 |
 Previous Article | Next Article 
The Journal of Neuroscience, July 15, 1999, 19(14):5980-5989
Targeted Mutagenesis of the POU-Domain Gene
Brn4/Pou3f4 Causes Developmental Defects in the Inner
Ear
Deborah
Phippard1,
Lihui
Lu1,
Daniel
Lee1,
James C.
Saunders2, and
E. Bryan
Crenshaw III1
Departments of 1 Neuroscience and
2 Otorhinolaryngology, Head and Neck Surgery, University of
Pennsylvania, Philadelphia, Pennsylvania 19104-6074
 |
ABSTRACT |
Targeted mutagenesis in mice demonstrates that the
POU-domain gene Brn4/Pou3f4 plays a crucial role in the
patterning of the mesenchymal compartment of the inner ear.
Brn4 is expressed extensively throughout the condensing
mesenchyme of the developing inner ear. Mutant animals displayed
behavioral anomalies that resulted from functional deficits in both the
auditory and vestibular systems, including vertical head bobbing,
changes in gait, and hearing loss. Anatomical analyses of the temporal
bone, which is derived in part from the otic mesenchyme, demonstrated
several dysplastic features in the mutant animals, including
enlargement of the internal auditory meatus. Many phenotypic features
of the mutant animals resulted from the reduction or thinning of the
bony compartment of the inner ear. Histological analyses demonstrated a
hypoplasia of those regions of the cochlea derived from otic
mesenchyme, including the spiral limbus, the scala tympani,
and strial fibrocytes. Interestingly, we observed a reduction
in the coiling of the cochlea, which suggests that Brn-4 plays a role
in the epithelial-mesenchymal communication necessary for the cochlear
anlage to develop correctly. Finally, the stapes demonstrated several
malformations, including changes in the size and morphology of its
footplate. Because the stapes anlage does not express the
Brn4 gene, stapes malformations suggest that the
Brn4 gene also plays a role in mesenchymal-mesenchymal signaling. On the basis of these data, we suggest that Brn-4 enhances the survival of mesodermal cells during the mesenchymal remodeling that
forms the mature bony labyrinth and regulates inductive signaling mechanisms in the otic mesenchyme.
Key words:
inner ear development; Brn4/Pou3f4; POU-domain
transcription factor; epithelial-mesenchymal interaction; stapes; targeted mutagenesis
| |
INTRODUCTION |
Inner ear development
requires a complex series of morphogenetic changes that result from the
interaction of ectodermal epithelia and mesenchyme (Deol, 1966 ;
Langman, 1982; Frenz and Van de Water, 1991). In vertebrates, the
development of the inner ear is initiated by the invagination of
somatic ectoderm that lies lateral to the hindbrain to form the otic
vesicle (for review, see Lewis et al., 1985; Peck, 1994). From the
simple spherical structure of the otic vesicle, a number of complex
morphological changes occur as a result of reciprocal interactions
between the ectodermally derived otic vesicle and the surrounding
mesenchyme (Noden and Van de Water, 1986; Fekete, 1996). The molecular
mechanisms that regulate this series of inductive interactions remain
to be fully characterized. However, genetic and reverse genetic
approaches are providing insights into the regulation of inner ear
development (for review, see Noden and Van de Water, 1992; Steel and
Brown, 1994; Smith, 1995).
The reverse genetic approach to the characterization of candidate
regulatory genes is illustrated by the isolation and characterization of the POU-domain gene family, many members of which are expressed during inner ear development (for review, see Ryan and Rosenfeld, 1997). POU-domain genes encode transcription factors that regulate a
number of developmental processes. Sequence-specific DNA binding of
POU-domain genes is mediated by a bipartite motif, which
consists of a POU homeodomain and POU-specific domain. The POU
homeodomain is a 60 amino acid segment with similarity to the classic
homeodomain transcription factors. The POU-specific domain is an
additional ~75 amino acid motif that cooperates with the POU
homeodomain to enhance the binding affinity and specificity of DNA
binding (for review, see Herr and Cleary, 1995; Ryan and Rosenfeld,
1997). These transcription factors display a broad domain of expression during embryogenesis (He et al., 1989; Ryan and Rosenfeld, 1997). Genetic analyses have demonstrated that these factors play crucial developmental roles in a number of organ systems, including the inner
ear (de Kok et al., 1995b; Erkman et al., 1996; Xiang et al., 1996,
1997).
For example, de Kok et al. (1995b) have shown that mutations in the
human Brain-4 (Brn4) ortholog POU3F4 produce mixed
conductive and sensorineural deafness associated with perilymphatic
gusher during stapes surgery (DFN3; McKusick catalog #304400).
High-resolution computed tomography has shown that these
patients also displayed multiple defects of the bony labyrinth. These
defects were classified as pseudo-Mondini stage II dysplasias and were
characterized by several features, including (1) partial hypoplasia of
the cochlea, (2) stapes fixation, and (3) a dilated internal auditory
meatus associated with an abnormal communication with the base of the cochlear duct. The defects that occur in DFN3 patients have been hypothesized to result from abnormal otic capsule formation between 25 and 47 d of gestation (Piussan et al., 1995). This corresponds approximately to 10.0-13.5 d postcoitus (dpc) of mouse development (Theiler, 1989) and corresponds precisely with the period of
development in which the mouse Brn4 gene is expressed in the
developing otic capsule (Phippard et al., 1998). Further molecular
analyses are necessary to determine the role of the Brn4
gene during normal development.
To assess the embryological consequences of Brn4/Pou3f4
mutations, we have generated a mutant mouse pedigree containing a null
mutation of the Brn4 gene, using homologous recombination in
embryonic stem (ES) cells. Previous analyses from our laboratory have
demonstrated that the Brn4 gene is initially expressed in the otic capsule at 10.5 dpc, when the capsule initiates the
mesenchymal condensation that gives rise to the temporal bone (Phippard
et al., 1998). As the otic mesenchyme condenses around the otic
vesicle, Brn4 is expressed throughout the otic capsule.
Characterization of Brn4 null mouse mutants demonstrates
that this gene plays a crucial role in the morphogenesis of the
mesenchymal component of the developing inner ear.
| |
MATERIALS AND METHODS |
Gene targeting of the Brn4 gene. Genomic
sequences for the Brn4/Pou3f4 gene were isolated from a
 FIXII library derived from 129/SvJ genomic DNA (Stratagene, La
Jolla, CA). The 5' homologous sequences were derived from the
XbaI ( 3.2 kb) to the BamHI site that lies 14 bp
5' of the initiator methionine codon. The lacZ gene from pCH110 was
introduced into the knock-out locus such that it would be expressed
from the endogenous Brn4 promoter. The PGK-neo gene was
isolated from pTKAB' (a gift of J. Bermingham), and the 3'
homologous sequences were derived from a 6.7 kb SpeI site
that lies 3' of the Brn4-coding sequences. The PGK-TK gene from pGEM7(TK)SalI was introduced into the targeting vector
to enable counterselection (a gift of M. A. Rudnicki). As
indicated in Figure 1, this
gene-targeting vector removed the coding sequence of the
Brn4 gene after integration. The targeting construct was linearized by restriction digestion with NotI, and 25-40
µg of linearized vector was transfected into 107
R1 ES cells by electroporation according to published protocols (Joyner, 1993). Transfected colonies were isolated after selection with
280 µg/ml (active) G418 (Life Technologies, Gaithersburg, MD) and 1 µM gancyclovir (Cytovene). Genomic DNA from individual clones was isolated, digested with PstI, electrophoresed on
a 0.7% agarose gel, transferred to Hybond N+
(Amersham, Arlington Heights, IL), and hybridized with a random-labeled 450 bp PstI/XbaI fragment that lies just 5' of
the gene-targeting vector (see Fig. 1). Positive clones were expanded
and analyzed by Southern blot analysis using the lacZ gene, the
Brn4-coding sequences, and a probe that lies within the
Brn4 gene 3' of those sequences included in the targeting
vector. A positive clone (2G-13) was injected into C57BL/6J
blastocysts, according to published protocols (Joyner, 1993). The
contribution of the ES cells to the resulting chimeric animals was
determined by estimating the proportion of agouti coat color. Chimeric
animals that were estimated to be >90% derived from ES cells were
mated to C57BL/6J or CD-1 females. Because the Brn4 gene is
X-linked, the null allele was transmitted to all of the female progeny
that were derived from the ES cells. These heterozygous females were
detected by Southern blot analyses, using the same protocol described
above for the analysis of ES cell clones. Hemizygous null male animals
were generated by mating of the heterozygous females to C57BL/6J
males.
