 |
 Previous Article | Next Article 
The Journal of Neuroscience, August 1, 1999, 19(15):6338-6347
Expression and Branch-Specific Export of mRNA Are Regulated
by Synapse Formation and Interaction with Specific
Postsynaptic Targets
Samuel
Schacher1,
Fang
Wu1,
John D.
Panyko1,
Zhong-Yi
Sun1, and
Denong
Wang2
1 Center for Neurobiology and Behavior and
2 Genome Center, Columbia University College of Physicians
and Surgeons and New York State Psychiatric Institute, New York, New
York 10032
 |
ABSTRACT |
Mechanosensory neurons (SNs) of Aplysia form
synapses in culture with some targets (L7), but not others (L11), even
when a SN is plated with both targets. We examined whether
branch-specific net export of mRNA encoding synapse-specific molecules
might contribute to branch-specific synapse formation. Single-cell
RT-PCR was used to assay levels of mRNA encoding the SN-specific
neuropeptide (sensorin A) and other transcripts in cell bodies and
neuritic processes of SNs cultured alone or with synaptic targets. Some mRNAs are exported to neurites, but not others. Sensorin A mRNA is
detected only in SN cell bodies and neurites, and expression levels
correlate with the strength of the synaptic connections formed with L7
after 4 d in culture. After 4 d, more sensorin A transcripts
are detected in SN neurites contacting L7 than in SN neurites
contacting L11. The differential expression at 4 d is found even
when a single SN contacts both targets simultaneously. By contrast, no
significant difference in expression is detected in SN neurites
contacting L7 versus L11 after 1 d of coculture. The results
suggest that interaction and synapse formation with a specific target
lead to a time-dependent change in the branch-specific accumulation of
sensorin A mRNA in SNs. Because local protein synthesis at synaptic
sites might contribute to synaptic function or plasticity, the results
suggest that branch-specific targeting of mRNA encoding synapse-related
molecules may contribute to the formation of specific synapses.
Key words:
synapse formation; specificity; gene expression; mRNA
export; RT-PCR; cell culture; Aplysia
| |
INTRODUCTION |
The correct wiring of the CNS is
believed to result from a multistep process involving axon guidance,
target selection, and fine tuning of connectivity via
activity-dependent mechanisms. In some circumstances individual neurons
undergo branch-specific synapse formation and elimination
simultaneously. Local signals, diffusible or cell surface molecules,
may modulate synapse formation or elimination (for review, see Cabelli
et al., 1997 ; Fitzsimonds and Poo, 1998; Sanes et al., 1998; Winberg et
al., 1998). How do these signals mediate the long-term maintenance of
one set of synaptic connections and the decline in efficacy or
elimination of others in the same neuron? One potential mechanism is
that local signals modulate the synthesis and targeting of
macrocmolecules required for synapse formation or maintenance. Although
some intrinsic signals could instruct region-specific
segregation nucleus versus cytoplasm, basal versus apical surfaces of
various cells, or axons versus dendrites of neuronsit is unclear how
macromolecules might be segregated or targeted to specific regions
within a given structure.
Signals that modulate mRNA export or local translation could target
macromolecules to specific sites within pre- and/or postsynaptic elements of neurons (Martin et al., 1997; Steward et al., 1998; Wu et
al., 1998). The export of specific mRNAs into dendrites of vertebrate
neurons is well established (Crino and Eberwine, 1996; Knowles et al.,
1996; Steward, 1997). Axons of vertebrate neurons, during regeneration
in culture (Kleiman et al., 1994; Olink and Hollenbeck, 1996; Bassell
et al., 1998) and in the posterior pituitary (Mohr et al., 1991), also
contain specific mRNAs. Some mRNAs, including those encoding
neuropeptides and other proteins, are exported into axons of
invertebrate neurons (van Minnen, 1994). Isolated axons of invertebrate
neurons appear to have the machinery to synthesize proteins (van Minnen
et al., 1997), including the proteins required for new synapse
formation accompanying long-term synaptic plasticity (Martin et al.,
1997). Thus, local translation of exported mRNAs encoding
synapse-specific macromolecules may contribute to the formation or
maintenance of specific synapses.
The large identified neurons of Aplysia form specific
synapses in dissociated cell culture even when a presynaptic neuron is
confronted with multiple targets (Camardo et al., 1983; Schacher and
Montarolo, 1991; Hawver and Schacher, 1993; Casadio et al., 1997).
Contact with a synaptic target by a mechanosensory neuron (SN) leads to
expression of branch-specific morphological, physiological, and
biochemical features. These include the formation of varicosities with
active zones (Glanzman et al., 1989), expression of electrical excitability and synaptic plasticity (Sun and Schacher, 1996), and
expression of high levels of the neuropeptide sensorin A (Santarelli et
al., 1996; Casadio et al., 1997). The level of sensorin A peptide in
the SN branches contacting L7 correlates with changes in synaptic efficacy associated with new synapse formation, long-term facilitation with 5-HT, and long-term depression with FMRFamide.
Can branch-specific export of mRNAs contribute to branch-specific
synapse formation? To test this hypothesis, we combined single-cell
RT-PCR with the advantages of cell cultures consisting of individual
pre- and postsynaptic neurons plated either alone or in various
combinations. We confirmed that sensorin mRNA is expressed only in SNs
and found that some mRNAs, actin and sensorin A, are exported from the
cell body. Accumulation of sensorin A mRNA to SN terminals is regulated
by contact with an appropriate target (L7) with time in culture even
when branches of the same SN contact another target (L11) that fails to
induce synapse formation. The results support the idea that
branch-specific export or accumulation of mRNAs encoding
synapse-specific molecules may contribute to the formation or
maintenance of specific synapses.
| |
MATERIALS AND METHODS |
Cell culture and electrophysiology. Mechanosensory
neurons (SNs) were isolated from pleural ganglia dissected from adult
animals (80-100 gm); motor cell L7 and/or L11 were isolated from
juvenile (1-3 gm) abdominal ganglia and maintained in culture for 20 hr or 4 d as described previously (Schacher, 1985; Rayport and
Schacher, 1986; Schacher and Montarolo, 1991; Zhu et al., 1994).
Individual cells (SN, L7, and/or L11) were plated in the same culture
dish at very low density so that the cells did not contact each other (Fig. 1A). Cocultures
consisted of one SN with one L7 or one L11 (SN-L7 or SN-L11; Fig.
1B), one SN with two L7 (SN-L7/L7), and one SN with
one L7 and one L11 (SN-L7/L11; Fig. 1C) (see Martin et al.,
1997). Because each neuron was isolated from the rest of the nervous
system (Schacher, 1985), the glial cells typically did not contaminate
the cultures. Occasionally, a few glial cells were attached to the cell
body of L7 or L11. No glial cells were detected in the compartment
containing the distal axon and regenerated neurites.
View larger version (30K):
[in this window]
[in a new window]
|
Figure 1.
