 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 1999, 19(15):6348-6359
L-Type Ca2+ Channels Are Essential for
Glutamate-Mediated CREB Phosphorylation and c-fos Gene
Expression in Striatal Neurons
Anjali
Rajadhyaksha,
Amy
Barczak,
Wendy
Macías,
Jean-Christophe
Leveque,
Susan E.
Lewis, and
Christine
Konradi
Molecular and Developmental Neuroscience Laboratory and Department
of Psychiatry, Massachusetts General Hospital and Harvard Medical
School, Charlestown, Massachusetts 02129
 |
ABSTRACT |
The second messenger pathways linking receptor activation at the
membrane to changes in the nucleus are just beginning to be unraveled
in neurons. The work presented here attempts to identify in striatal
neurons the pathways that mediate cAMP response element-binding protein (CREB) phosphorylation and gene expression in response to NMDA receptor activation. We investigated the phosphorylation of the
transcription factor CREB, the expression of the immediate early gene
c-fos, and the induction of a transfected reporter gene
under the transcriptional control of CREB after stimulation of
ionotropic glutamate receptors. We found that neither AMPA/kainate receptors nor NMDA receptors were able to stimulate independently a
second messenger pathway that led to CREB phosphorylation or c-fos gene expression. Instead, we saw a consecutive
pathway from AMPA/kainate receptors to NMDA receptors and from NMDA
receptors to L-type Ca2+ channels. AMPA/kainate
receptors were involved in relieving the Mg2+ block
of NMDA receptors, and NMDA receptors triggered the opening of L-type
Ca2+ channels. The second messenger pathway that
activates CREB phosphorylation and c-fos gene expression
is likely activated by Ca2+ entry through L-type
Ca2+ channels. We conclude that in primary striatal
neurons glutamate-mediated signal transduction is dependent on
functional L-type Ca2+ channels.
Key words:
glutamate; NMDA; AMPA; kainate; L-type
Ca2+ channels; CREB; c-fos
 |
INTRODUCTION |
The striatum (caudate, putamen, and
nucleus accumbens) has been implicated in movement disorders like
Parkinson's disease and Huntington's disease (Vonsattel et al., 1985 ;
DiFiglia, 1990 ; Langston, 1996 ). The striatum also plays a critical
role in drug addiction (Pich et al., 1997 ; Volkow et al., 1997 ),
schizophrenia (Buchsbaum et al., 1992 ; Siegel et al., 1993 ; Busatto and
Kerwin, 1997 ; Heckers, 1997 ), and memory (Knowlton et al., 1996 ).
Neuroplasticity of the striatum enables compensation for the loss of
dopamine (Bernheimer et al., 1973 ; Neve et al., 1982 ; Calne et al.,
1985 ; Burns, 1991 ; Hornykiewicz, 1993 ) and contributes to both the
therapeutic potential of neuroleptics (Burt et al., 1977 ; Eastwood et
al., 1994 , 1997 ; Mijnster et al., 1996 ) and the addictive properties of
drugs of abuse (Nestler et al., 1993 ; Self and Nestler, 1995 ; Hyman,
1996 ; Hyman and Nestler, 1996 ). Synaptic plasticity forms the basis of
learning and memory and involves mechanisms such as protein
phosphorylation and protein synthesis, leading to the strengthening of
preexisting synapses and the establishment of new synaptic connections
(Stanton and Sarvey, 1984 ; Deadwyler et al., 1987 ; Matthies, 1989 ;
Nairn and Shenolikar, 1992 ; Schulman, 1995 ; Bailey et al., 1996 ). The
examination of the mechanisms of gene regulation in the striatum is
vital for our understanding of striatal plasticity, striatal function,
and malfunction and for the treatment of disorders of the striatum.
The excitatory amino acid L-glutamate (glutamate)
participates in processes from neuronal communication to plasticity and neuropathology via its interaction with ionotropic and metabotropic receptors (Greenamyre and Porter, 1994 ; Michaelis, 1998 ). Ionotropic glutamate receptors are classified into AMPA, kainate, and
NMDA receptors (Hollmann and Heinemann, 1994 ; Schoepfer et al.,
1994 ; Michaelis, 1998 ; Ozawa et al., 1998 ). AMPA/kainate receptors gate ion channels that promote Na+ influx and, to a
lesser extent, Ca2+ influx (Hollmann et al., 1991 ;
Egebjerg and Heinemann, 1993 ; Kohler et al., 1993 ; Lomeli et al., 1994 )
and desensitize rapidly (Lomeli et al., 1994 ; Mosbacher et al., 1994 ).
NMDA-type glutamate receptor channels bind glycine and glutamate
(Ascher and Nowak, 1987 ; Johnson and Ascher, 1987 ; Hollmann and
Heinemann, 1994 ) and are permeable to Ca2+
(MacDermott et al., 1986 ; Connor et al., 1988 ) as well as
Na+ and K+ ions (Ascher and
Nowak, 1987 ; Kandel et al., 1991 ). At resting potential, NMDA receptors
are blocked by Mg2+ (Mayer et al., 1984 ; MacDermott
et al., 1986 ; Ruppersberg et al., 1993 ; Schoepfer et al., 1994 ). This
Mg2+ block can be relieved by depolarization, which
can be achieved by activation of AMPA/kainate receptors.
Another route for Ca2+ entry into striatal neurons
is provided by voltage-operated Ca2+ channels
(VOCCs) (Sanna et al., 1986 ; Thayer et al., 1986 ). The 1 subunit of
VOCCs determines the properties of the Ca2+ channel
(Hofmann et al., 1994 ; McCleskey, 1994 ; Walker and De Waard, 1998 ) and
forms the pore through which Ca2+ ions enter the
cell (Catterall, 1991 ; Walker and De Waard, 1998 ). Ca2+ channels that contain the 1C or 1D
subunit are classified as dihydropyridine-sensitive L-type
Ca2+ channels (Hofmann et al., 1994 ; McCleskey,
1994 ; Walker and De Waard, 1998 ). The L-type Ca2+
channel is activated by strong depolarization from relatively depolarized holding potentials and shows almost no inactivation by
depolarization (Tsien et al., 1988 ). Therefore, it opens only after a
strong stimulus and, after opened, causes extensive
Ca2+ influx (Catterall and Striessnig, 1992 ). These
characteristics and the distribution of L-type Ca2+
channels on somata and at the base of dendrites (Westenbroek et al.,
1990 ; Schild et al., 1995 ) provide a favorable setting to mediate gene
regulation in the nucleus.
Ca2+-stimulated second messenger pathways can
activate the transcription factor cAMP response element-binding
protein (CREB) (Sheng et al., 1991 ; Sun et al., 1994 ; Thompson et al.,
1995 ; Bito et al., 1996 ; Deisseroth and Tsien, 1997 ). CREB
constitutively binds with high affinity to the cAMP-responsive element
(CRE) and becomes a transcriptional activator after phosphorylation of
Ser133 (Montminy and Bilezikjian, 1987 ; Gonzalez and
Montminy, 1989 ; Montminy et al., 1990 ). CREB has been linked to memory
formation (Bourtchuladze et al., 1994 ; Yin et al., 1994 ),
neuroplasticity (Murphy and Segal, 1997 ), and long-term
potentiation (Impey et al., 1996 ). The immediate early gene
c-fos is activated by CREB (Sheng et al., 1990 ). The
promoter of the c-fos gene contains the cAMP and
Ca2+-responsive element (CaRE), which interacts
with CREB (Sheng et al., 1990 ; Ghosh et al., 1994 ). The CaRE site
integrates several second messenger pathways (Bonni et al., 1995 ; Ahn
et al., 1998 ) and is one of the preeminent regulatory sites of the
c-fos promoter (Robertson et al., 1995 ). Like CREB
phosphorylation, c-fos is induced after NMDA receptor
stimulation (Cole et al., 1989 ; Aronin et al., 1991 ; Lerea and
McNamara, 1993 ; Dave and Tortella, 1994 ) and after L-type
Ca2+ channel activation (Murphy et al., 1991 ; Misra
et al., 1994 ).
We show here that in primary striatal cultures, glutamate via
activation of NMDA receptors mediates CREB phosphorylation and gene
expression via L-type Ca2+ channels.
 |
MATERIALS AND METHODS |
Drugs. NMDA, (±)AMPA hydrobromide, kainate (kainic
acid), dizocilpine maleate [(+)MK 801 hydrogen maleate],
(±)2-amino5-phosphonopentanoic acid (APV), DNQX,
2,5-dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic acid
methylester (FPL 64176),
1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-3,4-dihydro-5H-2,3-benzodiazepine (GYKI 52466) hydrochloride, tetrodotoxin citrate (TTX), (±)verapamil hydrochloride, nifedipine, bicuculline, and picrotoxin were purchased from Research Biochemicals (Natick, MA), and L-glutamate
was purchased from Sigma (St. Louis, MO). The Ser133
CREB antiserum (Ginty et al., 1993 ), the CREB antiserum, and the Fos
antiserum were purchased from Upstate Biotechnology (Lake Placid, NY).
The antiserum against the 1C Ca2+ channel was
purchased from Alomone Labs (Jerusalem, Israel).
Primary striatal cultures. Primary striatal cultures were
prepared as described previously, with minor modifications (Konradi et
al., 1996 ; Rajadhyaksha et al., 1998 ). Striata were dissected under a
stereomicroscope from 18-d-old Sprague Dawley rat fetuses. Tissue was
resuspended in 2 ml of defined medium [50% F12/DMEM and 50% DMEM
(Life Technologies, Gaithersburg, MD) with the following supplements
per liter of medium: 4 gm of dextrose, 1× B27, 10 ml of
penicillin-streptomycin liquid (Life Technologies), and 25 mM HEPES]. The tissue was mechanically dissociated with a
fire-narrowed Pasteur pipette; the cells were resuspended in defined
medium to 106 cells/ml and plated in six-well plates
(Costar, Cambridge, MA) at 2 × 106 cells/well.
Plates were pretreated with 2 ml of a 1:500-diluted sterile solution of
polyethylenimine in water for 24 hr, washed twice with sterile water,
coated with 2.5% serum-containing PBS solution for at least 4 hr, and aspirated just before plating. All experiments were performed
with cells 6-8 d in culture and repeated at least once in an
independent dissection. As determined by HPLC analysis, glutamate
levels in the medium on the day of the experiments ranged from 1 to 5 µM. The neuron to astroglia ratio was below 25:1, as
established by immunocytochemical staining with the glial fibrillary
acid protein (Dako, Carpinteria, CA) and counterstaining with 1%
cresyl violet.
Defined salt solutions. To have comparable parameters, none
of the defined salt solutions contained sodium bicarbonate. Sodium bicarbonate was replaced by N-methyl-D-glucamine
(45 mM). Control salt solutions contained 110 mM NaCl, 2 mM MgSO4, 1.8 mM CaCl2, 400 µM glycine,
45 mM N-methyl-D-glucamine, 0.5%
phenol red, 3 gm/l dextrose, and 20 mM HEPES-KOH. In
experiments without Na+, NaCl was replaced by 110 mM N-methyl-D-glucamine. In
experiments without Ca2+ or without
Mg2+, either ion was left out. Salt solutions were
adjusted with HCl to pH 7.2. In experiments that used NMDA as an
agonist, 10 µM glutamate was added 18 hr before the
experiment. All salt solutions were added 18 hr before the experiment
to avoid false results because of media change. Neurons were carefully
monitored for neuronal death.
