 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 1999, 19(14):5919-5931
Overexpression of Brain-Derived Neurotrophic Factor Enhances
Sensory Innervation and Selectively Increases Neuron Number
Ann M.
LeMaster1,
Robin
F.
Krimm2,
Brian M.
Davis1,
Teresa
Noel2,
Mary E.
Forbes3,
James E.
Johnson3, and
Kathryn M.
Albers1, 2
Departments of 1 Anatomy and Neurobiology and
2 Pathology and Laboratory Medicine, University of
Kentucky, Lexington, Kentucky 40536, and 3 Department
of Neurobiology and Anatomy, Wake Forest University, Winston Salem,
North Carolina 27157
 |
ABSTRACT |
Target-derived neurotrophin growth factors have significant effects
on the development and maintenance of the mammalian somatosensory system. Studies of transgenic mice that overexpress neurotrophins NGF
and neurotrophin 3 (NT-3) at high levels in skin have shown increased sensory neuron number and enhanced innervation of specific sensory ending types. The effects of two other members of this family,
BDNF and NT-4, on sensory neuron development are less clear. This study
examined the role of brain-derived neurotrophic factor (BDNF) using
transgenic mice that overexpress BDNF in epithelial target tissues of
sensory neurons. BDNF transgenic mice had an increase in peripheral
innervation density and showed selective effects on neuron survival.
Neuron number in trigeminal ganglia, DRG, and SCG were unchanged,
although a 38% increase in neurons comprising the placode-derived
nodose-petrosal complex occurred. BDNF transgenic skin showed notable
enhancement of innervation to hair follicles as detected by
PGP9.5 immunolabeling. In nonhairy plantar skin, Meissner
corpuscle sensory endings were larger, and the number of Merkel cells
with associated innervation was increased. In trigeminal ganglia,
neurons expressing trkB receptor were increased threefold, whereas
trkA-positive neurons doubled. Analysis of trkB by Northern, reverse
transcription-PCR, and Western assays indicated a modest increase in
the expression of the T1 truncated receptor and preferential
distribution to the periphery. These data indicate that skin-derived
BDNF does not enhance survival of cutaneous sensory neurons, although
it does promote neurite innervation of specific sites and sensory end
organs of the skin.
Key words:
BDNF; transgenic; sensory; neurotrophin; Meissner; trkB
 |
INTRODUCTION |
In vivo and in
vitro studies have identified neurotrophin growth factors (NGF,
NT-3, BDNF, and NT-4) as compounds essential for sensory neuron
survival, sensory end organ development, and as modulators of adult
sensory physiology (Buchman and Davies, 1993 ; Snider, 1994 ; Reichardt
and Farinas, 1997 ; Carroll et al., 1998 ). During development,
neurotrophin synthesis occurs in peripheral targets of developing
sensory neurons, such as the skin (Davies et al., 1987 ). The
neurotrophic hypothesis predicts that the level of neurotrophin
regulates the onset and degree of neuron death that occurs during
development and thereby sculpts the pattern and density of axon
projections to specific targets in the periphery (Oppenheim, 1991 ).
Indeed, mice that lack NGF or its high-affinity receptor trkA lose
70-80% of their cranial and spinal sensory neurons (Crowley et al.,
1994 ), many of which are nociceptors. NT-3-deficient mice lose 55-65%
of sensory neurons, specifically lacking proprioceptive neurons and
cutaneous neurons that innervate hair follicles and Merkel cells of
touch dome mechanoreceptors (Airaksinen et al., 1996 ). Mice lacking
BDNF have greatest deficits in sensory neurons of the nodose-petrosal
ganglion (NPG) complex (39-66% loss) and vestibular ganglia
(82% loss), although they also lose 21-44% of trigeminal and
30-36% of L4 dorsal root ganglia (DRG) neurons (Ernfors et al., 1994 ;
Jones et al., 1994 ; Erickson et al., 1996 ). The identity of the types
of sensory neurons lost from trigeminal and DRG in BDNF knock-out mice
have not as yet been defined.
To investigate the requirement of target-derived neurotrophin synthesis
in sensory neuron development and differentiation, we isolated
transgenic mouse lines that overexpress each neurotrophin in the skin,
a major target of sensory and sympathetic neurons that normally
synthesizes neurotrophins. In line with the neurotrophic hypothesis, we
anticipated that increased neurotrophins in the peripheral tissue
should increase the survival of specific types of sensory neuron
populations. This was indeed the case in mice that overexpressed NGF in
which a doubling of sensory neuron number and significant increase in
myelinated and unmyelinated fibers in the skin was found (Albers et
al., 1994 ; Davis et al., 1997 ). In addition, a doubling in the
percentage of neurons expressing trkA, the high-affinity receptor for
NGF, also was found, indicating specific rescue of the NGF-dependent
cell population (Goodness et al., 1997 ). Analysis of transgenic mice
that overexpressed NT-3 also showed enhanced peripheral innervation,
with specific enhancement of mechanoreceptive neurons associated with
Merkel cells comprising touch dome sensory units of the skin (Albers et
al., 1996 ). NT-3 transgenics also had increased sensory neuron numbers
(65-70%) and twice the number of trkC-positive neurons, indicating a
significant role of target-derived NT-3 in neuron survival and differentiation.
BDNF neurotrophin is also expressed by the skin during development
[beginning at approximately embryonic day 11 (E11)] (Buchman and Davies, 1993 ), although its role as a target-derived factor that
supports neuron survival is less clear (Acheson and Lindsay, 1996 ). It
may function instead in a paracrine or autocrine manner to regulate
neuron survival and/or maturation (Wright et al., 1992 ; Robinson et
al., 1996 ), because both BDNF and its high-affinity receptor trkB are
expressed in neurons of developing sensory ganglia (Ernfors et al.,
1990 ; Klein et al., 1990b ; Schecterson and Bothwell, 1992 ). In
addition, little if any information is known about the types of
cutaneous sensory endings that are supported by BDNF expression in the
skin. To address these issues and to test the role of BDNF as a
target-derived survival factor, we established lines of transgenic mice
that overexpressed BDNF in the epidermis, similar to our NGF and NT-3
lines. Our analysis indicates that, although BDNF did selectively
increase innervation to the skin, it did not increase neuron number in
the trigeminal or dorsal root ganglia. Although neuron number was
unchanged in trigeminal and DRG populations, the number of neurons in
the placode-derived nodose-petrosal sensory complex was increased,
indicating a selective survival action of BDNF on neuronal types. Thus,
we find that, similar to NGF and NT-3, BDNF altered somatosensory
innervation patterns, but unlike NGF and NT-3, BDNF did not act as a
target-derived survival factor for cranial or spinal sensory neurons.
 |
MATERIALS AND METHODS |
Isolation of K14-BDNF transgenic mice
Human K14 keratin promoter and enhancer sequences (2.5 kbp) were
used to drive expression of a mouse BDNF cDNA isolated by PCR
amplification of genomic DNA using primers
5'ccagcgggatccgtgatgaccatccttttccttact3' and
5'cggtacggatcccataaatccactactttcccct3'. Gene sequences
encoding amino acids 131 to +124 (Yancopoulos et al., 1990 ) were
amplified using primer sequences containing a BamHI site to
facilitate cloning into the K14-hGH cassette (Vassar and Fuchs, 1991 ).
The 770 bp PCR product was cloned into pGem4Z (Promega, Madison, WI)
and sequenced to verify it encoded the BDNF peptide. The K14-BDNF transgene was gel- and column-purified, microinjected into pronuclei of
embryos obtained from B6×C3H F1 hybrid females (Harlan Sprague Dawley,
Indianapolis, IN), and implanted into pseudopregnant females as
described previously (Albers et al., 1994 ). Animals in this study were
used in accordance with the guidelines of the U.S. Public Health
Service Policy on Humane Care and Use of Laboratory Animals and
the NIH Guide for the Care and Use of Laboratory
Animals.
Southern hybridization analysis
Founder and F1 generations were analyzed by Southern blotting to
identify transgenic lines and to verify transgene integration. Subsequent generations were screened by slot blot analysis of isolated
tail DNA. Copy numbers were estimated by applying 2 µg of genomic DNA
to Nytran membranes, hybridizing with a 32P-labeled probe
to the BDNF sequence, exposing membranes to photographic film, and
using the NIH Image 1.57 software to measure relative band intensity.
