesting that a small population of neuronal precursors had been immortalized. After differentiation for 1-1.5 weeks with tetracycline (Tc), human serum (HS), forskolin (Fsk), GDNF (G), CNTF
(C), plus NGF (N) or with Tc, HS, retinoic acid (RA), G, C, plus N, the
cultures contained cells that exhibited neuronal morphology
(phase-bright, process-bearing) and -III tubulin and NF160
immunoreactivities (as evaluated relative to positive and negative
controls run in parallel), confirming that neuronal precursors had been immortalized.
Isolation and expansion of clonal human DRG progenitor
cell lines
Clonal immortalized human DRG cell lines were isolated by limiting
dilution. In some cases, putative clones were subcloned to insure
clonality. One putative clone, HD10.6, that exhibited capsaicin
sensitivity (see below) was the focus of the present study. To verify
that HD10.6 arose from a single integration event and is clonal,
genomic Southern analysis was performed. Genomic DNA from HD10.6 was
digested with the restriction enzymes BamHI, EcoRI, BstEII, or HindIII and probed
with [32P]v-myc. As expected,
HindIII produced a unit-length DNA fragment of 4.7 kb,
consistent with the absence of genetic rearrangement (Fig.
1A). BamHI,
EcoRI, and BstEII each cut once within the
provirus and at a unique site within the flanking genomic DNA; these
restriction enzymes gave single bands (Fig. 1A) that
were identical in early and late passage cultures, establishing that
HD10.6 is clonal and stable with respect to the provirus integration
site.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 1.
Clonal analysis and tetracycline suppression of
v-myc immunoreactivity in the human DRG cell line
HD10.6. A, Southern blot analysis of genomic DNA
hybridized with a v-myc probe. The DNA was enzymatically
digested with HindIII that cuts at two sites within the
vector or with EcoRI, BstEII, or
BamHI that cut within the vector and within the flanking
DNA sequence. B, Phase contrast photomicrograph of
HD10.6 cells grown in the proliferative condition. C,
D, v-myc staining
(green, left) and DAPI
counterstaining (blue, right) of cells
grown in the proliferative growth condition without tetracycline
(C) and after 6 d of differentiation with
tetracycline (D). E, Histogram
quantifying the percentage of cells immunoreactive for
v-myc in the proliferative growth condition
( Tc) and after 6 d of differentiation with
tetracycline (+Tc). Scale bars: B, 30 µm; C, D, 30 µm.
|
|
In the proliferative growth condition, clone HD10.6 exhibited a
doubling time of 1.2 d and a morphology (Fig.
1B) similar to that described for neural
crest-derived neuronal precursors isolated from the gut (Lo and
Anderson, 1995 ).
Immunocytochemistry for v-myc confirmed the presence of the
oncoprotein in HD10.6 cells and established that the oncoprotein was
effectively downregulated by the addition of Tc to the growth medium.
In the proliferative growth condition, 83 ± 2% of HD10.6 cells
expressed detectable v-myc immunoreactivity, with the
staining confined to the nuclei as expected (Fig.
1C,E). In contrast, after 6 d of Tc
treatment, no cells exhibited significant v-myc
immunoreactivity (Fig. 1D,E).
Neuronal differentiation of clone HD10.6
Clone HD10.6 cells acquired neuronal morphology during
differentiation on a polyornithine and laminin substrate in medium containing Tc, Fsk, HS, G, C, plus N (Fig.
2A). The time course of
neuronal differentiation was rapid; phase-bright cells with rounded
cell bodies and long processes were observed 3-4 d after the
initiation of differentiation. Moreover, -III tubulin, NF160, and
peripherin immunoreactivities (Fig. 2B-D)
were present in 61 ± 8, 46 ± 5, and 71 ± 7% of
differentiated HD10.6 cells, respectively.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
Neuronal differentiation of the HD10.6 cell line.
A, Phase contrast photomicrographs of two cells at 17, 24, 45, and 94 hr after the start of differentiation are shown.
B-D, Differentiated HD10.6 cells were immunoreactive
for -III tubulin (B), NF160
(C), and peripherin (D).
Scale bars: A, 30 µm; B-D, 20 µm.
|
|
To establish further the neuronal phenotype of clone HD10.6, we
selected differentiated cells with neuronal morphology for electrophysiological recording. Regenerative action potentials were
elicited by current injection (Fig.
3A, 15 of 15 cells). In
contrast, proliferating HD10.6 cells were quiescent. Differentiated HD10.6 cells expressed a variety of voltage- and ligand-gated currents
exhibited by DRG neurons. Voltage-gated sodium current (Fig.
