 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 1999, 19(15):6360-6371
Identification of Amino Acid Residues within GABAA
Receptor Subunits that Mediate Both Homomeric and Heteromeric
Receptor Expression
Pamela M.
Taylor1,
Philip
Thomas2,
George H.
Gorrie1,
Christopher N.
Connolly1,
Trevor G.
Smart2, and
Stephen J.
Moss1
1 The Medical Research Council Laboratory for
Molecular Cell Biology and Department of Pharmacology, University
College London, London WC1E 6BT, United Kingdom, and
2 Department of Pharmacology, The School of
Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, United
Kingdom
 |
ABSTRACT |
GABAA receptors are believed to be heteropentamers that
can be constructed from six subunit classes: (1-6), (1-4),
(1-3), , , and . Given that individual neurons often
express multiple receptor subunits, it is important to understand how
these receptors assemble. To determine which domains of receptor
subunits control assembly, we have exploited the differing capabilities
of the 2 and 3 subunits to form functional cell surface homomeric
receptors. Using a chimeric approach, we have identified four amino
acids in the N-terminal domain of the 3 subunit that mediate
functional cell surface expression of this subunit compared with 2,
which is retained within the endoplasmic reticulum. Substitution of these four amino acids glycine 171, lysine 173, glutamate 179, and
arginine 180 into the 2 subunit was sufficient to enable the 2
subunit to homo-oligomerize. The effect of this putative "assembly
signal" on the production of heteromeric receptors composed of 
and  subunits was also analyzed. This signal was not critical for
the formation of receptors composed of either 1 2 or 1 3 subunits, suggesting that mutation of these residues did not disrupt subunit folding. However, this signal was important in the formation of
 2 receptors. These residues did not seem to affect the initial association of 2 and 2 subunits but appeared to be important for
the subsequent production of functional receptors. Our studies identify, for the first time, key residues within the N-terminal domains of receptor subunits that mediate the selective assembly of
GABAA receptors.
Key words:
GABA receptor; homomeric; heteromeric; assembly; benzodiazepine; cell surface
 |
INTRODUCTION |
GABAA receptors are the
major sites of fast synaptic inhibition in the brain. Molecular cloning
has revealed a multiplicity of GABAA receptor subunits that
can be divided by sequence homology into six subunit classes:
(1-6), (1-3), (1-4), , , and . Alternative
splicing further increases the repertoire of GABAA receptors (Macdonald and Olsen, 1994 ; Rabow et al., 1995 ; Davies et
al., 1997 ; Hedblom and Kirkness, 1997 ). Localization experiments have revealed a large spatial and temporal variation in subunit expression, with many individual neurons expressing multiple subunits (Laurie et al., 1992 ; Macdonald and Olsen, 1994 ; Rabow et al., 1995 ).
Clearly, to understand the diversity of GABAA receptors expressed in neuronal membranes it is important to gain some insights into how these receptor subunits are assembled into functional hetero-oligomers.
To address this question, the assembly of recombinant receptors has
been analyzed, focusing on receptors composed of 1, 2, and 2
subunits, because this combination is believed to account for up to
50% of all benzodiazepine-sensitive receptors in the adult brain
(Laurie et al., 1992 ; Benke et al., 1994 ; Macdonald and Olsen, 1994 ;
Rabow et al., 1995 ). Collectively, it is apparent that
GABAA receptors are assembled in the endoplasmic reticulum (ER), where access to the cell surface is limited to receptors composed
of either 1 2 or 1 2 2 subunits (Connolly et al., 1996a ,b ). The 1 2 and 2 2 combinations and homomeric subunits are
retained within the ER (Connolly et al., 1996 a ,b ; Gorrie et al.,
1997 ). ER-retained unassembled subunits are rapidly degraded (Gorrie et
al., 1997 ). Recent studies focusing on the 3 subunit have shown that
in contrast to homomeric 1, 2, or 2L subunits, this protein
has the capacity to access the cell surface on homomeric expression as
determined by immunofluorescence (Connolly et al., 1996b ). In addition,
homomeric 3 subunits produce spontaneously gated ion channels on
expression in either Xenopus oocytes or mammalian cells
(Connolly et al., 1996b ; Wooltorton et al., 1997 ).
Using subunit chimeras, we have exploited the differences in cell
surface expression between the 2 and 3 subunits to identify key
residues that are important in controlling receptor assembly. This
approach has identified four amino acids in the N-terminal domain of
the 3 subunit that mediate subunit homo-oligomerization and cell
surface expression. These residues also selectively affected assembly
with the 2 subunit but not the 1 subunit. Together, these
observations demonstrate that defined signals in the N-terminal domains
of GABAA receptor subunits mediate selective subunit
oligomerization and play a critical role in controlling receptor assembly.
 |
MATERIALS AND METHODS |
Cell culture and transfection. Human embryonic kidney
293 (A293) cells and African green monkey kidney (COS) cells were
maintained in DMEM (Life Technologies, Gaithersburg, MD)
supplemented with 10% fetal bovine serum, 100 U/ml streptomycin
(Sigma, St. Louis, MO), and 100 U/ml penicillin (Sigma). Cells were
electroporated (400 V, infinite resistance, 125 µF; Bio-Rad Gene
Electroporator II) with 10 µg of DNA using equimolar ratios of
expression constructs. For electrophysiology, the reporter plasmid for
the S65T mutant jellyfish green fluorescent protein (Heim et al., 1995 )
was added to the transfection mixture. Transfected cells were
maintained in culture for up to 70 hr before use.
DNA construction. The murine GABAA receptor
cDNAs encoding the 1, 2L, and 2S (Whiting et al., 1990 ; Kofuji
et al., 1991 ) subunits with the 9E10 epitope (between amino acids 4 and
5) and the 2 subunit cDNA with the FLAG epitope (between amino acids 4 and 5) in the cytomegalovirus-based pGW1 expression vector have been
described previously (Connolly et al., 1996a ). The 3 subunit cDNA in
pGW1 was tagged with the FLAG epitope using the
oligonucleotide CATGTTCCCGGGGTCCTTGTCATCGTCGTCCTTGTAGTCGTTTACGCTCTGby
site-directed mutagenesis as described previously (Kunkel, 1985 ).
To generate the 2 3 chimera, a PstI/AvrII fragment
encoding the C terminal of the 3 subunit was ligated into the
(FLAG) 2, pGW1 AvrII/PstI vector using
standard recombinant methods. To generate the 3 2 chimera, a
PstI/HindIII fragment encoding the C terminal of
2 was ligated into the (FLAG) 3 pGW1
HindIII/PstI vector. An XhoI site was
introduced into both the 2 and 3 2 pGW1 constructs at a
position corresponding to residue 154 of the mature proteins by
site-directed mutagenesis using the oligonucleotides
GCCATAGCTTTCAATCTCGAGTGTACAGTTTTGTTC ( 2) and
GCCATAGCTTTCAATCTCGAGAGTGCAGTTTTGCTC ( 3) (Kunkel, 1985 ). A
SacII/XhoI fragment encoding residues 1-153 of
the 3 subunit was ligated into the (FLAG) 2 pGW1
XhoI/SacII vector, and a
XhoI/PstI fragment encoding residues 153-224 of
the 3 subunit was ligated into the (FLAG) 2 pGW1
XhoI/PstI vector to produce more refined
chimeras. Further mutants were generated by site-directed mutagenesis
using the oligonucleotides GGAGCTCGATCTTTGTCACGCCAGT and
AGTGACAGCATTGTCATCGCCACGCC for the
(FLAG) 3(DNTK) construct and
GAAGCTCAATCCTTTCCACTCCTGTGA and CCTGTGACTGCCTTGTC ACCGCCGCGCCAG
for the (FLAG) 2(GKER) construct.