Histology and immunocytochemistry
Age-matched mice were deeply anesthetized with 2.5% avertin
(2,2,2-tribromoethanol and tert-amyl alcohol diluted in 0.9% saline) and perfused with 4% paraformaldehyde in 0.1 M phosphate
buffer. For hematoxylin-eosin staining, skin was post-fixed in 4%
paraformaldehyde and 70% ethanol, embedded in paraffin, sectioned, and
stained. For immunocytochemistry, mice were perfused with 4%
paraformaldehyde, and tissues were post-fixed in 4% paraformaldehyde
solution for <2 hr, sunk in 25% sucrose-0.1 M phosphate
buffer, and embedded in 10% gelatin in 1× Tris-buffered
saline. Tissue was cut at 20- to 30-µm-thick sections, and
sections were washed, blocked 1 hr at room temperature in 5% normal
goat serum (NGS), 2% bovine serum albumin (BSA), and 0.25% Triton
X-100, and incubated overnight in primary antibodies diluted in 5% NGS
and 0.25% Triton solution. Sections were washed, incubated with 1:500
dilution of goat anti-rabbit biotinylated antibody (Vector
Laboratories, Burlingame, CA) for 1 hr, washed, and treated with
anti-endogenous peroxidase solution containing 2.5%
H2O2 and 5% methanol. For antibody detection, tissues were incubated in an avidin-biotin-complex mix (ABC,
Vectastain Elite; Vector Laboratories) for 1 hr, washed,
incubated in nickel enhanced-0.04% diaminobenzene solution, and
mounted onto Superfrost Plus slides (Lab Craft, Chelmsford, UK). A
rabbit polyclonal antibody to PGP9.5 (an ubiquitin carboxyl terminal
hydrolase that detects nearly all myelinated and unmyelinated nerve
fibers) was used at 1:5000 (Ultraclone, Isle of Wight, UK). For K20
labeling, foot pad skin was first separated into epidermal and dermal
compartments by incubating in 2 M sodium bromide for 1 hr
at 37°C. The epidermis was fixed in 20°C acetone, incubated
overnight in anti-K20 (1:10; Boehringer Mannheim, Indianapolis, IN) and
anti-NF150 (Chemicon, Temecula, CA), washed, incubated in goat
anti-mouse labeled Cy3 and goat anti-rabbit Cy2 antibody for 1 hr,
washed, coverslipped in anti-fade solution, and viewed using a Leica
(Nussloch, Germany) confocal microscope.
BDNF peptide measures
Electrochemiluminescence immunoassay. An
electrochemiluminescence immunoassay (ECLIA) was one of two methods
used to measure BDNF peptide. Tissue was homogenized in 50 vol of 100 mM PIPES buffer, pH 7.0, containing 500 mM NaCl, 2% BSA, 0.2% Triton X-100, 0.1%
NaN3, 2 µg/ml aprotinin, 2 mM EDTA, 10 µM leupeptin, 1 µM pepstatin, and 200 µM phenylmethanesulfonyl fluoride using ground glass
dounces. Samples were centrifuged at 16,000 × g for 20 min, supernatants were collected, and 53 µl of 1 N NaOH per
milliliter of supernatant was added. The ECLIA reaction mixture
contained 166 ng/ml biotinylated BDNF antibody (Amgen, Thousand Oaks,
CA), 333 ng/ml ruthenium II tris (bipyridyl)
[Ru(bpy)32+]-labeled (TAG-labeled) BDNF antibody
and 22 µg/ml streptaviden magnetic beads diluted in calcium- and
magnesium-free Dulbecco's PBS, pH 7.2, containing 3% BSA,
1.5% Tween 20, and 0.05% NaN3. This mix (150 µl) was
added to 50 µl of tissue supernatant in 12 × 75 mm
polypropylene tubes and vortexed for 90 min in an Origen Analyzer (IGEN
International, Gaithersburg, MD) carousel, after which 200 µl
of Origen Assay (IGEN International) stop buffer was added. To
biotinylate the BDNF antibody, 0.25 mg of antibody in PBS was diluted
with biotin-LC-sulfo-NHS ester to a molar ratio of 10:1 biotin/antibody
protein. This mix was incubated 1 hr at room temperature, terminated by
adding 20 µl of 2 M glycine, passed through a PD-10
Sephadex column, and eluted with 150 mM potassium phosphate
buffer, pH 7.2, containing 150 mM NaCl and 0.05%
NaN3 preservative to remove unreacted biotin-LC-sulfo-NHS
ester. Biotin-labeled antibody fractions were identified using a micro
BCA protein assay, pooled, stabilized by addition of 3% BSA, and
stored at 4°C. For TAG labeling, 0.25 mg of anti-BDNF antibody was
diluted with Ru[bpy]32+-NHS ester dissolved in
dimethylsulfoxide to achieve a final molar ratio of 7:1. The
reaction mixture was incubated for 1 hr at room temperature in the
dark, followed by addition of 20 µl of 2 M glycine. The
TAG-labeled mixture was passed through a PD-10 Sephadex column and
eluted with 150 mM potassium phosphate buffer, pH 7.2, containing 150 mM NaCl and 0.05% NaN3.
TAG-labeled antibody fractions were identified by protein assay,
pooled, stabilized by addition of 3% BSA, and stored at 4°C.
ELISA. In later stages of this study, BDNF was
assayed using a simpler, commercially available ELISA kit. Tissues were
removed, weighed, and frozen until homogenized in sample buffer (0.1 M PBS, 0.4 M NaCl, 0.1% Triton X-100, 2 mM EDTA, 0.1 mM benzethonium chloride, 2 mM benzamidine, 0.1 mM PMSF, 20 trypsan
inhibitor unit/ml aprotinin, and 0.5% BSA, pH 7.4) using either
a polytron or Duall type ground glass homogenizer. Samples were spun at
13,000 rpm for 15 min at 4°C, and supernatants were assayed using the BDNF Emax ImmunoAssay system (Promega). Dynatech immulon
plates were coated with an anti-BDNF monoclonal antibody to bind
soluble BDNF from solution. Bound BDNF complexes were exposed to an
anti-human BDNF polyclonal antibody, and the amount of bound antibody
was detected using an anti-IgY antibody conjugated to horseradish peroxidase. Unbound conjugate was removed by washing, and the chromogenic substrate 3,3',5,5'-tetramethyl benzidine (TMB) was added.
Bound BDNF was detected by catalyzed color development of TMB using a
plate reader.
Neuronal cell counting methodology
Two counting methods were used to estimate the number of neurons
in peripheral ganglia. Nodose, DRG, SCG, and trigeminal ganglia neurons
were counted used a modified Abercrombie counting method as described
previously (Davis et al., 1996 ). Briefly, ganglia were serial sectioned
at 5 µm and stained with cresyl violet, and the number of neurons
containing nucleoli were counted. Nucleolar number was summed and
multiplied by the interval between counted sections, and a correction
factor for multiple or split nucleoli was applied. The number of
trigeminal neurons was also estimated using the optical dissector
method (West, 1993 ). Ganglia were isolated from mice perfused with 4%
paraformaldehyde-0.1 M phosphate buffer. Tissue was
dehydrated through alcohols, embedded in graded celloidin
(Mallinckrodt, Phillipsburg, NJ) through 50:50 ethanol/ether solutions,
cut into 50 µm sections, and stained with Giemsa. The area of
sections containing neurons was outlined using a 2× objective to
determine grid position. The x-axis of the grid was set at 30 µm, and the y-axis was set at 60 µm to increase the
number of neurons sampled. Counting was done at every fifth
intersection of the x- and y-axes. The dimensions
of the counting box were set large enough to fit one neuron
(x, 30 µm; y, 30 µm). Thus, the area sampling
fraction (asf) is the area of the counting box (x × y) relative to the area where the counting occurred
[(5 × x) (5 × y)]. Because section
thickness (t) was 50 µm, the height of the counting box
(h) was set at 30 µm to avoid small neuronal fragments.
Using a 60× objective, neurons that appeared in the counting box or
crossed the top, right, and back sides of the box were recorded, and
neurons counted in each section summed (Q). Neuronal
number (n) was determined by the equation n = Q × 1/ssf × 1/asf × t/h. Because every section was counted, the ssf
(section sampling frequency, i.e., number of sections counted per total
number of sections) was not calculated. All analyses were done on
age-matched mice processed in parallel.
Electron microscopy
Mice were perfused with 0.9% saline followed by a 4%
paraformaldehyde-2% glutaraldehyde solution made in 0.1 M
Sorenson's phosphate buffer, pH 7.2. Saphenous nerve sections were
fixed 2 hr at 4°C in 3.5% glutaraldehyde and washed overnight at
4°C in 5% sucrose in Sorenson's buffer. Tissues were post-fixed 1 hr in buffered 1% osmium tetroxide, rinsed in buffered sucrose, dehydrated in a series of alcohols, washed in propylene oxide, and
embedded in Spurr's resin. Blocks were thin sectioned (60-80 nm),
mounted onto carbon-coated Formvar slot grids, stained with uranyl
acetate and 0.3% lead citrate, and examined on a Hitachi (Tokyo,
Japan) 7000 transmission electron microscope. All analyses were done on
age-matched mice processed in parallel.
RNA expression analysis
Northern hybridization analysis. Total RNA was
isolated using Trizol (Life Technologies, Gaithersburg, MD)
extraction followed by isopropanol precipitation. RNAs (10 µg of
brain, 10 µg of transgenic skin, and 20 µg of control skin) were
separated on agarose-formaldehyde gels, transferred to nitrocellulose
membranes, and hybridized to a 32P- CTP-labeled antisense
riboprobe made to the full-length BDNF cDNA sequence. Hybridization and
washes were done as described previously (Albers et al., 1996 ).
Relative band intensities were determined using NIH Image software.
In situ hybridization. In situ hybridization to
detect trk receptor expression was done as described previously
(Goodness et al., 1997 ). The trkA template encompassed nucleotides
1187-1547 of the rat trkA gene and encoded sequences within the
extracellular, transmembrane, and intracellular domains of the protein.