3B; 915 ± 162 pA; n = 12 cells;
holding potential of 80 mV; test potential of 10 mV) was rapid and
blocked by 1 µM TTX (9 of 9 cells), indicating
that all of the current was TTX-sensitive. Potassium current kinetics
and voltage dependence were consistent with the delayed rectifier class
of potassium currents (Fig. 3C), whereas calcium channel
current kinetics and voltage dependence were consistent with the
high-threshold class of calcium currents (Fig. 3D; 345 ± 49 pA; n = 7 cells; holding potential of 80 mV; test potential of 10 mV). The cells expressed P2X purinergic receptors, as indicated by their responses to  -methylene-ATP (20 or 100 µM) application with rapidly activating and
desensitizing currents (Fig. 3E; 196 ± 48 pA;
n = 6 of 6 cells; holding potential of 80 mV). In
addition, the cells responded to application of acidic (pH 5.1)
solution with inward currents comprised of both transient (932 ± 284 pA; n = 7 of 7 cells) and sustained (121 ± 29 pA; n = 10 of 12 cells) components at 80 mV (Fig.
3F).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3.
Action potential and voltage- and ligand-gated
currents in neuronally differentiated HD10.6 cells. Current or voltage
pulses are illustrated above the data traces in A-D. A,
Action potential elicited by current injection (104 pA).
Dashed line indicates membrane potential of 0 mV.
B, Sodium currents elicited by depolarizations from a
holding potential of 80 mV to test potentials of 40, 30, 20,
10, or 0 mV. Sodium currents were isolated using an internal solution
containing cesium to block potassium currents.
C, Potassium currents elicited by depolarizations from a
holding potential of 80 mV to test potentials of 30, 20, 10, 0, +10, or +20 mV. Potassium currents were isolated by including 1 µM TTX in the external solution to block sodium currents.
D, Calcium channel current in response to depolarization
from a holding potential of 80 to 10 mV. E,
 -Methylene-ATP ( -meATP) response elicited by
applying 20 µM  -methylene-ATP (solid
horizontal bar) for 7 sec at a holding potential of 80 mV.
F, Proton-activated current elicited by applying an
acidic (pH 5.1) solution (solid horizontal bar) for 30 sec at a holding potential of 80 mV.
|
|
Neuronal fate restriction of clone HD10.6
To determine the relative importance of extrinsic versus intrinsic
cues in fate determination, we differentiated clone HD10.6 in
conditions that are instructive for the differentiation of neural crest
stem cells into Schwann cells (Stemple and Anderson, 1992 ; Shah et al.,
1994 ) or smooth muscle cells (Shah et al., 1996 ).
HD10.6 cells grown in the standard neuronal differentiation medium (Tc,
HS, Fsk, G, C, plus N) stained positively for -III tubulin and NF160
but not for GFAP or the smooth muscle marker calponin (Fig.
4). Similarly, cells differentiated with
Tc plus heregulin 1 (Fig. 4), with Tc, Fsk, plus fetal bovine serum
(data not shown), with Tc plus transforming growth factor (TGF) 1
(Fig. 4), or with Tc, EGF, basic fibroblast growth factor (FGF-2), NGF, plus chick embryo extract (data not shown) were -III
tubulin-immunoreactive but not GFAP- or calponin-immunoreactive.
Although the proportion of -III tubulin-immunoreactive cells was
comparable in all of these conditions, the percentage of
NF160-immunoreactive cells was considerably less in the heregulin 1
and TGF 1 conditions (Fig. 4B). This is most likely
caused by an effect on the maturation of the neurons because weak NF160
labeling was observed (Fig. 4A). Nevertheless, these
data indicate that clone HD10.6 differentiates into neurons regardless
of the factors present in the culture medium.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4.
Restriction of HD10.6 cells to a neuronal fate.
A, HD10.6 cells were grown for 5 d in Tc, HS, Fsk,
G, C, plus N (TcHSFskGCN); Tc plus heregulin 1
(TcHRG- 1); or Tc plus TGF 1
(TcTGF 1). Cells were then immunostained for -III
tubulin, NF160, GFAP, or calponin. DAPI counterstaining reveals all the
nuclei in the field. B, Quantitation of cell
type-specific markers in HD10.6 cells shows the percentage of cells
immunoreactive for -III tubulin, NF160, GFAP, and calponin after
differentiation with Tc, HS, Fsk, G, C, plus N; Tc plus heregulin 1;
or Tc plus TGF 1. Scale bar, 30 µm.
|
|
After growth in the standard neuronal differentiation medium, two other
clones, derived from the same original immortalized human DRG culture,
gave rise to GFAP-immunoreactive Schwann cells and
calponin-immunoreactive, elongated, multinucleated muscle cells.