View larger version (16K):
[in this window]
[in a new window]
|
Figure 1.
Targeted mutagenesis of the Brn4 locus.
A, Diagram of the targeting vector (top
line), the wild-type allele (middle line), and
the mutated allele (bottom line). The entire intronless
coding region (box labeled Brn4) and a small
region of 3'-flanking sequences have been replaced by the lacZ reporter
gene and the PGK-neo gene. The lacZ-coding sequences have been
introduced into the Brn4 locus such that the
Brn4 promoter drives the transcription of the reporter
gene from the mutated allele. Homologous recombination was detected
with the 5' P/X probe that detects the conversion of a 4.6 kb
PstI fragment to 8.0 kb. P,
PstI; S, SalI;
X, XbaI. B, Southern blot
analysis of the genetic transmission of the X-linked locus. Analysis of
progeny from the founder chimeric male animals indicated that the
mutated allele is transmitted to only the female progeny in generation
2. Genomic DNA was digested with PstI and probed with
the 5' P/X probe. F, Females; M,
males.
|
|
Embryonic tissue analyses. For analysis of lacZ expression,
embryos were isolated from timed matings of hemizygous males that were
null for the X-linked Brn4 allele. The morning that vaginal plugs were detected was designated 0.5 dpc. Verification of
transgenic animals was performed by dot blot or PCR analyses of yolk
sac DNA with lacZ-specific probes or oligonucleotides. PCR analyses to
detect the lacZ gene were performed essentially as described (Hogan et
al., 1994), using the sense strand oligonucleotide
CGCCGAAATCCCGAATCTCTA and the antisense oligonucleotide
TCACCGCCGTAAGCCGACCAC. PCR was run for 30 cycles with a temperature
profile as follows: 94°C for 30 sec, 65°C for 40 sec, and 72°C
for 45 sec.
For the whole-mount preparation, the embryos were fixed in PBS
containing 2% paraformaldehyde, 0.2% glutaraldehyde, 0.02% NP-40,
and 0.01% sodium deoxycholate on ice for a period of time that
depended on gestational age; 8.5 and 9.5 dpc embryos were fixed for 1 hr, 10.5 and 11.5 dpc embryos were fixed for 1.5 hr, and 12.5 dpc and
older embryos were fixed for 2 hr. After fixation, embryos were washed
three times in PBS. Whole-mount preparations were then stained for 8 hr
to overnight at 33°C in 1 mg/ml
5-bromo-4-chloro-3-indolyl- -D-galactopyranoside (X-gal),
5 mM potassium ferricyanide, 5 mM potassium
ferrocyanide, 1 mM MgCl2, 0.02% NP-40,
and 0.01% sodium deoxycholate in PBS. Nontransgenic embryos control
for background staining. After staining, the embryos were washed three
times in PBS and post-fixed overnight in 4% paraformaldehyde in PBS at
4°C. Vibratome sections (150 µm) of whole-mount preparations were
generated to examine the fine structure of the embryonic expression
patterns. Embryos were photographed on a Leica MZ8 dissecting
microscope (Nussloch, Germany) using Ektachrome 160T slide film. Images
were then captured using an LS-1000 slide scanner (Nikon), and figures
were constructed using Photoshop (Adobe Systems).
Adult tissue analyses. Temporal bone preparations were
obtained by bisecting the head and dissecting away most soft tissue. Skulls were boiled in distilled water for 2-3 hr until the skull sutures were loosened enough to allow easy excision of the temporal bone. Temporal bones were then stained with 0.0015% alizarin red in
1% KOH for 48 hr (Peters, 1977).
Histological analysis of the cochlea began by perfusing the cochlea
through the aorta or via the oval window. Mice (6-8 weeks of age) were
anesthetized (Metofane) and sacrificed by cervical dislocation. The
temporal bones were dissected from the rest of the calvarium, and the
adherent tissues were removed. The bulla wall was punctured in the
inferioposterior quadrant below the tympanic membrane and then further
resected to expose the ossicles and oval window. In several cases, the
ossicles were dissected free from the temporal bone, stained with
alizarin red, as described above, and analyzed for malformations.
Removal of an intact stapes required that the stapedial artery and
stapedius muscle be severed with the tip of a 26 ga hypodermic needle.
The head of the stapes was then disarticulated from the long arm (crus)
of the incus. The round window was then punctured with the tip of the
hypodermic needle, and the cochlea was perfused through the oval window
with 4% paraformaldehyde in PBS. Fixation was continued overnight in 4% paraformaldehyde in PBS, followed by 4-5 d in Cal-EX II
decalcifying solution (Fisher Scientific, Houston, TX). Decalcified
temporal bones were imbedded in paraffin, sectioned (7 µm), and
stained with hematoxylin and eosin.
To generate whole-mount cleared preparations of the cochlea, we
perfused the temporal bones through the oval window and fixed the bones
overnight in 4% paraformaldehyde in PBS, as described above. The
temporal bones were bleached for 30 min in 6% hydrogen peroxide. A
solution of 10% latex paint (Dutch Boy; white multipurpose primer
sealer) in PBS was perfused into the cochlea through the oval window.
Preparations were then dehydrated through a graded series of ethanols
and cleared in methyl salicylate. Alternatively, the paint was applied
after the temporal bones were cleared in methyl salicylate. In this
case, a 10% solution of enamel paint (Duron; semigloss interior
alkyd) in methyl salicylate was perfused into the cochlea
through the oval window, such that the paint fills the perilymphatic
space that normally surrounds the membranous labyrinth.
Preyer's reflex measurements. Auditory function was
assessed in mutant mice or their wild-type control siblings by
ascertaining the pinna (Preyer's) reflex threshold. Mice (6 weeks of
age) were placed in a glass chamber and stimulated with a burst of
high-frequency noise. Each burst was 50 msec in duration with a 5 msec
rise and decay time. The burst consisted of a narrow-band noise whose
half-power points were between 10.0 and 18.5 kHz. The signal on the
high- and low-frequency side of these band limits declined at a rate of
48 dB/octave. The intensity of the noise burst was controlled by an
attenuator. This band of noise overlapped with the optimal hearing
range of the mouse (Fay, 1988). The noise bursts were delivered via a
high-frequency tweeter and were initiated by the observer via a switch
closure. The stimulus was calibrated at the bottom of the chamber using
a 12.5 mm condenser microphone, and the sound pressure level (SPL) was
expressed as decibels relative to 20 µPa. The occurrence of a
Preyer's reflex was determined by an observer who did not know the
genotype of the mouse. A modified method of limits was used to measure
the reflex threshold. Starting at a level of 90 dB SPL, a noise burst
was presented. If a pinna or startle reflex was identified, the
stimulus was attenuated 10 dB, and another burst was presented. This
approach continued until no reflex could be identified. The stimulus
level was then raised 5 dB, and a final trial was run. The threshold
was defined as that SPL value halfway between the noise burst levels
that could or could not elicit a reflex, and the error is given as an
SD. If there was uncertainty in the threshold, the process was
repeated. Care was taken to vary the interval between burst presentations (5-20 sec) to avoid habituation. This assessment of the
reflex threshold provided us with an estimate of the animals' hearing
ability in the noise-band frequency range.
| |
RESULTS |
Gene targeting of the Brn4/Pou3f4 locus
The role of the Brn4/Pou3f4 gene during embryogenesis
was investigated by generating a mutant mouse pedigree with a targeted deletion of this gene. As illustrated in Figure 1A,
the entire coding sequence of the Brn4 gene was removed via
homologous recombination in ES cells. Because the Brn4 gene
is X-linked, a single targeted allele of the Brn4 gene was
observed in the male R1 ES cell line (data not shown). Of 535 ES cell
clones that were isolated after selection in G418 and gancyclovir, only
one had undergone the appropriate targeting event. This ES cell clone
was introduced into C57BL/6J blastocysts, and chimeras with high levels
of contribution from the mutant ES cells were obtained. Germline
transmission of the X-linked null allele resulted in the generation of
heterozygous female animals (Fig. 1B). Hemizygous
null male animals were then generated by mating the heterozygous female
mice to C57BL/6J male animals (Fig. 1B).