The trkB template encompassed nucleotides 1362-1558 of the rat trkB
receptor that encoded amino acid sequences within the intracellular
domain. The trkC template encompassed nucleotides 1119-1493 of rat
trkC cDNA that encoded protein sequences in the extracellular,
transmembrane, and intracellular domains. The relative number of
neurons that expressed trkA, trkB, or trkC mRNAs was determined by
counting labeled neuronal profiles in which the number of reduced
silver grains over the soma was 2× background levels. The perimeter of labeled profiles was drawn in every tenth section of trigeminal ganglion and every fifth section of DRG using a drawing tube attached to an Olympus Opticals (Tokyo, Japan) microscope. Areas of drawn profiles were captured and calculated using NIH Image software. By
assuming circularity of each profile and knowing the section thickness
(20 µm), the relative frequency distribution of profiles was
generated, and the number and size distribution was corrected using the
recursive translation computer program (Rose and Rohrlich, 1987 ;
Goodness et al., 1997 ). Data were analyzed as a two-way ANOVA
using Statview software. Differences among means were determined using
Fischer's least significant difference analysis.
Reverse transcriptase-PCR. One microgram of DNased
RNA was reverse transcribed using Superscript (Life Technologies) and
random primers in a 20 µl reaction volume. Aliquots of the generated cDNAs were PCR amplified in a 50 µl volume by adding 1.5 U
Taq polymerase (Promega), PCR buffer, dNTP mix,
trkB-specific primers (20 µM each), and 0.2 µl of
32P-dCTP. A separate reaction to amplify actin was
used to serve as an internal standard. Typical reaction conditions were
as follows: 1 min, 94°C; 1 min, 60°C; and 2 min, 72°C. The
optimal number of cycles (to avoid plateau of reaction) was determined
for each primer pair. Quantification of band intensities was done using a Storm phosphorimager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Primer sets used were as follows: TrkB full-length, 5'ATAACGGAGACTACACCCTGATGG3' and 5'AGCTGACTGTTGGTGATGCC3' (506 bp); TrkB.T1, 5'CATAAGATCCCACTGGATGGGTAG3' and
5'GCTGCAGACATCCTCGGAGATTAC3'(363 bp); TrkB.T2, 5'CAGAAGTGTGCTTATTTTGC3'
and 5'AGACAATACAGGTCTACCTCTCAG3' (854 bp); actin,
5'TAAAACGCAGCTCAGTAACAGTCCG 3' and 3' TGGAATCCTGTGGCATCCATGAAAC 3' (348 bp).
Grain counting methodology
The percent of somal areas covered by autoradiographic grains
was determined as a measure of hybridization signal density and used to
indicate the relative amount of trkB mRNA per cell. Images of 25 randomly selected neurons per ganglia (six transgenic and six
age-matched controls, a total of 300 neurons) viewed using a 40× oil
immersion lens were captured using a CCD camera and imported into the
NIH Image morphometric program. Hematoxylin and eosin counterstain was
subtracted using a #47 wratten filter and the "horizontal
subtraction" option in the Image program. The "density slice"
option was used to threshold each neuron so only autoradiographic
grains were selected. Borders of each neuron were drawn, and the
percent area covered by grains was measured. Values were averaged and
statistical significance tested using a t test.
 |
RESULTS |
K14-BDNF transgenic mice express increased levels of BDNF in
specific epithelial targets
BDNF expression was driven using the human keratin K14 promoter to
direct high levels of transgene expression to the skin and tongue
(Vassar and Fuchs, 1991 ; Albers et al., 1994 ; Wang et al., 1997 ). Onset
of promoter activity in whisker pad skin was at E11.5 of mouse
development (H. F. Figueiredo and K. M. Albers, unpublished
data), a time that overlaps with endogenous neurotrophin
expression (Buchman and Davies, 1993 ). Three founder lines (737, 733, and 632) identified by Southern hybridization (Fig.
1A) had three, five,
and eight copies, respectively (data not shown). Relative mRNA
expression levels were determined by Northern analysis (Fig.
1B) and showed lowest transgene expression in line
737 and higher levels in lines 632 and 733. Control mouse brain,
control skin, and skin isolated from each transgenic line expressed
endogenous BDNF transcripts at 4.0 and 1.6 kb (Maisonpierre et al.,
1990 ), whereas transgenic mRNAs only hybridized to a band at ~2 kb,
the predicted size of the K14-BDNF mRNA. Smaller transgene transcripts
were also visible and likely represented alternatively spliced mRNA.
The two highest expressing lines (733 and 632) were established by
mating F1 offspring to control mice. For line 632, heterozygous
offspring were analyzed because homozygous mice reproduced poorly,
whereas homozygous offspring from line 733 were used for analysis
because they showed no difference in mating efficiency.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 1.
Isolation of K14-BDNF transgenic mice.
A, Southern hybridization was used to detect transgene
incorporation. Genomic DNA (10 µg) isolated from tail samples was
restriction digested with BamHI, separated on an 0.8%
agarose gel, transferred to nitrocellulose, and hybridized with a
random primed 32P-dCTP-labeled probe made to the
full-length BDNF cDNA. A 770 bp transgene band was detected in lines
737, 632, and 733 and not in control samples. The endogenous BDNF gene
was not detectable at this exposure (24 hr). Transgene copy number was
estimated by slot blot analysis of 2 µg of genomic DNA using a
32P-dCTP-labeled random primed probe made to the BDNF cDNA.
Band intensity measures were done using NIH Image 1.57 software and
nontransgenic DNA samples as standards. Transgenic line 737 had three
transgene copies, line 632 had eight copies, and line 733 had five
copies. B, Northern hybridization analysis was used to
detect transgene RNA expression. Total RNA from control brain (10 µg), control flank skin (20 µg), and transgenic flank skin (10 µg) was run on a formaldehyde gel, transferred to a nitrocellulose
membrane, and probed with a 32P- CTP-labeled riboprobe
made to the BDNF cDNA. Endogenous BDNF transcripts (4.0 and 1.6 kb)
were detected in control brain, control skin, and transgenic samples.
Transgenic samples (lines 737, 632, and 733) expressed a major
transgene transcript of ~2.0 kb. Arrows demarcate
migration distance of the 28 and 18 S ribosomal RNA bands.
|
|
BDNF peptide is overexpressed in transgenic skin and
retrogradely transported to sensory ganglia
To verify transgene BDNF peptide synthesis and specificity of
transgene expression, BDNF-specific ECLIA and ELISA were used to
measure BDNF peptide in various tissues of transgenic and control mice
(Table 1). As expected, BDNF peptide was
increased in whisker pad skin, dorsal skin, and tongue. In transgenic
skin, BDNF peptide was increased up to 9.85-fold over control levels
(0.69 vs 0.07 ng/ml; p < 0.01) (Table 1), whereas
tongue tissue showed even higher levels (1.60 ± 0.45 ng/ml). BDNF
peptide level was also increased in trigeminal, nodose-petrosal, and
dorsal root ganglia, indicating retrograde transport of peptide from
the epithelium because the K14-driven transgene was not expressed in
neurons (Davis et al., 1994 ). No change in BDNF level was measured in the SCG, brain, kidney, or liver of transgenics (Table 1).
Increased expression of BDNF in skin alters
sensory innervation
Previous studies of overexpressor transgenic mice have shown NGF
and NT-3 enhance sensory innervation and end organ development in
specific manners (Albers et al., 1994 , 1996 ; Davis et al., 1996 ). To
determine whether BDNF overexpression affected skin innervation,
histological and immunological analyses of postnatal day 7 (P7) and
adult whisker pad and flank skin were done (see also (Rice et al.,
1998 ). Hematoxylin and eosin staining of control (Fig.
2A) and transgenic
(Fig. 2B) skin showed transgenics had an increased
density of cells around hair follicles. The morphology of these cells
and their overlap with increased nerve innervation surrounding hair
follicles (Fig. 2D,F)
suggest they are Schwann cells. Interestingly, comparison of P7 skin
with adult skin showed a retraction from the epidermis of small
unmyelinated fibers in the adult, although hyperinnervation to hair
follicles was maintained (Fig. 2, E, control, F,
transgenic). Fiber retraction from epidermis and subepidermal regions
and increased hair follicle innervation were also apparent in flank
skin (data not shown).

View larger version (151K):
[in this window]
[in a new window]
|
Figure 2.
Histology and innervation of BDNF transgenic skin.
Comparison of adult flank skin of control (A) and
BDNF transgenic (B) mice stained with hematoxylin
and eosin showed that transgenic skin had increased cellularity in the
dermis and surrounding hair follicles (arrow in
B). Innervation density was assessed in P7 and adult
mice by labeling thick sections (40 µm) of skin from whisker pad with
an antibody against PGP9.5. Compared with control whisker pad skin
(C), skin of P7 transgenic mice
(D) had larger nerve bundles
(arrows) and increased fiber density in epidermis and
subepidermal regions of the skin, particularly around hair
follicles. Adult transgenic whisker pad skin
(F) also had increased density of PGP9.5-positive
fibers around hair follicles compared with control skin
(E). In addition, many regions showed fiber
withdrawal from the epidermis and subjacent dermal regions
(between arrowheads), although cluster endings in the
epidermis (arrow) remained. De, Dermis;
ep, epidermis; hf, hair follicle. Scale
bars: (in D) A-D, 100 µm; (in
F) E, F, 50 µm.
|
|
As a comparison to hairy skin, sensory innervation to nonhairy glabrous
skin of the front foot pad was examined. A principal sensory component
of glabrous skin are Meissner touch corpuscles, which are encapsulated
sensory mechanoreceptors innervated by rapidly adapting fibers that
respond to slight deformation of the skin (Perl, 1992 ). Immunolabeling
using PGP9.5 was used to visualize innervation to Meissner corpuscles
in skin overlying the eccrine sweat glands (Fig.