Therefore, under these conditions, immortalized precursor cells of
other lineages will differentiate into non-neuronal cells. In contrast,
HD10.6 cells differentiate only into neurons, independent of the
differentiation conditions, and therefore appear to be committed
neuronal progenitor cells.
Substrate also plays an important role in the differentiation of neural
crest stem cells, with fibronectin inhibiting neuronal specification
(Stemple and Anderson, 1992 ). To examine the effect of substrate on
differentiation of clone HD10.6, we compared cultures during 6 d
of differentiation on a polyornithine and laminin versus fibronectin
substrate. On both substrates, cells with neuronal morphology were
observed to a similar extent over the course of the differentiation
period (data not shown). These results establish that clone HD10.6 is
committed to a neuronal fate independent of growth factor and substrate conditions.
Sensory neuronal lineage of clone HD10.6
Neural progenitors in the DRG have been reported to differentiate
into autonomic neurons (Schweizer et al., 1983 ; Le Douarin et al.,
1985 ; Xue et al., 1988 , 1992 ). To determine whether we had immortalized
a sensory or autonomic neuronal progenitor, we examined clone HD10.6
for the expression of sensory- and autonomic-selective transcription
factors and for a specific sympathetic neuronal enzyme. DRG11, a
transcription factor specifically expressed in postmigratory sensory
neurons but not in autonomic neurons or glia (Saito et al., 1995 ), was
present after differentiation of HD10.6 (Fig.
5A). In contrast, hASH1, a
transcription factor found only within autonomic precursors in the
peripheral nervous system (Lo et al., 1991 ), was absent in
proliferating and differentiated HD10.6 cells (Fig. 5B).
Furthermore, differentiated HD10.6 cells did not express TH (Fig.
5C), a marker for sympathetic neurons from the autonomic
lineage.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5.
HD10.6 cells express features of sensory but not
autonomic neurons. A, B, Reverse
transcription-PCR analysis of DRG11 (A)
and hASH1 (B) expression in HD10.6 cells after
growth in proliferative (prolif.) or
differentiating (diff.) conditions. Negative controls
are sympathetic ganglia (symp. gang.;
A) and kidney tissue (B). Positive
controls are human DRG tissue (A) and
IMR 32 cells (B). C, Lack
of tyrosine hydroxylase immunoreactivity (green)
in differentiated HD10.6 cells, with DAPI counterstaining
(blue) to reveal all nuclei in the field. Scale bar, 20 µm.
|
|
Additional sensory neuronal markers were present in differentiated
HD10.6 cells. Substance P immunoreactivity was present in all
differentiated HD10.6 cells with neuronal morphology (Fig. 6A), whereas Islet-1, a
transcription factor required for DRG formation (Pfaff et al., 1996 ),
was present in the nuclei of ~50% of differentiated HD10.6 cells
(Fig. 6B). In addition, all differentiated HD10.6
neurons were immunoreactive for TrkA (Fig. 6C) and p75 (Fig.
6D), but we were unable to detect significant levels
of TrkC immunoreactivity. Taken together, these results suggest that clone HD10.6 belongs to the lineage of small-diameter,
TrkA-immunoreactive sensory neurons.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
HD10.6 cells differentiate into neurons with
nociceptive properties. A-D, Differentiated HD10.6
cells were immunoreactive for substance P (A),
Islet-1 (B), TrkA (C), and
p75 (D). E, Capsaicin (1 µM)-induced cobalt uptake in differentiated HD10.6 cells
is shown. Arrows indicate clusters of labeled
cells. F, Electrophysiological recording of current
elicited by applying 1 µM capsaicin (solid
horizontal bar) at a holding potential of 80 mV is shown.
Scale bars: A, B, 25 µm;
C, D, 30 µm; E, 35 µm.
|
|
Capsaicin sensitivity of clone HD10.6
Capsaicin sensitivity is a hallmark of nociceptive sensory
neurons. To examine differentiated HD10.6 cells for capsaicin
responsiveness, we used cobalt histology and electrophysiological
recording. Thirty-two percent of differentiated HD10.6 neurons
exhibited detectable levels of cobalt staining in response to 1 µM capsaicin (Fig. 6E); this staining
was blocked by 10 µM capsazepine. Electrophysiological recordings from differentiated HD10.6 neurons confirmed that the cells
express functional capsaicin receptors (Fig. 6F; 1 µM capsaicin; 423 ± 96 pA; 11 of 11 cells; holding
potential of 80 mV). These data show that differentiated HD10.6
cultures contain neurons with nociceptive properties.
 |
DISCUSSION |
We have established, for the first time, a stable immortalized
clonal cell line that differentiates into sensory neurons with nociceptive features. The properties of this cell line indicate that
sensory neuronal precursor cells exist in the human embryonic DRG.