Immunoblots. Primary rat striatal cultures were harvested in
boiling sample buffer (62.5 mM Tris-HCl, pH 6.8, 20%
glycerol, 2% SDS, 5% -mercaptoethanol, and 0.025% bromophenol
blue). Cell lysates were sonicated and centrifuged for 10 min. Equal
volumes of the lysates were loaded on 12% polyacrylamide gels for
phospho-CREB and CREB immunoblots or on 8% gels for Fos and 1C
Ca2+ channel-subtype immunoblots. Protein was
transferred to polyvinylidene fluoride membrane (Immobilon-P;
0.45 mm; Millipore, Bedford, MA) and blocked in blocking buffer (5%
nonfat dry milk in PBS and 0.1% Tween 20) for 1 hr. The blots were
incubated in primary antibody (1:1000
anti-Ser133-phospho-CREB or anti-CREB; 1:10,000
anti-Fos; or 1:500 anti- 1C) for 2 hr followed by three washes for 10 min in blocking buffer. This was followed by a 1 hr incubation in goat
anti-rabbit horseradish peroxidase-linked IgG (Vector Laboratories,
Burlingame, CA) at a dilution of 1:3000. Blots were washed three times
for 10 min in blocking buffer, developed with the Renaissance detection
system (Dupont NEN, Wilmington, DE), and exposed to autoradiographic film (Kodak, Rochester, NY). Kaleidoscope-prestained standards (Bio-Rad, Hercules, CA) were used for protein size determination. Phospho-CREB and CREB bands were detected at the 43 kDa standard. The
Fos band was detected at 60 kDa.
Calcium phosphate transfections. Transfection of primary
striatal neurons was performed following the protocol of Xia et al. (1996) . Embryonic day 18 striatal neurons were transfected on 4 d in vitro (DIV). The DNA/calcium phosphate
precipitate was prepared by mixing the DNA in 250 mM
CaCl2 with an equal volume of 2× HEPES-buffered saline
(0.14 mM NaCl, 0.025 mM HEPES, and 0.7 µM Na2HPO4). The
precipitate was allowed to form for 1 hr at room temperature. Fifteen
minutes before addition of the DNA mixture, the conditioned culture
medium was removed from the cells and replaced with 1.5 ml of F12/DMEM
(Life Technologies). The conditioned media were kept under 5%
CO2. The DNA mixture (100 µl) was added dropwise to each
well of a six-well plate and rocked gently. Plates were incubated for
80 min in a 5% CO2 incubator. After 80 min the cells were
shocked with 500 µl of 2% DMSO in F12/DMEM for 2 min and washed
twice with 1.5 ml of F12/DMEM. The conditioned media were added back to
the cells, and the plates were incubated in a 5% CO2
incubator at 37°C. For all transfections, 6 µg of total DNA was
used per well (35 mm) of a six-well plate. Forty-eight hours after
transfection, cells were treated with the respective drugs for 6 hr.
Media were aspirated, and plates were quick-frozen on liquid nitrogen
and stored at 80°C.
3xCRE-luciferase construct. A DNA sequence containing
three CRE sequences (TGACGTCA) was fused to a minimal Rous sarcoma
virus promoter (enhancerless) and was inserted into the pA3Pluc vector (Maxwell et al., 1989 ) 5' of a luciferase reporter gene.
Luciferase assay. The luciferase assay was performed using
the Promega luciferase assay kit (Madison, WI). Cells were lysed in 150 µl of 1× cell culture lysis reagent (25 mM
Tris-phosphate, pH 7.8, 2 mM DTT, 2 mM
1,2-diaminocyclohexane-N,N,N',N'-tetra-acetic acid, 10%
glycerol, and 1% Triton X-100); 100 µl of the lysate was used for
the luciferase reporter assay. Luciferase activity was measured for a
period of 10 sec using a luminometer (EG & G Berthold, Oak Ridge, TN),
and light intensity was expressed as relative light units.
Antisense experiments. Antisense sequences were targeted to
the translation initiation sites. Both antisense and scrambled antisense oligonucleotides were synthesized by the Massachusetts General Hospital core DNA synthesis facility. The first and last three nucleotides were phosphorothioate modified to avoid degradation of the oligonucleotides and also to reduce the cytotoxic effect observed with fully phosphorothioate-modified oligonucleotides. Striatal cultures were treated according to the method of
Bito et al. (1996) with a mixture of 5 µM 1C
(GGCCCGAATCATTGTGACTCCAGT) and 5 µM 1D
(TCATCATCATCATCATCATCCACG) antisense oligonucleotides for L-type
Ca2+ channel antisense experiments or a mixture of 5 µM NR1 (TGCTCATGAGCTCCGGGCACAGCG), 5 µM NR2A (CAATCTGCCCATGGTCGCCACTTA), and 5 µM NR2B (ACTCTGCGCTGGGCTTCATCTTCA) antisense
oligonucleotides for the NMDA receptor experiment. Oligonucleotides were added 30 min after cells were plated and daily thereafter until 4 DIV. Twenty-four hours after the last addition, cells were treated with
the respective agonists. For scrambled antisense DNA
controls, approximately every third and fourth nucleotide of the
antisense constructs were exchanged ( 1C, GACCTGAGTTACTGGCATATCCGC; 1D, TAAACCTCTCCATTCTCGTACACA; NR1, TGCCTAGTAGCTCGCGGACCAGGC; NR2A, ACATCGTCATCGCGCTGATCTCAC; and NR2B, TATGCCTCGGCGTTCAGCTCCATT).
c-fos Northern blot analysis. Medium was aspirated, and
striatal neurons were lysed in 500 µl of lysis buffer (50 mM Tris, pH 8.0, 100 mM NaCl, 5 mM
MgCl2, and 0.5% NP-40). After a 5 min incubation on
ice, lysates were transferred into microcentrifuge tubes and
centrifuged for 2 min at 14,000 rpm at 4°C; the supernatant was
transferred, and SDS was added to a final concentration of 0.2%. Cells
were extracted with phenol, followed by a chloroform extraction and
ethanol precipitation. RNA was size-separated on a 1.2% denaturing
agarose gel (1 M paraformaldehyde) in
3-(N-morpholino)propanesulfonic acid (MOPS) buffer (20 mM MOPS, pH 7.0, 5 mM sodium acetate, and 1 mM EDTA), electroblotted onto a nylon membrane (GeneScreen; DuPont, Billerica, MA), and hybridized with a c-fos
riboprobe (Riboprobe system; Promega). Northern blots were analyzed
with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA), with the IP lab imaging software. Expression of cyclophilin mRNA was used as a loading control (Danielson et al., 1988 ).
Statistical analyses. Autoradiographic films were scanned
with the Hewlett Packard Scan Jet. Because of the narrow range of film
(approximately one order of magnitude), the data obtained for
immunoblots are not comparable with the data obtained for c-fos Northern blots, which were analyzed with a
PhosphorImager that has a range of five orders of magnitude. Because
the data are compiled of many different Northern blots and immunoblots, they had to be normalized to internal, untreated controls. Thus, the
data are semiquantitative and are not based on absolute numbers. Data
were analyzed with one-way ANOVAs. The Tukey-Kramer honestly significant difference was used to analyze differences between the groups, whereas the Dunnett's test was used for comparisons of
treatment groups with controls. The JMP computer program (SAS Institute, Cary, NC) was used for data analysis.
 |
RESULTS |
Glutamate induces CREB phosphorylation and Fos protein expression
in primary striatal cultures
Glutamate (50 µM) induced Ser133
CREB phosphorylation in rat primary striatal cultures within 5 min of
treatment (Fig. 1A,
P-CREB). Ser133 CREB phosphorylation
peaked at 15 min and returned to basal levels 10 hr after glutamate was
added. When immunoblots were reprobed with a CREB antiserum that is
indiscriminate to the state of CREB phosphorylation, no
treatment-mediated regulation was seen (Fig. 1A,
CREB). In most blots, the CREB antiserum and the
Ser133 CREB antiserum revealed a double band
slightly >40 kDa, but some variability in the resolution of the double
band and/or staining of the upper band was observed with either
antiserum. Because the two bands had identical patterns of regulation,
these variations were not a problem. A temporal analysis of Fos protein
levels demonstrated an increase between 2 and 5 hr after the onset of glutamate treatment (Fig. 1A, Fos). In a
different time course, cultures were exposed to glutamate for limited
times (Fig. 1B), refed with medium lacking glutamate,
and harvested 15 min after glutamate treatment had begun. A 3 min
exposure to glutamate yielded maximum levels of CREB phosphorylation,
comparable with treatment for the entire 15 min (Fig.
1B; see also Fig. 6D for a time
course similar to that of Fig. 1A). In all subsequent
experiments agonists were present for the entire treatment period,
which was 15 min in experiments that examined Ser133
CREB phosphorylation.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 1.
Glutamate induces Ser133 CREB
phosphorylation and Fos protein in primary striatal cultures.
A, Immunoblots of rat primary striatal cultures were
treated with glutamate (50 µM) for 5 min to 10 hr
(times indicated above the
blots). P-CREB, CREB was phosphorylated 5 min after the addition of glutamate and remained phosphorylated for at
least 5 hr. CREB, An antiserum that is indifferent to
the state of phosphorylation of CREB showed that the protein levels of
CREB were not changed. Fos, Fos protein was induced 2-5
hr after the addition of glutamate. CREB and Ser133
CREB had a molecular weight of ~43 kDa, whereas Fos protein was
slightly below the 60 kDa protein marker. B, Primary
striatal cultures were exposed to glutamate (50 µM) for
1-15 min, at which time glutamate was removed from the cells. All
cells were harvested 15 min after the addition of glutamate.
Immunoblots were developed with Ser133 CREB
antiserum (Ginty et al., 1993 ). All treatments are shown in
duplicates.
|
|
Activation of ionotropic glutamate receptors and L-type
Ca2+ channels induces CREB phosphorylation and gene
expression
To analyze the contribution of different ionotropic glutamate
receptors to Ser133 CREB phosphorylation, we used
agonists specific for each class and found that NMDA (50 µM), AMPA (50 µM), and kainate (50 µM) all induced CREB phosphorylation (Fig.
2A). Higher
concentrations of these agonists did not induce more CREB
phosphorylation (data not shown). The medium contained
Mg2+ (2 mM) as well as ambient glutamate
levels (2-5 µM, as determined by HPLC measurement). The
ambient glutamate levels supported the effect of NMDA on CREB
phosphorylation in the presence of Mg2+ (see below).
Ser133 CREB phosphorylation was also induced by the
L-type Ca2+ channel agonist FPL 64176 (20 µM; Fig. 2A). The phosphorylation of
Ser133 CREB coincided with c-fos gene
expression in all stimulus paradigms used (Fig. 2B).
A luciferase construct under the transcriptional control of three CRE
enhancer elements, 3xCRE-luciferase (Fig. 2C),
was transfected into primary striatal cultures and was activated by all
agonists, comparable with c-fos mRNA (Fig.
2B) and Ser133 CREB
phosphorylation (Fig. 2A).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2.