Expression of a lacZ reporter gene introduced into the mutant
Brn4 allele
The targeted insertional mutation was designed so that the
Brn4-coding sequences were replaced by the lacZ reporter
gene. This experimental approach allowed us to follow the expression pattern of the mutant allele in both heterozygous female and hemizygous null male animals. Our analyses indicated that the transcriptional regulation of the mutant allele corresponded precisely with the expression domain of the endogenous Brn4 gene. To illustrate
the expression domain of the Brn4 gene, Figure
2 depicts preparations of embryos
containing a mutant Brn4 knock-out allele that have been
stained for lacZ expression.
View larger version (132K):
[in this window]
[in a new window]
|
Figure 2.
LacZ expression in mutant animals. Mutant embryos
were stained with X-gal to visualize the expression of the lacZ gene,
which was inserted into the Brn4 locus during the
generation of the knock-out allele. Unless specified otherwise the
embryos are oriented with rostral to the right and
dorsal toward the top. A, The whole-mount
preparation of a chimeric founder animal that corresponds to an 11.5 dpc embryo (chimeric embryos are developmentally delayed for ~1 day
because of experimental manipulation of the blastocysts). The
expression of lacZ recapitulates precisely the pattern of endogenous
Brn4 gene expression detected by hybridization
histochemical analyses (Le Moine and Young, 1992; Mathis et al., 1992;
Alvarez-Bolado et al., 1995; Phippard et al., 1998). Expression is
found throughout most of the neuraxis and in a handful of mesodermally
derived tissues in the head, including the otic capsule (white
arrow), a small population of first branchial arch mesenchyme
(black arrow), and the lateral nasal recess
(black arrowhead). B, A parasagittal
vibratome section (150 µm) through the otic vesicle of a 9.5 dpc
embryo. Expression of lacZ is not detected in the mesenchyme
surrounding the otic vesicle (black arrow), which lies
dorsal to the branchial arches. However, expression is detected
in the hindbrain of these embryos. C, A parasagittal
vibratome section through the otic vesicle of a 10.5 dpc embryo.
Expression of lacZ is detected in the condensing mesenchyme of the otic
vesicle (black arrow), which lies ventral to the otic
vesicle at this stage of embryogenesis. In this panel,
the black arrow indicates the dorsal-ventral
axis, with dorsal corresponding to the upper
right-hand corner of the panel.
D, Expression patterns of lacZ in a parasagittal section
of a 14.5 dpc embryo. At this stage of development, lacZ expression is
detected throughout the otic capsule but not in the otic epithelium
(some regions of the otic epithelium appear blue,
because they are covered with lacZ staining the otic capsule in these
thick vibratome sections). BA, Branchial arches;
HB, hindbrain; OV, otic vesicle.
|
|
At 9.5 dpc, the inner ear is just beginning to form as a hollow sphere
of epithelial tissue, referred to as the otic vesicle (Fig.
2B, black arrow). The Brn4 gene
is not yet expressed in the developing inner ear but is broadly
expressed throughout most of the neural tube (Fig.
2A,B). Initial activation of
Brn4 gene expression in the inner ear is detected at 10.5 dpc in the condensing mesenchyme of the otic capsule (Fig.
2C). Molecular signals from the otic vesicle induce
surrounding mesenchyme to aggregate or condense to form the otic
capsule (McPhee and Van de Water, 1986). The otic capsule represents
the first stages in the formation of the temporal bone and will
eventually give rise to the ossified and cartilaginous structures of
the inner ear. These ossified and cartilaginous structures eventually
encase the sensory and epithelial components of the inner ear, which
are referred to as the membranous labyrinth. As the otic capsule
develops, the mesenchyme surrounding the otic vesicle becomes
progressively condensed and ultimately completely encapsulates the
epithelial components of the developing inner ear. By 12.5 dpc, the
Brn4 gene is expressed throughout the otic capsule, and this
expression pattern is consistent with a role for Brn-4 in the
regulation of inner ear formation.
Behavioral characteristics of the mutant mice
Animals with null mutations in the Brn4 locus
demonstrated four behavioral phenotypes: (1) vertical head bobbing, (2)
changes in gait, (3) reduced whisker mobility, and (4) hearing loss.
Each of these phenotypes is consistent with malformations of structures that express the Brn4 gene, namely, the inner ear, the
whisker follicles, and the neural tube (Phippard et al., 1998) (A. Heydemann and E. B. Crenshaw III, unpublished observations). The
degree of vertical head bobbing is variable but was detected in the
vast majority of the null mutants. The reduction in whisker mobility was observed as the mice probed their environment. In normal mice, the
whiskers were moved in a sweeping motion when the animals explored
their environment. In the mutant mice, the whiskers, which were reduced
in size, did not demonstrate the typical sweeping motion and seldom moved.
As illustrated in Figure 3, we detected a
hearing loss in the null Brn4 mutants, which was determined
by an analysis of the auditory startle (Preyer's) reflex. The mean SPL
that elicited the threshold level of a Preyer's reflex in wild-type
littermates was 62 ± 3.1 dB SPL (n = 12).
The mutant animals, however, elicited a reflex threshold at 71 ± 3.6 dB SPL (n = 12). A one-tailed Student's t test for independent groups demonstrated that these data
were highly significant (p < 0.00001). The
Preyer's reflex estimate of hearing provides us with only a crude
assessment of auditory sensitivity. Preyer's reflex thresholds tend to
be insensitive relative to other threshold estimates (e.g., operant
conditioning techniques), and the broad-based stimulus used provides us
with limited information on threshold loss at different frequencies. Nevertheless, the reflex assessments of hearing were completely reliable over numerous replications with the same animal, from animal
to animal, and from observer to observer. From the observations summarized in Figure 3, we have concluded that hearing loss was fully
penetrant in the mutant animals.
View larger version (31K):
[in this window]
[in a new window]
|
Figure 3.
Preyer's reflex in Brn4 knock-out
(KO) mutants. The Brn4 null
mutants demonstrate approximately a 10 dB SPL hearing loss in
comparison with that in wild-type littermates, as assessed by Preyer's
reflex. Wild-type animals, 62 ± 3.1 dB SPL (n = 12). Brn4 null mutants, 71 ± 3.6 dB SPL
(n = 12). Error bars represent SD. The Preyer's
reflex threshold is measured in decibels SPL relative to a standard of
20 µPa. One-tailed Student's t test,
p < 0.00001. If female animals are excluded from
the comparison, then the wild-type male animals demonstrate a threshold
of 62 ± 3.3 dB SPL (n = 9). Furthermore,
there is no statistically significant difference in the threshold
between male and female animals, whether they are mutant or wild type
(data not shown).
|
|
Malformation of the stapes in the mutant mice
One of the major malformations contributing to hearing loss in
human patients with mutations in the human Brn4 ortholog is stapes fixation. This is a condition resulting in reduced stapes movements in the oval window, which compromises sound conduction through the middle ear ossicular system. For this reason, we examined, in detail, the stapes of Brn4 null mice. Figure
4 illustrates that the most profound
malformations in the mutant stapes occur in the footplate region. The
stapes normally conducts vibrational energy to the oval window and,
subsequently, produces sound pressure waves in the cochlea that lead to
hair cell transduction. The stapes footplate lies in the oval window,
and the morphology and area of the footplate affect the efficiency with
which sound energy is transmitted into the cochlear fluids. The normal
footplate displays a convex surface (Fig.
4A,C), whereas the surface of the
mutant is flattened (Fig. 4B,D).
When the sole of the normal stapes footplate is examined, it displays a
rounded, but slightly eccentric, ovoid morphology (Fig.