Furthermore, using this cell line, we showed that intrinsic determinants dominated the fate of the cell when challenged with different external stimuli. These data suggest that we have
immortalized a human DRG progenitor cell after commitment to a sensory
neuronal lineage.
Previous studies, using clonal analyses of primary cultures (Duff et
al., 1991 ; Stemple and Anderson, 1992 ; Shah et al., 1994 , 1996 ; Lo and
Anderson, 1995 ), in vitro analysis of an immortalized cell
line (Rao and Anderson, 1997 ), in vivo tracer injection
(Bronner-Fraser and Fraser, 1988 ), retroviral marking (Frank and Sanes,
1991 ), and transplantation methods (Schweizer et al., 1983 ), have
demonstrated the existence of multipotent and developmentally
restricted precursor cells in the developing rodent and avian
peripheral nervous systems. Specifically, these studies established
that premigratory neural crest stem cells give rise to neurons as well
as Schwann cells, smooth muscle cells, and melanocytes and that the
fate of neural crest stem cells can be influenced by environmental
signals in vitro (Matsumoto, 1994 ; Sun and Maxwell, 1994 ;
Maxwell et al., 1996 ; Varley and Maxwell, 1996 ) and in vivo.
However, less is known about the developmental capacity of
postmigratory neural crest stem cells. In the gut, postmigratory neural
crest stem cells committed to a neuronal lineage exist (Lo and
Anderson, 1995 ). However, in the DRG, some reports suggest that a
population of latent autonomic precursors is present (Schweizer et al.,
1983 ; Le Douarin et al., 1985 ; Xue et al., 1988 , 1992 ), whereas other studies (Duff et al., 1991 ) indicate that committed sensory neuronal precursors are present.
In the present study, the properties of the human DRG cell line HD10.6
suggest that human DRG progenitor cells undergo progressive restrictions in developmental potential, becoming fate-restricted to a
sensory neuronal lineage. HD10.6 cells differentiate only into neurons,
even when grown in culture conditions that promote the differentiation
of neural crest stem cells into Schwann cells or smooth muscle cells
(Stemple and Anderson, 1992 ; Shah et al., 1994 , 1996 ). Moreover, HD10.6
cells express the sensory neuron-selective transcription factor DRG11
but not the autonomic precursor-selective transcription factor hASH1.
Because our immortalization approach requires cell division for
successful retroviral infection, the properties of HD10.6 support the
existence in the DRG of proliferative human progenitor cells that are
committed to a sensory neuronal lineage. A possible caveat is that the
DRG cells that initially gave rise to HD10.6 did not have the same fate
restriction as HD10.6, as a result of immortalization and/or subsequent
cell division. We addressed this issue by evaluating clone HD10.6 as soon as a sufficient number of cells was available and by comparing the
behavior of HD10.6 cells from an early passage with the behavior of
HD10.6 cells from a later passage. HD10.6 cells exhibit a stable differentiated phenotype over >65 doublings, suggesting that
fundamental changes in behavior do not occur after cell division and
passaging. Therefore, we propose that unlike premigratory neural crest
stem cells, committed human DRG progenitor cells exist that have lost the capacity to differentiate into multiple cell types and are restricted to a sensory neuronal fate.
Differentiated HD10.6 cells exhibit a number of properties
characteristic of sensory neurons, including neuronal cytoskeletal markers, transcription factors, neurotransmitters, ion channels, and
neurotransmitter receptors. As expected, -III tubulin, NF160, peripherin, substance P, Islet-1, TrkA, and p75 are present in these
cells. Although these properties are also expressed in autonomic neurons, the expression of these characteristics in differentiated HD10.6 neurons, together with the sensory neuron-selective
transcription factor DRG11, is consistent with a sensory neuronal phenotype.
As expected, differentiated HD10.6 neurons are functional, firing
action potentials after current injection and expressing sodium,
potassium, and calcium currents. Importantly, differentiated HD10.6
cells exhibit two distinctive features of
nociceptors capsaicin-activated current and sustained proton-activated
current. Capsaicin has been shown to open cationic channels in the
nociceptive subpopulations of mammalian sensory neurons that are
associated with the C- and A -fibers (Bevan and Szolcsanyi, 1990 ).
Although all differentiated HD10.6 neurons exhibit capsaicin (1 µM)-activated currents as assessed by
electrophysiological measurements, only one-third of the neurons were
labeled by the same concentration of capsaicin using cobalt histology.