Activation of ionotropic glutamate receptors and
of L-type Ca2+ channels induces CREB
phosphorylation, c-fos gene expression, and the
3xCRE-luciferase construct in primary striatal cultures.
A, Cultures were exposed to glutamate (50 µM), NMDA (50 µM), AMPA (50 µM), kainate (50 µM), and FPL 64176 (FPL; 20 µM) and harvested 15 min after
the addition of each drug. Immunoblots were developed with the
Ser133 CREB antiserum. All drugs induced CREB
phosphorylation to varying degrees. Treatments are shown in duplicates
from a representative experiment that was repeated four times.
B, Cultures were exposed to glutamate (50 µM), NMDA (50 µM), AMPA (50 µM), kainate (50 µM), and FPL 64176 (20 µM) and harvested 40 min after the addition of each drug.
Northern blots were developed with a c-fos riboprobe.
All drugs induced c-fos mRNA to varying degrees.
Duplicate treatments are shown in two separate blots. The experiment
was repeated twice. C, Primary striatal cultures were
transfected with a 3xCRE-luciferase construct and
treated with glutamate (50 µM), NMDA (50 µM), AMPA (50 µM), kainate (50 µM), and FPL 64176 (20 µM) for 6 hr. Cells
were harvested, and luciferase activity was measured. The average fold
induction of luciferase activity (± SEM) over control levels is shown
(n = 10 for each treatment). indicates control
without agonist.
|
|
Glutamate-mediated CREB phosphorylation and gene expression require
functional NMDA receptors, Ca2+, and
Na+
MK 801 (1 µM) and APV (100 µM),
noncompetitive and competitive antagonists of the NMDA receptor,
respectively, blocked glutamate (see Fig. 10A)-,
NMDA-, AMPA-, and kainate (all 50 µM)-induced CREB
phosphorylation (Fig. 3A).
Expression of the endogenous c-fos gene (see Figs.
3B, 10C) and the 3xCRE-luciferase
construct (Fig. 3C) by ionotropic glutamate receptor
agonists was also blocked by MK 801.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3.
NMDA antagonists block ionotropic glutamate
receptor-mediated Ser133 CREB phosphorylation,
c-fos gene expression, and the induction of the
3xCRE-luciferase construct in primary striatal cultures.
A, Ser133 CREB phosphorylation
mediated by NMDA (50 µM), AMPA (50 µM), and
kainate (50 µM) is blocked by pretreatment for 20 min
with the NMDA antagonists MK 801 (1 µM) and APV (100 µM). Duplicate treatments are shown in two separate
blots. The experiment was repeated four times. (See also Fig. 10.)
B, c-fos gene induction mediated by NMDA
(50 µM), AMPA (50 µM), and kainate (50 µM) is blocked by pretreatment for 20 min with the NMDA
antagonist MK 801 (1 µM). Duplicate treatments are shown
in two separate blots. The experiment was repeated four times. (See
also Fig. 10.) C, Induction of the
3xCRE-luciferase construct after treatment for 6 hr with glutamate (50 µM), NMDA (50 µM),
and AMPA (50 µM) is blocked by pretreatment for 20 min
with the NMDA antagonist MK 801 (1 µM;
n = 6 for each treatment). The block of induction
by MK 801 is significant in all groups. Data are the average ± SEM. indicates control without agonist.
|
|
Glutamate- and NMDA-mediated CREB phosphorylation was dependent on
extracellular Ca2+ ions. Removal of
Ca2+ from the medium prevented CREB phosphorylation
(Fig. 4A). Glutamate receptor-mediated CREB phosphorylation was also dependent on
Na+ ions (Fig. 4B). In
Na+-free medium, glutamate could not induce CREB
phosphorylation (Fig. 4B), even in the absence of the
NMDA-blocking ion Mg2+. However, influx through
voltage-operated Na+ channels was not necessary for
glutamate- or FPL 64176-mediated CREB phosphorylation, because the
Na+ channel blocker TTX had no effect (Fig.
4C).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 4.
The role of Na+,
Mg2+, and Ca2+ in
Ser133 CREB phosphorylation mediated by ionotropic
glutamate receptors. Primary striatal cultures were switched to defined
salt solutions (see Materials and Methods) and treated 24 hr later as
indicated. Immunoblots were developed with the
Ser133 phospho-CREB antiserum. A,
Ca2+ is necessary for NMDA- and glutamate-mediated
phosphorylation of Ser133 CREB. In medium without
Ca2+ ( Ca2+) neither NMDA (50 µM; top) nor glutamate (50 µM; bottom) can induce
Ser133 CREB phosphorylation. This dependency
persists in Mg2+-free medium. A representative
experiment that was repeated twice is shown. B,
Na+ is necessary for glutamate-mediated
phosphorylation of Ser133 CREB. In medium without
Na+ ( Na+) glutamate (50 µM) cannot induce Ser133 CREB
phosphorylation. This dependency persists in
Mg2+-free medium. Treatments are shown in duplicates
from a representative experiment that was repeated twice.
C, Na+ channels are not involved in
Ser133 CREB phosphorylation. The voltage-operated
Na+ channel blocker TTX (2 µM) does
not block glutamate (50 µM)- or FPL 64176 (20 µM)-mediated CREB phosphorylation. Treatments are shown
in duplicates from a representative experiment that was repeated three
times. indicates control without agonist.
|
|
Glutamate-mediated CREB phosphorylation and gene expression are
supported by AMPA/kainate receptors
The role of AMPA/kainate receptors in glutamate-mediated gene
expression was investigated with the AMPA/kainate receptor inhibitors GYKI 52466 (50 µM) and DNQX (100 µM; Fig.
5). Because DNQX can bind the glycine
site of the NMDA receptor (Patel et al., 1990 ) and thus has inhibitory
properties for NMDA and AMPA/kainate receptors, we used the more
specific AMPA/kainate inhibitor GYKI 52466 in experiments that
differentiated inhibition of the NMDA receptor from that of
AMPA/kainate receptors. Both inhibitors partially blocked glutamate (50 µM)- and NMDA (50 µM)-mediated CREB
phosphorylation and c-fos gene expression (DNQX not shown)
and completely blocked AMPA (50 µM)- and kainate (50 µM)-mediated CREB phosphorylation and c-fos
gene expression (Fig. 5A,B). FPL
64176 (20 µM)-mediated CREB phosphorylation or
c-fos gene expression was not affected by GYKI 52466 (see
Figs. 5A,B,
10B,D) or DNQX (data not shown). In
transfection assays with the 3xCRE-luciferase construct,
glutamate-and AMPA-mediated induction was blocked by DNQX (Fig.
5C).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5.
The AMPA/kainate antagonists GYKI 52466 and DNQX
block ionotropic glutamate receptors to varying degrees, but they do
not block L-type Ca2+ channels in primary striatal
cultures. A, Ser133 CREB
phosphorylation mediated by AMPA (50 µM) or kainate (50 µM) was fully blocked by GYKI 52466 (GYKI;
50 µM). Glutamate (50 µM)- and NMDA (50 µM)-mediated CREB phosphorylation was partially blocked
by GYKI 52466, whereas FPL 64176 (20 µM)-mediated CREB
phosphorylation was not blocked by GYKI 52466. Treatments are shown in
duplicates. (See also Fig. 10.) B, c-fos
gene expression induced by AMPA (50 µM) or kainate (50 µM) was fully blocked by GYKI 52466 (50 µM), whereas c-fos gene expression induced
by glutamate (50 µM) or NMDA (50 µM) was
partially blocked by GYKI 52466. c-fos gene expression
induced by FPL 64176 (20 µM) was not blocked by GYKI
52466. The experiment was repeated three times. (See also Fig. 10.)
C, DNQX (100 µM) reduced glutamate (50 µM)-mediated induction and blocked AMPA (50 µM)-mediated induction of the
3xCRE-luciferase construct (n = 6).
Asterisks mark statistically significant differences
between groups that are linked in the graph. Data are the average ± SEM. D, Mg2+ prevents
phosphorylation of Ser133 CREB by NMDA (50 µM) in the absence of AMPA/kainate activity. In
glutamate-free medium, NMDA (50 µM) has little effect on
CREB phosphorylation in the presence of Mg2+ (2 mM) but readily induces CREB phosphorylation in the absence
of Mg2+ (compare
+Mg2+/ glutamate with
Mg2+/ glutamate). Ambient
glutamate levels (2-5 µM) are sufficient to prevent
Mg2+ (2 mM) from blocking NMDA-mediated
CREB phosphorylation (compare
+Mg2+/ glutamate with
+Mg2+/+glutamate). In the presence
of Mg2+ (2 mM) the AMPA/kainate receptor
antagonist GYKI 52466 (50 µM) blocks NMDA (50 µM)-mediated CREB phosphorylation but has little effect
in the absence of Mg2+ (compare all three
conditions). A representative experiment that was repeated twice is
shown. Note that +glutamate indicates the exposure to 10 µM glutamate 24 hr before the experiment until the
conclusion of the experiment; glutamate indicates a
change to glutamate-free medium 24 hr before the experiment until the
conclusion of the experiment. Small amounts of metabolic glutamate (in
the nanomolar range) released during the 24 hr may be present in the
medium and explain the slight increase of CREB phosphorylation in the
+Mg2+/ glutamate condition. indicates control without agonist.
|
|
AMPA/kainate receptors relieve the Mg2+ block of
the NMDA receptor
The role of AMPA/kainate receptors in NMDA-mediated CREB
phosphorylation was further revealed in experiments that examined the
effect of Mg2+ (Fig. 5D). With ambient
glutamate (2-5 µM), NMDA induced CREB phosphorylation
despite the presence of Mg2+ (2 mM; Fig.
5D,
+Mg2+/+glutamate). This
phosphorylation was blocked by the AMPA/kainate antagonist GYKI 52466 (50 µM). In the absence of glutamate, NMDA (50 µM) did not induce CREB phosphorylation in the presence
of Mg2+ (Fig. 5D,
+Mg2+/ glutamate). In the absence
of Mg2+, NMDA-induced CREB phosphorylation was
independent of AMPA/kainate receptors because it was insensitive to
GYKI 52466 and did not require ambient glutamate (Fig. 5D,
Mg2+/ glutamate). These data
suggest that AMPA/kainate receptors are necessary for removal of the
Mg2+ block of NMDA receptors.
L-type Ca2+ channels are necessary for
glutamate-mediated CREB phosphorylation and gene expression
The role of L-type Ca2+ channels in CREB
phosphorylation and gene expression stimulated by ionotropic glutamate
receptors was examined with the L-type Ca2+ channel
blocker nifedipine (Fig. 6). Nifedipine
(20 µM) blocked CREB phosphorylation induced by
glutamate, NMDA, AMPA, or kainate (all 50 µM) or by the
L-type Ca2+ channel agonist FPL 64176 (20 µM; see Figs. 6A,D,
10A,B). The block of glutamate
receptor-mediated CREB phosphorylation was also observed with another
L-type Ca2+ channel antagonist, verapamil (data not
shown). Likewise, induction of c-fos gene expression by
ionotropic glutamate receptor agonists (50 µM) and by FPL
64176 (20 µM) was blocked by nifedipine (20 µM; see Figs. 6B,
10C,D). In transfection experiments with
the 3xCRE-luciferase construct, nifedipine (20 µM) inhibited glutamate- and FPL 64176-induced increases
in luciferase expression (Fig. 6C). Because a transient
phosphorylation of CREB in the presence of nifedipine may not have been
detected after 15 min, we harvested cultures between 1 and 15 min after
glutamate stimulation in the presence or absence of nifedipine (20 µM). Nifedipine blocked glutamate-mediated CREB
phosphorylation at all times examined (Fig. 6D; note
that this time course is different from the time course in Fig.