Compartments analyzed by RT-PCR. A,
Isolated cells maintained in culture. Two compartments were analyzed:
(1) Cell body and most proximal portion of axon and neurites
(CB) and (2) axon and regenerated neurites from axon
stump (N). In some experiments the neurite
compartment of a single SN was added to both compartments of a single
target cell cultured alone. B, Cocultures with SN
contacting L7 or L11. In some experiments three compartments were
analyzed: SN cell body (1), SN neurites
contacting cell body and proximal axon of the target
(2), and interacting neurites from both cells
(3). In other experiments compartments
2 and 3 were combined as one.
C, Cocultures with a SN contacting two targets (L7
and/or L11). Three compartments were analyzed: SN cell body
(1); SN neurites contacting axon, neurites, and
cell body of a L7 (2); and SN neurites contacting
another L7 or L11 (3).
|
|
Standard electrophysiological techniques were used to record the
amplitude of the EPSP evoked in L7 or L11 with the stimulation of each SN (Schacher and Montarolo, 1991; Sun and Schacher, 1996; Martin et al., 1997). The motor cells (L7 and L11) were impaled with a
microelectrode (resistance of 15-20 M ) containing 2.0 M
K-acetate, 0.5 M KCl, and 10 mM K-HEPES, pH
7.4, and held at  80 mV. Each SN was stimulated with a brief (0.3-0.5
msec) depolarizing pulse to evoke an action potential, using an
extracellular electrode placed near the cell body of the SN. The
amplitude of the EPSPs evoked in L7 ranged from 1 mV (day 1) to
42 mV (day 4). Action potentials in SNs never evoked EPSPs (<0.2 mV)
in L11 (data not shown) (see Glanzman et al., 1989; Schacher and
Montarolo, 1991).
Dissection of cellular compartments. Cultures were rinsed
with hemolymph-free medium (1:1 by volume of L15 plus Instant Ocean) and allowed to cool to 4°C for ~20 min. Bovine serum albumin (BSA; 10 µg/ml) was added to the final rinse to prevent dissected cell bodies and neurites from sticking to the dish surface or the transfer pipettes. Cellular compartments were dissected and transferred by using
the methods described previously (Ambron et al., 1985). For cells
plated alone in culture (Fig. 1A), we analyzed
expression in two compartments: (1) cell body plus 100-150 µm of
proximal axon and attached neurites (CB) and (2) distal axon plus
regenerated neurites emerging from axon stumps (N). In some instances
we combined the neuritic compartment (N) of an isolated SN with the
cell body and neuritic compartments (CB + N) of an isolated target
neuron. In cocultures of one SN and one target (L7 or L11) we analyzed the expression in three compartments; cell body and proximal axon (100-150 µm) of SN (1), cell body and proximal axon (100-150 µm) of the target (2), and interacting distal axons and neurites from both
cells (3; as shown in Fig. 1B). In some instances we
combined compartments 2 and 3 to measure the total export of sensorin A transcripts in SN neurites contacting the entire target. For cultures with one SN in contact with two targets (two L7s or one L7 plus one
L11) we dissected and analyzed three compartments: SN cell body and
proximal axons (100-150 µm beyond bifurcation; see compartment 1 in Fig. 1C), SN neurites interacting with one
target (see compartment 2 in Fig. 1C), and the
other target (see compartment 3 in Fig. 1C).
RT-PCR to detect expression of specific mRNAs. Each cell
compartment was transferred to 200 µl of Trizol (Life
Technologies, Gaithersburg, MD), and total RNA was isolated
after chloroform extraction and isopropanol precipitation. cDNA from
each sample was synthesized by using random hexamers as primers and
reverse transcriptase (Superscript II). Aliquots (2 µl) from each
sample were used to amplify specific fragments by PCR (40 cycles),
using specific primer sets for (1) SN-specific neuropeptide
sensorin A (Brunet et al., 1991), AACAGAAACAGTCTTTCCCC and
TCTTGACTCACCAACTGCC (nucleotides 43-331); (2) neuron-specific isoform
of actin (DesGroseillers et al., 1994), CAGAGAGAAGATGACCCAG and
GGGTAAGAGAAGCAAGAAAG (nucleotides 416-1298); (3) common extracellular
region for all isoforms of apCAM (Mayford et al., 1992),
AACAACACGAAGATCGAAG and TGTTCACAATGCCATCAG (nucleotides 528-1104); and
(4) molluscan 18S rRNA (Winnepenninckx et al., 1998),
AAAACCAATCGTCGTCTC and TTTTCGTCACTACCTCCC (nucleotides 197-477). The
lengths of the synthesized fragments detected with ethidium
bromide staining on 1.2% agarose gels were identical to those
predicted from the known sequences in the database. For semiquantitative comparison of mRNA expression, the number of PCR
cycles was adjusted initially to ensure linearity of the fluorescent signals of the fragments amplified by PCR (see Fig.
2B). Each PCR run included amplifications and the
detection of specific fragments from known cDNAs of known
concentrations (positive controls), amplifications of each fragment
from samples of medium collected near cells after removal of the cells
from the culture dish, and other negative controls.
Samples used for analysis had to meet the following criteria: (1) no
contamination of genomic DNA occurred in the initial RNA preparation
with PCR amplification of the RNA sample itself, (2) actin and rRNA
transcripts were detected within the linear range of the PCR
amplification in each compartment of the culture or coculture, and (3)
no fragments were detected after amplification of the cell culture
medium collected after dissections. To quantify differences in the
levels of sensorin A expression, we normalized staining intensity for
sensorin A fragments (%) by the signals obtained for actin fragments
in the same sample (staining intensity of sensorin A/staining intensity
of actin × 100) . We normalized sensorin A levels with actin
levels, because average staining intensity for actin fragment within
each compartment was not affected by cell interaction. METAMORPH
software package was used to quantify average pixel intensities for PCR
fragments in each compartment. Based on signals generated from known
concentrations of sensorin A cDNA (positive controls), a twofold
increase in staining intensity for sensorin A fragment equaled
approximately a fivefold increase in the starting cDNA levels (see Fig.
2B). Overall differences in expression were
calculated by ANOVAs (1 or 2 factors), and the significance of
differences between individual groups was measured with a
multicomparison test (Scheffé's F test).
| |
RESULTS |
After 4 d in culture the large Aplysia neurons
regenerate profusely (Schacher and Proshansky, 1983) and establish
stable synaptic connections (Montarolo et al., 1986; Rayport and
Schacher, 1986; Hawver and Schacher, 1993). Martin et al. (1997) found
that SN axons and regenerated neurites isolated from their cell bodies synthesize significant amounts of proteins (10-20% of total
synthesis). We therefore examined whether the axons and neurites of
single SN, L7, or L11 contain various transcripts. We measured levels of 18S rRNA to confirm that all compartments of identified neurons have
the capacity to translate mRNAs. We determined levels of actin mRNA,
because these transcripts are abundant and are exported from the cell
bodies of other neurons. We examined whether mRNA encoding a family of
membrane proteins (apCAMs) is transported. This family of proteins,
homologous to NCAM and fasciclin II, is the major membrane protein in
neurons, accounting for >10% of the total membrane protein in the CNS
of Aplysia (Keller and Schacher, 1990; Mayford et al.,
1992). We also determined whether the expression of a mRNA encoding a
potential secretory product, the SN-specific neuropeptide sensorin A
(Brunet et al., 1991), is regulated by interactions with specific
targets. Levels of sensorin A peptide detected in SN varicosities are
modulated with synapse formation and after treatments that evoke
long-term changes in synaptic efficacy (Santarelli et al., 1996;
Casadio et al., 1997).