The dose of capsaicin (1 µM) that we used is specific for
nociceptors; the reported EC50 value for
capsaicin-activated current is 0.2 µM, with maximal
responses elicited by 1 µM capsaicin (Wood et al., 1988 ).
Wood et al. (1988) also showed that with cobalt histology, 1 µM capsaicin selectively labeled the nociceptive subpopulation of DRG neurons in culture, which represented 50% of the
cells, but not other peripheral neurons or non-neuronal cells. A
possible explanation for the discrepancy that we observed between
electrophysiological and histological assessments of the presence of
capsaicin receptors is the lower sensitivity of the histological
approach. Electrophysiological measurements directly measure the
presence of functional capsaicin receptors and are sensitive enough to
detect a single channel, whereas the histological approach is indirect
and of unknown sensitivity. Therefore, our conclusion is that all
differentiated HD10.6 neurons express capsaicin receptors, as indicated
by the electrophysiological measurements. Sustained proton-activated
current represents an additional property selectively expressed in
nociceptors because it has been reported to be present only in sensory
neurons of small diameter that respond to capsaicin (Bevan and Yeats,
1991 ). The presence of sustained proton-activated current in virtually
all differentiated HD10.6 neurons, along with the ubiquitous expression
of capsaicin-activated current in these cells, establishes the
nociceptive phenotype of differentiated HD10.6 neurons.
Differentiated HD10.6 neurons also express
 -methylene-ATP-activated current. Cells that contain P2X1 or P2X3
receptors can respond to  -methylene-ATP (Collo et al., 1996 ).
P2X1 receptors are present in sensory ganglia, the superior cervical
ganglion, celiac ganglia, and spinal cord motoneurons (Valera et al.,
1994 ; Collo et al., 1996 ), whereas P2X3 receptors are expressed only in
capsaicin-sensitive small-diameter sensory neurons (Chen et al., 1995 ).
Therefore, the presence of  -methylene-ATP-activated currents in
differentiated HD10.6 cells provides further evidence consistent with
their nociceptive phenotype. Taken together, the presence of
capsaicin-activated current, sustained proton-activated current, and
 -methylene-ATP-activated current indicates that HD10.6 is a
sensory neuronal line with nociceptive properties.
A property of nociceptors that differentiated HD10.6 neurons did not
express was TTX-resistant sodium currents. The dissociation of
TTX-resistant sodium channel expression from the expression of other
nociceptive properties, such as capsaicin receptors, suggests that
these properties are independently controlled by extrinsic cues. Clone
HD10.6 provides a tool for studying the molecular mechanisms that
differentially regulate these properties.
Before this study, there were no stable cell lines that mirror
nociceptive sensory neurons. The sensory neuronal-like cell lines that
had been described in the literature were established by fusion of
postmitotic embryonic [F-11 cell line (Platika et al., 1985 )] or
neonatal [ND cell lines (Wood et al., 1990 )] rat DRG neurons
with mouse N18Tg2 neuroblastoma cells. These hybrid cell lines exhibit
some DRG-selective properties, including transcription factors,
cytoskeletal proteins, synaptic proteins, ion channels, neurotransmitters, and neurotransmitter receptors. However, tyrosine hydroxylase and neuropeptide Y immunoreactivities were expressed by the
ND subclones (Suburo et al., 1992 ), suggesting that certain properties
exhibited by these clones were derived from the neuroblastoma parent.
In addition, these hybrid cell lines do not contain some of the
neuropeptides (Suburo et al., 1992 ) normally present within sensory
neuronal populations. Furthermore, low-threshold calcium current is a
more predominant component of calcium current in differentiated hybrid
cells (Boland and Dingledine, 1990 ; Kusano and Gainer, 1993 ; Kobrinsky
et al., 1994 ) than in DRG neurons. Moreover, although capsaicin- and
bradykinin-activated currents were expressed by a subset of F-11 cells
at early passages, these cells lost the ability to express these
properties after multiple passages (Kusano and Gainer, 1993 ).
The stable immortalized human PNS line described here can be expanded
readily and then differentiated rapidly, providing a renewable and
homogeneous source of sensory neurons. These neurons are functional and
exhibit properties specific to subsets of sensory neurons, including
characteristics unique to nociceptive sensory neurons. This
immortalized human PNS line will be valuable for future studies of
fundamental questions in developmental neurobiology, the identification
and validation of novel drug targets, and the development and
implementation of drug assays.
 |
FOOTNOTES |
Received Nov. 30, 1998; revised April 15, 1999; accepted April 16, 1999.