1B, because the cells were harvested immediately after treatment). Because neurons in culture synapse onto each other,
we examined whether the GABA antagonists bicuculline (Fig. 6E) or picrotoxin (data not shown) affect the
inhibitory potency of nifedipine on glutamate-mediated
Ser133 CREB phosphorylation. Neither antagonist
stimulated CREB phosphorylation, nor did either affect the potency of
nifedipine. In line with the excitatory properties of GABA in early
development (Cherubini et al., 1991 ), both antagonists slightly
inhibited CREB phosphorylation after glutamate treatment.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6.
L-type Ca2+ channel blockers inhibit
ionotropic glutamate receptor-mediated CREB phosphorylation in primary
striatal cultures. A, Ser133 CREB
phosphorylation after treatment with NMDA (50 µM), AMPA
(50 µM), kainate (50 µM), and FPL 64176 (20 µM) is blocked by the L-type Ca2+
channel antagonist nifedipine (20 µM). All treatments are
shown in duplicates. The experiment was repeated once. (See also Fig.
10.) B, c-fos mRNA induced by glutamate
(50 µM), NMDA (50 µM), AMPA (50 µM), kainate (50 µM), and FPL 64176 (20 µM) is inhibited by nifedipine (20 µM). The
experiment was repeated three times. (See also Fig. 10.)
C, Nifedipine (20 µM) inhibited glutamate
(50 µM)- and FPL 64176 (20 µM)-mediated
induction of the 3xCRE-luciferase construct
(n = 6). Asterisks mark
statistically significant differences between groups that are linked in
the graph. Data are the average ± SEM. D,
Nifedipine (20 µM) blocked glutamate (50 µM)-mediated CREB phosphorylation independent of time of
exposure to glutamate. Cultures were exposed to glutamate for the
times indicated above the
blots and harvested immediately after exposure.
Pretreatment with nifedipine (20 min) blocked glutamate-mediated CREB
phosphorylation at all times. The experiment was repeated three times.
E, The GABA receptor antagonist bicuculline (100 µM) did not prevent the inhibitory action of nifedipine
(20 µM) on glutamate (50 µM)-mediated CREB
phosphorylation. Preincubation with bicuculline did not increase
glutamate-mediated CREB phosphorylation, nor did it affect the
inhibitory action of nifedipine on glutamate-mediated CREB
phosphorylation. indicates control without agonist.
|
|
An antisense oligonucleotide approach was used to confirm these
results. A knockdown of L-type Ca2+ channels with
antisense oligonucleotides against the 1C and 1D subunits of
Ca2+ channels diminished glutamate- and FPL
64176-induced CREB phosphorylation significantly (Fig.
7A,B),
supporting a role for L-type Ca2+ channels in
glutamate-mediated CREB phosphorylation. With an antibody against
1C, a decrease in 1C protein was detected in cultures treated
with antisense oligonucleotides (Fig. 7A, 1C). No change in total CREB protein was seen (Fig. 7A,
CREB).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 7.
Knockdown of the L-type
Ca2+ channel reduces CREB phosphorylation after
treatment of cultures with glutamate or with FPL 64176. Knockdown of
the NMDA receptor reduces CREB phosphorylation only after treatment
with NMDA (50 µM). Striatal cultures were exposed to
antisense oligonucleotides (AS) against the 1
subunits of the L-type Ca2+ channel ( 1C and
1D) (A, B) or against the NMDA receptor (NR1, NR2A,
and NR2B) (C, D) for 5 d and treated with glutamate
(50 µM), NMDA (50 µM), or FPL 64176 (20 µM). In control experiments, sister cultures were treated
with scrambled antisense oligonucleotides (SAS).
A, Immunoblots developed with the
Ser133 CREB antiserum
(P-CREB), an antiserum against the 1C subtype
of the L-type Ca2+ channel ( 1C),
or an antiserum against CREB (CREB). The antisense
treatment reduced the 1C subtype of the L-type
Ca2+ channel but not the levels of total CREB
protein. Glutamate (50 µM)- and FPL 64176 (20 µM)-mediated CREB phosphorylation was partially blocked
by the antisense treatment. B, Average induction of CREB
phosphorylation (± SEM) after treatment with glutamate (50 µM) or FPL 64176 (20 µM) in cultures
exposed to SAS (control) or AS
(n = 4). The reduction in CREB phosphorylation in
the presence of antisense oligonucleotides was statistically
significant for glutamate-and FPL 64176-treated cultures (marked by
asterisks). C, Immunoblots developed with
the Ser133 CREB antiserum (P-CREB),
an antiserum against the NR1 subtype of the NMDA receptor
(NR1), or an antiserum against CREB protein
(CREB). Levels of NR1 protein were reduced, whereas
levels of total CREB protein were unaffected. The antisense treatment
partially blocked NMDA (50 µM)-mediated CREB
phosphorylation but did not affect FPL 64176 (20 µM)-mediated CREB phosphorylation. D,
Average induction of CREB phosphorylation (± SEM) after treatment with
NMDA (50 µM) or FPL 64176 (20 µM) in
cultures exposed to SAS (control) or AS
(n = 4). The reduction in CREB phosphorylation in
the presence of antisense oligonucleotides was statistically
significant for NMDA-treated cultures (marked by
asterisks).
|
|
FPL 64176-mediated CREB phosphorylation and gene expression are
independent of functional ionotropic glutamate receptors
The NMDA antagonist MK 801 (1 µM) did not block FPL
64176 (20 µM)-mediated CREB phosphorylation (see Figs.
8A, 10B), even at concentrations
submaximal for the stimulation of CREB phosphorylation (Fig.
8B). Likewise, the
AMPA/kainate antagonists GYKI 52466 (50 µM; see Figs.
5A, 10B) or DNQX (100 µM;
data not shown) had no effect on FPL 64176-mediated CREB
phosphorylation, nor did a combination of NMDA and AMPA/kainate
receptor antagonists [MK 801 (1 µM) and DNQX (100 µM); Fig. 8C]. Knockdown of NMDA receptors
with antisense oligonucleotides had no effect on FPL 64176 (20 µM)-mediated CREB phosphorylation but reduced CREB
phosphorylation after NMDA (50 µM) treatment (Fig.
7C,D). A combination of antisense
oligonucleotides against NR1, NR2A, and NR2B was used in these
experiments, and NR1 protein was reduced in antisense-treated cultures
(Fig. 7C, NR1). NR1 is a necessary component of
all NMDA receptors (Hollmann and Heinemann, 1994 ), and NR2A and NR2B
are the most prevalent NR2 subtypes in the striatum (Standaert et al.,
1994 ; Landwehrmeyer et al., 1995 ; Mutel et al., 1998 ). c-fos
gene expression activated by L-type Ca2+ channel
agonists was also unaffected by the AMPA/kainate antagonist GYKI 52466 (50 µM; see Figs. 5B, 10D)
and the NMDA antagonist MK 801 (1 µM; Fig.
8D). Combinations of FPL 64176 and AMPA or of FPL
64176 and NMDA were unaffected by MK 801 or by GYKI 52466 (Fig.
9), although these combinations were
blocked by the L-type Ca2+ channel antagonist
nifedipine. Moreover, Ser133 CREB phosphorylation
induced by a combination of the glutamate receptor agonists AMPA and
NMDA was significantly blocked by nifedipine (20 µM), MK
801 (1 µM), and GYKI 52466 (50 µM; Fig. 9).
A comparison of the inhibitory properties of MK 801, GYKI 52466, and
nifedipine on glutamate- and FPL 64176-activated CREB
phosphorylation and c-fos gene expression is shown in Figure
10.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 8.
Ionotropic glutamate receptor antagonists cannot
block FPL 64176-mediated Ser133 CREB
phosphorylation in primary striatal cultures. A, The
NMDA antagonist MK 801 (1 µM) does not block FPL 64176 (20 µM)-mediated CREB phosphorylation. All treatments
are shown in duplicates. The experiment was repeated four times in
duplicates. (See also Fig. 9.) B, Lower concentrations
of FPL 64176 (0.5 and 1 µM) are also not blocked by MK
801. All treatments are shown in duplicates. C, A
mixture of DNQX (100 µM) and MK 801 (1 µM)
does not block FPL 64176 (20 µM)-mediated CREB
phosphorylation. All treatments are shown in duplicates. The experiment
was repeated twice. D, c-fos gene
expression induced by FPL 64176 (20 µM) is not blocked by
MK 801 (1 µM). Duplicate treatments are shown in two
separate blots. (See also Fig. 9.) indicates control without
agonist.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Figure 9.
The induction of
Ser133 CREB phosphorylation by ionotropic glutamate
receptor agonists together with the L-type Ca2+
channel agonist FPL 64176 is inhibited by nifedipine but not by
ionotropic glutamate receptor antagonists. Primary striatal cultures
were treated with AMPA (50 µM) and NMDA (50 µM), FPL 64176 (20 µM) and AMPA (50 µM), or FPL 64176 (20 µM) and NMDA (50 µM). A, B,
Left, Immunoblots with the Ser133
phospho-CREB antiserum are shown. Right, The bar
graphs show the average fold induction of
Ser133 CREB phosphorylation (± SEM) of six
experiments. Asterisks mark statistically significant
differences from the group treated with the agonist mixture.
A, The induction of CREB phosphorylation was
significantly blocked by the L-type Ca2+
channel antagonist nifedipine (20 µM) in all treatments
but was not blocked by the NMDA antagonist MK 801 (1 µM)
whenever FPL 64176 was part of the mixture. B, The
induction of CREB phosphorylation was not blocked by the AMPA/kainate
antagonist GYKI 52466 (50 µM) in the presence of FPL
64176. indicates control without agonist.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 10.
Average fold induction of
Ser133 CREB phosphorylation and c-fos
gene expression mediated by glutamate or FPL 64176 and inhibited by MK
801, GYKI 52466, or nifedipine. Each antagonist treatment was compared
with the agonist treatment within the same blot. Different antagonists
were run in separate blots. Levels of induction after agonist treatment
were not identical in all blots and are presented in individual
bars for each antagonist. Data are the average ± SEM.