Specific transcripts are exported from cell bodies of
Aplysia neurons
Not all transcripts are exported from the cell bodies of
Aplysia neurons. All cells contain 18S rRNA in both cell
body and neurites (Fig.
2A). The level of
expression of the rRNA fragment in the cell bodies reflects differences
in cell volume. The staining intensity of rRNA fragments in the cell
bodies of L7 and L11 is approximately equal, and the levels are
approximately two times greater than levels detected in the cell bodies
of SNs (n = 5 for each cell grown alone). A twofold
change in staining intensity equals approximately a fivefold change
in cDNA levels in the sample (Fig. 2B). The axons and
neurites from individual identified cells also contained transcripts
for some mRNAs (Fig. 2A). Actin transcripts were
detected in the neuritic compartment of all of the cells that were
examined. By contrast, apCAM transcripts were detected only in the cell
bodies of SN, L7, and L11. As expected, transcripts for sensorin A were
detected in SNs only and also were exported to SN axons and
neurites.
View larger version (52K):
[in this window]
[in a new window]
|
Figure 2.
Detection of RNA in cell compartments by
RT-PCR. A, Selective transcripts are exported, and
sensorin A transcripts are expressed only in SNs. Shown is ethidium
bromide staining of PCR fragments separated on 1.2% agarose gel.
Fragments of appropriate lengths were amplified after 40 cycles with
primer sets for sensorin A, 18S rRNA, actin, and apCAM by using two
separate sets of samples from 4-d-old cultures of SN,
L7, and L11 plated alone. Each cell was
separated into two compartments, cell body (CB) or
neurites (N). Actin and rRNA were detected in
both compartments, whereas isoforms of apCAMs are detected only in the
CB compartment. Sensorin A transcripts were detected only in the SNs
and expressed in both CB and neurite compartments. B,
PCR amplification is linear. Staining intensity of PCR fragments
decreases with decreasing concentrations of cDNA in the sample. A
50-fold difference in cDNA levels (undiluted sample equals 100, and
negative control is 0) can be resolved for the three mRNAs and the
rRNA. If we normalize the highest concentration (100) as
1, the staining levels for the other concentrations (in descending
order) are as follows: 0.58, 0.24, and 0.12 for sensorin A
(n = 3); 0.52, 0.32, and 0.15 for apCAM
(n = 3); 0.54, 0.28, and 0.16 for actin
(n = 3); 0.49, 0.32, and 0.18 for rRNA
(n = 3).
|
|
Expression and export of sensorin A mRNA are correlated with
presence of synapses on day 4
We next explored whether the expression of the SN-specific
transcript is influenced by interaction with specific targets. Cocultures (SN-L7 and SN-L11) were prepared by placing the axon stump
of a SN close to the axons of the targets, were allowed to regenerate
for 4 d to form stable connections (Fig.
3), and then were examined for the
presence of synaptic connections. As expected, all SN-L11 cultures had
no synaptic connections, and all SN-L7 cultures formed connections.
The amplitude of the EPSPs ranged from 3 to >40 mV. In one set of
cultures we assayed the expression of rRNA and mRNAs in three
compartments (Figs. 1B, 3). In other cultures we
assayed the expression of sensorin A and actin transcripts in two
compartments: SN cell body and SN neurites contacting cell body and
processes of the target cell (see compartments 2 and
3 in Fig. 1B). We also measured the
expression of sensorin A and actin transcripts in the cell body and
neurites of SNs cultured alone.
View larger version (70K):
[in this window]
[in a new window]
|
Figure 3.
Dissection of cellular compartments for RT-PCR
analyses. Shown are Nomarski contrast images of coculture before each
dissection. Cell bodies or neuritic processes are detached from the
substrate and transferred to tubes with Trizol. A,
SN-L7 (A1) and SN-L11
(A2) cultures after 4 d
before SN axons are cut (arrows). B, Same
SN-L7 (B1) and SN-L11
(B2) cultures before target cell
axon is cut (arrows). C, Remaining cell
bodies and neurites before their detachment and transfer into Trizol.
Each compartment is analyzed by RT-PCR. Scale bar, 60 µm.
|
|
The expression of sensorin A transcripts in SNs correlated with the
amplitude of the EPSP evoked in L7 (Fig.
4). As EPSP amplitude increased, there
was a corresponding increase in the staining intensity of the PCR
fragment for sensorin A in both the SN cell body and neuritic
compartments (Fig. 4A,B, respectively). Staining intensity for actin fragments in the SN cell body did not correlate with EPSP amplitude (R2 = 0.08;
p > 0.3). There was a correlation between EPSP
amplitude and staining intensity for sensorin A PCR fragments in the SN cell body (R2 = 0.35;
p < 0.02; Fig. 4C) and a stronger
correlation between EPSP amplitude and staining intensity for sensorin
A PCR fragments in SN neurites contacting L7
(R2 = 0.79; p < 0.001; Fig. 4D). By contrast, staining intensity for
actin fragments in the same samples containing combined neurites of SN
and L7 did not correlate with EPSP amplitude
(R2 = 0.01; p > 0.8).
View larger version (19K):
[in this window]
[in a new window]
|
Figure 4.
Expression of sensorin A transcripts in SNs
correlates with synaptic efficacy. A, C,
EPSP amplitude correlates with the expression of sensorin transcripts
in SN cell bodies. Staining intensity of actin fragments amplified from
SN cell bodies is not correlated with EPSP amplitude. Normalized levels
of sensorin A fragment (y-axis = staining
intensity of sensorin A/staining intensity of actin × 100) in the SN
cell body (compartment 1 in Fig.
1B) are correlated with EPSP amplitude
(R2 = 0.35;
n = 15; p < 0.02).
B, D, EPSP amplitude correlates with
expression of sensorin A transcripts in SN neurites. Staining intensity
of actin fragments in the neuritic compartments does not correlate with
EPSP amplitude. Normalized levels of sensorin A fragment amplified in
the SN neurites interacting with axons and neurites of L7 (compartment
3 in Fig. 1B) correlate with EPSP
amplitude (R2 = 0.79;
n = 15; p < 0.001).
|
|
We next compared expression of sensorin A transcripts in SNs contacting
L7 to expression in SNs contacting L11 (Fig.
5). As expected, rRNA and actin
transcripts were present in all compartments, whereas apCAM transcripts
were present in cell bodies only (Fig. 5A). The compartments
with SN neurites interacting with cell body or processes of L7
contained sensorin A mRNA. By contrast, few sensorin A PCR fragments
were detected in SN neurites interacting with cell body and processes
of L11 (Fig. 5A). All SN cell bodies contained sensorin A
transcripts. There was no significant effect of target interaction on
the average level of sensorin A transcripts in SN cell bodies (ANOVA;
F = 0.278; p > 0.75; Fig.