We thank Drs. David J. Anderson, Fred H. Gage, Steve Heinemann, Patrick
Hogan, Bruce Koch, Steve Matsumoto, Mahendra S. Rao, Jacqueline A. M. Smith, A. Neil Verity, and John N. Wood for suggestions during the
course of this work and Drs. David W. Anderson and Alan Lewis for
encouragement. We also thank Michael Housley, Hoang Le, James Leisten,
Nandita Patnaik, and Gilbert Ramirez for outstanding technical support
and Nathan Eller for expert graphics assistance.
Correspondence should be addressed to Dr. Heather K. Raymon, Signal
Pharmaceuticals Incorporated, 5555 Oberlin Drive, Suite 100, San Diego,
CA 92121.
Dr. Johnson's present address: DURECT Corporation, 10240 Bubb
Road, Cupertino, CA 95014.
Dr. Sah's present address: Biogen, 14 Cambridge Center, Cambridge, MA 02142.
 |
REFERENCES |
-
Akopian AN,
Sivilotti L,
Wood JN
(1996)
A tetrodotoxin-resistant voltage-gated sodium channel expressed by sensory neurons.
Nature
379:257-262[Medline].
-
Bevan S,
Szolcsanyi J
(1990)
Sensory neuron-specific actions of capsaicin: mechanisms and applications.
Trends Pharmacol Sci
11:330-333[Medline].
-
Bevan S,
Yeats J
(1991)
Protons activate a cation conductance in a sub-population of rat dorsal root ganglion neurones.
J Physiol (Lond)
433:145-161[Abstract/Free Full Text].
-
Bevan SJ,
James IF,
Rang HP,
Winter J,
Wood JN
(1987)
The mechanism of action of capsaicin
a sensory neurotoxin.
In: Neurotoxins and their pharmacological implications (Jenner P,
ed), pp 261-277. New York: Raven. -
Boland LM,
Dingledine R
(1990)
Multiple components of both transient and sustained barium currents in a rat dorsal root ganglion cell line.
J Physiol (Lond)
420:223-245[Abstract/Free Full Text].
-
Bronner-Fraser M,
Fraser SE
(1988)
Cell lineage analysis reveals multipotency of some avian neural crest cells.
Nature
335:161-164[Medline].
-
Caffrey JM,
Eng DL,
Black JA,
Waxman SG,
Kocsis JD
(1992)
Three types of sodium channels in adult rat dorsal root ganglion neurons.
Brain Res
592:283-297[Web of Science][Medline].
-
Caterina MJ,
Schumacher MA,
Tominaga M,
Rosen TA,
Levine JD,
Julius D
(1997)
The capsaicin receptor: a heat-activated ion channel in the pain pathway.
Nature
389:816-824[Web of Science][Medline].
-
Chen CC,
Akopian AN,
Sivilotti L,
Colquhoun D,
Burnstock G,
Wood JN
(1995)
A P2X purinoceptor expressed by a subset of sensory neurons.
Nature
377:428-431[Medline].
-
Collo G,
North RA,
Kawashima E,
Merlo-Pich E,
Neidhart S,
Suprenant A,
Buell G
(1996)
Cloning of P2X5 and P2X6 receptors and the distribution and properties of an extended family of ATP-gated ion channels.
J Neurosci
16:2495-2507[Abstract/Free Full Text].
-
Duff RS,
Langtimm CJ,
Richardson MK,
Sieber-Blum M
(1991)
In vitro clonal analysis of progenitor cell patterns in dorsal root and sympathetic ganglia of the quail embryo.
Dev Biol
147:451-459[Web of Science][Medline].
-
Elliott AA,
Elliott JR
(1993)
Characterization of TTX-sensitive and TTX-resistant sodium currents in small cells from adult rat dorsal root ganglia.
J Physiol (Lond)
463:39-56[Abstract/Free Full Text].
-
Fitzgerald M
(1983)
Capsaicin and sensory neurones
a review.
Pain
15:109-130[Web of Science][Medline]. -
Frank E,
Sanes JR
(1991)
Lineage of neurons and glia in chick dorsal root ganglia: analysis in vivo with a recombinant retrovirus.
Development
111:895-908[Abstract/Free Full Text].
-
Holzer P
(1988)
Local effector functions of capsaicin-sensitive sensory nerve endings: involvement of tachykinins, calcitonin gene-related peptide and other neuropeptides.
Neuroscience
24:739-768[Web of Science][Medline].
-
Hunt SP,
Rossi J
(1985)
Peptide- and non-peptide-containing unmyelinated primary afferents: the parallel processing of nociceptive information.
Philos Trans R Soc Lond [Biol]
308:283-289[Abstract/Free Full Text].