3). Transgenic corpuscles (Fig. 3B,D) were clearly larger and more
densely innervated compared with control samples (Fig.
3A,C). Other PGP9.5-positive
endings in the epidermis that appeared nonencapsulated were also
enhanced in BDNF skin (Fig. 3A, B,
arrowheads). Using hematoxylin and eosin staining,
Meissner-like sensory corpuscles were also found in shallow dermal
papilla located laterally to the sweat glands (Fig. 3E,
control). In comparable regions of BDNF transgenic skin (Fig. 3F), these Meissner-like corpuscles were found to be
unusually large. Transgenic corpuscles were associated with an
increased number of lamellar cells (Fig. 3F,
arrows), which are thought to be modified Schwann cells of
neural crest origin (Vega et al., 1996 ). Although the size and
innervation to Meissner corpuscles was increased, no overt change in
the number of endings was apparent.

View larger version (142K):
[in this window]
[in a new window]
|
Figure 3.
To determine whether BDNF affected sensory nerve
innervation of glabrous skin, front foot pad skin from control
(A, C) and transgenic (B,
D) mice was immunolabeled with an antibody against
PGP9.5. BDNF foot pads had increased innervation to Meissner corpuscles
(arrows in A-D) and unencapsulated
endings (arrowheads) in the upper epidermis.
C (control) and D (transgenic) show
enlarged view of Meissner endings. Meissner endings with associated
lamellar cells (arrows) were also found between pad
regions in controls (E) and transgenics
(F). Note enlargement in transgenic endings.
sc, Stratum corneum; ep, epidermis;
n, nerve fiber. Scale bars: C, 40 µm;
F, 20 µm.
|
|
In comparing the innervation of BDNF and control foot pad skin, an
evident increase in the number of PGP9.5-positive cells and fibers
aligned along the dermal-epidermal border was also noted (Fig.
4, A, control, B,
transgenic). This location and the finding that these cells labeled
with the Merkel cell-specific marker keratin K20 (Fig.
4C,D) identified them as Merkel cells (Moll et
al., 1995 ; Navarro et al., 1995 ). Merkel cell number with associated
innervation was clearly increased in the transgenic skin and in many
fields were found in clustered arrangements, suggesting BDNF-enhanced
Merkel cell duplication during maturation of the skin. This finding is
interesting in light of previous studies that showed that Merkel cells
associated with touch dome mechanoreceptors in dorsal skin were
dependent on skin-derived NT-3 (Airaksinen et al., 1996 ; Albers et al.,
1996 ) and suggested that Merkel cells were either responsive to both
BDNF and NT-3 or that Merkel cells in foot pad and backskin had
differing trophic dependencies. To test these possibilities, we assayed
the number of Merkel cells in BDNF backskin and, interestingly, found
no significant difference (p = 0.21) in Merkel
cell number between control (14.1 ± 2.5; n = 3)
and BDNF transgenic (16.8 ± 1.6; n = 3) touch
domes. These findings indicate that Merkel cells have site-specific
trophic dependencies and support previous findings of heterogeneity in
this neuroendocrine cell population (Nurse and Farraway, 1988 ).

View larger version (80K):
[in this window]
[in a new window]
|
Figure 4.
The number of Merkel cell endings in the foot pad
are increased in BDNF overexpressors. Sections of control
(A) and transgenic (B) foot
pad skin labeled with anti-PGP9.5. Merkel cells at the
dermal-epidermal border are marked by arrows in
A and B. A large Merkel cell cluster in
B is indicated by arrowheads. To better
view the distribution of Merkel cells, foot pad epidermis of control
(C) and transgenic (D) mice
was separated from the underlying dermis and Merkel complexes
double-labeled using an anti-keratin K20 and anti-neurofilament NF150
antibody. Note increase in the number of individual Merkel cells and
their clustering into discrete units (D), similar
to those marked by arrowheads in B.
Inset shows magnified image of transgenic skin; areas of
Merkel cell and nerve terminal overlap appear yellow.
Scale bars: B, 40 µm; C, 100 µm;
inset, 15 µm.
|
|
Sensory neuron populations are differentially affected by
BDNF overexpression
Transgenic mice that overexpressed either NGF or NT-3 had
increased numbers of neurons in DRG and trigeminal ganglia that resulted from a decrease in developmental cell death (Figueiredo and
Albers, unpublished data). We were therefore surprised to find in our
analysis of BDNF ganglia that no change in the number of trigeminal or
DRG neurons in BDNF occurred (Table 2),
because BDNF is known to support the survival of mouse embryonic DRG
and trigeminal neurons in cell culture (Buchman and Davies, 1993 ), and
BDNF knock-out mice showed reduction of neurons in trigeminal ganglion
(44 and 27%) and L4 DRG (30 and 34%) (Ernfors et al., 1994 ; Jones et
al., 1994 , respectively). To directly examine whether axonal
projections to the skin were altered, we counted the number of
myelinated and unmyelinated axons in the cutaneous saphenous nerve
(composed of axons from lumbar dorsal root ganglia L2 and L4) (Table
3). Myelinated axon profiles in BDNF and
control samples were nearly identical in number (controls, 610 ± 28; n = 7; vs transgenics, 606 ± 21;
n = 5; p = 0.9353), a result consistent with the unchanged axon counts measured in BDNF knock-out mice by
Carroll et al. (1998) . Surprisingly, BDNF overexpressors did have a
statistically significant 25% decrease in unmyelinated axon
counts (controls, 3318 ± 158; vs transgenics, 2663 ± 213; p = 0.0233), although no change in DRG neuron number
was measured. Although no definitive explanation for this loss can be
given at this time, this reduction may be related to the BDNF-induced withdrawal of unmyelinated fibers from the epidermis and upper dermis
(Fig. 2F), suggesting that chronic exposure of nerve
terminals to BDNF may induce fiber retraction but not cause neuronal
death. Another possibility is that the lost unmyelinated axons are
sympathetic fibers running through the saphenous nerve and that
increased BDNF caused their selective reduction. This seems unlikely,
however, because (1) no loss of sympathetic neurons was measured in the superior cervical ganglia (Table 2), and (2) labeling of sympathetic fibers in transgenic backskin using an anti-tyrosine hydroxylase antibody indicated sympathetic projections were slightly increased compared with control skin (data not shown). A similar increase was
reported by Botchkarev et al. (1998) for subsets of sympathetic innervation in mice overexpressing BDNF in muscle.
To determine whether transgene-derived BDNF supported neuronal
populations known to be dependent on BDNF for survival, we also counted
neurons in the placode-derived nodose-petrosal sensory ganglia (Table
2). An increase in neuron number was found in the NPG, a complex
composed of the fused superior and inferior vagal ganglia and petrosal
ganglion whose sensory neurons project to the tongue and visceral
organs (e.g., esophagus, stomach, and intestine) (Neuhuber, 1987 ). NPG
neurons have a shared dependence on BDNF and NT-4 and are reduced
(47%) in BDNF knock-out mice (Erickson et al., 1996 ). Because K14-BDNF
was expressed at high levels in tongue and BDNF peptide was elevated in
the NPG (Table 1), an enhanced target-derived support to transgenic NPG
neurons was feasible. Neuronal counts did indeed show that NPG ganglia of transgenics had 38% more neurons than control ganglia (6670 ± 639 vs 4850 ± 223; p < 0.05). In addition, size
distribution analysis of neurons comprising the NPG ganglia showed
transgenic neurons were, across all size classes, larger than control
neurons (BDNF, 24 µm; vs control, 20.5 µm diameter;
p < 0.0001; Kolmogorov-Smirnov; n = 3 mice per group). Thus, BDNF increased the number and size of NPG
neuronal populations but had no affect on the number of neurons
comprising either trigeminal, DRG, or sympathetic ganglia.
Trk receptor expression is altered in trigeminal and DRG of
BDNF overexpressors
The biological response of sensory neurons to neurotrophins is
mediated by the family of trk receptor tyrosine kinases (Barbacid, 1994 ). Neurotrophins signal through trk receptors in specific manners,
such that trkA preferentially binds NGF, trkC binds NT-3, and trkB
binds BDNF and NT-4. Studies of mice that overexpress NGF and NT-3 in
the skin have shown that, in vivo, increased ligand expression can cause a doubling in the percent of neurons that expressed mRNAs encoding the cognate receptors (trkA and trkC, respectively) (Albers et al., 1996 ; Goodness et al., 1997 ). This increase in trk-expressing neurons could be explained by the increased survival of the respective neuronal population, as indicated by the
increase in total neuron number in the NGF and NT-3 lines. BDNF mice
did not have an increase in neuron number, raising the question of
whether trkB expression would be modified in sensory neurons of the
BDNF transgenics. In situ hybridization to examine expression of the full-length trkB receptor mRNA showed
BDNF-overexpressors did have a statistically significant
increase in the number of trkB-expressing neurons in trigeminal and DRG
ganglia (292 and 60%, respectively) (Table
4). Because neuron number did not
increase (Table 2), increased levels of BDNF in the skin must have
caused upregulation of trkB mRNA in neurons that normally were either trkB-negative or expressed trkB at undetectable levels, i.e., phenotypic switching to a trkB phenotype must have occurred. This interpretation is also supported by grain counting analysis of neurons
processed for in situ hybridization, which showed trkB expression did not change on a per cell level, i.e., the average somal
area covered by autoradiographic grains was not significantly different
between transgenics (8.2 ± 1.0%) and controls (7.45 ± 1.1%; p < 0.05). The consequence of the trk receptor
switching may be reflected, at least in part, by the increased
innervation surrounding hair follicles (Fig. 2) and enhanced
innervation to Meissner corpuscles and Merkel cells of the foot pad
(Figs. 3, 4). Future studies to define the physiological profile of
neuronal populations in the BDNF skin will determine whether this is
the case.