Immunocytochemistry. Transfected cells plated on
poly-L-lysine (10 µg/ml)-coated coverslips were fixed in
3% paraformaldehyde (in PBS) 15-18 hr after transfection, and
immunofluorescence was performed as described previously (Connolly et
al., 1996a ). When cells were permeabilized, 0.05% vol/vol, NP40 was
added to all solutions after fixation. The primary antibodies were
applied for 1 hr at the following concentrations: anti-FLAG M2 mouse
monoclonal antibody (IBI Ltd.), 9 µg/ml; 9E10 supernatant (Evan et
al., 1985 ) diluted 1:2. Secondary antibodies, either
fluoroscein-conjugated anti-mouse IgG (Pierce, Rockford, IL) or Alexa
488-conjugated anti-mouse IgG (Molecular Probes, Eugene, OR) at 1 µg/ml were applied for 45 min. Fluorescence images were analyzed by
confocal microscopy (MRC 1000, Bio-Rad, Hercules, CA).
Quantitation of cell surface fluorescence by flow cytometrical
sorting analysis. After transfection (15-18 hr), cells were blown
gently into Ca2+/Mg2+-free PBS.
Subsequent washes and antibody dilutions were performed in HBSS (Life
Technologies) containing 2.5 mg/ml BSA and 2.5 mM EDTA at
4°C. Cells were incubated with primary antibody, purified 9E10, at 3 µg/ml or anti-FLAG antibody at 4 µg/ml, for 45 min, washed three
times, and then incubated with Alexa 488-conjugated anti-mouse IgG at 1 µg/ml for a further 30 min, before they were washed twice and
resuspended in Mg2+/Ca2+-free
PBS. Cell fluorescence was measured using a Becton Dickinson FACS
Calibur machine (Becton Dickinson, Mountain View, CA), and the
percentage of transfected cells that were more fluorescent than
mock-transfected cells was determined by calculating the number of
cells above the boundary of fluorescence of mock-transfected cells on a
fluorescence histogram. A statistical analysis of the apparent
differences in cell-surface expression of different subunits or subunit
combinations was performed using the Student's t test.
Sucrose density gradient fractionation. Receptor subunits
were subjected to sucrose density gradient fractionation on 5-20% linear sucrose density gradients in lysis buffer (Gorrie et al., 1997 ).
Before loading, solubilized cell extracts were clarified by
centrifugation (100,000 × g for 10 min). Gradients
were calibrated by loading parallel gradients with marker proteins (1 mg/ml) of known sedimentation coefficients: BSA, 4.3S; aldolase, 7.4S;
catalase, 11.2S. Gradients were centrifuged in a Beckman SW55Ti rotor
at 40,000 rpm for 14 hr at 4°C. The gradients were fractionated into fourteen 350 µl fractions, and receptor subunit sedimentation was
analyzed by Western blotting. Alternatively, the (9E10) 2
subunit was immunoprecipitated from each fraction as described previously (Gorrie et al., 1997 ).
Western blotting. Receptor subunits were detected in
gradient fractions using either anti-FLAG antibody or purified 9E10
antibody at 10 µg/ml. Western blotting was performed as described
previously (Connolly et al., 1996a ) using an enhanced chemiluminescent
substrate (Pierce Supersignal substrate). The signals were quantitated
using a Bio-Rad phosphorimager.
Immunoprecipitation. Cells were
L-methionine-starved for 30 min before labeling with
[35S]methionine (ICN/Flow) at 200 µCi/ml.
Immunoprecipitation using FLAG or 9E10 antibodies was performed as
described previously.
Electrophysiological analysis. Whole-cell recordings from
transfected A293 cells were performed as described previously
(Wooltorton et al., 1997 ) up to 70 hr after transfection. Drugs were
rapidly applied via a modified U-tube. The expression of functional
cell-surface homomeric subunit receptors was assessed by their
sensitivity to Zn2+ (10 µM),
picrotoxin (10 µM), and pentabarbitone (1 mM). For  and  heteromers, GABA sensitivity was
assessed. Control untransfected cells did not elicit membrane currents
or change membrane conductances when exposed to these ligands.
 |
RESULTS |
GABAA receptor 2 and 3 subunits differ in their
ability to access the cell surface
To examine the mechanisms underlying the assembly of
GABAA receptors, receptor subunits modified with
reporter epitopes were expressed in A293 cells. Addition of reporter
epitopes between residues 4 and 5 of selected GABAA
receptor subunits has been shown to be functionally silent (Connolly et
al., 1996a ,b ). Receptor expression was analyzed by
immunofluorescence with or without membrane permeabilization. Homomeric
expression of (FLAG) 2 in A293 cells did not produce
surface staining (Fig. 1). The staining
pattern in permeabilized cells showed that this subunit is retained
within the ER on homomeric expression (Connolly et al., 1996a ,b ; Gorrie
et al., 1997 ). In contrast, homomeric expression of
(FLAG) 3 produced robust surface expression in
unpermeabilized cells (Fig. 1), as demonstrated previously in
Madin-Darby canine kidney (MDCK) cells (Connolly et al., 1996b ).
Similar differences in surface expression of 2 and 3 were
observed in both COS and baby hamster kidney cells, suggesting that
this phenomena is not likely to be host cell specific (data not
shown).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 1.
Surface expression of homomeric
(FLAG) subunits in A293 cells. Expression was determined
by immunofluorescence using anti-FLAG M2 mouse monoclonal antibody and
fluorescein-conjugated secondary antibodies with (+) or without ( )
permeabilization 15-18 hr after transfection. Images were collected by
confocal microscopy. The structure of each construct is indicated above
the image, with the 2 sequence in white and 3 in
gray. The four transmembrane domains in the C-terminal
half of the subunits are represented by boxes.
A, (FLAG) 2 (+); B,
(FLAG) 3 ( ); C,
(FLAG) 2 3 (+); D,
(FLAG) 3 2 ( ). Scale bar, 10 µm.
|
|
Specific residues within the N-terminal domain of GABAA
receptor subunits control cell surface expression
To determine the molecular basis of the differential ability of
homomeric subunits to access the cell surface, chimeras between
(FLAG) 2 and (FLAG) 3 were produced. These
constructs were produced at amino acid glutamine 224 within
transmembrane domain 1 (TM1), which is identical in all subunits
(Yemer et al., 1989 ; Macdonald and Olsen, 1994 ; Rabow et al.,
1995 ). Two chimeras were constructed in which the N-terminal and
C-terminal portions of the (FLAG) 3 and
(FLAG) 2 subunits were exchanged. These chimeras,
(FLAG) 2/ 3 and (FLAG) 3/ 2, were
expressed in A293 cells, and subunit localization was analyzed by
immunofluorescence. The (FLAG) 3/ 2 chimera, containing
the N terminus of 3, was capable of robust cell surface expression
as defined by staining in unpermeabilized cells, comparable to that
seen with (FLAG) 3 (Fig. 1D). In
contrast, the (FLAG) 2/ 3 chimera containing the N
terminus of 2 was not able to access the cell surface (Fig.