5B). On average, staining intensity for sensorin A PCR
fragments within SN cell bodies ranged from 40 to 45% of the staining
intensity detected for actin PCR fragments. By contrast, there was
significantly greater staining for sensorin A fragments in SN neurites
contacting L7 (Scheffé's F = 3.241;
p < 0.05) and significantly less staining of sensorin
A fragments in SN neurites contacting L11 (Scheffé's F = 2.981; p < 0.05) as compared with
that detected in neurites of SNs plated alone (Fig. 5B).
Overall, absolute staining intensity for sensorin A PCR fragments in SN
neurites contacting L7 was more than twofold greater than staining
intensity in neurites of SNs plated alone (pixel intensity of 85.6 ± 15.2 vs 40.6 ± 7.9). Staining intensity in SN neurites
contacting L11 was <50% of the staining levels detected in SNs
neurites plated alone (18.3 ± 4.9 vs 40.6 ± 7.9). Thus,
target interaction can either enhance or depress net export of sensorin
A transcripts to SN neurites and varicosities. Moreover, net export of
sensorin A transcripts correlates with synaptic efficacy.
View larger version (46K):
[in this window]
[in a new window]
|
Figure 5.
Export of sensorin A transcripts is modulated by
target in 4 d cultures. A, RT-PCR fragments
amplified from samples prepared from the cell bodies of SNs
(SCB), SN neurites interacting with axons and neurites
of the target (N), and SN neurites interacting
with the cell body and proximal axon of the target motor cells
(MCB) from two sets of SN-L11 and SN-L7 cocultures.
Fragments were synthesized with specific primers for sensorin A, actin,
apCAM (all isoforms), and 18S rRNA. Note that sensorin A and actin mRNA
were exported to neurites whereas apCAM was not. Little sensorin A was
detected in the neurites of SN contacting the neuritic arbor or cell
body of L11, compared with the signal obtained in the neurites of SN
contacting the neuritic arbor and cell body of L7. B,
Target-dependent modulation of levels of sensorin transcripts in SN
neurites (normalized to the level of actin transcripts in each
compartment). Two compartments were analyzed: SN cell body
(CB) and neurites of SN interacting with the entire
target cell (NEUR). The neurite compartment of SN alone
consisted of the neurites of a single SN combined with the cell body
and neuritic arbor of a single target cell grown alone. Interaction
with a target (n = 7 cultures for each condition)
had no significant effect on the normalized expression of sensorin A
transcripts in the SN cell bodies (see Results). By contrast, the
expression of sensorin transcripts in the SN neurites was modulated
both up and down (ANOVA; df = 2, 18; F = 7.397; p < 0.007).
|
|
Branch-specific expression of sensorin A transcripts is regulated
by targets on day 4
We next examined whether net export of sensorin A mRNA is
regulated in different branches of a single SN. We isolated SNs with
bifurcate axons and plated a target neuron next to the distal stump of
each branch. In some cultures we plated a L7 at each SN branch (Fig.
6A), whereas at other
cultures we plated a L7 at one branch and a L11 at the other (Fig.
6B). As expected, stimulation of the SN evoked EPSPs
in L7, but not in L11. Each culture was dissected into three
compartments: SN cell body and proximal axons, SN neurites interacting
with one target, and SN neurites interacting with the other (see Fig.
1C).
View larger version (68K):
[in this window]
[in a new window]
|
Figure 6.
SN with bifurcate axon establishes separate sets
of contact with two targets in culture. Shown are Nomarski contrast
views of a single SN with two branches (extending left
and right) contacting two targets after 4 d in
culture. A, SN contacting two L7 motor cells
(SN-L7/L7). Scale bar, 50 µm.
B, SN contacting a L7 and a L11
(SN-L7/L11). Scale bar, 70 µm. Three compartments
were analyzed by RT-PCR: the cell body and proximal axon of the SN
(SN; see compartment 1 in Fig.
1C) and SN neurites from each branch interacting with
the cell body, axons, and neurites of each target (compartments
2 and 3 in Fig. 1C).
|
|
Overall expression of sensorin A transcripts in cell bodies of SNs was
not affected significantly by the presence of two L7 targets versus one
L7 and one L11 (SN lanes in Fig.
7A; p > 0.5). A significant difference was observed in the levels of sensorin A
transcripts detected in the neurites of different SN branches (n = 7 cultures; Fig. 7B). Whereas all SN
neurites contacting L7 expressed sensorin A transcripts (L7
lanes in Fig. 7A), little or no expression of sensorin
A transcripts was detected in SN neurites contacting L11 (L11
lanes in Fig. 7A). There was approximately a fourfold
difference in the staining intensity of sensorin A PCR fragments in SN
neurites contacting L7 versus neurites of the same SN contacting L11
(Scheffé's F = 3.869; p < 0.04). By contrast, equivalent staining of sensorin A PCR fragments was detected in the SN neurites contacting each L7 target (Fig.
7A,C; n = 7 cultures; p > 0.7).
View larger version (35K):
[in this window]
[in a new window]
|
Figure 7.
The target regulates branch-specific export of
sensorin A transcripts. A, Sensorin A fragments
amplified from SN cell bodies (SN) and their
neurites interacting with each target in two sets of SN-L7/L11 and
SN-L7/L7 cocultures (see Fig. 1C). Little sensorin A
mRNA was detected in neurites of SN contacting L11 cell body or
neurites. B, C, Differential export in
SN-L7/L11 cultures, but not in SN-L7/L7 cultures. After staining
intensity for sensorin A to that obtained for actin in each sample was
normalized, sensorin A staining of SN neurites contacting L7 was, on
average, 3.5× greater than the staining intensity obtained for SN
neurites interacting with L11 (B). The level of
sensorin A mRNA fragments in SN neurites interacting with each L7 was
not significantly different (C).
|
|
Target- and branch-specific differences in mRNA levels develop
over time
Under the culture conditions used, SNs establish synaptic
connections with L7 by 12 hr (Zhu et al., 1994). By 20 hr, SN neurites extend over the major processes of L7 and form numerous varicosities (Zhu et al., 1994), and the new synaptic connections express some forms
of short-term synaptic plasticity (Sun and Schacher, 1996). The
efficacy of these connections increases with time in culture and
reaches a stable level by 4 d (Glanzman et al., 1989; Zhu et al.,
1994). We examined whether target- or branch-specific differences in
the levels of sensorin A transcripts were expressed at these earlier
stages of synapse formation (20 hr). We assayed for sensorin A
transcripts in the neurites of SNs contacting L7 or L11 in cocultures
with a single target (Fig. 8) and in
cocultures in which a single SN contacts both targets (Fig.
9).
View larger version (36K):
[in this window]
[in a new window]
|
Figure 8.