Asterisks mark statistically significant differences
between groups that are linked in the graph. A,
Glutamate (50 µM)-mediated CREB phosphorylation was
significantly reduced after pretreatment with MK 801 (1 µM; n = 6), GYKI 52466 (50 µM; n = 2), or nifedipine (20 µM; n = 4). B, FPL
64176 (20 µM)-mediated CREB phosphorylation was
unaffected by MK 801 (1 µM; n = 9)
and by GYKI 52466 (50 µM; n = 2) but
was blocked by nifedipine (20 µM; n = 10). C, Glutamate (50 µM)-mediated
c-fos gene expression was significantly reduced after
pretreatment with MK 801 (1 µM; n = 10) or nifedipine (20 µM; n = 4). The
reduction after pretreatment with GYKI 52466 (50 µM;
n = 4) was not significant. D, FPL
64176 (20 µM)-mediated c-fos gene
expression was unaffected by MK 801 (1 µM;
n = 8) and by GYKI 52466 (50 µM;
n = 4) but was blocked by nifedipine (20 µM; n = 6).
|
|
 |
DISCUSSION |
Glutamate mediates CREB phosphorylation and gene expression in
primary striatal cultures in a Ca2+- and
Na+-dependent manner
Glutamate was a potent inducing agent of Ser133
CREB phosphorylation in primary striatal cultures. Phosphorylation of
Ser133 CREB was dependent on Ca2+
and Na+ and reached maximum levels after a 3 min
exposure to glutamate. The subsequent expression of Fos protein was
observed between 1 and 5 hr. The timing of induction of CREB
phosphorylation and Fos protein expression is in agreement with
regulation of the c-fos gene by Ser133
phospho-CREB. Glutamate treatment had no effect on the levels of CREB
protein, consistent with the notion that CREB activates gene expression
after it is phosphorylated on Ser133 and not via an
increase in its protein levels. Because the c-fos promoter
can also be regulated by regulatory elements other than CREB, we
examined the regulation of a transfected reporter gene, luciferase,
under the exclusive control of three copies of a consensus CREB-binding
site (CRE). The regulation of the 3xCRE-luciferase reporter
construct by ionotropic glutamate receptor agonists was comparable with
the regulation of the endogenous c-fos gene.
AMPA/kainate receptors activate the NMDA receptor by relieving the
Mg2+ block
AMPA/kainate receptor agonists induced CREB phosphorylation and
c-fos gene expression by an NMDA receptor-dependent
mechanism. In glutamate-containing medium, NMDA antagonists blocked
AMPA- and kainate-mediated Ser133 CREB
phosphorylation and c-fos gene expression, demonstrating the
need for functional NMDA receptors. In the presence of
Mg2+, AMPA/kainate receptors provided the
depolarization that enabled the NMDA receptor to open in response to
glutamate and glycine. In fact, the ability of the NMDA receptor to
mediate CREB phosphorylation in Mg2+-containing
medium was significantly hampered when AMPA/kainate receptors were
blocked. Our data suggest that a preexisting interaction of the NMDA
receptor with ambient glutamate and glycine levels caused channel
opening after the relief of the Mg2+ block by
AMPA/kainate receptors. In glutamate-free medium, AMPA/kainate receptor
agonists could not induce Ser133 CREB
phosphorylation (data not shown). NMDA receptors induced CREB
phosphorylation in glutamate-free medium only in the absence of
Mg2+ but depended on glutamate (and AMPA/kainate
receptors) in the presence of Mg2+.
Two findings support the hypothesis that AMPA/kainate receptors
mediate gene expression by removing the Mg2+ block
of NMDA receptors; in the absence of extracellular NMDA or
glutamate or when NMDA receptors were blocked, AMPA/kainate receptor
stimulation could not induce CREB phosphorylation. Furthermore, in the
absence of Mg2+, AMPA/kainate receptors were
irrelevant for NMDA receptor-mediated phosphorylation of
Ser133 CREB.
L-type Ca2+ channels are essential for
glutamate-mediated CREB phosphorylation and gene expression in primary
striatal cultures
Ionotropic glutamate receptors induced CREB phosphorylation and
c-fos gene expression with the assistance of L-type
Ca2+ channels. Antagonists of L-type
Ca2+ channels were able to reduce significantly the
induction of CREB phosphorylation and gene expression by all ionotropic
glutamate receptor agonists, alone or in combination. The effect of
L-type Ca2+ channel blockers was independent of GABA
activity in the cultures, because the potency of the block was not
changed by GABA antagonists. Antisense oligonucleotides against the two
1 subtypes of the L-type Ca2+ channel in the
brain, 1C and 1D, significantly reduced CREB phosphorylation
mediated by glutamate or FPL 64176, whereas antisense oligonucleotides
against the NMDA receptor had no effect on FPL 64176-mediated CREB
phosphorylation. Glutamate-mediated CREB phosphorylation was dependent
on Na+ ions yet independent of TTX-sensitive
Na+ channels. This finding suggests that
Na+ influx specifically through ionotropic glutamate
receptors may be a necessary step toward glutamate-mediated CREB
phosphorylation. We hypothesize that Na+ influx
through NMDA receptors is important to depolarize the neuron and to
trigger the opening of L-type Ca2+ channels. Even
though there was Ca2+ in the
Na+-free medium, it was not enough to stimulate an
intraneuronal second messenger pathway and CREB phosphorylation. This
suggests that Na+ and Ca2+ ions
have different roles in the signal transduction pathway, Na+ via membrane depolarization viaNMDA receptors
and Ca2+ via membrane depolarization via L-type
Ca2+ channels and via stimulation of the
intracellular second messenger pathway.
AMPA/kainate receptors, NMDA receptors, and L-type
Ca2+ channels contribute consecutively to the same
signal transduction pathway
One important question was whether signals from ionotropic
glutamate receptors and L-type Ca2+ channels mediate
c-fos gene expression by distinct calcium-signaling pathways, as has been suggested for other culture systems (Bading et
al., 1993 ; Hardingham et al., 1997 ). It has been found that the two
primary cis-acting regulatory elements of the
c-fos promoter, the CRE and the serum response element
(SRE), are regulated differentially depending on the mode of calcium
entry. The CRE is regulated by nuclear calcium from the L-type calcium
channels, and the SRE is regulated by cytoplasmic calcium from the NMDA
receptor (Bading et al., 1993 ; Hardingham et al., 1997 ). However, in
our cultures, NMDA receptor-induced c-fos gene expression
was dependent on L-type Ca2+ channels. Comparable
regulation of CREB phosphorylation and c-fos gene expression
was observed. Furthermore, direct activation of the L-type
Ca2+ channels with FPL 64176 induced
c-fos gene expression. This suggests that in our striatal
cultures, either the SRE is not active or the L-type
Ca2+ channel is able to provide all the factors
necessary for c-fos transcriptional activation, including
the SRE. The pharmacological profile of the ionotropic glutamate
receptor antagonists and of the L-type Ca2+ channel
blockers allowed us to determine further that AMPA/kainate receptors,
NMDA receptors, and L-type Ca2+ channels contribute
consecutively to Ser133 CREB phosphorylation (see below).
The sequence of events leading from glutamate receptor
activation to gene expression
AMPA/kainate receptor channels open after interaction with
glutamate and permit Na+ entry at the synapse
(Kandel et al., 1991 ). The resulting local depolarization removes the
Mg2+ block of the NMDA receptor, which permits the
NMDA receptor to respond to extracellular glutamate and glycine.
Opening of the NMDA receptor channel causes Na+ and
Ca2+ influx. Unlike the AMPA/kainate receptor
channel that desensitizes rapidly, NMDA receptor channels have long
opening times (Ascher and Nowak, 1987 ; Gasic and Hollmann, 1992 ).
Therefore, NMDA receptors can trigger the opening of L-type
Ca2+ channels that open during strong depolarization
(Tsien et al., 1988 ). The activation of L-type Ca2+
channels promotes Ca2+ entry along the dendrites and
at the cell body (Westenbroek et al., 1990 ; Schild et al., 1995 ).
Second messengers activated by Ca2+ translocate to
the nucleus and phosphorylate CREB (Deisseroth et al., 1998 ) (Fig.
11).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 11.
Model of the interaction of AMPA/kainate
receptors, NMDA receptors, and L-type Ca2+ channels
in striatal Ser133 CREB phosphorylation and gene
expression. 1, The activation of AMPA/kainate receptors
causes Na+ influx and a local depolarization that
relieves the Mg2+ block of the NMDA receptor.
2a, Activation of the NMDA receptor via ligand
binding and depolarization leads to Na+ influx as
well as Ca2+ influx. Unlike the AMPA/kainate
receptors, NMDA receptors do not rapidly desensitize and allow for a
depolarization that is strong enough to trigger the opening of L-type
Ca2+ channels. 3, L-type
Ca2+ channels allow for Ca2+
influx and activation of a kinase pathway that translocates to the
nucleus to phosphorylate Ser133 CREB.
2b, A signal transduction cascade originating at NMDA
receptors that is independent of L-type Ca2+
channels is negligible for CREB phosphorylation or c-fos
gene expression in primary striatal cultures.
|
|
Our results suggest an important role for L-type
Ca2+ channels in neuroplasticity of the striatum and
confirm previous reports about the involvement of L-type
Ca2+ channels in NMDA-mediated plasticity and
toxicity (Weiss et al., 1990 ; Westenbroek et al., 1990 ; Chetkovich et
al., 1991 ; Sucher et al., 1991 ; Aroniadou et al., 1993 ). Under our
experimental conditions, NMDA receptors initiated a signal transduction
pathway but did not initiate a significant intraneuronal second
messenger pathway, either alone or together with AMPA/kainate
receptors. Depolarization of L-type Ca2+ channels
played a crucial role in the activation of an intraneuronal second
messenger pathway.
Although the supportive role of AMPA/kainate receptors for NMDA
receptors is in agreement with previous findings in hippocampal culture
(Bading et al., 1995 ), other findings differ. In hippocampal cultures
NMDA receptors and L-type Ca2+ channels seem to
contribute to independent, parallel pathways rather than to the same
pathway (Bading et al., 1993 , 1995 ). Like in hippocampal cultures,
L-type Ca2+ channels in the striatum activate the
CRE and function independently of NMDA receptors. But although we do
not exclude a direct pathway from NMDA receptors to the SRE in the
striatum, this pathway in itself is not enough to mediate
c-fos gene expression. This difference may be attributed to
intrinsic differences between both types of neurons or to the different
neurotransmitters released in either culture. Hippocampal neurons are
mostly glutamatergic and express very high levels of glutamate
receptors (Jarvis et al., 1987 ; Miyoshi et al., 1991 ; Sakurai et al.,
1991 ). Striatal cultures are primarily GABAergic and express much lower
levels of glutamate receptors (Jarvis et al., 1987 ; Miyoshi et
al., 1991 ; Sakurai et al., 1991 ). Because neurons in culture synapse
onto each other, hippocampal neurons excite each other after
activation, whereas GABA in striatal neurons, dependent on the level of
maturity (Cherubini et al., 1991 ), may be excitatory or inhibitory. To
avoid trans-synaptic effects in hippocampal cultures,
Na+ channels are often blocked with TTX. We repeated
some of our experiments in the presence of TTX but observed results
comparable with those of experiments without TTX (data not shown).
Thus, there are fundamental differences in glutamate-mediated gene
expression in neurons of both brain areas.
 |
FOOTNOTES |
Received Dec. 22, 1998; revised May 14, 1999; accepted May 17, 1999.
This work was supported by the National Alliance for Research on
Schizophrenia and Depression (C.K.) and the National Institute of Drug
Abuse Grant DA07134 (C.K.).
Correspondence should be addressed to Dr. Christine Konradi, Laboratory
of Molecular and Developmental Neuroscience, Massachusetts General
Hospital, CNY 2510, Building 149, 13th Street,
Charlestown, MA 02129.
 |
REFERENCES |
-
Ahn S,
Olive M,
Aggarwal S,
Krylov D,
Ginty DD,
Vinson C
(1998)
A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos.
Mol Cell Biol
18:967-977[Abstract/Free Full Text].