1C). However, this protein could be seen in permeabilized
cells where it appeared to be retained in the ER, like
(FLAG) 2 (Connolly et al., 1996a ). From this approach, it
is clear that the N-terminal domain of (FLAG) 3 is
important for determining cell surface expression.
To identify the regions of (FLAG) 3 responsible for
mediating homomeric cell surface expression more precisely, further
chimeras were produced. An alignment of the 3 and 2 subunit
N-terminal domains is shown in Figure 2.
There are 20 amino acid residues within the N terminus that differ
between the 2 and 3 subunits. These differences are clustered in
two distinct portions of the N-terminal domain (Fig. 2). Exchange of
amino acids between isoleucine 154 and glutamine 224 from the
(FLAG) 3 to the (FLAG) 2 subunit resulted
in cell surface expression (Fig.
3B). In contrast, substitution
of residues 1-153 from (FLAG) 3 into
(FLAG) 2 resulted in intracellular retention (Fig.
3A). These studies clearly identify a role for amino acids
between residues 154 and 224 within the 3 subunit in mediating cell
surface homomeric expression. Using systematic site-directed
mutagenesis, four amino acids were identified G171,
K173, E179, and
R180 (single letter amino acid code) within the
(FLAG) 3 subunit that were critical in conferring cell
surface expression on (FLAG) 2 (Fig. 3D). The
individual mutation of D(171)G, N(173)K, T(179)K, or K(180)R in 2
did not promote cell surface homomeric expression (data not shown). As
a control, the corresponding residues from (FLAG) 2,
D171
N173T179K180,
were used to replace GKER in (FLAG) 3. Mutant
(FLAG) 3(DNTK) was unable to access
the cell surface and appeared to be ER-retained like
(FLAG) 2 (Fig. 3C).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2.
Sequence alignment of the N-terminal domains of
the 2 and 3 subunits. Amino acids that differ between the 2
and 3 subunits are indicated (*). The joins between the two subunits
in the 2 3 chimeras are shown by arrows. The four
residues that affect cell surface expression are in
bold. The presumed Cys-Cys loop is indicated. The
boxed region indicates the first presumed transmembrane
domain.
|
|

View larger version (81K):
[in this window]
[in a new window]
|
Figure 3.
Surface expression of homomeric
(FLAG) 2 3 chimeras in A293 cells. Expression was
determined by immunofluorescence using anti-FLAG M2 mouse monoclonal
antibody and fluorescein-conjugated secondary antibodies with (+) or
without ( ) permeabilization 15-18 hr after transfection, and images
were collected by confocal microscopy. A,
(FLAG) 3 2 2 (+); B,
(FLAG) 2 3 2 ( ); C,
(FLAG) 3(DNTK) (+); D,
(FLAG) 2(GKER) ( ). Scale bar, 10 µm.
|
|
In addition to immunofluorescence studies, flow cytometrical sorting
(FACS) was used to determine the levels of cell surface expression of
homomeric subunits. Live A293 cells were labeled by
immunofluorescence using FLAG antibody followed by an Alexa 488-conjugated secondary antibody and analyzed by FACS. Figure 4A shows typical
results for mock-transfected A293 cells or cells expressing
(FLAG) 2 or (FLAG) 3. Expression of
(FLAG) 3 on the cell surface results in a clear shift of
the histogram peak to higher fluorescence intensity. This shift in
fluorescence was expressed as a percentage of cells expressing the FLAG
epitope on the cell surface. Typically 30% of
(FLAG) 3-transfected cells expressed the FLAG epitope.
This value reflects transfection efficiency; therefore, when different
subunits were compared, cell surface expression was calculated as a
percentage of the cell surface expression seen for
(FLAG) 3 in each experiment, which was normalized to
100%. Despite the fact that (FLAG) 2 cannot be detected
on the cell surface by immunofluorescence microscopy, very low levels
(~2%) of (FLAG) 2 could sometimes be detected by FACS
analysis. This is likely to represent cells that have become
permeabilized during the staining procedure. The values obtained for
(FLAG) 2 were not significantly different from
mock-transfected cells (p > 0.05) (Fig.
4B). The levels of cell surface expression for the
(FLAG) 2(GKER) mutant were found to be
variable but not significantly different from the
(FLAG) 3 subunit (p > 0.05) (Fig.
4B). Similarly, the number of
(FLAG) 3(DNTK)-transfected cells in
which the FLAG epitope was detected on the cell surface was not
significantly different from that for
(FLAG) 2-transfected cells (p > 0.05) (Fig. 4B) and is significantly less than for
(FLAG) 3-transfected cells (p > 0.05).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4.
Quantitation of subunit cell surface
expression in A293 cells by FACS analysis. Cell surface subunits
were labeled by immunofluorescence on nonpermeabilized cells using
anti-FLAG M2 mouse monoclonal antibody and an anti-mouse Alexa
488-conjugated secondary antibody. The cells were then subjected to
flow cytometry analysis. A, Histograms showing the
distribution of cells with different levels of cell surface fluorescence for mock-transfected cells
(top panel) and cells transfected with either
(FLAG) 3 (middle panel) or
(FLAG) 2 (bottom panel) cDNAs.
B, Relative levels of (FLAG) subunit cell
surface expression. The number of cells expressing the flag epitope on
the cell surface was expressed as a percentage of the number of
(FLAG) 3-transfected cells expressing the flag epitope on
the cell surface (mock, n = 5;
(FLAG) 3, n = 9;
(FLAG) 2, n = 4;
(FLAG) 2(GKER), n = 6; (FLAG) 3(DNTK),
n = 5). C, Expression levels of
(FLAG) 2 (lane 2),
(FLAG) 2(GKER) (lane
3), (FLAG) 3 (lane 4),
(FLAG) 3(DNTK) (lane
5), or control untransfected COS cells (lane 1)
were assessed in COS cells labeled for 2 hr with 100 µCi/ml
[35S]methionine. Expressing cells were then lysed,
and receptor subunits were immunoprecipitated with FLAG antibody,
resolved by SDS-PAGE, and visualized by autoradiography. The migration
of molecular mass standards is indicated on the
left.
|
|
To determine whether the differing wild-type and mutant subunits were
expressed at similar levels, cells expressing FLAG-tagged versions of
these constructs were metabolically labeled with
[35S]methionine. Receptor subunits were then
immunoprecipitated and separated by SDS-PAGE (Fig. 4C).
(FLAG) 3 migrated with a molecular mass of between 57 and
59 kDa, and (FLAG) 2 migrated as bands of 54 and 50 kDa,
as determined previously (Connolly et al., 1996a ; McDonald et al.,
1998 ). This approach determined that 2,
2(GKER), 3, and 3(DNTK)
were all expressed to similar levels (Fig. 4C).