Level of sensorin A transcripts in SN neurites is
not modulated by target in 20 hr cultures. A, RT-PCR
fragments amplified from samples prepared from the cell bodies of SNs
(SCB), interacting neurites (N),
and SN neurites combined with the cell body and proximal axon of the
target motor cells (MCB) from two sets of
SN-L11 and SN-L7 cocultures. Fragments
were synthesized with specific primers for sensorin A and actin. Unlike
the situation on day 4, sensorin A was detected in the neurites of SN
contacting either the neurites of L11 or L7. Little or no signal was
detected in SN neurites contacting the cell bodies of L11 or L7. After
20 hr in culture, neuritic growth from SN typically was restricted to a
small region of the target as compared with overall growth by day 4 (Zhu et al., 1994; Sun and Schacher, 1996). B, Absence
of modulation of levels of sensorin transcripts in SN neurites
(normalized to level of actin transcripts in each compartment) at 20 hr
in culture. Two compartments were analyzed: the SN cell body
(CB) and neurites of SN contacting the target cell
(NEUR).
|
|
View larger version (31K):
[in this window]
[in a new window]
|
Figure 9.
The target fails to regulate branch-specific
accumulation of sensorin A transcripts after 20 hr in culture.
A, Sensorin A and actin mRNA fragments amplified from SN
cell body (SN) and SN neurites interacting with
each target (L7 or L11) in four sets of
SN-L7/L11 cultures. In most cases (75%) sensorin A mRNA was detected
in neurites of SN contacting either L7 or L11. B,
Absence of branch-specific accumulation after 20 hr. Shown are
normalized levels of sensorin A mRNA in SN neurites interacting with L7
versus SN neurites of the same cell interacting with L11.
|
|
After 20 hr the stimulation of the SN evoked EPSPs in L7 ranging from 1 to 16 mV. No responses were evoked in L11. There was no significant
target-dependent difference in the level of actin or sensorin A
transcripts in the cell bodies of SNs (Fig. 8; p > 0.6 and 0.5, respectively). Although average expression of sensorin A
transcripts in SN neurites contacting L7 (n = 6 cultures) was greater than the level in SN neurites contacting L11
(n = 6 cultures; Fig. 8B), we failed
to detect a significant difference (p > 0.4) in
the level of sensorin A transcripts in SN neurites contacting L7 versus
L11. There was no significant difference (p > 0.3) in the level of sensorin A transcripts in branches contacting L7 versus L11 when SN contacted both targets simultaneously (SN-L7/L11; Fig. 9; n = 12 cultures). Although some SN-L11
neuritic contacts showed very low levels of staining (one of six
SN-L11 cultures and three of 12 SN-L7/L11 cultures), the remaining
samples expressed levels that are comparable to those expressed in SN
neurites contacting L7 (Figs. 8A, 9A). For
example, the level of sensorin A mRNA in SN neurites contacting L7 was
greater than that detected in neurites of the same SN contacting L11 in
all cases on day 4 (seven of seven). By contrast, in 50% of the
cultures on day 1, SN neurites contacting L11 expressed sensorin A mRNA
at levels that either matched or were greater than those expressed in
SN neurites contacting L7. In the remaining three cultures, SN neurites
contacting L11 expressed sensorin A transcripts at a slightly lower
level than that expressed by SN neurites of the same SN contacting L7.
Overall, absolute staining intensity for sensorin A fragments in SN
neurites contacting L7 on day 1 was comparable to staining intensity in neurites of SNs contacting L11 (pixel intensity of 45.8 ± 5.5 vs
35.4 ± 2.7). Thus, modulations in the net export and targeting of
sensorin A transcripts to SN terminals contacting appropriate postsynaptic targets develop over time in culture.
| |
DISCUSSION |
The results indicate that rRNA and selected mRNAs are exported
from the cell bodies of Aplysia neurons, regenerating and
forming synaptic connections in culture. Net export of a mRNA expressed only in the presynaptic SN is modulated by target- and branch-specific interactions.
The export of selected mRNAs into both dendritic and axonal
compartments of vertebrate neurons has been observed during early stages of regeneration in cell culture (Kleiman et al., 1994; Olink and
Hollenbeck, 1996; Bassell et al., 1998). Actin mRNA, a transcript
synthesized in abundance by regenerating cells, is exported into the
axons and regenerated neurites of SNs, L7, and L11. As is the case for
mRNA encoding neuropeptides expressed in both vertebrates and
invertebrates (Mohr et al., 1991; van Minnen, 1994), we also found that
mRNA encoding a putative neurosecretory product that is expressed
exclusively in SNs of Aplysia (Brunet et al., 1991;
Santarelli et al., 1996) is expressed only in SNs and is exported to
regenerated neurites and terminals of SNs. By contrast, the mRNAs
encoding the isoforms of apCAM (Mayford et al., 1992) are expressed in
the cell bodies of SNs and motor cells at levels comparable to those
detected for actin but are not detected with our methods in axons and
regenerated neurites of cells in culture for 4 d. Sequence and
structure information within individual transcripts synthesized in
Aplysia neurons is likely to mediate selective export to
distal processes (Wilhelm and Vale, 1993; St. Johnston, 1995; Wallace
et al., 1998) via the formation of mRNA-protein complexes that
interact with cytoskeletal components of the transport apparatus
(Wilhelm and Vale, 1993; Knowles et al., 1996; Bassell and Singer,
1997; Oleynikov and Singer, 1998). Alternatively, many mRNAs are
exported but most are degraded, whereas others are protected from
degradation by their specific interactions with cytoskeletal or
cytoplasmic proteins and accumulate in distal processes (Cooperstock
and Lipshitz, 1997).
We also found that the level of sensorin A transcripts in the neuritic
compartments of SNs contacting L7 increases with time and is highly
correlated with the amplitude of the EPSP evoked in L7 on day 4. These
results together with earlier findingsSN varicosities contacting L7
contain active zones for transmitter release, and the number and size
of SN varicosities increase with time and correlate with EPSP amplitude
(Glanzman et al., 1989, 1990; Schacher and Montarolo, 1991; Zhu et al.,
1994)suggest that exported sensorin A mRNA may accumulate at or near
SN varicosities that have formed synaptic contacts with targets. The
accumulation of mRNA at these sites would parallel the sites of
accumulation for sensorin A neuropeptide, where expression levels of
the peptide also correlate with synaptic efficacy (Santarelli et al.,
1996). The correlation of sensorin A expression (mRNA and peptide) with EPSP amplitude was observed, although one of the sensorin peptides can
evoke hyperpolarizations in some motor neurons (Brunet et al., 1991).
The nature of the responses in L7 evoked by all peptides derived from
the sensorin A precursor and the potential role of the sensorin
peptides in synapse formation remain to be determined.
Is the sensorin A mRNA exported to SN neurites and varicosities
translated, and is the translated product functional? Recent studies of
Martin et al. (1997) indicate that mRNA in isolated SN neurites can
serve as a source for protein synthesis and that the local synthesis
regulated by neuromodulators such as 5-HT can contribute to changes in
synaptic efficacy and the formation of new varicosities. However, it is
not known whether sensorin A neuropeptides are synthesized in isolated
SN neurites or whether the locally synthesized peptides are packaged
for activity- or calcium-dependent release. The packaging of local
translated products into membranous organelles would require additional
synthetic machinery in the distal neurites and varicosities, including
the attachment of polyribosomes to endoplasmic reticulum (ER) and subsequent processing. Although ER-like structures are detected at
synaptic sites (Bailey et al., 1979), the presence of rough ER and of
other components required for packaging locally translated peptides
into vesicles is unknown.