-
Kobrinsky EM,
Pearson HA,
Dolphin AC
(1994)
Low- and high-voltage-activated calcium channel currents and their modulation in the dorsal root ganglion cell line ND7-23.
Neuroscience
58:539-552[Web of Science][Medline].
-
Kostyuk PG,
Veselovsky NS,
Tsyndrenko AY
(1981)
Ionic currents in the somatic membrane of rat dorsal root ganglion neurons
I. Sodium currents.
Neuroscience
6:2423-2430[Web of Science][Medline]. -
Kusano K,
Gainer H
(1993)
Modulation of voltage-activated Ca currents by pain-inducing agents in a dorsal root ganglion neuronal line, F-11.
J Neurosci Res
34:158-169[Web of Science][Medline].
-
Le Douarin NM,
Xue ZG,
Smith J
(1985)
In vivo and in vitro studies on the segregation of autonomic and sensory cell lineages.
J Physiol (Lond)
80:255-261.
-
Lewis C,
Neidhart S,
Holy C,
North RA,
Buell G,
Surprenant A
(1995)
Coexpression of P2X2 and P2X3 receptor subunits can account for ATP-gated currents in sensory neurons.
Nature
377:432-435[Medline].
-
Lo L,
Anderson DJ
(1995)
Postmigratory neural crest cells expressing c-RET display restricted developmental and proliferative capacities.
Neuron
15:527-539[Web of Science][Medline].
-
Lo LC,
Johnson JE,
Wuenschell CW,
Saito T,
Anderson DJ
(1991)
Mammalian achaete-scute homolog 1 is transiently expressed by spatially restricted subsets of early neuroepithelial and neural crest cells.
Genes Dev
5:1524-1537[Abstract/Free Full Text].
-
Matsumoto SG
(1994)
Neuronal differentiation in cultures of murine neural crest. II. Development of capsaicin-sensitive neurons.
Brain Res Dev Brain Res
83:17-27[Medline].
-
Maxwell GD,
Reid K,
Elefanty A,
Bartlett PF,
Murphy M
(1996)
Glial cell line-derived neurotrophic factor promotes the development of adrenergic neurons in mouse neural crest cultures.
Proc Natl Acad Sci USA
93:13274-13279[Abstract/Free Full Text].
-
Molliver DC,
Radeke MJ,
Feinstein SC,
Snider WD
(1995)
Presence or absence of TrkA protein distinguishes subsets of small sensory neurons with unique cytochemical characteristics and dorsal horn projections.
J Comp Neurol
361:404-416[Web of Science][Medline].
-
Molliver DC,
Wright DE,
Leitner ML,
Parsadanian AS,
Doster K,
Wen D,
Yan Q,
Snider WD
(1997)
IB4-binding DRG neurons switch from NGF to GDNF dependence in early postnatal life.
Neuron
19:849-861[Web of Science][Medline].
-
Ogata N,
Tatebayashi H
(1993)
Kinetic analysis of two types of Na+ channels in rat dorsal root ganglia.
J Physiol (Lond)
466:9-37[Abstract/Free Full Text].
-
Pfaff SL,
Mendelsohn M,
Stewart CL,
Edlund T,
Jessell TM
(1996)
Requirement for LIM homeobox gene Isl1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation.
Cell
84:309-320[Web of Science][Medline].
-
Platika D,
Boulos MH,
Baizer L,
Fishman MC
(1985)
Neuronal traits of clonal cell lines derived by fusion of dorsal root ganglia neurons with neuroblastoma cells.
Proc Natl Acad Sci USA
82:3499-3503[Abstract/Free Full Text].
-
Rao MS,
Anderson DJ
(1997)
Immortalization and controlled in vitro differentiation of murine multipotent neural crest stem cells.
J Neurobiol
32:722-746[Web of Science][Medline].
-
Roy ML,
Narahashi T
(1992)
Differential properties of tetrodotoxin-sensitive and tetrodotoxin-resistant sodium channels in rat dorsal root ganglion neurons.
J Neurosci
12:2104-2111[Abstract].
-
Sah DW,
Ray J,
Gage FH
(1997)
Bipotent progenitor cell lines from the human CNS.
Nat Biotechnol
15:574-580[Web of Science][Medline].
-
Saito T,
Greenwood A,
Sun Q,
Anderson DJ
(1995)
Identification by differential RT-PCR of a novel paired homeodomain protein specifically expressed in sensory neurons and a subset of their CNS targets.
Mol Cell Neurosci
6:280-292[Web of Science][Medline].
