QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (49) Citing Articles via Google Scholar Google Scholar Articles by Taylor, P. M. Articles by Moss, S. J. Search for Related Content PubMed PubMed Citation Articles by Taylor, P. M. Articles by Moss, S. J.

 Previous Article  |  Next Article 

The Journal of Neuroscience, August 1, 1999, 19(15):6360-6371

Identification of Amino Acid Residues within GABA_A Receptor  Subunits that Mediate Both Homomeric and Heteromeric Receptor Expression

Pamela M. Taylor¹, Philip Thomas², George H. Gorrie¹, Christopher N. Connolly¹, Trevor G. Smart², and Stephen J. Moss¹

¹ The Medical Research Council Laboratory for Molecular Cell Biology and Department of Pharmacology, University College London, London WC1E 6BT, United Kingdom, and ² Department of Pharmacology, The School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

GABA_A receptors are believed to be heteropentamers that can be constructed from six subunit classes: (1-6), (1-4), (1-3), , , and . Given that individual neurons often express multiple receptor subunits, it is important to understand how these receptors assemble. To determine which domains of receptor subunits control assembly, we have exploited the differing capabilities of the 2 and 3 subunits to form functional cell surface homomeric receptors. Using a chimeric approach, we have identified four amino acids in the N-terminal domain of the 3 subunit that mediate functional cell surface expression of this subunit compared with 2, which is retained within the endoplasmic reticulum. Substitution of these four amino acidsglycine 171, lysine 173, glutamate 179, and arginine 180into the 2 subunit was sufficient to enable the 2 subunit to homo-oligomerize. The effect of this putative "assembly signal" on the production of heteromeric receptors composed of and subunits was also analyzed. This signal was not critical for the formation of receptors composed of either 12 or 13 subunits, suggesting that mutation of these residues did not disrupt subunit folding. However, this signal was important in the formation of 2 receptors. These residues did not seem to affect the initial association of 2 and 2 subunits but appeared to be important for the subsequent production of functional receptors. Our studies identify, for the first time, key residues within the N-terminal domains of receptor  subunits that mediate the selective assembly of GABA_A receptors.

Key words: GABA receptor; homomeric; heteromeric; assembly; benzodiazepine; cell surface

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

GABA_A receptors are the major sites of fast synaptic inhibition in the brain. Molecular cloning has revealed a multiplicity of GABA_A receptor subunits that can be divided by sequence homology into six subunit classes: (1-6), (1-3), (1-4), , , and . Alternative splicing further increases the repertoire of GABA_A receptors (Macdonald and Olsen, 1994; Rabow et al., 1995; Davies et al., 1997; Hedblom and Kirkness, 1997). Localization experiments have revealed a large spatial and temporal variation in subunit expression, with many individual neurons expressing multiple subunits (Laurie et al., 1992; Macdonald and Olsen, 1994; Rabow et al., 1995). Clearly, to understand the diversity of GABA_A receptors expressed in neuronal membranes it is important to gain some insights into how these receptor subunits are assembled into functional hetero-oligomers.

To address this question, the assembly of recombinant receptors has been analyzed, focusing on receptors composed of 1, 2, and 2 subunits, because this combination is believed to account for up to 50% of all benzodiazepine-sensitive receptors in the adult brain (Laurie et al., 1992; Benke et al., 1994; Macdonald and Olsen, 1994; Rabow et al., 1995). Collectively, it is apparent that GABA_A receptors are assembled in the endoplasmic reticulum (ER), where access to the cell surface is limited to receptors composed of either 12 or 122 subunits (Connolly et al., 1996a,b). The 12 and 22 combinations and homomeric subunits are retained within the ER (Connolly et al., 1996 a,b; Gorrie et al., 1997). ER-retained unassembled subunits are rapidly degraded (Gorrie et al., 1997). Recent studies focusing on the 3 subunit have shown that in contrast to homomeric 1, 2, or 2L subunits, this protein has the capacity to access the cell surface on homomeric expression as determined by immunofluorescence (Connolly et al., 1996b). In addition, homomeric 3 subunits produce spontaneously gated ion channels on expression in either Xenopus oocytes or mammalian cells (Connolly et al., 1996b; Wooltorton et al., 1997).