4E). The mutant footplate, however, typically
displays a more polygonal morphology, with a marked narrowing on one
end (Fig. 4F). Additionally, the stapes from the
mutant animals are generally thinner than are those of the normal
stapes (data not shown). The other ossicular bones, the incus and
malleus, appeared normal in the mutant animals (data not shown).
View larger version (75K):
[in this window]
[in a new window]
|
Figure 4.
Malformations of the stapes observed in
Brn4 null mice. The stapes of the mutant animals
demonstrate several malformations, particularly in the stapedial
footplate. A, C, E,
Wild-type stapes are depicted. B, D,
F, Mutant stapes are depicted. A,
B, The footplate of the stapes (arrow in
A) in mutant embryos (B) is
flatter in comparison with that in wild-type stapes
(A). C, D, A
lateral view of the stapes demonstrates that the crus from which the
stapedial ligament is attached is thinner in the mutant animals
(D) than in the wild-type animals
(C). E, F,
Examination of the sole of the stapes footplate illustrates the
slightly eccentric ovoid shape of the wild-type footplate
(E). The mutant footplate adopts a more polygonal
shape with an acutely angled tip on one end of the footplate
(arrow in F). Stapes
(n = 10) isolated from six mutant male animals were
examined. Wild-type stapes (n = 15) were examined
from eight male animals, including six wild-type littermates, two males
from the inbred strain 129/SvJ, and two CBA/2J male animals.
|
|
Malformations of the cochlea in the mutant mice
Histological analyses demonstrated that adult cochleae from the
Brn4 mutant mice had several dysplastic features (Fig.
5). Midmodiolar sections demonstrated the
overall hypoplasia of the cochlea (Fig.
5A,B). This hypoplasia was most
obvious in the basal turn and primarily resulted from a change in the
scala tympani. The scala tympani of normal mice, which lies inferior to
the organ of Corti, is ovoid in the basal turn of the cochlea (Fig.
5C). However, in the mutant cochlea, the scala tympani
adopts a more flattened elliptical shape with an apparent reduction in
volume (Fig. 5D). Figure 5 depicts the typical reduction in
size of the scala tympani and scala vestibuli in the mutant animals,
but a few animals display a severe phenotype in which the scala tympani cross section is reduced by approximately one-half to one-third (data
not shown). An additional component of the cochlear hypoplasia results
from a reduction in the coiling, or number of turns, of the cochlea.
This hypoplastic phenotype is demonstrated both in midmodiolar sections
of the cochlea (Fig. 5) and in cleared temporal bone preparations (Fig.
6). Midmodiolar sections of normal
cochleae typically reveal cross sections through the organ of Corti at three different levels with an additional cross section near the apical
end of this structure, the helicotrema (Fig. 5A,
arrow). Midmodiolar sections of the mutant cochlea reveal a
fewer number of cochlear turns (Fig. 5B). The reduction in
cochlear coiling was most evident in cleared temporal bone
preparations, which provide direct visualization of the cochlear
morphology in whole mount (Fig. 6). The normal mouse cochlea consists
of one and three-fourth turns, as shown in Figure 6A
(Sher, 1971). Approximately 60% of the mutant cochleae show a
reduction in the number of turns to one and one-half turns (Fig.
6B). However, ~1/4th of the cochlea demonstrated
even fewer turns, with the least amount of coiling being a three-fourth
turn (~15% of the cochleae examined). Only 1/10th of the mutant
cochleae examined demonstrated the normal one and three-fourth turns.
Even when comparing the left and right bony labyrinths from the same
animal, we observed variability in the number of turns (Fig.
6B,C). Heterozygous female animals contained the normal one and three-fourth turns and were
indistinguishable from wild-type animals.
View larger version (156K):
[in this window]
[in a new window]
|
Figure 5.
Brn4 knock-out mutants demonstrate cochlear
dysplasias in adult mice. B, D,
Midmodiolar sections from an adult (6-week-old) Brn4
hemizygous null mutant are shown. A, C,
Similar sections from a wild-type littermate are shown.
A, B, The cochlea of the mutant mouse
(B) demonstrates an overall hypoplastic structure
compared with that of the wild-type animal (A).
The arrow in A indicates the most apical
turn of the normal cochlea, which is rarely detected in similar
sections of the mutant animal. C, D, The
scala tympani of the mutant mouse (D) is
flattened and elliptical in comparison with that of the wild-type
control mouse (C). Additionally, Reissner's
membrane displays the distended morphology seen in D in
the mutant embryos, consistent with a hydrops condition in the mutant
animals. In all cases examined, similar phenotypes were found in
homozygous knock-out female animals (data not shown).
OC, Organ of Corti; RM, Reissner's
membrane; SG, spiral ganglion; SL, spiral
limbus; SM, scala media; ST, scala
tympani; SV, scala vestibuli. Scale bars:
A, B, 300 µm; C,
D, 200 µm.
|
|
View larger version (67K):
[in this window]
[in a new window]
|
Figure 6.
Cleared temporal bone preparations demonstrate
cochlear hypoplasia. Temporal bone preparations were perfused through
the oval window with white paint to visualize cochlear morphology.
Cochleae are oriented such that the apical turn is at the
top of the photograph, as indicated by the
arrow in B. A, A cochlea
from a wild-type animal with one and three-fourth turns is shown.
B, C, Mutant cochlea displayed a reduced
number of turns, which could vary between less than one complete turn
to one and one-half turns. Additionally, the amount of coiling can
differ between left and right cochlea of the same mutant animal. For
example, C demonstrates the right cochlea of a
homozygous knock-out female animal, which has less than one coil. By
contrast, B demonstrates the left cochlea of the same
animal, which has one and one-half turns.
|
|
Histological analyses of the organ of Corti did not demonstrate
gross abnormalities in the number or morphology of sensory hair cells
(data not shown). However, a supporting structure for the organ of
Corti, the spiral limbus, does show a reduction in size (Fig.
7A,B).
To quantitate this reduction, we have measured the height of the spiral
limbus in the basal turn of the cochlea. The mean spiral limbus height
in the wild-type animals was 91 µm with an SD of 11 µm
(n = 10); in null male hemizygotes, the height was
75 ± 12 µm (n = 6). An additional phenotype in
the cochlea of Brn4 mutant animals included the fibrocytes
of the spiral ligament, which appear thinner and less
adherent to one another than do those in the wild-type mouse (Fig.
7C,D). This results in acellular spaces within
the region where the fibrocytes normally underlie the stria vascularis.
Reissner's membrane often appears to be less tightly adherent to the
fibrocytes in the mutant than in the wild-type mouse. These fibrocytes
provide structural support for the stria vascularis, which regulates
the ionic composition of the endolymph that bathes the organ of Corti.
This malformation could compromise the function of the stria
vascularis, leading to increased pressure or hydrops in the inner ear.
In fact, all of the mutant animals examined (n = 12)
appear to have hydrops, which is diagnosed by a distension of
Reissner's membrane (Fig. 5D).
View larger version (122K):
[in this window]
[in a new window]
|
Figure 7.
Histological analysis of spiral
limbus and strial fibrocyte dysplasias. B,
D, Midmodiolar sections from an adult (6-week-old)
Brn4 hemizygous null mutant are shown. A,
C, Similar sections from a wild-type littermate are
shown. A, B, This view demonstrates that
the spiral limbus of mutant animals (B) is
smaller than that detected in the wild-type animals
(A). The height of the spiral limbus was
calculated by drawing a baseline (height = 0) at the widest part
of the spiral limbus from the tympanic lip of the internal spiral
sulcus to the point where the spiral limbus meets the bony wall of the
cochlea (see arrowheads in B).
Measurements were made from photomicrographs, and the highest point
attained by the interdental cells at the crest of the spiral limbus was
measured in a plane perpendicular to the baseline. An additional aspect
of the mutant phenotype seen in this figure includes acellular gaps
that are often detected between the spiral ganglion cells of the
mutants and the modiolus (arrow in B). In
wild-type animals, such an acellular gap is rarely detected
(B). C, D, This
view demonstrates that the strial fibrocytes are not tightly
adher-ent in the mutant (D) compared with
the wild-type (C) mouse. This phenotype was fully
penetrant in all 12 mutant animals examined. F,
Fibrocytes; RM, Reissner's membrane; SV,
stria vascularis. Scale bars: A, B, 50 µm; C, D, 20 µm.
|
|
Additional features of the mutant phenotype sometimes include an
incomplete fasciculation of the vestibuloacoustic nerve, as it enters
the basal turn of the cochlea (data not shown). The apparent loss of
cohesiveness of this nerve may be caused by the increased size of the
internal auditory meatus, which conveys the nerve through the
temporal bone.