Functional properties of subunit chimeras
The ability of different subunits to form functional
homo-oligomeric receptors was also measured. Whole-cell currents
generated in response to the application of various ligands from
transfected A293 cells were recorded at a holding potential of 40 mV.
A293 cells expressing 2 show no response to the application of GABA, pentobarbital, Zn2+, or picrotoxin (Fig.
5A). In contrast, cells
expressing 3 subunits are insensitive to the application of up to 1 mM GABA but display large inward currents with associated
rebound currents in response to pentobarbital (Fig. 5B)
(Wooltorton et al., 1997 ). The characteristic spontaneous gating of
homo-oligomeric 3 receptors can be demonstrated by the generation of
outward currents in response to the GABAA receptor
inhibitors Zn2+ and picrotoxin (Fig. 5B).
This is because the pipette electrolyte and external Krebs'
composition caused ECl to approximate 0 mV. Thus, the spontaneous gating of 3 homomers was manifest by a persistent inward current at the 40 mV holding potential. In agreement with the immunofluorescence studies, recordings made from
cells expressing either the 3 2 or 2 3 2 chimeras resulted in functional cell surface receptors because 1 mM
pentobarbital activated inward currents. These chimeras also exhibited
spontaneous gating as the addition of 10 µM
Zn2+ or 10 µM picrotoxin elicited
outward membrane currents (Fig. 5C,D). In contrast, 2 3
or 3 2 3 chimeras exhibited no sensitivity to pentobarbital (1 mM), Zn+2 (10 µM), or
picrotoxin (10 µM) (n = 3; data not
shown).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 5.
Functional analysis of subunit homomers.
Whole-cell currents were recorded from transfected A293 cells after the
application of 1 mM GABA, 1 mM pentobarbital
(PB), 10 µM Zn2+, or 10 µM picrotoxin (PTX) from A27.1p93
cells expressing A, 2; B, 3;
C, 3 2; D, 2 3 2;
E, 3(DNTK); and F,
2(GKER) constructs. Calibration bar:
A-D, 200 pA; E, F, 100 pA. All of the
cells were voltage-clamped at 40 mV, and each trace is representative
of observations made from four to five determinations.
|
|
Whole-cell recordings were also made from cells expressing subunit
point mutants. Cells transfected with 3(DNTK) are
insensitive to the application of GABA, pentobarbital,
Zn2+, and picrotoxin (Fig. 5E),
confirming that 3(DNTK) does not assemble into
functional homomeric receptors. However, A293 cells expressing
2(GKER) exhibited a weak response to 1 mM pentobarbital (Fig. 5F), indicating that the four substitutions enable the 2 subunit to form functional homo-oligomeric receptors. In contrast, cells expressing
2(GKER) do not clearly display outward currents
in response to Zn2+ or picrotoxin, suggesting that
these subunits do not appear to form spontaneously open
Cl channels.
Therefore, the data derived from the immunofluoresence, FACS, and
electrophysiological studies clearly identify four N-terminal amino
acid residues, GKER, within (FLAG) 3 that are necessary
for homomeric cell surface expression and are also sufficient to confer
homomeric cell surface expression on the (FLAG) 2 subunit
after mutation. Given that similar surface levels of 2(GKER) and 3 are seen (Fig. 4), the
differences in the physiological properties of these homomeric
receptors are of interest. These observations suggest that although the
residues G171, K173,
E179, and R180 are sufficient to
mediate cell surface expression, other distinct residues are
responsible for the unique pharmacological and physiological properties
of 3 homomers.
Sucrose density gradient fractionation of receptor
subunits
The ER retention of (FLAG) 2 and the cell surface
expression of (FLAG) 3 may reflect differences between
the abilities of these two proteins to homo-oligomerize, because
oligomerization is a prerequisite for ER exit (Hammond and Helenius,
1995 ). To analyze the oligomerization of receptor subunits,
detergent-solubilized cell extracts were fractionated on 5-20% linear
sucrose density gradients. For these studies, expression in COS cells
was used because they gave higher expression levels than A293 cells,
facilitating biochemical analysis. Gradient fractions were subjected to
Western blotting or immunoprecipitation with 9E10 antibody. The
behavior of the 3(DNTK),
2(GKER), 2, and 3 subunits was identical in
both COS and A293 cells (Fig. 1-3) with regard to cell surface
expression (data not shown).
The (FLAG) 3 subunit exhibited a sedimentation
coefficient of 9S as determined by reference to standards (Fig.
6A,B). The
sedimentation coefficient of (FLAG) 3 is distinct from
(FLAG) 2, which exhibits a 5S coefficient (Fig.
6A-C) (Gorrie et al., 1997 ). In contrast, 2
exhibits a coefficient of 9S when coexpressed with the 1 or the 1
and 2 subunits to form functional cell surface receptors (Gorrie et
al., 1997 ; Tretter et al., 1997 ). The distinct sedimentation
coefficients of (FLAG) 2 and (FLAG) 3,
combined with differential ER retention, suggested that these subunits
differ in their abilities to homo-oligomerize. This issue was explored
further by determining the sedimentation coefficients of
(FLAG) 2(GKER) and
(FLAG) 3(DNTK), which differ in their
ability to access the cell surface (Figs. 3, 4).
(FLAG) 3(DTNK), which is ER-retained,
exhibited a sedimentation coefficient of approximately 5S (Fig.
6A,B) like (FLAG) 2 (Fig.
6A,C) (Gorrie et al., 1997 ). In contrast,
(FLAG) 2(GKER), which like
(FLAG) 3 can access the cell surface, had a sedimentation
coefficient of 9S (Fig. 6A,C). Given that the
(FLAG) 2,
(FLAG) 2(GKER),
(FLAG) 3, and
(FLAG) 3(DNTK) proteins are all
expressed to similar overall levels (Fig. 4C), these
observations strongly suggest that the amino acids GKER in
(FLAG) 3 mediate cell surface expression by facilitating
subunit homo-oligomerization.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
Differential sedimentation of
(FLAG) subunits on sucrose density gradients. COS cells
transfected with (FLAG) 3,
(FLAG) 3(DNTK), or
(FLAG) 2(GKER) were subjected to
sucrose density gradient fractionation 16 hr after transfection.
Gradient fractions were separated by SDS-PAGE; the
(FLAG) subunits were detected by Western blotting using
anti-FLAG M2 monoclonal antibody (A), and the
signals were quantified using a Bio-Rad phoshorimager
(B, , (FLAG) 3, ,
(FLAG) 3(DNTK); C, ,
(FLAG) 2, ,
(FLAG) 2(GKER)). The data for
(FLAG) 2 are taken from Gorrie et al. (1997) and
represent immunoprecipitation of this protein from expressing cells
after metabolic labeling with [35S]methionine. The
level of 2 in each fraction was quantified using a Bio-Rad
phosphorimager. Sedimentation coefficients of receptor subunits were
determined by reference to the standards BSA (4.3S), aldolase (7.4S),
and catalase (11.2S).
|
|
The amino acids responsible for mediating 3 subunit
homo-oligomerization mediate cell surface expression with the 2
subunit but not the 1 subunit
To determine whether the amino acids that control 3 subunit
homo-oligomerization influence hetero-oligomerization, various (FLAG) 2 and (FLAG) 3 constructs were
coexpressed with (9E10) 2L or (9E10) 1
subunits. Both (9E10) 1 and (9E10) 2L are
ER-retained on homomeric expression (Connolly et al., 1996a ,b ),
so expression was monitored by detecting the 9E10 reporter epitope at
the cell surface. Coexpression of (9E10) 1 with either
the (FLAG) 2(GKER) or
(FLAG) 3(DNTK) constructs resulted in
robust expression of both reporter epitopes on the cell surface (Fig.