Using subunit chimeras, we have exploited the differences in cell surface expression between the 2 and 3 subunits to identify key residues that are important in controlling receptor assembly. This approach has identified four amino acids in the N-terminal domain of the 3 subunit that mediate subunit homo-oligomerization and cell surface expression. These residues also selectively affected assembly with the 2 subunit but not the 1 subunit. Together, these observations demonstrate that defined signals in the N-terminal domains of GABA_A receptor subunits mediate selective subunit oligomerization and play a critical role in controlling receptor assembly.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell culture and transfection. Human embryonic kidney 293 (A293) cells and African green monkey kidney (COS) cells were maintained in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% fetal bovine serum, 100 U/ml streptomycin (Sigma, St. Louis, MO), and 100 U/ml penicillin (Sigma). Cells were electroporated (400 V, infinite resistance, 125 µF; Bio-Rad Gene Electroporator II) with 10 µg of DNA using equimolar ratios of expression constructs. For electrophysiology, the reporter plasmid for the S65T mutant jellyfish green fluorescent protein (Heim et al., 1995) was added to the transfection mixture. Transfected cells were maintained in culture for up to 70 hr before use.

DNA construction. The murine GABA_A receptor cDNAs encoding the 1, 2L, and 2S (Whiting et al., 1990; Kofuji et al., 1991) subunits with the 9E10 epitope (between amino acids 4 and 5) and the 2 subunit cDNA with the FLAG epitope (between amino acids 4 and 5) in the cytomegalovirus-based pGW1 expression vector have been described previously (Connolly et al., 1996a). The 3 subunit cDNA in pGW1 was tagged with the FLAG epitope using the oligonucleotide CATGTTCCCGGGGTCCTTGTCATCGTCGTCCTTGTAGTCGTTTACGCTCTGby site-directed mutagenesis as described previously (Kunkel, 1985).

To generate the 23 chimera, a PstI/AvrII fragment encoding the C terminal of the 3 subunit was ligated into the ^(FLAG)2, pGW1 AvrII/PstI vector using standard recombinant methods. To generate the 32 chimera, a PstI/HindIII fragment encoding the C terminal of 2 was ligated into the ^(FLAG)3 pGW1 HindIII/PstI vector. An XhoI site was introduced into both the 2 and 32 pGW1 constructs at a position corresponding to residue 154 of the mature proteins by site-directed mutagenesis using the oligonucleotides GCCATAGCTTTCAATCTCGAGTGTACAGTTTTGTTC (2) and GCCATAGCTTTCAATCTCGAGAGTGCAGTTTTGCTC (3) (Kunkel, 1985). A SacII/XhoI fragment encoding residues 1-153 of the 3 subunit was ligated into the ^(FLAG)2 pGW1 XhoI/SacII vector, and a XhoI/PstI fragment encoding residues 153-224 of the 3 subunit was ligated into the ^(FLAG)2 pGW1 XhoI/PstI vector to produce more refined chimeras. Further mutants were generated by site-directed mutagenesis using the oligonucleotides GGAGCTCGATCTTTGTCACGCCAGT and AGTGACAGCATTGTCATCGCCACGCC for the ^(FLAG)3^(DNTK) construct and GAAGCTCAATCCTTTCCACTCCTGTGA and CCTGTGACTGCCTTGTC ACCGCCGCGCCAG for the ^(FLAG)2^(GKER) construct.

Immunocytochemistry. Transfected cells plated on poly-L-lysine (10 µg/ml)-coated coverslips were fixed in 3% paraformaldehyde (in PBS) 15-18 hr after transfection, and immunofluorescence was performed as described previously (Connolly et al., 1996a). When cells were permeabilized, 0.05% vol/vol, NP40 was added to all solutions after fixation. The primary antibodies were applied for 1 hr at the following concentrations: anti-FLAG M2 mouse monoclonal antibody (IBI Ltd.), 9 µg/ml; 9E10 supernatant (Evan et al., 1985) diluted 1:2. Secondary antibodies, either fluoroscein-conjugated anti-mouse IgG (Pierce, Rockford, IL) or Alexa 488-conjugated anti-mouse IgG (Molecular Probes, Eugene, OR) at 1 µg/ml were applied for 45 min. Fluorescence images were analyzed by confocal microscopy (MRC 1000, Bio-Rad, Hercules, CA).