Malformations of the temporal bone in Brn4
null mutants
Because Brn4 is highly expressed throughout the
anlage of the temporal bone, we examined the morphology of this bone in
adult mutant animals (Fig. 8). The major
external malformations that occur in the temporal bone result from
enlargement of the internal auditory meatus. In rodents, this meatus
consists of three foramina through which the auditory (VIII) nerve and
facial (VII) nerve are conveyed through the temporal bone to the
brainstem (Curthoys, 1981). The largest of these cavities contains the
type I and II auditory nerve fibers, which originate at the auditory
hair cells, have their cell bodies in the spiral ganglion, and have
nerve fibers that project from the cochlea through the central axis or
modiolus. The two smaller foramina convey the motor fibers of
the facial (VII) nerve through the temporal bone and allow the
vestibular component of the VIII nerve to communicate with the
vestibular nuclei. All three foramina are enlarged in the mutant
animals (Fig. 8).
View larger version (98K):
[in this window]
[in a new window]
|
Figure 8.
Malformations of the temporal bone in
Brn4 null mice. Analysis of whole-mount preparations of
adult temporal bone demonstrates dysplasia of the three foramina of the
internal auditory meatus. A, C,
E, A wild-type temporal bone is depicted.
B, D, F, A mutant temporal
bone is depicted. A, B, A medial view of
the temporal bone demonstrates that the bony tissue appears thinner in
the mutant (B) than in the wild type
(A). The bone encompassing the superior
semicircular canal is thinner in the mutant than in the wild-type
animal (arrow), and the rostromedial ridge of the
temporal bone is thinner in the mutant (arrowhead).
C, D, The cochlear foramen of the
internal auditory meatus (IAM) is enlarged in the mutant
(D) animal when compared with that in the
wild-type animal. E, F, The second and
third foramen of the mutant IAM (F) appear to be
fused (arrow) when compared with that in the wild type
(E). Scale bars: A,
B, 1 mm; C-F, 0.5 mm.
|
|
We have observed additional malformations of the temporal bone, which
include (1) thinning of the lateral wall of the subarcuate fossa, which
houses the lateral aspect of the cerebellum (data not shown), (2)
thinning of the bone encompassing the superior semicircular canal (Fig.
8A,B), and (3) reduction in the
size of the rostromedial ridge of the temporal bone (Fig.
8A,B). In each of these cases, the
malformations appear to result from a reduction in the thickness of the
bone. This observation is consistent with the hypothesis that the
Brn4 gene may be necessary for the survival of mesenchymal
cells during the extensive mesenchymal remodeling that occurs during
development of the otic capsule (Phippard et al., 1998).
Malformations of the superior semicircular canals are observed in
Brn4 null animals
Because the vertical head-bobbing phenotype in the mutant mice
implies that the vestibular system is not functioning properly, we have
examined the anatomy of the vestibular apparatus in greater detail. We
consistently observed a constriction in the bony labyrinth encompassing
the superior semicircular canals in the Brn4 null mice,
which is ~40% of the size of the wild-type superior semicircular canals (Fig. 9). Therefore, both the
thickness of the bone encompassing the superior semicircular canal and
the perilymphatic space encompassing the canal are reduced in size
(Figs. 8A,B, 9). The orientation of
the superior semicircular canal within the cranium is approximately parallel with the major body axis, and therefore, a dysfunctional superior semicircular canal would most easily explain the vertical nature of the head-bobbing phenotype. We have not observed
malformations in the posterior semicircular canals in the
Brn4 null mutants. However, the lateral semicircular canal
shows a constriction or dysplastic phenotype in 4 of the 15 animals
examined. Because the Brn4 gene is expressed throughout the
otic capsule during development, it is not clear why any of the canals
should be differentially sensitive to the loss of Brn4 gene
function. In heterozygous female animals, the superior semicircular
canals were identical in size to that in wild-type animals (data not
shown). These data indicate that a constriction of the semicircular
canal results in compromised vestibular function in the mutant animals.
Furthermore, the correlation of the orientation plane of the superior
semicircular and the vertical motion of the head-bobbing phenotype
suggests that the dysplastic superior canal is the major dysfunctional
component of the vestibular apparatus in the Brn4 null
animals.
View larger version (91K):
[in this window]
[in a new window]
|
Figure 9.
Constriction of the superior semicircular canal in
Brn4 null mice. Temporal bone preparations were filled with
latex paint and cleared in methyl salicylate to examine the structure
of the bony labyrinth. A, Medial view of the left
superior semicircular canal of a heterozygous female animal. The
specimen is oriented with anterior to the right and
dorsal toward the top of the photograph.
B, The left superior semicircular canal of a homozygous
female knock-out animal. The arrow indicates the typical
constriction in the most dorsal extent of the superior semicircular
canal. The narrowest constriction points of the mutant canals are
~2.5 times smaller than are those of the wild-type mice. Scale bar,
300 µm.
|
|
| |
DISCUSSION |
Mice lacking the POU-domain transcription factor Brn-4 showed
several malformations in the development of the inner ear. Many of
these malformations are detected in inner ear structures derived from
mesenchymal origins, which express the Brn4 gene. These
malformations included structures, such as the scala tympani and the
internal auditory meatus, that are derived from the otic capsule.
Malformations in the mutant animals resulted in functional deficits in
the adult mutant animals, including hearing loss and head bobbing.
These mutant phenotypes suggest that Brn4 is crucial for the
proper morphogenesis of both the auditory and vestibular systems of the inner ear.
The widespread distribution of defects in the inner ear correlated with
the expression of Brn-4 throughout most of otic mesenchyme during
development (Phippard et al., 1998). Brn4 gene expression was activated simultaneously with the initial mesenchymal condensation events that formed the otic capsule, suggesting the Brn4
gene is induced by the same factors that regulate otic capsule
formation. Later in embryogenesis, Brn4 gene expression is
found throughout the otic capsule. Many of the defects found in the
mutant mice are a result of reduced bone formation, including enlarged
foramina of the internal auditory meatus and thinning of bone in the
subarcuate fossa. These observations suggest that the Brn4
gene is required for the proliferation or differentiation of temporal
bone tissue. This conclusion is consistent with the role that has been
demonstrated for another member of the POU-domain gene family,
Pit1, which plays a crucial role in the regulation of
proliferation and differentiation of the anterior pituitary gland (Li
et al., 1990; Lin et al., 1992).
Not all of the malformations in the mutant animals were restricted
exclusively to defects in otic mesenchyme. For example, the reduction
in the number of turns of the cochlea suggests that dysplastic changes
in the morphogenetic movements of the otic epithelia occur. Figure
10A-C illustrates
the morphogenetic movements of the otic epithelia that are required to
generate cochlear coiling. Formation of the cochlea is initiated as a
tubular outgrowth of the pars inferior of the otic epithelium. This
outgrowth forms the cochlear duct that coils within the surrounding
otic mesenchymeto give the overall "snail-shaped" appearance of
the cochlea. In the Brn4 mutant mice, none of the cochleae
that we examined had attained the correct number of turns, and some of
the mutants demonstrated a severe reduction in cochlear coiling (Fig.
6C). Because we have not detected the expression of
Brn4 in the otic epithelium, it seems likely that the
coiling defect occurs because of phenotypic changes within the otic
mesenchyme itself. These phenotypic changes could result from the
disruption of cell signaling between the mesenchyme and epithelium.
Alternatively, defective remodeling of the mesenchyme could impede the
coiling of the cochlear duct by preventing the outgrowth of the tubular
duct process. The absence of Brn-4 may be interfering with the signals
required for epithelial-mesenchymal interaction such that the
mesenchyme is not remodeled and the extension of the cochlear duct is
physically blocked.
View larger version (41K):
[in this window]
[in a new window]
|
Figure 10.