Target signals modulate both up and down the net export of sensorin A
transcripts to SN neurites by day 4 in culture when the efficacy of the
connection and the number of varicosities are stable. Compared with the
level detected in SN neurites maintained in culture without any
contact, the level of sensorin A transcripts in SN neurites contacting
L7 is enhanced, whereas the level detected in SN neurites contacting
L11 is reduced. This suggests that retrograde signals from both
postsynaptic targets modulate the net export of sensorin A transcripts
into neurites of the presynaptic SN. Although the nature of the signals
is not known, the enhancing signals from L7 may be similar to those
that influence other L7-dependent enhancements evoked in SN: the number
of neurites and varicosities, varicosities with active zones, and
neuropeptide expression (Glanzman et al., 1989; Schacher and Montarolo,
1991; Santarelli et al., 1996). By contrast, the signal from L11 is
likely to be a separate inhibitory factor and not simply the absence of
factors produced by L7, because (1) net export of sensorin A
transcripts is lower than that found for SNs alone and (2) the neuritic
arbor of SNs contacting L11 has varicosities and neurites for which the
numbers are intermediate of those observed for SN neurites contacting L7 versus no target at all (Glanzman et al., 1989; Schacher and Montarolo, 1991). If the numbers of SN neurites and varicosities were
the critical factors affecting the accumulation of sensorin A
transcripts, SN neurites contacting L11 should express intermediate levels of sensorin A transcripts.
Signals from the targets appear to affect net export of sensorin A
transcripts by acting locally on SN neurites and terminals. When a
single SN contacts two L7 cells via a bifurcate axon, equivalent levels
of sensorin A transcripts are detected in the terminal neurites
contacting each target. By contrast, when a single SN contacts both L7
and L11, the net export to the neurites contacting L7 after 4 d in
culture is significantly greater than the export in the other branch
for which the neurites contact L11. These results, coupled with the
correlation between EPSP amplitude and net export of sensorin A
transcripts to SN neurites (see above), suggest that the target-derived
signals from L7 or L11 can influence net accumulation and targeting of
exported sensorin A mRNA at distal neurites on day 4. Moreover, they
suggest that the inhibitory signals from L11 are less likely to depress
initial packaging and export from the cell body. If the latter
mechanism only were operative, we would predict a lower level of
expression in the SN neurites contacting L7 when the other SN branch
contacts an L11 as compared with expression of sensorin transcripts
when each SN branch contacts a L7. This does not appear to be the case
(see Fig. 7). The data, however, do not rule out the possibility that a
separate signal from L7 also affects packaging and export from the SN
cell body. The absolute level of sensorin A transcripts exported into
neurites contacting L7 increases with time in culture. This signal,
coupled with other local positive and inhibitory signals affecting
transport or accumulation, can influence the net export at different
branches and sites (Knowles and Kosik, 1997; Chicurel et al., 1998;
Steward et al., 1998).
The target-dependent influences on net export of sensorin A transcripts
develop over time. Although SNs form synapses selectively after 20 hr,
we did not detect a significant difference in target- or
branch-specific expression. The accumulation of sensorin A transcripts
at SN branches contacting L11 at 20 hr suggests that the local
inhibitory signals from L11 induce a multi-step process in the SNs that
leads over time to a reduction in net export. This scenario is
reminiscent of the time course for changes observed in neuritic growth
from one branch of a neuron with a bifurcate axon when the other branch
contacts and forms synaptic connections with a target (Schacher, 1985).
Goldberg and Schacher (1987) reported that neuritic growth at each
branch is correlated with the level of axonal transport of organelles.
After 1 d in culture and the early establishment of synaptic
contact at one branch, the growth and axonal transport at each branch
is equivalent. With time, there is a downregulation of growth and
organelle transport (both orthograde and retrograde) in the branch
without the target, whereas the branch contacting the target continues
to grow, form contacts with the target, and has normal levels of
organelle transport. Thus, the presence of a target at one branch leads
over time to selective stabilization of the transport apparatus in one
branch and destabilization of the transport apparatus in the other
branch. In the experiments reported here, the retrograde signals from L11 and L7 may initiate local alterations in the cytoskeletal or
transport machinery of the branches and neurites, thereby modulating net export of sensorin A mRNA to SN neurites contacting L11 versus L7.
One model explaining our results is that different target-derived
signals affect the organization of the cytoplasmic apparatus responsible for the export and accumulation of stable transcripts at
developing and maturing synaptic contacts. The signals can influence
export at three sites (Steward et al., 1998). First, signals from L7
may influence the initial packaging of the mRNAs for export from the
cell body by modulating the expression of binding proteins,
cytoskeletal elements, and transport motors necessary for the export of
the mRNA-protein complexes. Second, signals from L7 or L11 may
stabilize or destabilize, respectively, the transport apparatus within
the axon allowing export of mRNA-protein complexes to developing or
maturing synapses. Third, signals from the targets modulate the
organization of synaptic contacts that may be required for the local
accumulation of stable mRNAs. This could be accomplished by appropriate
expression of specific components of the cytoskeleton within
varicosities that bind the mRNA, thereby preventing degradation by
cytoplasmic RNases and facilitating translation. Future experiments
will examine the nature of the target-derived signals, their effect on
each step in the export and accumulation of mRNAs, and the contribution
and function of local translated products to synapse formation and maturation.
| |
FOOTNOTES |
Received Dec. 23, 1998; revised May 17, 1999; accepted May 17, 1999.
This research was supported by National Institutes of Health (NIH)
Grant NS 27541 and National Science Foundation Grant IBN-9808938; animals were provided by the National Center for Research Resources National Resource for Aplysia at the University of
Miami, supported by NIH Grant RR-10294. We thank Rachel Yarmolinsky for
assistance in preparing the figures and Drs. A. Hegde, R. Hen, and
Z.-P. Sun for comments on this manuscript.
Correspondence should be addressed to Dr. Samuel Schacher, Center for
Neurobiology and Behavior, Columbia University College of Physicians
and Surgeons, New York State Psychiatric Institute, 722 West 168th
Street, New York, NY 10032.
| |
REFERENCES |
-
Ambron RT,
Den H,
Schacher S
(1985)
Synaptogenesis by single identified neurons in vitro: contribution of rapidly transported and newly synthesized proteins.
J Neurosci
5:2857-2865[Abstract].
-
Bailey CH,
Thompson EB,
Castellucci VF,
Kandel ER
(1979)
Ultrastructure of the synapses of sensory neurons that mediate the gill withdrawal reflex in Aplysia.
J Neurocytol
8:415-444[Web of Science][Medline].
-
Bassell GJ,
Singer RH
(1997)
mRNA and cytoskeletal filaments.
Curr Opin Cell Biol
9:109-115[Web of Science][Medline].