7). Likewise, both
2(GKER) and 3(DNTK) were
able to assemble with the 1 and 2 subunits to produce functional
1 2 receptors (data not shown). Because both the 2 and 3
subunits can produce functional receptors on coexpression with 1 and
2 subunits, this result is not unexpected (Macdonald and Olsen,
1994 ; Rabow et al., 1995 ). However, coassembly with the 1 subunit
indicates that the four mutations do not disturb the folding of subunit polypeptides.

View larger version (59K):
[in this window]
[in a new window]
|
Figure 7.
Surface expression of heteromeric
(FLAG) (9E10) 1 receptors in A293
cells. Expression was determined by immunofluorescence on
nonpermeabilized cells 15-18 hr after transfection using anti-FLAG M2
mouse monoclonal antibody to detect (FLAG) subunits
(left panel) and 9E10 antibody to detect
(9E10) 1 (right panel) followed by
Alexa 488-conjugated secondary antibodies. Images were collected by
confocal microscopy. A,
(FLAG) 3(DNTK)(9E10) 1;
B, (FLAG) 2(GKER)
(9E10) 1. Scale bar, 10 µm.
|
|
Coexpression of (FLAG) 2 with (9E10) 2L
resulted in ER retention of both subunits, in agreement with earlier
observations (Connolly et al., 1996a ,b ) (Fig.
8A). However,
coexpression of (FLAG) 3 and (9E10) 2L
resulted in robust cell surface expression of (9E10) 2L
(Fig. 8B). These results suggest clear differences in
the ability of (FLAG) 2 and (FLAG) 3 to
assemble with (9E10) 2L. To determine whether the amino
acids that mediate homomeric expression of 3 influence heteromeric
expression, selected subunit mutants were coexpressed with
(9E10) 2L. In contrast to the lack of surface expression
of wild-type (FLAG) 2 with (9E10) 2L,
coexpression of (FLAG) 2(GKER) with
(9E10) 2L produced robust cell surface expression of both
subunits (Fig. 8C). When (9E10) 2L was
expressed with (FLAG) 3(DNTK), cell
surface expression of both subunits was also observed, although at
reduced levels compared with cells coexpressing
(FLAG) 3 and (9E10) 2L (Fig.
8D). Identical assembly behavior was seen with both the 2L and 2S splice variants. These observations indicate that the amino acid residues that mediate 3 subunit homo-oligomerization and cell surface expression also mediate hetero-oligomeric interactions between 3 and 2 subunits.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 8.
Surface expression of heteromeric
(FLAG) (9E10) 2L receptors in A293 cells.
Expression was determined by immunofluorescence on nonpermeabilized
cells 15-18 hr after transfection using anti-FLAG M2 mouse monoclonal
antibody to detect (FLAG) subunits (left
panel) and 9E10 antibody to detect
(9E10) 2L (right panel) followed by
Alexa 488-conjugated secondary antibodies. Images were collected by
confocal microscopy. Transfection and staining were performed
simultaneously for each subunit combination, and the pictures were all
taken using the same confocal microscope settings. A,
(FLAG) 2 + (9E10) 2L;
B, (FLAG) 3 + (9E10) 2L;
C, (FLAG) 2(GKER)
+ (9E10) 2L; D,
(FLAG) 3(DNTK) + (9E10) 2L. Scale bar, 10 µm.
|
|
Cell surface  2 receptors also form functional
ion channels
To investigate the abilities of the subunits to form
hetero-oligomeric receptors when coexpressed with the 2S subunit, whole-cell currents generated in response to the application of various
ligands in transfected A293 cells were recorded. Cells coexpressing
2 and 2S subunits were insensitive to GABA, pentobarbital, Zn2+, and picrotoxin (Fig.
9A), as described previously
(Connolly et al., 1996a ). In contrast, cells coexpressing 3 and
2S exhibited both GABA- and pentobarbital-gated membrane currents
(Fig. 9B). The pharmacology of these channels was distinct
from that of 3 homomers, which are insensitive to GABA (Connolly et
al., 1996a ; Wooltorton et al., 1997 ). Application of the
GABAA receptor inhibitors Zn2+ (10 µM) and picrotoxin (10 µM) to cells
expressing 3 and 2S resulted in the generation of outward
currents (Fig. 9B), indicating that 3 2S channels show
a degree of spontaneous activity or that the cells express a mixed
population of 3 homomers and 3 2S receptors.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 9.
Functional analysis of  2S hetero-oligomers.
Whole-cell currents were recorded in response to 1 mM GABA,
1 mM pentobarbital (PB), 10 µM
Zn2+, or 10 µM picrotoxin
(PTX) from A293 cells expressing
A, 2 2S; B, 3 2S;
C, 2(GKER) 2S; and
D, 3(DNTK) 2S. Cells were
voltage-clamped at 40 mV holding potential, and each trace is
representative of four to five determinations.
|
|
Cells coexpressing 2S with 2(GKER) exhibit
currents similar to those generated by cells expressing 3 2S
receptors. Application of GABA or pentobarbital generated inward
currents; in contrast, both Zn2+ and picrotoxin
blocked spontaneously open channels resulting in the generation of
outward currents (Fig. 9C). Interestingly, cells
coexpressing the 3(DNTK) mutant with 2S also
displayed inward currents in response to GABA or pentobarbital, but
these currents were much smaller than those observed for 3 2S or
2(GKER) 2S receptors (Fig. 9D). This
was a consistent feature that was independent of the transfection
efficiency. Small outward currents were induced in response to the
application of 10 µM Zn2+ or
picrotoxin, indicating that some of the
3(DNTK) 2S receptors gate spontaneously (Fig.
9D). It is unlikely that mixed populations of
3(DNTK) homomers and 3 2S receptors are
expressed, because the former fail to form functional cell surface
receptors. These electrophysiological observations correlate well with
the immunofluorescence data, which suggested that
3(DNTK) formed cell surface receptors when
coexpressed with 2, but with a reduced efficiency compared with
wild-type 3 subunits. Identical behavior was seen in these
experiments with either splice variant of the 2 subunit (data not shown).
Quantitation of  2 cell surface expression
To confirm that the reduction in whole-cell currents produced on
expression of 3(DNTK) and 2 subunits compared
with 3 and 2 subunits was caused by a reduction in cell surface
expression, coexpressing cells were subjected to flow cytometry to
quantify heteromeric  2 receptor cell surface expression. This was
achieved by monitoring the level of surface (9E10) 2L
using 9E10 antibody. In cells coexpressing 2 and
(9E10) 2L, the level of cell surface expression was low
and similar to that observed for untransfected cells (Fig.