Schematic illustration of development of the
cochlea. A-C, The formation of the
coiled form of the cochlea during embryogenesis is depicted. These
schematics illustrate the morphogenetic changes in the
epithelial sac that is derived from the otic vesicle. The illustrated
morphogenetic movements all occur within the surrounding condensed
mesenchyme of the otic capsule, which expresses the Brn4
gene. A, Formation of the cochlea is initiated by a
tubular outgrowth of the pars inferior (ventral region) of the otic
vesicle. B, Further extension of this tubular outgrowth
gives rise to the cochlear duct. C, The cochlear duct
coils progressively during development to give rise ultimately to one
and three-fourth turns in the mouse, whereas the adjacent region of the
otic just superior to the cochlea becomes the saccule (Sher, 1971;
Morsli et al., 1998). The cochlear duct is the anlage of the middle
fluid-filled sound-conducting chamber in the cochlea, referred to as
the scala media. D-F, The mesenchymal
remodeling of the otic capsule that gives rise to the two additional
sound conduction compartments in the cochlea, the scala vestibuli and
the scala tympani, is depicted. These panels depict a
cross section through the cochlear duct. D, When the
cochlear duct is initially formed, it is surrounded by the condensed
mesenchyme of the otic capsule. E, The scala tympani and
the scala vestibuli are formed by cavitation of the otic capsule. A
time point during which these compartments are cavitating but are still
filled with trabeculae of mesenchymal material is depicted in
E. F, Illustration of the adult cochlea
depicts the fully formed scala vestibuli and scala tympani. Both of
these structures exhibit defects in the Brn4 mutant
animals. This figure was schematized on the basis of figures found in
Langman (1982) and modified to reflect mouse development more
accurately.
|
|
Malformations in structures that result from mesenchymal remodeling of
the otic capsule constitute the major class of abnormalities observed
in Brn4 null animals. For example, remodeling of the otic
mesenchyme surrounding the cochlear duct is necessary to generate two
acellular fluid-filled chambers in the adult cochlea, the scala
vestibuli and the scala tympani (Fig. 10D-F).
These chambers, which are malformed in the mutant animals, are
generated by cavitation or vacuolization of the otic mesenchyme
(Langman, 1982). We suggest that the appropriate regulation of the
Brn-4 factor within the otic mesenchyme is necessary for the
mesenchymal remodeling that leads to the formation of the scala
vestibuli and the scala tympani. This hypothesis is further supported
by the observation that Brn-4 subcellular localization is regulated in
regions of the otic capsule that undergo mesenchymal remodeling during
embryogenesis (Phippard et al., 1998). In regions of the otic capsule
that will form bone in the adult, the Brn-4 transcription factor
retains a nuclear subcellular localization. However, in regions of the
otic capsule that will be eliminated to form acellular caverns within
the temporal bone, Brn-4 shifts from a nuclear to a
perinuclear/cytoplasmic subcellular localization, suggesting that the
ability of this transcription factor to function is downregulated in
these regions. This shift in subcellular localization occurs in the
foramen of the internal auditory meatus and the perilymphatic
compartments of the cochlea. Most regions of the inner ear that
demonstrated regulation of Brn-4 subcellular localization also
demonstrate defects in Brn4 null mutants.
The defects demonstrated in the Brn4 null animals have been
observed in human patients with mutations in the human Brn4
ortholog POU3F4. These patients exhibited hypoplasia of the cochlea, an enlarged internal auditory meatus, and stapes fixation (de Kok et al.,
1995a; Piussan et al., 1995). These pathologies suggest an evolutionary
conservation of Brn-4 function in mammals. Interestingly, several
differences can be noted between the mouse mutant and the human
patients. First, the human patients demonstrate profound sensorineural
deafness, arising from the loss of spiral ganglion cells in the
cochlea. Although the mutant mice showed some hearing loss, it was mild
compared with that of the human patients. To date, we have not observed
any signs of sensorineural deafness in young animals. A more extensive
analysis of sensorineural hearing loss in older animals is complicated
by the fact that the genetic background (C57BL/6J) leads to age-onset
sensorineural deafness. We are currently backcrossing the
Brn4 mutation onto a different genetic background (CBA/J)
that does not have age-onset hearing loss (for review, see Willott,
1996). The second difference between human and mouse mutants is found
in the stapes. Stapes fixation clearly contributes to the conductive
hearing loss of the patients. Although the stapes does exhibit
malformations in the mutant embryos, we have yet to observe stapes
fixation in dissected temporal bone preparations of transgenic mice.
The differences with regard to the stapes may represent subtle
differences in the size, morphology, and ontogeny of the human stapes
when compared with that of the mouse.
Although defects were observed in the stapes of Brn4 null
animals, Brn4 gene expression is not observed in the
developing stapes (Phippard et al., 1998), which is formed from a
mesenchymal condensation event that occurs adjacent to the otic
capsule. Brn4 gene expression was observed, however, in
those regions of the otic capsule that lie adjacent to the developing
stapes from which the oval window develops. It is essential for the
footplate of the stapes to sit in an appropriate manner in the oval
window. Efficient sound conduction occurs when the footplate is firmly attached to the annular ligament and can move freely. Therefore, it
seems likely that inductive signals from the otic capsule are required
for the proper formation of the stapes and its positioning in the oval
window. Further analyses of the mutant embryos may provide insight into
the mesenchymal-mesenchymal signals necessary to coordinate the
formation and orientation of the stapes and the oval window.
Interestingly, we did not see malformations of the inner ear in
heterozygous female animals. Because of X chromosome inactivation, one
would expect the inner ears of the heterozygous females to comprise a
mosaic of cells with one-half expressing the functional Brn4
allele and the other half expressing the knock-out allele. The anatomy
of the temporal bones of heterozygous females was qualitatively
unaffected. Also, all quantitative analyses examined, such as size of
the superior semicircular canal and the number of cochlear turns, were
identical to that of wild-type animals. One possible explanation is
that cells that do not express the Brn4 gene are regulated
by those neighboring cells that express a functional Brn4
allele. Alternatively, regulatory mechanisms within the cells that
contain the null Brn4 allele may have induced the expression
of the Brn4 gene on the inactive X chromosome. Additional
studies will be required to distinguish these hypotheses.
Despite the widespread expression of Brn-4 throughout the neural
tube, we have not observed any defects in the development or function
of the CNS (D. Phippard and E. B. Crenshaw III, unpublished observations). A likely explanation for this observation is that other
POU-domain factors, including closely related members of the POU-domain
subclass III, are also expressed widely in the neural tube, suggesting
functional redundancy of these genes during neural tube ontogeny. All
members of this subclass are broadly expressed throughout the neural
tube during embryogenesis but show restricted domains of expression in
late fetal and adult animals (He et al., 1989). As seen in the
Brn4 mutants, the targeted disruption of the POU-domain
subclass III members Brn2/Pou3f2 and Tst1/Pou3f3
demonstrated rather restricted phenotypes in comparison with their
broad domains of expression (Nakai et al., 1995; Schonemann et al.,
1995; Bermingham et al., 1996). In fact, the defects in targeted
disruptions of this subclass tended to be restricted to the regions of
the CNS in which they showed expression patterns unique from that of
other subclass members. For example, the targeted disruption of the
Tst1 gene demonstrated defects in glial cells and the
LOTN region of the brainstem (Bermingham et al., 1996). Additionally, the defects tended to occur in cells in which the POU-domain gene was expressed in late fetal and adult stages. For
example, the defects in the Brn2 mutants resulted in
malformations of the hypothalamic nuclei that express the
Brn2 gene in the adult (Nakai et al., 1995; Schonemann et
al., 1995). In toto, these data strongly suggest that POU-domain
factors are functionally redundant during neural tube development.
In conclusion, the absence of Brn-4 expression seems to affect three
different properties of otic mesenchyme: (1) mesenchymal remodeling
that is necessary to generate structures such as the scala tympani, (2)
epithelial-mesenchymal interactions that are required to form the
cochlear coils, and (3) mesenchymal-mesenchymal interactions that are
necessary for the coordinated formation of the oval window and the
stapes. The Brn4 gene is a useful marker gene for the
formation of the otic mesenchyme, as well as a critical factor in
pattern formation of the developing inner ear. Further analyses of the
underlying processes that regulate the Brn4 gene as well as
its role during inner ear development will provide insight into the
molecular mechanisms of inner ear ontogeny.
| |
FOOTNOTES |
Received Dec. 10, 1998; revised April 22, 1999; accepted April 27, 1999.