-
Bassell GJ,
Zhang H,
Byrd AL,
Femino AM,
Singer RH,
Taneja KL,
Lifshitz LM,
Herman IM,
Kosik KS
(1998)
Sorting of
 -actin mRNA and protein to neurites and growth cones in culture.
J Neurosci
18:251-265[Abstract/Free Full Text]. -
Brunet J-F,
Shapiro E,
Foster SA,
Kandel ER,
Yuichi I
(1991)
Identification of a peptide specific for Aplysia sensory neurons by PCR-based differential screening.
Science
252:856-859[Abstract/Free Full Text].
-
Cabelli RJ,
Shelton DL,
Segal RA,
Shatz CJ
(1997)
Blockade of endogenous ligands of trkB inhibits formation of ocular dominance columns.
Neuron
19:63-76[Web of Science][Medline].
-
Camardo J,
Proshansky E,
Schacher S
(1983)
Identified Aplysia neurons form specific chemical synapses in culture.
J Neurosci
3:2614-2620[Abstract].
-
Casadio A,
Martin KC,
Bailey CH,
Chen M,
Zhu H,
Kandel ER
(1997)
Molecular mechanisms underlying synapse-specific long-term facilitation of Aplysia sensory to motor synapses.
Soc Neurosci Abstr
24:234.
-
Chicurel ME,
Singer RH,
Meyer CJ,
Ingber DE
(1998)
Integrin binding and mechanical tension induce movement of mRNA and ribosomes to focal adhesions.
Nature
392:730-733[Medline].
-
Cooperstock RL,
Lipshitz HD
(1997)
Control of mRNA stability and translation during Drosophila development.
Semin Cell Dev Biol
8:541-549[Web of Science][Medline].
-
Crino PB,
Eberwine J
(1996)
Molecular characterization of the dendritic growth cone: regulated mRNA transport and local protein synthesis.
Neuron
17:1173-1187[Web of Science][Medline].
-
DesGroseillers L,
Auclair D,
Wickham L,
Maalouf M
(1994)
A novel actin cDNA is expressed in the neurons of Aplysia californica.
Biochim Biophys Acta
121:322-324.
-
Fitzsimonds RM,
Poo M-M
(1998)
Retrograde signaling in the development and modification of synapses.
Physiol Rev
78:143-170[Abstract/Free Full Text].
-
Glanzman DL,
Kandel ER,
Schacher S
(1989)
Identified target motor neuron regulates neurite outgrowth and synapse formation of Aplysia sensory neurons in vitro.
Neuron
3:441-450[Web of Science][Medline].
-
Glanzman DL,
Kandel ER,
Schacher S
(1990)
Target-dependent structural changes accompanying long-term synaptic facilitation in Aplysia neurons.
Science
249:799-802[Abstract/Free Full Text].
-
Goldberg DJ,
Schacher S
(1987)
Differential growth of the two branches of a regenerating bifurcate axon is associated with differential axonal transport of organelles.
Dev Biol
124:35-40[Web of Science][Medline].
-
Hawver D,
Schacher S
(1993)
Selective fasciculation as a mechanism for the formation of specific chemical connections between Aplysia neurons in vitro.
J Neurobiol
24:368-383[Web of Science][Medline].
-
Keller F,
Schacher S
(1990)
Neuron-specific membrane glycoproteins promoting neurite fasciculation in Aplysia californica.
J Cell Biol
111:2637-2650[Abstract/Free Full Text].
-
Knowles RB,
Kosik KS
(1997)
Neurotrophin-3 signals redistribute RNA in neurons.
Proc Natl Acad Sci USA
94:14804-14808[Abstract/Free Full Text].
-
Knowles RB,
Sabry JH,
Martone ME,
Deerinck TJ,
Ellisman MH,
Bassell GJ,
Kosik KS
(1996)
Translocation of RNA granules in living neurons.
J Neurosci
16:7812-7820[Abstract/Free Full Text].
-
Kleiman R,
Banker G,
Steward O
(1994)
Development of subcellular mRNA compartmentation in hippocampal neurons in culture.
J Neurosci
14:1130-1140[Abstract].
-
Martin KC,
Casadio A,
Zhu H,
Yaping E,
Rose JC,
Chen M,
Bailey CH,
Kandel ER
(1997)
Synapse-specific, long-term facilitation of Aplysia sensory to motor synapses: a function for local protein synthesis in memory storage.
Cell
91:927-938[Web of Science][Medline].
-
Mayford M,
Barzilai A,
Keller F,
Schacher S,
Kandel ER
(1992)
Modulation of an NCAM-related adhesion molecule with long-term synaptic plasticity in Aplysia.
Science
256:638-644[Abstract/Free Full Text].
-
Mohr E,
Fehr S,
Richter D
(1991)
Axonal transport of neuropeptide encoding mRNAs within the hypothalamo-hypophaseal tract of rats.
EMBO J
10:2419-2424[Web of Science][Medline].
-
Montarolo PG,
Goelet P,
Castellucci VF,
Morgan J,
Kandel ER,
Schacher S
(1986)
A critical period for macromolecular synthesis in long-term heterosynaptic facilitation in Aplysia.
Science
234:1249-1254[Abstract/Free Full Text].
-
Oleynikov Y,
Singer RH
(1998)
RNA localization: different zip codes, same postman?
Trends Cell Biol
8:381-383.[Web of Science][Medline]
-
Olink-Coux M,
Hollenbeck PJ
(1996)
Localization and active transport of mRNA in axons of sympathetic neurons in culture.
J Neurosci
16:1346-1358[Abstract/Free Full Text].
-
Rayport SG,
Schacher S
(1986)
Synaptic plasticity in vitro: cell culture of identified Aplysia neurons mediating short-term habituation and sensitization.
J Neurosci
6:759-763[Abstract].
-
Sanes JR,
Apel ED,
Gautam M,
Glass D,
Grady RM,
Martin PT,
Nicholl MC,
Yancopoulus GD
(1998)
Agrin receptors at the skeletal neuromuscular junction.
Ann NY Acad Sci
841:1-13[Web of Science][Medline].
-
Santarelli L,
Montarolo PG,
Schacher S
(1996)
Neuropeptide localization in varicosities of Aplysia sensory neurons is regulated by target and neuromodulators evoking long-term synaptic plasticity.
J Neurobiol
31:297-308[Web of Science][Medline].
-
Schacher S
(1985)
Differential synapse formation and neurite outgrowth at two branches of the metacerebral cell of Aplysia in dissociated cell culture.
J Neurosci
5:2028-2034[Abstract].
-
Schacher S,
Montarolo PG
(1991)
Target-dependent structural changes in sensory neurons of Aplysia accompany long-term heterosynaptic inhibition.
Neuron
6:679-690[Web of Science][Medline].
-
Schacher S,
Proshansky E
(1983)
Neurite regeneration by Aplysia neurons in dissociated cell culture: modulation by Aplysia hemolymph and the presence of the initial axon segment.
J Neurosci
3:2403-2413[Abstract].
-
Steward O
(1997)
mRNA localization in neurons: a multipurpose mechanism?
Neuron
18:9-12[Web of Science][Medline].