10). For cells coexpressing 3 and
(9E10) 2L, (9E10) 2L could be detected on
the surface of ~15% of cells, and this was used to normalize the
cell surface expression of constructs in each experiment (Fig. 10). In
(9E10) 2L 3(DNTK)-transfected cells,
(9E10) 2L surface fluorescence was significantly
decreased (p < 0.05) (Fig. 10) compared with
(9E10) 2L 3-expressing cells (Fig. 10) but was
significantly greater than for both (9E10) 2L 2 and
mock-transfected cells (p < 0.05) (Fig. 10).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 10.
Relative levels of (9E10) 2L
subunit cell surface expression when expressed with different subunits. Cell surface 2L subunits were labeled by
immunofluorescence on nonpermeabilized cells using 9E10 antibody and an
Alexa-488 conjugated anti-mouse secondary antibody. The number of cells
expressing the 9E10 epitope on the cell surface was measured by FACS
analysis and expressed as a percentage of the number of
(9E10) 2L 3 transfected cells expressing the 9E10
epitope on the cell surface (n = 3 for each subunit
combination).
|
|
Interaction of the 2S subunit with subunits
To determine whether changes in subunit oligomerization are
responsible for the reduced cell surface expression of
3(DNTK)/ 2S constructs compared with 3/ 2S
or 2(GKER)/ 2S, subunit oligomerization was
analyzed by immunoprecipitation. For these experiments, a
(9E10) 2S construct was expressed with each of the subunit constructs used in this study (Fig.
11). The migration of homomeric 2,
3, and 2S subunits is also shown for clarity in Figure 11. The
2 and 3 subunits migrated as bands of 50-54 and 57-59 kDa,
respectively, whereas (9E10) 2S migrated as a diffuse
band of between 45 and 49 kDa. Association between the 2 and subunits was examined by immunoprecipitation using 9E10 antibody.
Coimmunoprecipitation of 3 (57 and 59 kDa) and
3(DNTK) (57 and 59 kDa) with
(9E10) 2S was clearly observed because these proteins
have distinct migrations on SDS-PAGE (Fig. 11). Because the close
migration of 2 and 2S, coimmunoprecipitation was more difficult
to detect; however, the higher molecular mass species of 2 and
2(GKER) (54 kDa) (Fig. 11) coprecipitated with
(9E10) 2S. These results suggested that the reduced
efficiency of surface expression of 3(DNTK) 2S
and the failure of 2 2S to access the cell surface is not attributable to an inability to oligomerize, in agreement with earlier
observations (Connolly et al., 1996a ). Instead, the efficiency of
assembly is likely to be affected at a later stage, possibly with the
2 2 and 3(DNTK) 2 combinations forming
dimeric or trimeric complexes, which are processed inefficiently into
functional receptors. Alternatively, these residues may affect the
transport or targeting of assembled / oligomers to the cell
surface.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 11.
Coimmunoprecipitation of subunits with the
(9E10) 2S subunit. COS cells or cells expressing 3
(lane 1), 2 (lane 2),
(9E10) 2S (lane 3), flag-tagged
(FLAG) 2 + (9E10) 2S (lane
4), (FLAG) 3 + (9E10) 2S
(lane 5),
(FLAG) 2(GKER) +
(9E10) 2S (lane 6),
(FLAG) 3(DNTK) +
(9E10) 2S (lane 7), or control cells
were [35S]methionine-labeled and
immunoprecipitated using 9E10 antibody coupled to protein A-Sepharose.
Immune complexes were separated by SDS-PAGE using 8% gels. The
migration of 3, 2, and 2S is indicated as is the migration of
molecular mass standards.
|
|
 |
DISCUSSION |
To identify amino acid residues that control GABAA
receptor assembly, we have used a chimeric approach to analyze the
selective cell surface expression of the 3 subunit compared with the
2 subunit. This resulted in the identification of four amino
acids G171, K173, E179, and R180 within the N-terminal domain of 3
that are capable of conferring homomeric cell surface expression on
2. The sedimentation of subunit constructs was compared by
sucrose density gradient centrifugation. 2 migrated as a 5S complex; in contrast, 3 migrated as a 9S complex. Interconversion of the sedimentation coefficients of 2 and 3 could be achieved by
replacing the amino acids GKER in 3 with DNTK from 2 and vice
versa. Together, these observations suggest that these amino acids
identified in our study mediate 3 subunit oligomerization. However,
whether residues G171, K173, E179, and R180 all contribute equally to this process remains to be established.
The functional properties of the different homomers were also
examined. In agreement with earlier observations, 2 was unable to
form functional channels. However, 3 produced
pentobarbital-activated, Zn+2-sensitive responses
(Connolly et al., 1996b ). In agreement with its failure to
homo-oligomerize and its resultant ER retention, expression of
3(DNTK) did not produce functional receptors. In
contrast, pentobarbital-activated responses could be recorded from
2(GKER)-expressing cells. These
pentobarbital-evoked responses were much smaller than those recorded
from 3-expressing cells and unlike 3 homomers were not
spontaneously gated (Wooltorton et al., 1997 ). Given that surface
levels of 2(GKER) were similar to those of 3,
these observations suggest that the residues GKER are sufficient to
mediate 3 subunit homo-oligomerization, but other distinct
N-terminal amino acid residues within this subunit are important for
channel gating.
The contribution of the amino acids within 3 controlling
homo-oligomerization in mediating heteromeric receptor assembly was
analyzed. Coexpression of and subunits in heterologous systems
results in the production of GABA-gated channels (Macdonald and Olsen,
1994 ; Rabow et al., 1995 ). That the substitution of residues GKER and
DNTK between 2 and 3 does not affect assembly with 1 is not
unexpected but is of significance. This result suggests that the amino
acids identified in our study are likely to constitute an assembly
signal that mediates subunit oligomerization rather than having effects
on gross subunit folding.
The production of functional receptors composed of and subunits
is less consistent. The formation of both 2 2 (Draguhn et al.,
1990 ; Sigel et al., 1990 ) and 3 2 receptors (Zezula et al., 1996 )
has been reported. Other studies have reported that coexpression of
1 and 2S (Angelotti et al., 1993 ) or 2 and 2L (Connolly et
al., 1996a ) does not result in the formation of functional receptors.
The observation that 2 and 2 do not coassemble into cell surface
receptors is consistent with earlier results (Connolly et al.,
1996a ,b ). However, 3 was able to assemble with 2 to form
functional GABA-gated cell surface receptors. These results indicate
clear differences in the abilities of the 2 and 3 subunits to
assemble with the 2 subunit. Substitution of G171, K173, E179, and
R180, key residues in 3 subunit homo-oligomerization, into the 2
was sufficient to allow assembly with the 2 subunit. However,
substitution of these residues for the corresponding amino acids from
2, DNTK, reduced the efficiency of, but did not completely prevent,
assembly with the 2 subunit. Immunoprecipitation of 2 from COS
cell lysates results in the coimmunoprecipitation of coexpressed 2,
3, 2(GKER), or 3(DNTK),
suggesting that the initial steps of  oligomerization are unaffected by these amino acids. However, the production of a 9S
complex that presumably represents functional receptors (Gorrie et al.,
1997 ; Tretter et al., 1997 ) appeared to be drastically reduced for the
3(DNTK) construct compared with either wild-type
3 or 2(GKER) constructs. Together, these
observations suggest that the GKER residues within the 3 subunit are
not essential for the initial steps in  subunit oligomerization
but play a critical role in facilitating the production of functional
tetrameric or pentameric subunit assemblies.