Receptor binding studies and analysis of trk expression in BDNF gene
knock-out mice indicates BDNF also interacts with and activates the
trkA receptor (Rodriguez-Tebar et al., 1990 ; Liebl et al., 1997 ). In
particular, BDNF mutants showed a 20-30% loss of trkA-expressing
neurons, which may reflect dependence of some trkA neurons on BDNF
during development. In support of these findings, our in
situ analysis showed that overexpression of BDNF increased the
trkA-expressing population by 70% in trigeminal ganglia (Table 4). In
addition, size distribution analysis of trkB-positive neurons in the
trigeminal ganglia showed that the number of trkB neurons was increased
in all size ranges (Fig. 5A),
with many in the small cell population (13-15 µm). Similarly, an
increased number of trkA-positive neurons was also found, primarily in
the small-sized neuronal populations (13-15 µm) (Fig.
5B), suggesting overlap of the trkA and trkB populations. In
contrast, no change in either the number or size distribution of the
trkC population was found (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5.
Size distribution of trk receptor-expressing
neurons in trigeminal ganglia. Size distributions of trkB- and
trkA-expressing neurons of trigeminal ganglia from K14-BDNF transgenic
and control mice are plotted as the number of cells per radius. In
transgenic trigeminal ganglia (A), trkB neurons
were increased in all size ranges (11-27 µm radius). TrkA neurons in
transgenic ganglia were predominantly in the small neuron (13-15 µm)
populations, indicating that small trkA neurons were most affected by
increased BDNF. Data were analyzed using the Kolmogorov-Smirnov
statistic to identify differences in size distributions as in Goodness
et al. (1997) . Asterisks denotes bins in the trkA
distribution (B) that had statistically
significant increases in the number of trkA neurons.
|
|
TrkB receptor isoform expression is modified by overexpression
of BDNF
Alternative RNA splicing generates at least three trkB isoforms
that all bind BDNF (Klein et al., 1990a ; Middlemas et al., 1991 ). The
full-length tyrosine kinase form, trkB.FL, contains an extracellular
ligand-binding domain, a transmembrane domain, and a tyrosine
kinase-containing intracellular domain. Truncated forms, trkBT.1 and
trkBT.2, contain extracellular and transmembrane domains but lack
intracellular kinase domains. The kinase domain is replaced by two
unique short sequences containing 23 (trkBT.1) or 21 (trkBT.2) amino
acids (Middlemas et al., 1991 ). Truncated isoforms are proposed to
modulate BDNF activity by sequestering it from the surrounding tissue
and thereby reducing full-length trkB binding (Biffo et al., 1995 ).
Similarly, truncated forms may also negatively regulate kinase
signaling by forming nonfunctional, heterodimer (full-length and
truncated) receptor complexes (Eide et al., 1996 ). In addition,
cellular level physiology measures have suggested truncated forms may
stimulate kinase signaling pathways, as measured by generation of
glycolytic and respiratory products (Baxter et al., 1997 ). In
vivo, truncated trkB receptor expression is upregulated in
developing neurons and in response to injury, suggesting a role for
truncated forms in regulating the impact of BDNF on neuron development
and repair processes (Ninkina et al., 1996 ; Wheeler et al., 1998a ).
To determine whether increased levels of BDNF in the skin affected
receptor isoform expression in sensory populations, the relative level
of mRNAs encoding each isoform was measured using Northern
hybridization and reverse transcriptase-PCR (RT-PCR) (Fig.
6). Northern analysis using either a
probe that recognized all forms of trkB (kinase and truncated) (Fig.
6A, TrkB-all) or a probe specific
for the full-length kinase form (Fig. 6A,
TrkB.FL) detected numerous splice variants, as documented
previously (Klein et al., 1990a ). Densitometric analysis of specific
bands (8.2 and 5.5 kb) showed transgenic ganglia had approximately
double the amount of both full-length and truncated mRNAs, which was consistent with the increase in trkB-expressing neurons detected by
in situ hybridization.

View larger version (64K):
[in this window]
[in a new window]
|
Figure 6.
Expression of trkB isoforms in BDNF
transgenic neuronal tissues. A, Northern blot analysis
of RNA from transgenic and control trigeminal ganglia was done using a
probe that detected mRNAs encoding both full-length and truncated trkB
forms (TrkB-all) or mRNAs encoding only
full-length forms (TrkB.FL). Hybridization signals for
mRNAs encoding both full-length and truncated forms were increased
compared with control samples. Signal density measures were normalized
to actin. B, To better quantify relative levels of
expression, RT-PCR analysis of trigeminal RNA from control and
transgenic mice was done using primers specific for full-length trkB
(trkB.FL) and truncated forms (trkB.T1 and trkB.T2). Shown are
representative data from a total of six transgenic and six control mice
analyzed. ImageQuant software was used to measure band intensity and
showed that trkB.FL and trkB.T1 were increased in transgenic ganglia
1.8- and 0.19-fold, respectively. A control brain sample was used as an
internal standard for primer specificity and reaction efficiency.
Values were normalized to actin. C, Western analysis of
trkB expression in control and transgenic trigeminal ganglia
(left) and infraorbital nerve (ION)
(right) showed prominent expression of the 95 kDa
isoform compared with the full-length 145 kDa form. Densitometric
measures showed a modest increase (~25%) in truncated trkB in
transgenic ganglia (two samples per group shown), whereas
transgenic ION samples had double the amount of truncated trkB compared
with control nerve samples. This distribution suggests truncated forms
were preferentially transported to the periphery. Protein samples from
brain indicate mobility of the trkB isoforms. Mrk,
Molecular weight standards.
|
|
To determine more precisely the expression levels of trkB mRNAs in
trigeminal ganglia, RT-PCR using primers specific for full-length (trkB.FL) and truncated (trkB.T1 and trkB.2) mRNAs was performed. cDNAs
generated by reverse transcription were PCR amplified in the presence
of 32P-dCTP, and product levels were quantified using a
phosphorimager (Fig. 6B). Image analyses showed
transgenic ganglia had approximately double the amount of trkB.FL mRNA
compared with control ganglia and that truncated trkB.T1 was expressed
at levels slightly above control (0.19-fold; p < 0.05), whereas trkB.T2 was unchanged.
TrkB protein levels were also increased in transgenic mice as measured
by Western immunoblotting of protein samples isolated from trigeminal
ganglia and nerves projecting to the periphery (Fig. 6C).
Densitometric measure of bands representing the 145 kDa full-length
form and 95 kDa truncated form showed full-length trkB was slightly
increased in transgenic ganglia and virtually undetectable in nerve.
Truncated forms predominated in control and transgenic ganglia and
appeared slightly increased in transgenic ganglia (~25% by
densitometry) (Fig. 6C, left panel).
Interestingly, the amount of truncated trkB protein was doubled in
nerve fibers projecting to the skin (Fig. 6C, right
panel). Collectively, these results indicate that synthesis
and peripheral transport of truncated trkB, which from RT-PCR analysis
was most likely TrkB.T1, was enhanced in BDNF transgenics.
K14-BDNF transgenic mice showed no change in nociceptive
behavioral response
BDNF has been implicated as a regulatory molecule of pain and
mechanosensation (Siuciak et al., 1994 ; Zhou and Rush, 1996 ; Carroll et
al., 1998 ). This possibility and the preferential increase in
small-diameter neuron populations in BDNF transgenic ganglia prompted
us to measure nociceptive responses in BDNF mice. Temperature sensitivity was measured using a hot plate set at 52°C on eight transgenic and eight control mice tested over 4 consecutive days (Fig.
7A). Although control mice
averaged a 26.7 sec latency and transgenic mice averaged a 23.5 sec
latency, this trend was not statistically significant.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7.
Measure of nociceptive behavior of control and
BDNF transgenic mice. Hot plate tests were used to determine whether
peripheral overexpression of BDNF affected nociception. Mice were
placed on a 52°C heated surface, and the time interval between
placement and a behavioral escape response (i.e., paw lick or jump) was
measured. Response latencies compared using ANOVA showed no significant
difference between control and transgenic mice
(A). Measures of mechanical sensitivity were done
using von Frey hair analysis by placing mice on a platform of mesh
material and applying filaments of increasing stiffness to the plantar
surface of the hind paw to elicit a response (i.e., twitching or
licking of paw). BDNF transgenics (n = 8) and
controls (n = 8) were tested over 4 consecutive
days, and the distribution of thresholds was compared using the
Kolmogorov-Smirnov statistic (B). No
statistically significant difference in response to mechanical stimuli
between transgenic and control mice was measured.
|
|
Nociceptive behavioral response to mechanical stimulation was also
tested in BDNF transgenic mice by measuring von Frey hair thresholds on
foot pad skin. Mice were tested over a 4 d period, and the
response data was plotted using the Kolmogorov-Smirnov analysis (Davis
et al., 1993 ). Similar to thermoception, no statistically significant
change in behavioral response was measured in BDNF transgenic mice
(Fig. 7B).