-
Aroniadou VA,
Maillis A,
Stefanis CC
(1993)
Dihydropyridine-sensitive calcium channels are involved in the induction of N-methyl-D-aspartate receptor-independent long-term potentiation in visual cortex of adult rats.
Neurosci Lett
151:77-80[Web of Science][Medline].
-
Aronin N,
Chase K,
Sagar SM,
Sharp FR,
DiFiglia M
(1991)
N-Methyl-D-aspartate receptor activation in the neostriatum increases c-fos and fos-related antigens selectively in medium-sized neurons.
Neuroscience
44:409-420[Web of Science][Medline].
-
Ascher P,
Nowak L
(1987)
Electrophysiological studies of NMDA receptors.
Trends Neurosci
10:284-287[Web of Science].
-
Bading H,
Ginty DD,
Greenberg ME
(1993)
Regulation of gene expression in hippocampal neurons by distinct calcium signaling pathways.
Science
260:181-186[Abstract/Free Full Text].
-
Bading H,
Segal MM,
Sucher NJ,
Dudek H,
Lipton SA,
Greenberg ME
(1995)
N-Methyl-D-aspartate receptors are critical for mediating the effects of glutamate on intracellular calcium concentration and immediate early gene expression in cultured hippocampal neurons.
Neuroscience
64:653-664[Web of Science][Medline].
-
Bailey CH,
Bartsch D,
Kandel ER
(1996)
Toward a molecular definition of long-term memory storage.
Proc Natl Acad Sci USA
93:13445-13452[Abstract/Free Full Text].
-
Bernheimer H,
Birkmayer W,
Hornykiewicz O,
Jellinger K,
Seitelberger F
(1973)
Brain dopamine and the syndromes of Parkinson and Huntington. Clinical, morphological and neurochemical correlations.
J Neurol Sci
20:415-455[Web of Science][Medline].
-
Bito H,
Deisseroth K,
Tsien RW
(1996)
CREB phosphorylation and dephosphorylation: a Ca2+- and stimulus duration-dependent switch for hippocampal gene expression.
Cell
87:1203-1214[Web of Science][Medline].
-
Bonni A,
Ginty DD,
Dudek H,
Greenberg ME
(1995)
Serine 133-phosphorylated CREB induces transcription via a cooperative mechanism that may confer specificity to neurotrophin signals.
Mol Cell Neurosci
6:168-183[Web of Science][Medline].
-
Bourtchuladze R,
Frenguelli B,
Blendie J,
Cioffi D,
Schütz G,
Silva AJ
(1994)
Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive element-binding protein.
Cell
79:59-68[Web of Science][Medline].
-
Buchsbaum MS,
Haier RJ,
Potkin SG,
Nuechterlein K,
Bracha HS,
Katz M,
Lohr J,
Wu J,
Lottenberg S,
Jerabek PA
(1992)
Frontostriatal disorder of cerebral metabolism in never-medicated schizophrenics.
Arch Gen Psychiatry
49:935-942[Abstract/Free Full Text].
-
Burns RS
(1991)
Subclinical damage to the nigrostriatal dopamine system by MPTP as a model of preclinical Parkinson's disease: a review.
Acta Neurol Scand Suppl
136:29-36[Medline].
-
Burt DR,
Creese I,
Snyder SH
(1977)
Antischizophrenic drugs: chronic treatment elevates dopamine receptor binding in brain.
Science
196:326-328[Abstract/Free Full Text].
-
Busatto GF,
Kerwin RW
(1997)
Schizophrenia, psychosis, and the basal ganglia.
Psychiatr Clin North Am
20:897-910[Web of Science][Medline].
-
Calne DB,
Langston JW,
Martin WR,
Stoessl AJ,
Ruth TJ,
Adam MJ,
Pate BD,
Schulzer M
(1985)
Positron emission tomography after MPTP: observations relating to the cause of Parkinson's disease.
Nature
317:246-248[Medline].
-
Catterall WA
(1991)
Functional subunit structure of voltage-gated calcium channels.
Science
253:1499-1500[Free Full Text].
-
Catterall WA,
Striessnig J
(1992)
Receptor sites for Ca2+ channel antagonists.
Trends Pharmacol Sci
13:256-262[Medline].
-
Cherubini E,
Gaiarsa JL,
Ben-Ari Y
(1991)
GABA: an excitatory transmitter in early postnatal life.
Trends Neurosci
14:515-519[Web of Science][Medline].
-
Chetkovich DM,
Gray R,
Johnston D,
Sweatt JD
(1991)
N-Methyl-D-aspartate receptor activation increases cAMP levels and voltage-gated Ca2+ channel activity in area CA1 of hippocampus.
Proc Natl Acad Sci USA
88:6467-6471[Abstract/Free Full Text].
-
Cole AJ,
Saffen DW,
Baraban JM,
Worley PF
(1989)
Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation.
Nature
340:474-476[Medline].
-
Connor JA,
Wadman WJ,
Hockberger PE,
Wong RK
(1988)
Sustained dendritic gradients of Ca2+ induced by excitatory amino acids in CA1 hippocampal neurons.
Science
240:649-653[Abstract/Free Full Text].
-
Danielson PE,
Forss-Petter S,
Brow MA,
Calavetta L,
Douglass J,
Milner RJ,
Sutcliffe JG
(1988)
p1B15: a cDNA clone of the rat mRNA encoding cyclophilin.
DNA
7:261-267[Web of Science][Medline].
-
Dave JR,
Tortella FC
(1994)
Regional changes in c-fos mRNA in rat brain after i.v. or i.c.v. NMDA injections.
NeuroReport
5:1645-1648[Web of Science][Medline].
-
Deadwyler SA,
Dunwiddie T,
Lynch G
(1987)
A critical level of protein synthesis is required for long-term potentiation.
Synapse
1:90-95[Web of Science][Medline].
-
Deisseroth K,
Tsien RW
(1997)
Calmodulin translocation to the nucleus mediates rapid synaptic control of CREB phosphorylation in hippocampal neurons.
Soc Neurosci Abstr
23:311.
-
Deisseroth K,
Heist EK,
Tsien RW
(1998)
Translocation of calmodulin to the nucleus supports CREB phosphorylation in hippocampal neurons.
Nature
392:198-202[Medline].
-
DiFiglia M
(1990)
Excitotoxic injury of the neostriatum: a model for Huntington's disease.
Trends Neurosci
13:286-289[Web of Science][Medline].
-
Eastwood SL,
Burnet PW,
Harrison PJ
(1994)
Striatal synaptophysin expression and haloperidol-induced synaptic plasticity.
NeuroReport
5:677-680[Web of Science][Medline].
-
Eastwood SL,
Heffernan J,
Harrison PJ
(1997)
Chronic haloperidol treatment differentially affects the expression of synaptic and neuronal plasticity-associated genes.
Mol Psychiatry
2:322-329[Web of Science][Medline].
-
Egebjerg J,
Heinemann SF
(1993)
Ca2+ permeability of unedited and edited versions of the kainate selective glutamate receptor GluR6.
Proc Natl Acad Sci USA
90:755-759[Abstract/Free Full Text].
-
Gasic G,
Hollmann M
(1992)
Molecular neurobiology of glutamate receptors.
Annu Rev Physiol
54:507-536[Web of Science][Medline].
-
Ghosh A,
Ginty DD,
Bading H,
Greenberg ME
(1994)
Calcium regulation of gene expression in neuronal cells.
J Neurobiol
25:294-303[Web of Science][Medline].
-
Ginty DD,
Kornhauser JM,
Thompson MA,
Bading H,
Mayo KE,
Takahashi JS,
Greenberg ME
(1993)
Regulation of CREB phosphorylation in the suprachiasmatic nucleus by light and circadian clock.
Science
260:238-241[Abstract/Free Full Text].
-
Gonzalez GA,
Montminy MR
(1989)
Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133.
Cell
59:675-680[Web of Science][Medline].
-
Greenamyre JT,
Porter RH
(1994)
Anatomy and physiology of glutamate in the CNS.
Neurology
44:S7-S13[Medline].
-
Hardingham GE,
Chawla S,
Johnson CM,
Bading H
(1997)
Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression.
Nature
385:260-265[Medline].
-
Heckers S
(1997)
Neuropathology of schizophrenia: cortex, thalamus, basal ganglia, and neurotransmitter-specific projection systems.
Schizophr Bull
23:403-421.
-
Hofmann F,
Biel M,
Flockerzi V
(1994)
Molecular basis for Ca2+ channel diversity.
Annu Rev Neurosci
17:399-418[Web of Science][Medline].
-
Hollmann M,
Heinemann S
(1994)
Cloned glutamate receptors.
Annu Rev Neurosci
17:31-108[Web of Science][Medline].
-
Hollmann M,
Hartley M,
Heinemann S
(1991)
Ca2+ permeability of KA-AMPA-gated glutamate receptor channels depends on subunit composition.
Science
252:851-853[Abstract/Free Full Text].
-
Hornykiewicz O
(1993)
Parkinson's disease and the adaptive capacity of the nigrostriatal dopamine system: possible neurochemical mechanisms.
Adv Neurol
60:140-147[Medline].
-
Hyman SE
(1996)
Addiction to cocaine and amphetamine.
Neuron
16:901-904[Web of Science][Medline].
-
Hyman SE,
Nestler EJ
(1996)
Initiation and adaptation: a paradigm for understanding psychotropic drug action.
Am J Psychiatry
153:151-162[Abstract/Free Full Text].
-
Impey S,
Villacres EC,
Poser S,
Chavkin C,
Storm DR
(1996)
Induction of CRE-mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the hippocampus.
Neuron
16:973-982[Web of Science][Medline].
-
Jarvis MF,
Murphy DE,
Williams M
(1987)
Quantitative autoradiographic localization of NMDA receptors in rat brain using [3H]CPP: comparison with [3H]TCP binding sites.
Eur J Pharmacol
141:149-152[Web of Science][Medline].
-
Johnson JW,
Ascher P
(1987)
Glycine potentiates the NMDA response in cultured mouse brain neurons.
Nature
325:529-531[Medline].
-
Kandel ER,
Schwartz JH,
Jessell TM
(1991)
In: Principles of neural science. New York: Elsevier.
-
Knowlton BJ,
Mangels JA,
Squire LR
(1996)
A neostriatal habit learning system in humans.
Science
273:1399-1402[Abstract].
-
Kohler M,
Burnashev N,
Sakmann B,
Seeburg PH
(1993)
Determinants of Ca2+ permeability in both TM1 and TM2 of high affinity kainate receptor channels: diversity by RNA editing.
Neuron
10:491-500[Web of Science][Medline].
-
Konradi C,
Leveque JC,
Hyman SE
(1996)
Amphetamine and dopamine-induced immediate early gene expression in striatal neurons depends upon postsynaptic NMDA receptors and calcium.
J Neurosci
16:4231-4239[Abstract/Free Full Text].
-
Landwehrmeyer GB,
Standaert DG,
Testa CM,
Penney Jr JB,
Young AB
(1995)
NMDA receptor subunit mRNA expression by projection neurons and interneurons in rat striatum.
J Neurosci
15:5297-5307[Abstract].
-
Langston JW
(1996)
The etiology of Parkinson's disease with emphasis on the MPTP story.
Neurology
47:S153-S160[Web of Science][Medline].