This work was supported by National Institutes of Health Grant
R01 NS-31674 and the March of Dimes Basil O'Connor Starter Scholar
Award. We would like to thank Emily Howard, Tony Caggiano, and Jeff
Neul with help generating the knock-out construct; Drs. Andras Nagy and
J. Rossant for the R1 ES cells; Dr. John Bermingham for the pTKAB'
vector; and Dr. M. A. Rudnicki for the PGK-TK plasmid.
Correspondence should be addressed to Dr. E. Bryan Crenshaw III,
Department of Neuroscience, University of Pennsylvania, Philadelphia, PA 19104-6074.
| |
REFERENCES |
-
Alvarez-Bolado G,
Rosenfeld MG,
Swanson LW
(1995)
Model of forebrain regionalization based on spatiotemporal patterns of POU-III homeobox gene expression, birthdates, and morphological features.
J Comp Neurol
355:237-295[Web of Science][Medline].
-
Bermingham JR,
Scherer SS,
O'Connell S,
Arroyo E,
Kalla KA,
Powell FL,
Rosenfeld MG
(1996)
Tst-1/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration.
Genes Dev
10:1751-1762[Abstract/Free Full Text].
-
Curthoys IS
(1981)
Scarpa's ganglion in the rat and guinea pig.
Acta Otolaryngol (Stockh)
92:107-113[Medline].
-
de Kok YJ,
Merkx GF,
van der Maarel SM,
Huber I,
Malcolm S,
Ropers HH,
Cremers FP
(1995a)
A duplication/paracentric inversion associated with familial X-linked deafness (DFN3) suggests the presence of a regulatory element more than 400 kb upstream of the POU3F4 gene.
Hum Mol Genet
4:2145-2150[Abstract/Free Full Text].
-
de Kok YJ,
van der Maarel SM,
Bitner-Glindzicz M,
Huber I,
Monaco AP,
Malcolm S,
Pembrey ME,
Ropers HH,
Cremers FP
(1995b)
Association between X-linked mixed deafness and mutations in the POU domain gene POU3F4.
Science
267:685-688[Abstract/Free Full Text].
-
Deol MS
(1966)
Influence of the neural tube on the differentiation of the inner ear in the mammalian embryo.
Nature
209:219-220[Medline].
-
Erkman L,
McEvilly RJ,
Luo L,
Ryan AK,
Hooshmand F,
O'Connell SM,
Keithley EM,
Rapaport DH,
Ryan AF,
Rosenfeld MG
(1996)
Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development.
Nature
381:603-606[Medline].
-
Fay RR
(1988)
In: Hearing in vertebrates: a psychophysics data book, pp 367-369. Winnetka, IL: Hill-Fay.
-
Fekete DM
(1996)
Cell fate specification in the inner ear.
Curr Opin Neurobiol
6:533-541[Web of Science][Medline].
-
Frenz DA,
Van de Water TR
(1991)
Epithelial control of periotic mesenchyme chondrogenesis.
Dev Biol
144:38-46[Web of Science][Medline].
-
He X,
Treacy MN,
Simmons DM,
Ingraham HA,
Swanson LW,
Rosenfeld MG
(1989)
Expression of a large family of POU-domain regulatory genes in mammalian brain development.
Nature
340:35-41[Medline][Erratum (1989) 340:662].
-
Herr W,
Cleary MA
(1995)
The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain.
Genes Dev
9:1679-1693[Free Full Text].
-
Hogan B,
Beddington R,
Costantini F,
Lacy E
(1994)
In: Manipulating the mouse embryo: a laboratory manual. Plainview, NY: Cold Spring Harbor Laboratory.
-
Joyner AL
(1993)
Gene targeting.
In: The practical approach series (Rickwood D,
Hames BD,
eds), p 234. New York: Oxford UP.
-
Langman J
(1982)
In: Medical embryology. Baltimore: Williams and Wilkins.
-
Le Moine C,
Young WS
(1992)
RHS2, a POU domain-containing gene, and its expression in developing and adult rat.
Proc Natl Acad Sci USA
89:3285-3289[Abstract/Free Full Text].
-
Lewis ER,
Leverenz EL,
Bialek WS
(1985)
In: The vertebrate inner ear. Boca Raton, FL: CRC.
-
Li S,
Crenshaw EB,
Rawson EJ,
Simmons DM,
Swanson LW,
Rosenfeld MG
(1990)
Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1.
Nature
347:528-533[Medline].
-
Lin C,
Lin SC,
Chang CP,
Rosenfeld MG
(1992)
Pit-1-dependent expression of the receptor for growth hormone releasing factor mediates pituitary cell growth [see comments].
Nature
360:765-768[Medline].
-
Mathis JM,
Simmons DM,
He X,
Swanson LW,
Rosenfeld MG
(1992)
Brain 4: a novel mammalian POU domain transcription factor exhibiting restricted brain specific expression.
EMBO J
7:2551-2561.
-
McPhee JR,
Van de Water TR
(1986)
Epithelial-mesenchymal tissue interactions guiding otic capsule formation: the role of the otocyst.
J Embryol Exp Morphol
97:1-24[Web of Science][Medline].
-
Morsli H,
Choo D,
Ryan A,
Johnson R,
Wu DK
(1998)
Development of the mouse inner ear and origin of its sensory organs.
J Neurosci
18:3327-3335[Abstract/Free Full Text].
-
Nakai S,
Kawano H,
Yudate T,
Nishi M,
Kuno J,
Nagata A,
Jishage K,
Hamada H,
Fujii H,
Kawamura K,
Shiba K,
Noda T.
(1995)
The POU domain transcription factor Brn-2 is required for the determination of specific neuronal lineages in the hypothalamus of the mouse.
Genes Dev
9:3109-3121[Abstract/Free Full Text].
-
Noden DM,
Van de Water TR
(1986)
The developing ear: tissue origins and interactions.
In: The biology of change in otolaryngology (Ruben RW,
ed), pp 15-46. Oxford, UK: Elsevier.
-
Noden DM,
Van de Water TR
(1992)
Genetic analyses of mammalian ear development [review].
Trends Neurosci
15:235-237[Web of Science][Medline].
-
Peck JE
(1994)
Development of hearing. Part II. Embryology.
J Am Acad Audiol
5:359-365[Medline].
-
Peters PW
(1977)
Double staining of fetal skeletons for cartilage and bone.
In: Methods in prenatal toxicology (Neubert D,
ed), pp 153-154. Stuttgart, Germany: Thieme.
-
Phippard DJ,
Heydemann A,
Lechner M,
Lu L,
Lee D,
Kyin T,
Crenshaw III EB
(1998)
Changes in the subcellular localization of the Brn4 gene product precede mesenchymal remodeling of the otic capsule.
Hear Res
120:77-85[Web of Science][Medline].
-
Piussan C,
Hanauer A,
Dahl N,
Mathieu M,
Kolski C,
Biancalana V,
Heyberger S,
Strunski V
(1995)
X-linked progressive mixed deafness: a new microdeletion that involves a more proximal region in Xq21.
Am J Hum Genet
56:224-230[Web of Science][Medline].
-
Ryan AK,
Rosenfeld MG
(1997)
POU domain family values: flexibility, partnerships, and developmental codes.
Genes Dev
11:1207-1225[Free Full Text].
-
Schonemann MD,
Ryan AK,
McEvilly RJ,
O'Connell SM,
Arias CA,
Kalla KA,
Li P,
Sawchenko PE,
Rosenfeld MG
(1995)
Development and survival of the endocrine hypothalamus and posterior pituitary gland requires the neuronal POU domain factor Brn-2.
Genes Dev
9:3122-3135[Abstract/Free Full Text].
-
Sher AE
(1971)
The embryonic and postnatal development of the inner ear of the mouse.
Acta Otolaryngol Suppl (Stockh)
285:1-77.