-
Steward O,
Wallace CS,
Lyford GL,
Worley PF
(1998)
Synaptic activation causes the mRNA for the IEG Arc to localize selectively near activated postsynaptic sites on dendrites.
Neuron
21:741-751[Web of Science][Medline].
-
St. Johnston D
(1995)
The intracellular localization of mRNAs.
Cell
81:161-170[Web of Science][Medline].
-
Sun Z-Y,
Schacher S
(1996)
Development of short-term heterosynaptic facilitation at Aplysia sensorimotor synapses in vitro is accompanied by changes in the functional expression of presynaptic serotonin receptors.
J Neurophysiol
76:2250-2261[Abstract/Free Full Text].
-
van Minnen J
(1994)
Axonal localization of neuropeptide-encoding mRNA in identified neurons of the snail Lymnaea stagnalis.
Cell Tissue Res
276:155-161[Web of Science][Medline].
-
van Minnen J,
Bergman JJ,
Van Kesteren ER,
Smit AB,
Geraerts WPM,
Lukowiak K,
Hasan SU,
Syed NI
(1997)
De novo protein synthesis in isolated axons of identified neurons.
Neuroscience
80:1-7[Web of Science][Medline].
-
Wallace CS,
Lyford GL,
Worley PF,
Steward O
(1998)
Differential intracellular sorting of immediate early gene mRNAs depends on signals in the mRNA sequence.
J Neurosci
18:26-35[Abstract/Free Full Text].
-
Wilhelm JE,
Vale RD
(1993)
RNA on the move: the mRNA localization pathway.
J Cell Biol
123:269-274[Free Full Text].
-
Winberg ML,
Mitchell KJ,
Goodman CS
(1998)
Genetic analysis of the mechanisms controlling target selection: complementary and combinatorial functions of netrins, semaphorins, and IgCams.
Cell
93:581-592[Web of Science][Medline].
-
Winnepenninckx B,
Steiner G,
Backeljau T,
De Wachter R
(1998)
Details of gastropod phylogeny inferred from 18S rRNA sequences.
Mol Phylogenet Evol
9:55-63[Web of Science][Medline].
-
Wu L,
Wells D,
Tay J,
Mendis D,
Abbott MA,
Barnitt A,
Quinlan E,
Heynen A,
Fallon JR,
Richter JD
(1998)
CPEB-mediated cytoplasmic polyadenylation and the regulation of experience-dependent translation of
 -CaMKII mRNA at synapses.
Neuron
21:1129-1139[Web of Science][Medline]. -
Zhu H,
Wu F,
Schacher S
(1994)
Aplysia cell adhesion molecules and serotonin regulate sensory cell-motor cell interactions during early stages of synapse formation in vitro.
J Neurosci
14:6886-6900[Abstract].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19156338-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
A. Giuditta, J. Tai Chun, M. Eyman, C. Cefaliello, A. P. Bruno, and M. Crispino
Local Gene Expression in Axons and Nerve Endings: The Glia-Neuron Unit
Physiol Rev,
April 1, 2008;
88(2):
515 - 555.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, Y. Chen, and S. Schacher
Multifunctional Role of Protein Kinase C in Regulating the Formation and Maturation of Specific Synapses
J. Neurosci.,
October 24, 2007;
27(43):
11712 - 11724.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, Y. Chen, and S. Schacher
Protein Kinase C Regulates Local Synthesis and Secretion of a Neuropeptide Required for Activity-Dependent Long-Term Synaptic Plasticity
J. Neurosci.,
August 15, 2007;
27(33):
8927 - 8939.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-J. Sung, F. Wu, S. Schacher, and R. T. Ambron
Synaptogenesis regulates axotomy-induced activation of c-Jun-activator protein-1 transcription.
J. Neurosci.,
June 14, 2006;
26(24):
6439 - 6449.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Liu, J.-Y. Hu, F. Wu, J. H. Schwartz, and S. Schacher
Two mRNA-Binding Proteins Regulate the Distribution of Syntaxin mRNA in Aplysia Sensory Neurons.
J. Neurosci.,
May 10, 2006;
26(19):
5204 - 5214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, F. Wu, and S. Schacher
Two Signaling Pathways Regulate the Expression and Secretion of a Neuropeptide Required for Long-Term Facilitation in Aplysia
J. Neurosci.,
January 18, 2006;
26(3):
1026 - 1035.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Wagatsuma, H. Sadamoto, T. Kitahashi, K. Lukowiak, A. Urano, and E. Ito
Determination of the exact copy numbers of particular mRNAs in a single cell by quantitative real-time RT-PCR
J. Exp. Biol.,
June 15, 2005;
208(12):
2389 - 2398.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Wiersma-Meems, J. Van Minnen, and N. I. Syed
Synapse Formation and Plasticity: The Roles of Local Protein Synthesis
Neuroscientist,
June 1, 2005;
11(3):
228 - 237.
[Abstract]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, J. Goldman, F. Wu, and S. Schacher
Target-Dependent Release of a Presynaptic Neuropeptide Regulates the Formation and Maturation of Specific Synapses in Aplysia
J. Neurosci.,
November 3, 2004;
24(44):
9933 - 9943.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-H. Han, C.-S. Lim, Y.-S. Lee, E. R. Kandel, and B.-K. Kaang
Role of Aplysia Cell Adhesion Molecules During 5-HT-Induced Long-Term Functional and Structural Changes
Learn. Mem.,
July 1, 2004;
11(4):
421 - 435.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Liu, J.-Y. Hu, S. Schacher, and J. H. Schwartz
The Two Regulatory Subunits of Aplysia cAMP-Dependent Protein Kinase Mediate Distinct Functions in Producing Synaptic Plasticity
J. Neurosci.,
March 10, 2004;
24(10):
2465 - 2474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Giustetto, A. N. Hegde, K. Si, A. Casadio, K. Inokuchi, W. Pei, E. R. Kandel, and J. H. Schwartz
Axonal transport of eukaryotic translation elongation factor 1{alpha} mRNA couples transcription in the nucleus to long-term facilitation at the synapse
PNAS,
November 11, 2003;
100(23):
13680 - 13685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, X. Meng, and S. Schacher
Redistribution of Syntaxin mRNA in Neuronal Cell Bodies Regulates Protein Expression and Transport during Synapse Formation and Long-Term Synaptic Plasticity
J. Neurosci.,
March 1, 2003;
23(5):
1804 - 1815.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Hu, X. Meng, and S. Schacher
Target Interaction Regulates Distribution and Stability of Specific mRNAs
J. Neurosci.,
April 1, 2002;
22(7):
2669 - 2678.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Schacher and F. Wu
Synapse Formation in the Absence of Cell Bodies Requires Protein Synthesis
J. Neurosci.,
March 1, 2002;
22(5):
1831 - 1839.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Walcourt, R. L. Scott, and H. A. Nash
Blockage of One Class of Potassium Channel Alters the Effectiveness of Halothane in a Brain Circuit of Drosophila
Anesth. Analg.,
February 1, 2001;
92(2):
535 - 541.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
The Neuroscientist Comments
Neuroscientist,
April 1, 2000;
6(2):
69 - 72.
[PDF]
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