The role of the residues identified in our study in the production of
receptors composed of   subunits that are believed to account
for most GABAA receptor subtypes in the brain remains to be
determined (Macdonald and Olsen, 1994 ; Rabow et al., 1995 ). Although
the production of receptors composed of 1 2 3 and 1 2 3 was unaffected by the amino acids mediating 3 subunit
homo-oligomerization, they may play a role in the assembly of receptors
containing other subunit variants. Alternatively, they may also be
of importance in the production of heteromeric receptors where the subunit is substituted for either the or subunits (MacDonald
and Olsen, 1994 ; Rabow et al., 1995 ; Davies et al., 1997 ).
The four residues that control the interactions of the 3 subunit
during assembly are not located in a region of the polypeptide sequence
that is homologous to the assembly domains that have been identified
for nicotinic ACh receptor subunits or glycine receptor subunits (Gu et
al., 1991 ; Chavez et al., 1992 ; Kuhse et al., 1993 ; Kreienkamp et al.,
1995 ). However, an asparagine residue in the N terminus of the 1
subunit that mediates cell surface homomeric expression is located in a
region homologous to the 3 assembly signal defined here (Hackam et
al., 1997 ). Presumably this assembly signal within the 3 subunit
will interact in concert with other as yet undefined assembly signals
to ensure the fidelity of GABAA receptor assembly.
In conclusion, the results of this study provide the first direct
evidence of defined signals in the N-terminal domain of GABAA receptor subunits that are important in mediating
subunit selective receptor assembly.
 |
FOOTNOTES |
Received Dec. 23, 1998; revised May 17, 1999; accepted May 17, 1999.
This work was supported by the Medical Research Council (United
Kingdom) and the Wellcome Trust.
Correspondence should be addressed to Dr. S. J. Moss, The Medical
Research Council Laboratory for Molecular Cell Biology, University
College London, Gower Street, London WC1E 6BT, United Kingdom.
 |
REFERENCES |
-
Angelotti TP,
Macdonald RL
(1993)
Assembly of GABAA receptor subunits:
1 1 and 1 1 2S subunits produce unique ion channels with dissimilar single-channel properties.
J Neurosci
13:1429-1440[Abstract]. -
Benke D,
Fritschy JM,
Trzeciak A,
Bannwarth W,
Mohler H
(1994)
Distribution, prevalence, and drug binding profile of gamma-aminobutyric acid type A receptor subtypes differing in the beta-subunit variant.
J Biol Chem
269:27100-27107[Abstract/Free Full Text].
-
Chavez RA,
Maloof J,
Beeson D,
Newsom-Davis J,
Hall ZW
(1992)
Subunit folding and alpha delta heterodimer formation in the assembly of the nicotinic acetylcholine receptor. Comparison of the mouse and human alpha subunits.
J Biol Chem
267:23028-23034[Abstract/Free Full Text].
-
Connolly CN,
Krishek BJ,
McDonald BJ,
Smart TG,
Moss SJ
(1996a)
Assembly and cell surface expression of heteromeric and homomeric gamma-aminobutyric acid type A receptors.
J Biol Chem
271:89-96[Abstract/Free Full Text].
-
Connolly CN,
Wooltorton JRA,
Smart TG,
Moss SJ
(1996b)
Subcellular localization of
-aminobutyric acid type A receptors is determined by receptor subunits.
Proc Natl Acad Sci USA
93:9899-9904[Abstract/Free Full Text]. -
Davies PA,
Hanna MC,
Hales TG,
Kirkness EF
(1997)
Insensitivity to anaesthetic agents conferred by a class of GABA(A) receptor subunit.
Nature
385:820-823[Medline].
-
Draguhn A,
Verdorn TA,
Ewert M,
Seeburg PH,
Sakmann B
(1990)
Functional and molecular distinction between recombinant rat GABAA receptor subtypes by Zn2+.
Neuron
5:781-788[Web of Science][Medline].
-
Evan GI,
Lewis G,
Ramsey G,
Bishop JM
(1985)
Isolation of monoclonal antibodies specific for human c-myc proto oncogene product.
Mol Cell Biol
5:3610-3616[Abstract/Free Full Text].
-
Gorrie GH,
Vallis Y,
Stephenson A,
Whitfield J,
Browning B,
Smart TG,
Moss SJ
(1997)
Assembly of GABAA receptors composed of
1 and 2 subunits in both cultured neurons and fibroblasts.
J Neurosci
17:6587-6596[Abstract/Free Full Text]. -
Gu Y,
Camacho P,
Gardner P,
Hall ZW
(1991)
Identification of two amino acid residues in the epsilon subunit that promote mammalian muscle acetylcholine receptor assembly in COS cells.
Neuron
6:879-887[Web of Science][Medline].
-
Hackam AS,
Wang TL,
Guggino WB,
Cutting GR
(1997)
The N-terminal domain of human GABA receptor
1 subunits contains signals for homooligomeric and heterooligomeric interaction.
J Biol Chem
272:13750-13757[Abstract/Free Full Text]. -
Hammond C,
Helenius A
(1995)
Quality control in the secretory pathway.
Curr Opin Cell Biol
7:670-529.
-
Hedblom E,
Kirkness EF
(1997)
A novel class of GABAA receptor subunit in tissues of the reproductive system.
J Biol Chem
272:15346-15350[Abstract/Free Full Text].
-
Heim R,
Cubitt AB,
Tsien RY
(1995)
Improved green fluorescent proteins.
Nature
373:663-664[Medline].
-
Kofuji P,
Wang JB,
Moss SJ,
Huganir RL,
Burt DR
(1991)
Generation of two forms of the gamma-aminobutyric acid A receptor gamma 2-subunit in mice by alternative splicing.
J Neurochem
56:713-715[Web of Science][Medline].
-
Kreienkamp HJ,
Maeda RK,
Sine SM,
Taylor P
(1995)
Intersubunit contacts governing assembly of the mammalian nicotinic acetylcholine receptor.
Neuron
14:635-644[Web of Science][Medline].
-
Kuhse J,
Laube B,
Magalei D,
Betz H
(1993)
Assembly of the inhibitory glycine receptor: identification of amino acid sequence motifs governing subunit stoichiometry.
Neuron
6:1049-1056.
-
Kunkel TA
(1985)
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc Natl Acad Sci USA
82:488-492[Abstract/Free Full Text].
-
Laurie DJ,
Wisden W,
Seeberg PH
(1992)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain II. Olfactory bulb and cerebellum.
J Neurosci
12:4151-4172[Abstract].
-
Macdonald RL,
Olsen RW
(1994)
GABAA receptor channels.
Annu Rev Neurosci
17:569-602[Web of Science][Medline].