-
Lerea LS,
McNamara JO
(1993)
Ionotropic glutamate receptor subtypes activate c-fos transcription by distinct calcium-requiring intracellular signaling pathways.
Neuron
10:31-41[Web of Science][Medline].
-
Lomeli H,
Mosbacher J,
Melcher T,
Hoger T,
Geiger JR,
Kuner T,
Monyer H,
Higuchi M,
Bach A,
Seeburg PH
(1994)
Control of kinetic properties of AMPA receptor channels by nuclear RNA editing.
Science
266:1709-1713[Abstract/Free Full Text].
-
MacDermott AB,
Mayer ML,
Westbrook GL,
Smith SJ,
Barker JL
(1986)
NMDA-receptor activation increases cytoplasmic calcium concentration in cultured spinal cord neurones.
Nature
321:519-522[Medline].
-
Matthies H
(1989)
In search of cellular mechanisms of memory.
Prog Neurobiol
32:277-349[Web of Science][Medline].
-
Maxwell IH,
Harrison GS,
Wood WM,
Maxwell F
(1989)
A DNA cassette containing a trimerized SV40 polyadenylation signal which efficiently blocks spurious plasmid-initiated transcription.
Biotechniques
7:276-280[Web of Science][Medline].
-
Mayer ML,
Westbrook GL,
Guthrie PB
(1984)
Voltage-dependent block by Mg2+ of NMDA responses in spinal cord neurones.
Nature
309:261-263[Medline].
-
McCleskey EW
(1994)
Calcium channels: cellular roles and molecular mechanisms.
Curr Opin Neurobiol
4:304-312[Medline].
-
Michaelis EK
(1998)
Molecular biology of glutamate receptors in the central nervous system and their role in excitotoxicity, oxidative stress and aging.
Prog Neurobiol
54:369-415[Web of Science][Medline].
-
Mijnster MJ,
Ingham CA,
Meredith GE,
Docter GJ,
Arbuthnott GW
(1996)
Morphological changes in met(5)-enkephalin-immunoreactive synaptic boutons in the rat neostriatum after haloperidol decanoate treatment.
Eur J Neurosci
8:716-726[Web of Science][Medline].
-
Misra RP,
Bonni A,
Miranti CK,
Rivera VM,
Sheng M,
Greenberg ME
(1994)
L-type voltage-sensitive calcium channel activation stimulates gene expression by a serum response factor-dependent pathway.
J Biol Chem
269:25483-25493[Abstract/Free Full Text].
-
Miyoshi R,
Kito S,
Doudou N,
Nomoto T
(1991)
Influence of age on N-methyl-D-aspartate antagonist binding sites in the rat brain studied by in vitro autoradiography.
Synapse
8:212-217[Web of Science][Medline].
-
Montminy MR,
Bilezikjian LM
(1987)
Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene.
Nature
328:175-178[Medline].
-
Montminy MR,
Gonzalez GA,
Yamamoto KK
(1990)
Regulation of cAMP-inducible genes by CREB.
Trends Neurosci
13:184-188[Web of Science][Medline].
-
Mosbacher J,
Schoepfer R,
Monyer H,
Burnashev N,
Seeburg PH,
Ruppersberg JP
(1994)
A molecular determinant for submillisecond desensitization in glutamate receptors.
Science
266:1059-1062[Abstract/Free Full Text].
-
Murphy D,
Segal M
(1997)
Morphological plasticity of dendritic spines in central neurons is mediated by activation of cAMP response element binding protein.
Proc Natl Acad Sci USA
94:1482-1487[Abstract/Free Full Text].
-
Murphy TH,
Worley PF,
Baraban JM
(1991)
L-type voltage-sensitive calcium channels mediate synaptic activation of immediate early genes.
Neuron
7:625-635[Web of Science][Medline].
-
Mutel V,
Buchy D,
Klingelschmidt A,
Messer J,
Bleuel Z,
Kemp JA,
Richards JG
(1998)
In vitro binding properties in rat brain of [3H]Ro 25-6981, a potent and selective antagonist of NMDA receptors con-taining NR2B subunits.
J Neurochem
70:2147-2155[Web of Science][Medline].
-
Nairn AC,
Shenolikar S
(1992)
The role of protein phosphatases in synaptic transmission, plasticity and neuronal development.
Curr Opin Neurobiol
2:296-301[Medline].
-
Nestler EJ,
Hope BT,
Widnell KL
(1993)
Drug addiction: a model for the molecular basis of neural plasticity.
Neuron
11:995-1006[Web of Science][Medline].
-
Neve KA,
Kozlowski MR,
Marshall JF
(1982)
Plasticity of neostriatal dopamine receptors after nigrostriatal injury: relationship to recovery of sensorimotor functions and behavioral supersensitivity.
Brain Res
244:33-44[Web of Science][Medline].
-
Ozawa S,
Kamiya H,
Tsuzuki K
(1998)
Glutamate receptors in the mammalian central nervous system.
Prog Neurobiol
54:581-618[Web of Science][Medline].
-
Patel J,
Zinkand WC,
Klika AB,
Mangano TJ,
Keith RA,
Salama AI
(1990)
6,7-Dinitroquinoxaline-2,3-dione blocks the cytotoxicity of N-methyl-D-aspartate and kainate, but not quisqualate, in cortical cultures.
J Neurochem
55:114-121[Web of Science][Medline].
-
Pich EM,
Pagliusi SR,
Tessari M,
Talabot-Ayer D,
Hooft van Huijsduijnen R,
Chiamulera C
(1997)
Common neural substrates for the addictive properties of nicotine and cocaine.
Science
275:83-86[Abstract/Free Full Text].
-
Rajadhyaksha A,
Leveque J,
Macias W,
Barczak A,
Konradi C
(1998)
Molecular components of striatal plasticity: the various routes of cyclic AMP pathways.
Dev Neurosci
20:204-215[Web of Science][Medline].
-
Robertson LM,
Kerppola TK,
Vendrell M,
Luk D,
Smeyne RJ,
Bocchiaro C,
Morgan JI,
Curran T
(1995)
Regulation of c-fos expression in transgenic mice requires multiple interdependent transcription control elements.
Neuron
14:241-252[Web of Science][Medline].
-
Ruppersberg JP,
Mosbacher J,
Gunther W,
Schoepfer R,
Fakler B
(1993)
Studying block in cloned N-methyl-D-aspartate (NMDA) receptors.
Biochem Pharmacol
46:1877-1885[Web of Science][Medline].
-
Sakurai SY,
Cha JH,
Penney JB,
Young AB
(1991)
Regional distribution and properties of [3H]MK-801 binding sites determined by quantitative autoradiography in rat brain.
Neuroscience
40:533-543[Web of Science][Medline].
-
Sanna E,
Head GA,
Hanbauer I
(1986)
Evidence for a selective localization of voltage-sensitive Ca2+ channels in nerve cell bodies of corpus striatum.
J Neurochem
47:1552-1557[Web of Science][Medline].
-
Schild D,
Geiling H,
Bischofberger J
(1995)
Imaging of L-type Ca2+ channels in olfactory bulb neurones using fluorescent dihydropyridine and a styryl dye.
J Neurosci Methods
59:183-190[Web of Science][Medline].
-
Schoepfer R,
Monyer H,
Sommer B,
Wisden W,
Sprengel R,
Kuner T,
Lomeli H,
Herb A,
Kohler M,
Burnashev N,
Günther W,
Ruppersberg P,
Seeburg P
(1994)
Molecular biology of glutamate receptors.
Prog Neurobiol
42:353-357[Web of Science][Medline].
-
Schulman H
(1995)
Protein phosphorylation in neuronal plasticity and gene expression.
Curr Opin Neurobiol
5:375-381[Web of Science][Medline].
-
Self DW,
Nestler EJ
(1995)
Molecular mechanisms of drug reinforcement and addiction.
Annu Rev Neurosci
18:463-495[Web of Science][Medline].
-
Sheng M,
McFadden G,
Greenberg ME
(1990)
Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB.
Neuron
4:571-582[Web of Science][Medline].
-
Sheng M,
Thompson MA,
Greenberg ME
(1991)
CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases.
Science
252:1427-1430[Abstract/Free Full Text].
-
Siegel Jr BV,
Buchsbaum MS,
Bunney Jr WE,
Gottschalk LA,
Haier RJ,
Lohr JB,
Lottenberg S,
Najafi A,
Nuechterlein KH,
Potkin SG,
Wu JC
(1993)
Cortical-striatal-thalamic circuits and brain glucose metabolic activity in 70 unmedicated male schizophrenic patients.
Am J Psychiatry
150:1325-1336[Abstract/Free Full Text].
-
Standaert DG,
Testa CM,
Young AB,
Penney Jr JB
(1994)
Organization of N-methyl-D-aspartate glutamate receptor gene expression in the basal ganglia of the rat.
J Comp Neurol
343:1-16[Web of Science][Medline].
-
Stanton PK,
Sarvey JM
(1984)
Blockade of long-term potentiation in rat hippocampal CA1 region by inhibitors of protein synthesis.
J Neurosci
4:3080-3088[Abstract].
-
Sucher NJ,
Lei SZ,
Lipton SA
(1991)
Calcium channel antagonists attenuate NMDA receptor-mediated neurotoxicity of retinal ganglion cells in culture.
Brain Res
551:297-302[Web of Science][Medline].
-
Sun P,
Enslen H,
Myung PS,
Maurer RA
(1994)
Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity.
Genes Dev
8:2527-2539[Abstract/Free Full Text].
-
Thayer SA,
Murphy SN,
Miller RJ
(1986)
Widespread distribution of dihydropyridine-sensitive calcium channels in the central nervous system.
Mol Pharmacol
30:505-509[Abstract].
-
Thompson MA,
Ginty DD,
Bonni A,
Greenberg ME
(1995)
L-type voltage-sensitive Ca2+ channel activation regulates c-fos transcription at multiple levels.
J Biol Chem
270:4224-4235[Abstract/Free Full Text].
-
Tsien RW,
Lipscombe D,
Madison DV,
Bley KR,
Fox AP
(1988)
Multiple types of neuronal calcium channels and their selective modulation.
Trends Neurosci
11:431-438[Web of Science][Medline].
-
Volkow ND,
Wang GJ,
Fowler JS,
Logan J,
Gatley SJ,
Hitzemann R,
Chen AD,
Dewey SL,
Pappas N
(1997)
Decreased striatal dopaminergic responsiveness in detoxified cocaine-dependent subjects.
Nature
386:830-833[Medline].
-
Vonsattel JP,
Myers RH,
Stevens TJ,
Ferrante RJ,
Bird ED,
Richardson Jr EP
(1985)
Neuropathological classification of Huntington's disease.
J Neuropathol Exp Neurol
44:559-577[Web of Science][Medline].
-
Walker D,
De Waard M
(1998)
Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function.
Trends Neurosci
21:148-154[Web of Science][Medline].
-
Weiss JH,
Hartley DM,
Koh J,
Choi DW
(1990)
The calcium channel blocker nifedipine attenuates slow excitatory amino acid neurotoxicity.
Science
247:1474-1477[Abstract/Free Full Text].
-
Westenbroek RE,
Ahlijanian MK,
Catterall WA
(1990)
Clustering of L-type Ca2+ channels at the base of major dendrites in hippocampal pyramidal neurons.