-
Sangameswaran L,
Delgado SG,
Fish LM,
Koch BD,
Jakeman LB,
Stewart GR,
Sze P,
Hunter JC,
Eglen RM,
Herman RC
(1996)
Structure and function of a novel voltage-gated, tetrodotoxin-resistant sodium channel specific to sensory neurons.
J Biol Chem
271:5953-5956[Abstract/Free Full Text].
-
Schweizer G,
Ayer-Le Lievre C,
Le Douarin NM
(1983)
Restrictions of developmental capacities in the dorsal root ganglia during the course of development.
Cell Differ
13:191-200[Web of Science][Medline].
-
Shah NM,
Marchionni MA,
Isaacs I,
Stroobant P,
Anderson DJ
(1994)
Glial growth factor restricts mammalian neural crest stem cells to a glial fate.
Cell
77:349-360[Web of Science][Medline].
-
Shah NM,
Groves AK,
Anderson DJ
(1996)
Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members.
Cell
85:331-343[Web of Science][Medline].
-
Stemple DL,
Anderson DJ
(1992)
Isolation of a stem cell for neurons and glia from the mammalian neural crest.
Cell
71:973-985[Web of Science][Medline].
-
Suburo AM,
Wheatley SC,
Horn DA,
Gibson SJ,
Jahn R,
Fischer-Colbrie R,
Wood JN,
Latchman DS,
Polak JM
(1992)
Intracellular redistribution of neuropeptides and secretory proteins during differentiation of neuronal cell lines.
Neuroscience
46:881-889[Web of Science][Medline].
-
Sun Y,
Maxwell GD
(1994)
Ciliary neurotrophic factor (CNTF) has a dose-dependent biphasic effect on the number of adrenergic cells which develop in avian trunk neural crest cultures.
Neurosci Lett
165:1-4[Web of Science][Medline].
-
Szallasi A
(1994)
The vanilloid (capsaicin) receptor: receptor types and species differences.
Gen Pharmacol
25:223-243[Web of Science][Medline].
-
Valera S,
Hussy N,
Evans RJ,
Adami N,
North RA,
Suprenant A,
Buell G
(1994)
A new class of ligand-gated ion channel defined by P2X receptor for extracellular ATP.
Nature
371:516-519[Medline].
-
Varley JE,
Maxwell GD
(1996)
BMP-2 and BMP-4, but not BMP-6, increase the number of adrenergic cells which develop in quail trunk neural crest cultures.
Exp Neurol
140:84-94[Web of Science][Medline].
-
Waldmann R,
Champigny G,
Bassilana F,
Heurteaux C,
Lazdunski M
(1997a)
A proton-gated cation channel involved in acid-sensing.
Nature
386:173-177[Medline].
-
Waldmann R,
Bassilana F,
de Weille J,
Champigny G,
Heurteaux C,
Lazdunski M
(1997b)
Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons.
J Biol Chem
272:20975-20978[Abstract/Free Full Text].
-
Wood JN,
Winter J,
James IF,
Rang HP,
Yeats J,
Bevan S
(1988)
Capsaicin-induced ion fluxes in dorsal root ganglion cells in culture.
J Neurosci
8:3208-3220[Abstract].
-
Wood JN,
Bevan SJ,
Coote PR,
Dunn PM,
Harmar A,
Hogan P,
Latchman DS,
Morrison C,
Rougon G,
Theveniau M,
Wheatley S
(1990)
Novel cell lines display properties of nociceptive sensory neurons.
Proc R Soc Lond [Biol]
241:187-194[Medline].
-
Xue ZG,
Le Douarin NM,
Smith J
(1988)
Insulin and insulin-like growth factor-I can trigger the differentiation of catecholaminergic precursors in cultures of dorsal root ganglia.
Cell Differ Dev
25:1-10[Web of Science][Medline].
-
Xue ZG,
Xue XJ,
Fauquet M,
Smith J,
Le Douarin N
(1992)
Expression of the gene encoding tyrosine hydroxylase in a subpopulation of quail dorsal root ganglion cells cultured in the presence of insulin or chick embryo extract.
Brain Res Dev Brain Res
69:23-30[Medline].
-
Zeilhofer HU,
Swandulla D,
Reeh PW,
Kress M
(1996)
Ca2+ permeability of the sustained proton-induced cation current in adult rat dorsal root ganglion neurons.
J Neurophysiol
76:2834-2840[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19135420-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
W. Murrell, A. Wetzig, M. Donnellan, F. Feron, T. Burne, A. Meedeniya, J. Kesby, J. Bianco, C. Perry, P. Silburn, et al.
Olfactory Mucosa Is a Potential Source for Autologous Stem Cell Therapy for Parkinson's Disease
Stem Cells,
August 1, 2008;
26(8):
2183 - 2192.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|