Although no change in nociceptor response was elicited, it is likely
that, given the increased neurite innervation to hair follicles, Merkel
cells, and Meissner corpuscles, changes in sensory perception occurred
in BDNF overexpressors. At present, no behavioral testing paradigm for
measure of these slowly and rapidly adapting mechanoreceptors is
available, although future in vitro electrophysiological assays using an isolated skin preparation are planned to examine possible alteration of the sensory neuron population.
 |
DISCUSSION |
Previous studies of transgenic mice that overexpressed either NGF
or NT-3 in a target-derived manner showed these neurotrophins caused a
significant increase in the survival of trigeminal and DRG neurons and
altered sensory innervation to the skin (Albers et al., 1994 , 1996 ).
These changes were consistent with cell culture and gene knock-out
studies showing these neurotrophins supported developing embryonic
neurons in culture and were survival factors for specific types of
sensory neurons. To determine whether increased levels of
target-derived BDNF could also impact neuron survival, transgenic mice
that overexpressed BDNF in the skin were analyzed. In contrast to NGF
and NT-3, overexpression of BDNF did not increase the number of
trigeminal or DRG neurons, although it did induce a 38% increase in
the placode-derived nodose-petrosal ganglia complex, a result
consistent with the 43-66% loss of nodose neurons in BDNF knock-out
mice (Ernfors et al., 1994 ; Jones et al., 1994 ; Erickson et al., 1996 ).
Thus, NPG neurons and neurons of cranial and spinal ganglia appear to
have inherent differences in their response to target-derived BDNF; NPG
neurons had increased survival, whereas survival of cranial and spinal
sensory neurons was unaffected.
That the number of trigeminal and DRG neurons was unchanged in BDNF
overexpressors was surprising in light of neuron counts of BDNF and
trkB knock-out mice, which showed a 20-44% neuronal loss in these
ganglia (but see Silos-Santiago et al., 1997 ). The simplest explanation
for the lack of BDNF-induced enhancement of trigeminal and DRG neurons
would be that BDNF produced by the skin does not function as a
target-derived survival factor for developing sensory neurons that
innervate the skin but rather as a regulator of neuronal
differentiation once their axons reach their target. This would agree
with studies of LoPresti and Scott (1994) that showed BDNF had slight
affect on survival of chicken cutaneous neurons and suggests neurons
other than cutaneous types are lost in the BDNF-deficient DRG and
trigeminal ganglia.
That skin-derived BDNF does not increase trigeminal and DRG neuron
survival implies that trkB neurons must either be supported by
ganglionic sources of BDNF, i.e., in an autocrine or paracrine manner,
or that other growth factors, such as NGF or NT-3, are required for
embryonic survival of trkB neurons. Autocrine or paracrine modes of
support are less likely because expression of BDNF in sensory
(trigeminal) ganglia was not detected by in situ
hybridization until ~E14.5 (Schecterson and Bothwell, 1992 ), a time
past when developing neurons are lost in BDNF mutants (~E13.5 in L4
DRG) (Liebl et al., 1997 ). If, on the other hand, NGF and NT-3
neurotrophins support developing trkB neurons, overlap of trkB with
trkA and trkC receptor expressing populations would be expected.
Indeed, recent studies by Farinas et al., (1998) of E11 mouse L1 DRG
support this possibility, because 70% of developing neurons express
trkC, 40% express trkB, and 20% express trkA. By E13, a major shift
in expression was found, and only 8% of neurons expressed trkB,
whereas 80% expressed trkA, suggesting a switch in the neurotrophin
responsiveness from NT-3 to NGF. Also important is the finding that, in
E11 DRG, ~40% of trkB-expressing neurons are lost in NT-3-deficient
mice (Farinas et al., 1998 ), demonstrating an early dependence of at
least some trkB neurons on NT-3 (Conover et al., 1995 ). Thus, these
data are consistent with a model in which trkB neurons are initially
supported by NT-3. However, our studies of adult BDNF transgenic
ganglia showed an increased number of trkB and trkA neurons, suggesting
NGF may also have acted as a trkB neuron survival factor during the
later period of neuronal death (E13-E15). If this is the case, the
neurons affected would express both trkB and trkA, a likely possibility because 80% of E13 neurons were trkA-positive (Farinas et al., 1998 ).
A model consistent with these data would be one proposed by Buchman and
Davies (1993) in which the type of neurotrophin support required by
sensory neurons varies temporally, i.e., NT-3 would support early (E11)
trkB neuron survival, whereas NGF would supports late (E13-E15) trkB
neuron survival. In this paradigm, increased target-derived BDNF would
have no effect on survival and, because endogenous levels of NGF and
NT-3 remain at normal levels, no increase in cell number would be expected.
Although not a target-derived survival factor for cutaneous neurons,
skin-derived BDNF did influence the establishment and maintenance of
sensory endings in the periphery. Thus, skin of postnatal transgenic
mice showed prominent hyperinnervation to the epidermis and hair
follicles. Interestingly, this epidermal hyperinnervation retracted to
lower dermal layers of the skin as it matured. Although the cause of
this retraction remains to be determined, one possibility is that
increased BDNF in epidermis was repulsive to matured nerve endings.
Precedent for such an effect is found in studies of embryonic neurons
grown in culture. In vitro application of BDNF to neurite
growth cones of rat DRG explants grown in NGF-containing media caused
dramatic retraction of lamellipodia and cessation of neurite growth
(Paves and Saarma, 1997 ), suggesting BDNF was inhibitory to
NGF-responsive endings. Because many unmyelinated peptidergic endings
that innervate the epidermis are NGF-dependent, these terminals may be
most affected, i.e., repulsed, by the increased epidermally supplied
BDNF. This retraction of nerve fibers appeared specific to the
epidermis and subjacent dermis, because dermal regions surrounding hair follicles remained hyperinnervated in the adult BDNF skin.
The retraction of fibers in transgenic hairy skin contrasted with that
seen in glabrous foot pad skin in which fiber withdrawal was not
observed. In fact, in foot pad there was a marked increase in Merkel
cells and their associated nerve terminals. This finding is of interest
because (1) Merkel cell complexes are known to require NT-3 for their
development, and (2) studies of BDNF (+/ ) mice showed
electrophysiological impairment of slowly adapting mechanoreceptors
(SAMs) that innervate Merkel cells (Carroll et al., 1998 ). Although
reduced BDNF impaired SAM responses, it was not a survival factor for
SAMs, because no change in Merkel complexes of backskin nor reduction
in myelinated axon number in the saphenous nerve of BDNF knock-outs
were found. Our measures are in partial agreement with this
interpretation, because no change in myelinated axon number nor number
of Merkel cells in backskin of BDNF transgenics were found.
Interestingly, this was not the case in foot pad skin in which Merkel
cell-neurite complexes were markedly increased in density, suggesting
a site-specificity of BDNF action on Merkel cell endings. This
site-specific response to BDNF is consistent with comparative studies
of Merkel cells in rat backskin and foot pad, which showed different
responses to denervation, i.e., denervation caused loss of Merkel cells
in backskin but did not affect Merkel cell number in foot pads (Nurse
and Farraway, 1988 ; Mills et al., 1989 ). Thus, Merkel endings in hairy
and glabrous skin may be trophically regulated in distinctly different
manners, e.g., foot pad Merkel cells may respond in a paracrine manner
to BDNF, whereas backskin Merkel cells do not, and this regulation may
confer different physiological properties appropriate for the skin location.
Another sensory ending clearly affected by BDNF overexpression was the
foot pad Meissner corpuscle. Although the number of these low-threshold
rapidly adapting mechanoreceptors appeared unchanged, the
complexity and size of the sensory projection to these endings was
greatly enhanced. Once again, BDNF did not act as a survival factor but
may act instead to influence sensitivity of Meissner endings by
enhancing neurite ending morphology. Interestingly, Meissner endings
were also enlarged in NT-4 overexpressing transgenic mice (R. F. Krimm and K. M. Albers, unpublished data), suggesting that an
overlapping trophic support mechanism mediated through trkB receptor
activation exists for these sensory complexes.
To understand on a mechanistic level how BDNF might elicit the changes
found in peripheral innervation, we examined how overexpression in the
skin affected full-length and truncated trkB receptor expression in the
ganglia. Accumulating evidence has suggested truncated trkB receptors
have important roles in mediating physiological effects of BDNF, either
by direct signal transduction (Baxter et al., 1997 ) or as modulators of
ligand binding to full-length receptors (Middlemas et al., 1991 ; Eide
et al., 1996 ). Analyses showed the trkB.T1 form was elevated,
albeit modestly, in trigeminal ganglia along with the full-length
mRNAs, suggesting the T1 form (more so than the T2 isoform) was
recruited in response to the increased levels of peripheral BDNF. This
increase in mRNA expression, coupled with the doubling of truncated
forms in nerves projecting to the skin, suggests that preferential T1
synthesis and transport occurred in neurons exposed to increased BDNF
and that trkB.T1 can modulate BDNF signaling. Because BDNF is released
after many types of neuronal injury (Ernfors et al., 1993 ; Friedman et
al., 1995 ; Wheeler et al., 1998b ), understanding the underlying
mechanisms and consequence of this response has relevance in design of
therapeutic approaches to nerve injury.
 |
FOOTNOTES |
Received Aug. 19, 1998; revised May 5, 1999; accepted May 6, 1999.