-
McDonald BJ,
Amato A,
Connolly CN,
Benke D,
Moss SJ,
Smart TG
(1998)
Adjacent phosphorylation sites on GABAA receptor
subunits determine regulation by cAMP-dependent protein kinase.
Nature Neurosci
1:23-28.[Web of Science][Medline] -
Rabow LE,
Russek SJ,
Farb DH
(1995)
From ion currents to genomic analysis: recent advances in GABAA receptor research.
Synapse
21:189-274[Web of Science][Medline].
-
Sigel E,
Baur R,
Trube G,
Mohler H,
Malherbe P
(1990)
The effect of subunit composition of rat brain GABAA receptors on channel function.
Neuron
5:703-711[Web of Science][Medline].
-
Tretter V,
Ehya N,
Fuchs K,
Sieghart W
(1997)
Stoichiometry of a recombinant GABAA receptor subtype.
J Neurosci
17:2728-2737[Abstract/Free Full Text].
-
Whiting P,
McKernan RM,
Iversen LL
(1990)
Another mechanism for creating diversity in gamma-aminobutyrate type A receptors: RNA splicing directs expression of two forms of gamma 2 phosphorylation site.
Proc Natl Acad Sci USA
87:9966-9970[Abstract/Free Full Text].
-
Wooltorton JA,
McDonald BJ,
Moss SJ,
Smart TG
(1997)
Identification of a Zn+2 binding site on the murine GABAA receptor complex: dependence on the second transmembrane domain of
subunits.
J Physiol (Lond)
505.3:633-640[Abstract/Free Full Text]. -
Yemer S,
Schofield PR,
Draguhn A,
Werner P,
Kohler M,
Seeberg PH
(1989)
GABAA receptor
subunit heterogeneity: functional expression of cloned cDNAs.
EMBO J
8:1665-1670[Web of Science][Medline]. -
Zezula J,
Slany A,
Sieghart W
(1996)
Interaction of allosteric ligands with GABAg1 receptors containing one, two or three different subunits.
Eur J Pharmacol
301:207-214[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19156360-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
W.-y. Lo, E. J. Botzolakis, X. Tang, and R. L. Macdonald
A Conserved Cys-loop Receptor Aspartate Residue in the M3-M4 Cytoplasmic Loop Is Required for GABAA Receptor Assembly
J. Biol. Chem.,
October 31, 2008;
283(44):
29740 - 29752.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Bracamontes and J. H. Steinbach
Multiple Modes for Conferring Surface Expression of Homomeric {beta}1 GABAA Receptors
J. Biol. Chem.,
September 19, 2008;
283(38):
26128 - 26136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Saliba, M. Pangalos, and S. J. Moss
The Ubiquitin-like Protein Plic-1 Enhances the Membrane Insertion of GABAA Receptors by Increasing Their Stability within the Endoplasmic Reticulum
J. Biol. Chem.,
July 4, 2008;
283(27):
18538 - 18544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Saras, G. Gisselmann, A. K. Vogt-Eisele, K. S. Erlkamp, O. Kletke, H. Pusch, and H. Hatt
Histamine Action on Vertebrate GABAA Receptors: DIRECT CHANNEL GATING AND POTENTIATION OF GABA RESPONSES
J. Biol. Chem.,
April 18, 2008;
283(16):
10470 - 10475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Saliba, G. Michels, T. C. Jacob, M. N. Pangalos, and S. J. Moss
Activity-Dependent Ubiquitination of GABAA Receptors Regulates Their Accumulation at Synaptic Sites
J. Neurosci.,
November 28, 2007;
27(48):
13341 - 13351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Sarto-Jackson, R. Furtmueller, M. Ernst, S. Huck, and W. Sieghart
Spontaneous Cross-link of Mutated {alpha}1 Subunits during GABAA Receptor Assembly
J. Biol. Chem.,
February 16, 2007;
282(7):
4354 - 4363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Gallagher, W. Shen, L. Song, and R. L. Macdonald
Endoplasmic Reticulum Retention and Associated Degradation of a GABAA Receptor Epilepsy Mutation That Inserts an Aspartate in the M3 Transmembrane Segment of the {alpha}1 Subunit
J. Biol. Chem.,
November 11, 2005;
280(45):
37995 - 38004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Gallagher, L. Song, F. Arain, and R. L. Macdonald
The Juvenile Myoclonic Epilepsy GABAA Receptor {alpha}1 Subunit Mutation A322D Produces Asymmetrical, Subunit Position-Dependent Reduction of Heterozygous Receptor Currents and {alpha}1 Subunit Protein Expression
J. Neurosci.,
June 16, 2004;
24(24):
5570 - 5578.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Miko, E. Werby, H. Sun, J. Healey, and L. Zhang
A TM2 Residue in the {beta}1 Subunit Determines Spontaneous Opening of Homomeric and Heteromeric {gamma}-Aminobutyric Acid-gated Ion Channels
J. Biol. Chem.,
May 28, 2004;
279(22):
22833 - 22840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Jin, D. Walther, J. Zhang, C. Rowe-Teeter, and G. K. Fu
Serine 171, a Conserved Residue in the {gamma}-Aminobutyric Acid Type A (GABAA) Receptor {gamma}2 Subunit, Mediates Subunit Interaction and Cell Surface Localization
J. Biol. Chem.,
April 2, 2004;
279(14):
14179 - 14183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Lagree, K. Brunschwig, P. Lopez, N. B. Gilula, G. Richard, and M. M. Falk
Specific amino-acid residues in the N-terminus and TM3 implicated in channel function and oligomerization compatibility of connexin43
J. Cell Sci.,
August 1, 2003;
116(15):
3189 - 3201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Boyd, A. I. Doward, E. F. Kirkness, N. S. Millar, and C. N. Connolly
Cell Surface Expression of 5-Hydroxytryptamine Type 3 Receptors Is Controlled by an Endoplasmic Reticulum Retention Signal
J. Biol. Chem.,
July 18, 2003;
278(30):
27681 - 27687.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Bollan, D. King, L. A. Robertson, K. Brown, P. M. Taylor, S. J. Moss, and C. N. Connolly
GABAA Receptor Composition Is Determined by Distinct Assembly Signals within alpha and beta Subunits
J. Biol. Chem.,
February 7, 2003;
278(7):
4747 - 4755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Sarto, T. Klausberger, N. Ehya, B. Mayer, K. Fuchs, and W. Sieghart
A Novel Site on gamma 3 Subunits Important for Assembly of GABAA Receptors
J. Biol. Chem.,
August 16, 2002;
277(34):
30656 - 30664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Christie, C. P. Miralles, and A. L. De Blas
GABAergic Innervation Organizes Synaptic and Extrasynaptic GABAA Receptor Clustering in Cultured Hippocampal Neurons
J. Neurosci.,
February 1, 2002;
22(3):
684 - 697.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Taylor, C. N. Connolly, J. T. Kittler, G. H. Gorrie, A. Hosie, T. G. Smart, and S. J. Moss
Identification of Residues within GABAA Receptor alpha Subunits That Mediate Specific Assembly with Receptor beta Subunits
J. Neurosci.,
February 15, 2000;
20(4):
1297 - 1306.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|