-
Smith SD
(1995)
Overview of genetic auditory syndromes [review].
J Am Acad Audiol
6:1-14[Medline].
-
Steel KP,
Brown SD
(1994)
Genes and deafness [review].
Trends Genet
10:428-435[Web of Science][Medline].
-
Theiler K
(1989)
In: The house mouse: atlas of embryonic development, Second Edition. New York: Springer.
-
Willott JF
(1996)
Anatomic and physiologic aging: a behavioral neuroscience perspective.
J Am Acad Audiol
7:141-151[Medline].
-
Xiang M,
Gan L,
Zhou L,
Klein WH,
Nathans J
(1996)
Targeted deletion of the mouse POU domain gene Brn-3a causes selective loss of neurons in the brainstem and trigeminal ganglion, uncoordinated limb movement, and impaired suckling.
Proc Natl Acad Sci USA
93:11950-11955[Abstract/Free Full Text].
-
Xiang M,
Gan L,
Li D,
Chen ZY,
Zhou L,
O'Malley Jr BW,
Klein W,
Nathans J
(1997)
Essential role of POU-domain factor Brn-3c in auditory and vestibular hair cell development.
Proc Natl Acad Sci USA
94:9445-9450[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19145980-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
H. K. Lee, M. H. Song, M. Kang, J. T. Lee, K.-A. Kong, S.-J. Choi, K. Y. Lee, H. Venselaar, G. Vriend, W.-S. Lee, et al.
Clinical and molecular characterizations of novel POU3F4 mutations reveal that DFN3 is due to null function of POU3F4 protein
Physiol Genomics,
November 1, 2009;
39(3):
195 - 201.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Yamamoto, T. Okano, X. Ma, R. S. Adelstein, and M. W. Kelley
Myosin II regulates extension, growth and patterning in the mammalian cochlear duct
Development,
June 15, 2009;
136(12):
1977 - 1986.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P.-Y. Wang, A. Protheroe, A. N. Clarkson, F. Imhoff, K. Koishi, and I. S. McLennan
Mullerian inhibiting substance contributes to sex-linked biases in the brain and behavior
PNAS,
April 28, 2009;
106(17):
7203 - 7208.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Batista-Brito, R. Machold, C. Klein, and G. Fishell
Gene Expression in Cortical Interneuron Precursors is Prescient of their Mature Function
Cereb Cortex,
October 1, 2008;
18(10):
2306 - 2317.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Chen, M. Montcouquiol, R. Calderon, N. A. Jenkins, N. G. Copeland, M. W. Kelley, and K. Noben-Trauth
Jxc1/Sobp, Encoding a Nuclear Zinc Finger Protein, Is Critical for Cochlear Growth, Cell Fate, and Patterning of the Organ of Corti
J. Neurosci.,
June 25, 2008;
28(26):
6633 - 6641.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-O. Trowe, H. Maier, M. Schweizer, and A. Kispert
Deafness in mice lacking the T-box transcription factor Tbx18 in otic fibrocytes
Development,
May 1, 2008;
135(9):
1725 - 1734.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Manoussaki, R. S. Chadwick, D. R. Ketten, J. Arruda, E. K. Dimitriadis, and J. T. O'Malley
The influence of cochlear shape on low-frequency hearing
PNAS,
April 22, 2008;
105(16):
6162 - 6166.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. S. Arnold, E. M. Braunstein, T. Ohyama, A. K. Groves, J. C. Adams, M. C. Brown, and B. E. Morrow
Tissue-specific roles of Tbx1 in the development of the outer, middle and inner ear, defective in 22q11DS patients
Hum. Mol. Genet.,
May 15, 2006;
15(10):
1629 - 1639.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Wang, T. Liu, Z. Li, X. Ma, and T. Jin
Redundant and Synergistic Effect of Cdx-2 and Brn-4 on Regulating Proglucagon Gene Expression
Endocrinology,
April 1, 2006;
147(4):
1950 - 1958.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Qin, L. Wine-Lee, K. J. Ahn, and E. B. Crenshaw III
Genetic Analyses Demonstrate That Bone Morphogenetic Protein Signaling Is Required for Embryonic Cerebellar Development
J. Neurosci.,
February 15, 2006;
26(7):
1896 - 1905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Jones, M. Montcouquiol, A. Dabdoub, C. Woods, and M. W. Kelley
Inhibitors of Differentiation and DNA Binding (Ids) Regulate Math1 and Hair Cell Formation during the Development of the Organ of Corti
J. Neurosci.,
January 11, 2006;
26(2):
550 - 558.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Bok, M. Bronner-Fraser, and D. K. Wu
Role of the hindbrain in dorsoventral but not anteroposterior axial specification of the inner ear
Development,
May 1, 2005;
132(9):
2115 - 2124.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. E. Sobol, X. Teng, and E. B. Crenshaw III
Abnormal Mesenchymal Differentiation in the Superior Semicircular Canal of Brn4/Pou3f4 Knockout Mice
Arch Otolaryngol Head Neck Surg,
January 1, 2005;
131(1):
41 - 45.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Wine-Lee, K. J. Ahn, R. D. Richardson, Y. Mishina, K. M. Lyons, and E. B. Crenshaw III
Signaling through BMP type 1 receptors is required for development of interneuron cell types in the dorsal spinal cord
Development,
November 1, 2004;
131(21):
5393 - 5403.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Andl, K. Ahn, A. Kairo, E. Y. Chu, L. Wine-Lee, S. T. Reddy, N. J. Croft, J. A. Cebra-Thomas, D. Metzger, P. Chambon, et al.
Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development
Development,
May 15, 2004;
131(10):
2257 - 2268.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. M. Riccomagno, L. Martinu, M. Mulheisen, D. K. Wu, and D. J. Epstein
Specification of the mammalian cochlea is dependent on Sonic hedgehog
Genes & Dev.,
September 15, 2002;
16(18):
2365 - 2378.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Heller
Application of physiological genomics to the study of hearing disorders
J. Physiol.,
August 15, 2002;
543(1):
3 - 12.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. C. Morton
Genetics, genomics and gene discovery in the auditory system
Hum. Mol. Genet.,
May 15, 2002;
11(10):
1229 - 1240.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Ahn, Y. Mishina, M. C. Hanks, R. R. Behringer, and E. B. Crenshaw III
BMPR-IA signaling is required for the formation of the apical ectodermal ridge and dorsal-ventral patterning of the limb
Development,
November 15, 2001;
128(22):
4449 - 4461.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Cho, J. Mu, J. K. Kim, J. L. Thorvaldsen, Q. Chu, E. B. Crenshaw III, K. H. Kaestner, M. S. Bartolomei, G. I. Shulman, and M. J. Birnbaum
Insulin Resistance and a Diabetes Mellitus-Like Syndrome in Mice Lacking the Protein Kinase Akt2 (PKBbeta )
Science,
June 1, 2001;
292(5522):
1728 - 1731.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Andersen and M. G. Rosenfeld
POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease
Endocr. Rev.,
February 1, 2001;
22(1):
2 - 35.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. Cantos, L. K. Cole, D. Acampora, A. Simeone, and D. K. Wu
Patterning of the mammalian cochlea
PNAS,
October 24, 2000;
97(22):
11707 - 11713.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Boyd, H. J. Blair, P. Cunliffe, W. K. Masson, and V. Reed
A Phenotype Map of the Mouse X Chromosome: Models for Human X-linked Disease
Genome Res.,
March 1, 2000;
10(3):
277 - 292.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
D. Phippard, Y. Boyd, V. Reed, G. Fisher, W. K. Masson, E. P. Evans, J. C. Saunders, and E. B. Crenshaw III
The sex-linked fidget mutation abolishes Brn4/Pou3f4 gene expression in the embryonic inner ear
Hum. Mol. Genet.,
January 1, 2000;
9(1):
79 - 85.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cohen-Salmon, D. Frenz, W. Liu, E. Verpy, S. Voegeling, and C. Petit
Fdp, a New Fibrocyte-derived Protein Related to MIA/CD-RAP, Has an in Vitro Effect on the Early Differentiation of the Inner Ear Mesenchyme
J. Biol. Chem.,
December 15, 2000;
275(51):
40036 - 40041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