This work was supported by National Institutes of Health Grants NS33730
(K.M.A) and NS31826 (B.M.D). We thank James Simpson, Marc Jones, Mary
Gail Engle, and Cynthia Long for excellent technical assistance.
Correspondence should be addressed to Kathryn M. Albers, University of
Kentucky Medical Center, Department of Pathology and Laboratory
Medicine, Suite MS 117, Lexington, KY 40536-0084.
 |
REFERENCES |
-
Acheson A,
Lindsay RM
(1996)
Non target-derived roles of the neurotrophins.
Phil Trans R Soc Lond B Biol Sci
351:417-422[Web of Science][Medline].
-
Airaksinen MS,
Koltzenburg M,
Lewin GR,
Masu Y,
Helbig C,
Wolf E,
Brem G,
Toyka KV,
Thoenen H,
Meyer M
(1996)
Specific subtypes of cutaneous mechanoreceptors require neurotrophin-3 following peripheral target innervation.
Neuron
16:287-295[Web of Science][Medline].
-
Albers KM,
Wright DE,
Davis BM
(1994)
Overexpression of nerve growth factor in epidermis of transgenic mice causes hypertrophy of the peripheral nervous system.
J Neurosci
14:1422-1432[Abstract].
-
Albers KM,
Perrone TN,
Goodness TP,
Jones ME,
Green MA,
Davis B M
(1996)
Cutaneous overexpression of NT-3 increases sensory and sympathetic neuron number and enhances touch dome and hair follicle innervation.
J Cell Biol
134:487-497[Abstract/Free Full Text].
-
Barbacid M
(1994)
The Trk family of neurotrophin receptors.
J Neurobiol
25:1386-1403[Web of Science][Medline].
-
Baxter GT,
Radeke MJ,
Kuo RC,
Makrides V,
Hinkle B,
Hoang R,
Medina-Selby A,
Coit D,
Valenzuela P,
Feinstein SC
(1997)
Signal transduction mediated by the truncated trkB receptor isoforms, trkB.T1 and trkB.T2.
J Neurosci
17:2683-2690[Abstract/Free Full Text].
-
Biffo S,
Offenhauser N,
Carter BD,
Barde YA
(1995)
Selective binding and internalisation by truncated receptors restrict the availability of BDNF during development.
Development
121:2461-2470[Abstract].
-
Botchkarev VA,
Botchkareva NV,
Lommatzsch M,
Peters EM,
Lewin GR,
Subramaniam A,
Braun A,
Renz H,
Paus R
(1998)
BDNF overexpression induces differential increases among subsets of sympathetic innervation in murine back skin.
Eur J Neurosci
10:3276-3283[Web of Science][Medline].
-
Buchman VL,
Davies AM
(1993)
Different neurotrophins are expressed and act in a developmental sequence to promote the survival of embryonic sensory neurons.
Development
118:989-1001[Abstract].
-
Carroll P,
Lewin GR,
Koltzenburg M,
Toyka KV,
Thoenen H
(1998)
A role for BDNF in mechanosensation.
Nat Neurosci
1:42-46.[Web of Science][Medline]
-
Conover JC,
Erickson JT,
Katz DM,
Bianchi LM,
Poueymirou WT,
McClain J,
Pan L,
Helgren M,
Ip NY,
Boland P,
Friedman B,
Wiegand S,
Vejsada R,
Kato AC,
DeChiara TM,
Yancopoulos GD
(1995)
Neuronal deficits, not involving motor neurons, in mice lacking BDNF and/or NT4.
Nature
375:235-238[Medline].
-
Crowley C,
Spencer SD,
Nishimura MC,
Chen KS,
Pitts-Meek S,
Armanini MP,
Ling LH,
McMahon SB,
Shelton DL,
Levinson AD,
Philips HS
(1994)
Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons.
Cell
76:1001-1011[Web of Science][Medline].
-
Davies AM,
Bandtlow C,
Heumann R,
Korsching S,
Rohrer H,
Thoenen H
(1987)
Timing and site of nerve growth factor synthesis in developing skin in relation to innervation and expression of the receptor.
Nature
326:353-358[Medline].
-
Davis BM,
Lewin GR,
Mendell LM,
Jones ME,
Albers KM
(1993)
Altered expression of nerve growth factor in the skin of transgenic mice leads to changes in response to mechanical stimuli.
Neuroscience
56:789-792[Web of Science][Medline].
-
Davis BM,
Albers KM,
Seroogy KB,
Katz DM
(1994)
Overexpression of nerve growth factor in transgenic mice induces novel sympathetic projections to primary sensory neurons.
J Comp Neurol
349:464-474[Web of Science][Medline].
-
Davis BM,
Wang HS,
Albers KM,
Carlson SL,
Goodness TP,
McKinnon D
(1996)
Effects of NGF overexpression on anatomical and physiological properties of sympathetic postganglionic neurons.
Brain Res
724:47-54[Web of Science][Medline].
-
Davis BM,
Fundin BT,
Albers KM,
Goodness TP,
Cronk KM,
Rice FL
(1997)
Overexpression of nerve growth factor in skin causes preferential increases among innervation to specific sensory targets.
J Comp Neurol
387:489-506[Web of Science][Medline].
-
Eide FF,
Vining ER,
Eide BL,
Zang K,
Wang XY,
Reichardt LF
(1996)
Naturally occurring truncated trkB receptors have dominant inhibitory effects on brain-derived neurotrophic factor signaling.
J Neurosci
16:3123-3129[Abstract/Free Full Text].
-
Erickson JT,
Conover JC,
Borday V,
Champagnat J,
Barbacid M,
Yancopoulos G,
Katz DM
(1996)
Mice lacking brain-derived neurotrophic factor exhibit visceral sensory neuron losses distinct from mice lacking NT4 and display a severe developmental deficit in control of breathing.
J Neurosci
16:5361-5371[Abstract/Free Full Text].
-
Ernfors P,
Wetmore C,
Olson L,
Persson H
(1990)
Identification of cells in rat brain and peripheral tissues expressing mRNA for members of the nerve growth factor family.
Neuron
5:511-526[Web of Science][Medline].
-
Ernfors P,
Rosario CM,
Merlio JP,
Grant G,
Aldskogius H,
Persson H
(1993)
Expression of mRNAs for neurotrophin receptors in the dorsal root ganglion and spinal cord during development and following peripheral or central axotomy.
Mol Brain Res
17:217-226[Medline].
-
Ernfors P,
Lee KF,
Jaenisch R
(1994)
Mice lacking brain-derived neurotrophic factor develop with sensory deficits.
Nature
368:147-150[Medline].
-
Farinas I,
Wilkinson GA,
Backus C,
Reichardt LF,
Patapoutian A
(1998)
Characterization of neurotrophin and Trk receptor functions in developing sensory ganglia: direct NT-3 activation of TrkB neurons in vivo.
Neuron
21:325-334[Web of Science][Medline].
-
Friedman B,
Kleinfeld D,
Ip NY,
Verge VM,
Moulton R,
Boland P,
Zlotchenko E,
Lindsay RM,
Liu L
(1995)
BDNF and NT-4/5 exert neurotrophic influences on injured adult spinal motor neurons.
J Neurosci
15:1044-1056[Abstract].
-
Goodness TP,
Albers KM,
Davis FE,
Davis BM
(1997)
Overexpression of nerve growth factor in skin increases sensory neuron size and modulates Trk receptor expression.
Eur J Neurosci
9:1574-1585[Web of Science][Medline].
-
Jones KR,
Farinas I,
Backus C,
Reichardt LF
(1994)
Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development.
Cell
76:989-999[Web of Science][Medline].
-
Klein R,
Conway D,
Parada LF,
Barbacid M
(1990a)
The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain.
Cell
61:647-656[Web of Science][Medline].
-
Klein R,
Martin-Zanca D,
Barbacid M,
Parada LF
(1990b)
Expression of the tyrosine kinase receptor gene trkB is confined to the murine embryonic and adult nervous system.
Development
109:845-850[Abstract/Free Full Text].
-
Liebl DJ,
Tessarollo L,
Palko ME,
Parada LF
(1997)
Absence of sensory neurons before target innervation in brain-derived neurotrophic factor-, neurotrophin 3-, and TrkC-deficient embryonic mice.
J Neurosci
17:9113-9121[Abstract/Free Full Text].
-
LoPresti P,
Scott SA
(1994)
Target specificity and size of avian sensory neurons supported in vitro by nerve growth factor, brain-derived neurotrophic factor, and neurotrophin-3.
J Neurobiol
25:1613-1624[Web of Science][Medline].
-
Maisonpierre PC,
Belluscio L,
Squinto S,
Ip NY,
Furth ME,
Lindsay RM,
Yancopoulos GD
(1990)
Neurotrophin-3: a neurotrophic factor related to NGF and BDNF.