Nature
347:281-284[Medline].
-
Xia Z,
Dudek H,
Miranti CK,
Greenberg ME
(1996)
Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism.
J Neurosci
16:5425-5436[Abstract/Free Full Text].
-
Yin JCP,
Wallach JS,
Del Vecchio M,
Wilder EL,
Zhou H,
Quinn WG,
Tully T
(1994)
Induction of a dominant negative CREB transgene specifically blocks long-term memory in Drosophila.
Cell
79:49-58[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19156348-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Geambasu and T. L. Krukoff
Adrenomedullin acts in the lateral parabrachial nucleus to increase arterial blood pressure through mechanisms mediated by glutamate and nitric oxide
Am J Physiol Regulatory Integrative Comp Physiol,
July 1, 2008;
295(1):
R38 - R44.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kim, H.-M. Yun, J.-H. Baik, K. C. Chung, S.-Y. Nah, and H. Rhim
Functional Interaction of Neuronal Cav1.3 L-type Calcium Channel with Ryanodine Receptor Type 2 in the Rat Hippocampus
J. Biol. Chem.,
November 9, 2007;
282(45):
32877 - 32889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Stutzmann
The Pathogenesis of Alzheimers Disease Is It a Lifelong "Calciumopathy"?
Neuroscientist,
October 1, 2007;
13(5):
546 - 559.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-W. Liu and X.-B. Gao
Adenosine Inhibits Activity of Hypocretin/Orexin Neurons by the A1 Receptor in the Lateral Hypothalamus: A Possible Sleep-Promoting Effect
J Neurophysiol,
January 1, 2007;
97(1):
837 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Lindemeyer, J. Leemhuis, S. Loffler, N. Grass, W. Norenberg, and D. K. Meyer
Metabotropic Glutamate Receptors Modulate the NMDA- and AMPA-Induced Gene Expression in Neocortical Interneurons
Cereb Cortex,
November 1, 2006;
16(11):
1662 - 1677.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Yang and L. Chen
Targeting Prefrontal Cortical Dopamine D1 and N-Methyl-D-Aspartate Receptor Interactions in Schizophrenia Treatment
Neuroscientist,
October 1, 2005;
11(5):
452 - 470.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Rajadhyaksha and B. E. Kosofsky
Psychostimulants, L-type Calcium Channels, Kinases, and Phosphatases
Neuroscientist,
October 1, 2005;
11(5):
494 - 502.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
V. G. Olson, C. P. Zabetian, C. A. Bolanos, S. Edwards, M. Barrot, A. J. Eisch, T. Hughes, D. W. Self, R. L. Neve, and E. J. Nestler
Regulation of Drug Reward by cAMP Response Element-Binding Protein: Evidence for Two Functionally Distinct Subregions of the Ventral Tegmental Area
J. Neurosci.,
June 8, 2005;
25(23):
5553 - 5562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Viyoch, N. Matsunaga, M. Yoshida, H. To, S. Higuchi, and S. Ohdo
Effect of Haloperidol on mPer1 Gene Expression in Mouse Suprachiasmatic Nuclei
J. Biol. Chem.,
February 25, 2005;
280(8):
6309 - 6315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Olson, T. Tkatch, S. Hernandez-Lopez, S. Ulrich, E. Ilijic, E. Mugnaini, H. Zhang, I. Bezprozvanny, and D. J. Surmeier
G-Protein-Coupled Receptor Modulation of Striatal CaV1.3 L-Type Ca2+ Channels Is Dependent on a Shank-Binding Domain
J. Neurosci.,
February 2, 2005;
25(5):
1050 - 1062.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yang, L. Mao, Q. Tang, S. Samdani, Z. Liu, and J. Q. Wang
A Novel Ca2+-Independent Signaling Pathway to Extracellular Signal-Regulated Protein Kinase by Coactivation of NMDA Receptors and Metabotropic Glutamate Receptor 5 in Neurons
J. Neurosci.,
December 1, 2004;
24(48):
10846 - 10857.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rajadhyaksha, I. Husson, S. S. Satpute, K. D. Kuppenbender, J. Q. Ren, R. M. Guerriero, D. G. Standaert, and B. E. Kosofsky
L-Type Ca2+ Channels Mediate Adaptation of Extracellular Signal-Regulated Kinase 1/2 Phosphorylation in the Ventral Tegmental Area after Chronic Amphetamine Treatment
J. Neurosci.,
August 25, 2004;
24(34):
7464 - 7476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Emamian, M. Karayiorgou, and J. A. Gogos
Decreased Phosphorylation of NMDA Receptor Type 1 at Serine 897 in Brains of Patients with Schizophrenia
J. Neurosci.,
February 18, 2004;
24(7):
1561 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-B. Gao, P. K. Ghosh, and A. N. van den Pol
Neurons Synthesizing Melanin-Concentrating Hormone Identified by Selective Reporter Gene Expression After Transfection In Vitro: Transmitter Responses
J Neurophysiol,
December 1, 2003;
90(6):
3978 - 3985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Sanguinetti and P. B. Bennett
Antiarrhythmic Drug Target Choices and Screening
Circ. Res.,
September 19, 2003;
93(6):
491 - 499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Groth and P. G. Mermelstein
Brain-Derived Neurotrophic Factor Activation of NFAT (Nuclear Factor of Activated T-Cells)-Dependent Transcription: A Role for the Transcription Factor NFATc4 in Neurotrophin-Mediated Gene Expression
J. Neurosci.,
September 3, 2003;
23(22):
8125 - 8134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Weick, R. D. Groth, A. L. Isaksen, and P. G. Mermelstein
Interactions with PDZ Proteins Are Required for L-Type Calcium Channels to Activate cAMP Response Element-Binding Protein-Dependent Gene Expression
J. Neurosci.,
April 15, 2003;
23(8):
3446 - 3456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Mao and J. Q. Wang
Glutamate Cascade to cAMP Response Element-Binding Protein Phosphorylation in Cultured Striatal Neurons through Calcium-Coupled Group I Metabotropic Glutamate Receptors
Mol. Pharmacol.,
September 1, 2002;
62(3):
473 - 484.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Zhang and E. Townes-Anderson
Regulation of Structural Plasticity by Different Channel Types in Rod and Cone Photoreceptors
J. Neurosci.,
August 15, 2002;
22(16):
7065 - 7079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-S. Lo and R. S. Erzurumlu
L-Type Calcium Channel-Mediated Plateau Potentials in Barrelette Cells During Structural Plasticity
J Neurophysiol,
August 1, 2002;
88(2):
794 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-B. Gao and A. N van den Pol
Melanin-concentrating hormone depresses L-, N-, and P/Q-type voltage-dependent calcium channels in rat lateral hypothalamic neurons
J. Physiol.,
July 1, 2002;
542(1):
273 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Chen and C. R. Yang
Interaction of Dopamine D1 and NMDA Receptors Mediates Acute Clozapine Potentiation of Glutamate EPSPs in Rat Prefrontal Cortex
J Neurophysiol,
May 1, 2002;
87(5):
2324 - 2336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mabuchi, K. Kitagawa, K. Kuwabara, K. Takasawa, T. Ohtsuki, Z. Xia, D. Storm, T. Yanagihara, M. Hori, and M. Matsumoto
Phosphorylation of cAMP Response Element-Binding Protein in Hippocampal Neurons as a Protective Response after Exposure to Glutamate In Vitro and Ischemia In Vivo
J. Neurosci.,
December 1, 2001;
21(23):
9204 - 9213.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Pliakas, R. R. Carlson, R. L. Neve, C. Konradi, E. J. Nestler, and W. A. Carlezon Jr
Altered Responsiveness to Cocaine and Increased Immobility in the Forced Swim Test Associated with Elevated cAMP Response Element-Binding Protein Expression in Nucleus Accumbens
J. Neurosci.,
September 15, 2001;
21(18):
7397 - 7403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G Placantonakis and J. P Welsh
Two distinct oscillatory states determined by the NMDA receptor in rat inferior olive
J. Physiol.,
July 1, 2001;
534(1):
123 - 140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hernandez-Lopez, T. Tkatch, E. Perez-Garci, E. Galarraga, J. Bargas, H. Hamm, and D. J. Surmeier
D2 Dopamine Receptors in Striatal Medium Spiny Neurons Reduce L-Type Ca2+ Currents and Excitability via a Novel PLC{beta}1-IP3-Calcineurin-Signaling Cascade
J. Neurosci.,
December 15, 2000;
20(24):
8987 - 8995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Inglefield and T. J. Shafer
Polychlorinated Biphenyl-Stimulation of Ca2+ Oscillations in Developing Neocortical Cells: A Role for Excitatory Transmitters and L-Type Voltage-Sensitive Ca2+ Channels
J. Pharmacol. Exp. Ther.,
October 1, 2000;
295(1):
105 - 113.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Liljelund, J. G. Netzeband, and D. L. Gruol
L-Type Calcium Channels Mediate Calcium Oscillations in Early Postnatal Purkinje Neurons
J. Neurosci.,
October 1, 2000;
20(19):
7394 - 7403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zirpel, M. A. Janowiak, C. A. Veltri, and T. N. Parks
AMPA Receptor-Mediated, Calcium-Dependent CREB Phosphorylation in a Subpopulation of Auditory Neurons Surviving Activity Deprivation
J. Neurosci.,
August 15, 2000;
20(16):
6267 - 6275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Schjott and M. R. Plummer
Sustained Activation of Hippocampal Lp-Type Voltage-Gated Calcium Channels by Tetanic Stimulation
J. Neurosci.,
July 1, 2000;
20(13):
4786 - 4797.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Kim, M. S. Szczypka, and R. D. Palmiter
Dopamine-Deficient Mice Are Hypersensitive to Dopamine Receptor Agonists
J. Neurosci.,
June 15, 2000;
20(12):
4405 - 4413.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Leveque, W. Macias, A. Rajadhyaksha, R. R. Carlson, A. Barczak, S. Kang, X.-M. Li, J. T. Coyle, R. L. Huganir, S. Heckers, et al.
Intracellular Modulation of NMDA Receptor Function by Antipsychotic Drugs
J. Neurosci.,
June 1, 2000;
20(11):
4011 - 4020.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Mermelstein, H. Bito, K. Deisseroth, and R. W. Tsien
Critical Dependence of cAMP Response Element-Binding Protein Phosphorylation on L-Type Calcium Channels Supports a Selective Response to EPSPs in Preference to Action Potentials
J. Neurosci.,
January 1, 2000;
20(1):
266 - 273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ohkubo, N. Mitsuda, M. Tamatani, A. Yamaguchi, Y.-D. Lee, T. Ogihara, M. P. Vitek, and M. Tohyama
Apolipoprotein E4 Stimulates cAMP Response Element-binding Protein Transcriptional Activity through the Extracellular Signal-regulated Kinase Pathway
J. Biol. Chem.,
January 26, 2001;
276(5):
3046 - 3053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mitsuda, N. Ohkubo, M. Tamatani, Y.-D. Lee, M. Taniguchi, K. Namikawa, H. Kiyama, A. Yamaguchi, N. Sato, K. Sakata, et al.
Activated cAMP-response Element-binding Protein Regulates Neuronal Expression of Presenilin-1
J. Biol. Chem.,
March 23, 2001;
276(13):
9688 - 9698.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|