Science
247:1446-1451[Abstract/Free Full Text].
-
Middlemas DS,
Lindberg RA,
Hunter T
(1991)
TrkB, a neural receptor protein-tyrosine kinase: evidence for a full-length and two truncated receptors.
Mol Cell Biol
11:143-153[Abstract/Free Full Text].
-
Mills LR,
Nurse CA,
Diamond J
(1989)
The neural dependency of Merkel cell development in the rat: the touch domes and foot pads contrasted.
Dev Biol
136:61-74[Web of Science][Medline].
-
Moll I,
Kuhn C,
Moll R
(1995)
Cytokeratin 20 is a general marker of cutaneous Merkel cells while certain neuronal proteins are absent.
J Invest Dermatol
104:910-915[Web of Science][Medline].
-
Navarro X,
Verdu E,
Wendelschafer-Crabb G,
Kennedy WR
(1995)
Innervation of cutaneous structures in the mouse hind paw: a confocal microscopy immunohistochemical study.
J Neurosci Res
41:111-120[Web of Science][Medline].
-
Neuhuber WL
(1987)
Sensory vagal innervation of the rat esophagus and cardia: a light and electron microscopic anterograde tracing study.
J Auton Nerv Syst
20:243-255[Web of Science][Medline].
-
Ninkina N,
Adu J,
Fischer A,
Pinon LG,
Buchman VL,
Davies AM
(1996)
Expression and function of TrkB variants in developing sensory neurons.
EMBO J
15:6385-6393[Web of Science][Medline].
-
Nurse CA,
Farraway L
(1988)
Development of Merkel cell populations with contrasting sensitivities to neonatal deafferentation in the rat whisker pad.
Somatosens Mot Res
6:141-162[Web of Science][Medline].
-
Oppenheim RW
(1991)
Cell death during development of the nervous system.
Annu Rev Neurosci
14:453-501[Web of Science][Medline].
-
Paves H,
Saarma M
(1997)
Neurotrophins as in vitro growth cone guidance molecules for embryonic sensory neurons.
Cell Tissue Res
290:285-297[Web of Science][Medline].
-
Perl E
(1992)
Function of dorsal root ganglion neurons: an overview.
In: Sensory neurons: diversity, development, and plasticity (Scott SA,
ed), pp 3-23. New York: Oxford UP.
-
Reichardt LF,
Farinas I
(1997)
Neurotrophic factors and their receptors: roles in neuronal development and function.
In: Molecular approaches to neural development (Cowan MW,
Jessell TM,
Zipurski L,
eds), pp 220-263. New York: Oxford UP.
-
Rice FL,
Albers KM,
Davis BM,
Silos-Santiago I,
Wilkinson GA,
LeMaster AM,
Ernfors P,
Smeyne RJ,
Aldskogius H,
DeChiara TM,
Philips HS,
Reichardt LF,
Barbacid M,
Yancopoulos GD,
Fundin BT
(1998)
Differential dependency of unmyelinated and Ad epidermal and upper dermal innervation on neurotrophins, trk receptors and p75 LNGFR.
Dev Biol
198:57-81[Web of Science][Medline].
-
Robinson M,
Buj-Bello A,
Davies AM
(1996)
Paracrine interactions of BDNF involving NGF-dependent embryonic sensory neurons.
Mol Cell Neurosci
7:143-151[Web of Science][Medline].
-
Rodriguez-Tebar A,
Dechant G,
Barde YA
(1990)
Binding of brain-derived neurotrophic factor to the nerve growth factor receptor.
Neuron
4:487-492[Web of Science][Medline].
-
Rose RD,
Rohrlich D
(1987)
Counting sectioned cells via mathematical reconstruction.
J Comp Neurol
263:365-386[Web of Science][Medline].
-
Schecterson LC,
Bothwell M
(1992)
Novel roles for neurotrophins are suggested by BDNF and NT-3 mRNA expression in developing neurons.
Neuron
9:449-463[Web of Science][Medline].
-
Silos-Santiago I,
Fagan AM,
Garber M,
Fritzsch B,
Barbacid M
(1997)
Severe sensory deficits but normal CNS development in newborn mice lacking trkB and trkC tyrosine protein kinase receptors.
Eur J Neurosci
9:2045-2056[Web of Science][Medline].
-
Siuciak JA,
Altar CA,
Wiegand SJ,
Lindsay RM
(1994)
Antinociceptive effect of brain-derived neurotrophic factor and neurotrophin-3.
Brain Res
633:326-330[Web of Science][Medline].
-
Snider WD
(1994)
Functions of the neurotrophins during nervous system development: what the knockouts are teaching us.
Cell
77:627-638[Web of Science][Medline].
-
Vassar R,
Fuchs E
(1991)
Transgenic mice provide new insights into the role of TGF-a during epidermal development and differentiation.
Genes Dev
5:714-727[Abstract/Free Full Text].
-
Vega JA,
Haro JJ,
Del Valle ME
(1996)
Immunohistochemistry of human cutaneous Meissner and pacinian corpuscles.
Microsc Res Tech
34:351-361[Web of Science][Medline].
-
Wang X,
Zinkel S,
Polonsky K,
Fuchs E
(1997)
Transgenic studies with a keratin promoter-driven growth hormone transgene; prospects for gene therapy.
Proc Natl Acad Sci USA
94:219-226[Abstract/Free Full Text].
-
West MJ
(1993)
New stereological methods for counting neurons.
Neurobiol Aging
14:275-285[Web of Science][Medline].
-
Wheeler EF,
Gong H,
Grimes R,
Benoit D,
Vazquez L
(1998a)
p75NTR and Trk receptors are expressed in reciprocal patterns in a wide variety of non-neural tissues during rat embryonic development, indicating independent receptor functions.
J Comp Neurol
391:407-428[Web of Science][Medline].
-
Wheeler EF,
Naftel JP,
Pan M,
von Bartheld CS,
Byers MR
(1998b)
Neurotrophin receptor expression is induced in a subpopulation of trigeminal neurons that label by retrograde transport of NGF or fluoro- gold following tooth injury.
Brain Res Mol Brain Res
61:23-38[Medline].
-
Wright EM,
Vogel KS,
Davies AM
(1992)
Neurotrophic factors promote the maturation of developing sensory neurons before they become dependent on these factors for survival.
Neuron
9:139-150[Web of Science][Medline].
-
Yancopoulos GD,
Maisonpierre PC,
Ip NY,
Aldrich TH,
Belluscio L,
Boulton TG,
Cobb MH,
Squinto SP,
Furth ME
(1990)
Neurotrophic factors, their receptors, and the signal transduction pathways they activate.
Cold Spring Harbor Symp Quant Biol
55:371-379[Abstract/Free Full Text].
-
Zhou XF,
Rush RA
(1996)
Endogenous brain-derived neurotrophic factor is anterogradely transported in primary sensory neurons.
Neuroscience
74:945-953[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19145919-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
F. N. Zaidi, R. F. Krimm, and M. C. Whitehead
Exuberant Neuronal Convergence onto Reduced Taste Bud Targets with Preservation of Neural Specificity in Mice Overexpressing Neurotrophin in the Tongue Epithelium
J. Neurosci.,
December 12, 2007;
27(50):
13875 - 13881.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Albers and B. M. Davis
The Skin as a Neurotrophic Organ
Neuroscientist,
August 1, 2007;
13(4):
371 - 382.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. de Groot, A. J. M. Coenen, A. Verhofstad, F. van Herp, and G. J. M. Martens
In Vivo Induction of Glial Cell Proliferation and Axonal Outgrowth and Myelination by Brain-Derived Neurotrophic Factor
Mol. Endocrinol.,
November 1, 2006;
20(11):
2987 - 2998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Guha, W. A. Gomes, J. Samanta, M. Gupta, F. L. Rice, and J. A. Kessler
Target-derived BMP signaling limits sensory neuron number and the extent of peripheral innervation in vivo
Development,
March 1, 2004;
131(5):
1175 - 1186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ho, A. Eggert, T. Hishiki, J. E. Minturn, N. Ikegaki, P. Foster, A. M. Camoratto, A. E. Evans, and G. M. Brodeur
Resistance to Chemotherapy Mediated by TrkB in Neuroblastomas
Cancer Res.,
November 15, 2002;
62(22):
6462 - 6466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Cronk, G. A. Wilkinson, R. Grimes, E. F. Wheeler, S. Jhaveri, B. T. Fundin, I. Silos-Santiago, L. Tessarollo, L. F. Reichardt, and F. L. Rice
Diverse dependencies of developing Merkel innervation on the trkA and both full-length and truncated isoforms of trkC
Development,
August 1, 2002;
129(15):
3739 - 3750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zwick, B. M. Davis, C. J. Woodbury, J. N. Burkett, H. R. Koerber, J. F. Simpson, and K. M. Albers
Glial Cell Line-Derived Neurotrophic Factor is a Survival Factor for Isolectin B4-Positive, but not Vanilloid Receptor 1-Positive, Neurons in the Mouse
J. Neurosci.,
May 15, 2002;
22(10):
4057 - 4065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fitzgerald and S. Beggs
Book Review: The Neurobiology of Pain: Developmental Aspects
Neuroscientist,
June 1, 2001;
7(3):
246 - 257.
[Abstract]
[PDF]
|
 |
|
|