Quantitation of cell surface fluorescence by flow cytometrical sorting analysis. After transfection (15-18 hr), cells were blown gently into Ca²⁺/Mg²⁺-free PBS. Subsequent washes and antibody dilutions were performed in HBSS (Life Technologies) containing 2.5 mg/ml BSA and 2.5 mM EDTA at 4°C. Cells were incubated with primary antibody, purified 9E10, at 3 µg/ml or anti-FLAG antibody at 4 µg/ml, for 45 min, washed three times, and then incubated with Alexa 488-conjugated anti-mouse IgG at 1 µg/ml for a further 30 min, before they were washed twice and resuspended in Mg²⁺/Ca²⁺-free PBS. Cell fluorescence was measured using a Becton Dickinson FACS Calibur machine (Becton Dickinson, Mountain View, CA), and the percentage of transfected cells that were more fluorescent than mock-transfected cells was determined by calculating the number of cells above the boundary of fluorescence of mock-transfected cells on a fluorescence histogram. A statistical analysis of the apparent differences in cell-surface expression of different subunits or subunit combinations was performed using the Student's t test.

Sucrose density gradient fractionation. Receptor subunits were subjected to sucrose density gradient fractionation on 5-20% linear sucrose density gradients in lysis buffer (Gorrie et al., 1997). Before loading, solubilized cell extracts were clarified by centrifugation (100,000 × g for 10 min). Gradients were calibrated by loading parallel gradients with marker proteins (1 mg/ml) of known sedimentation coefficients: BSA, 4.3S; aldolase, 7.4S; catalase, 11.2S. Gradients were centrifuged in a Beckman SW55Ti rotor at 40,000 rpm for 14 hr at 4°C. The gradients were fractionated into fourteen 350 µl fractions, and receptor subunit sedimentation was analyzed by Western blotting. Alternatively, the ^(9E10)2 subunit was immunoprecipitated from each fraction as described previously (Gorrie et al., 1997).

Western blotting. Receptor subunits were detected in gradient fractions using either anti-FLAG antibody or purified 9E10 antibody at 10 µg/ml. Western blotting was performed as described previously (Connolly et al., 1996a) using an enhanced chemiluminescent substrate (Pierce Supersignal substrate). The signals were quantitated using a Bio-Rad phosphorimager.

Immunoprecipitation. Cells were L-methionine-starved for 30 min before labeling with [³⁵S]methionine (ICN/Flow) at 200 µCi/ml. Immunoprecipitation using FLAG or 9E10 antibodies was performed as described previously.

Electrophysiological analysis. Whole-cell recordings from transfected A293 cells were performed as described previously (Wooltorton et al., 1997) up to 70 hr after transfection. Drugs were rapidly applied via a modified U-tube. The expression of functional cell-surface homomeric  subunit receptors was assessed by their sensitivity to Zn²⁺ (10 µM), picrotoxin (10 µM), and pentabarbitone (1 mM). For and heteromers, GABA sensitivity was assessed. Control untransfected cells did not elicit membrane currents or change membrane conductances when exposed to these ligands.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

GABA_A receptor 2 and 3 subunits differ in their ability to access the cell surface

To examine the mechanisms underlying the assembly of GABA_A receptors, receptor  subunits modified with reporter epitopes were expressed in A293 cells. Addition of reporter epitopes between residues 4 and 5 of selected GABA_A receptor subunits has been shown to be functionally silent (Connolly et al., 1996a,b). Receptor expression was analyzed by immunofluorescence with or without membrane permeabilization. Homomeric expression of ^(FLAG)2 in A293 cells did not produce surface staining (Fig. 1). The staining pattern in permeabilized cells showed that this subunit is retained within the ER on homomeric expression (Connolly et al., 1996a,b; Gorrie et al., 1997). In contrast, homomeric expression of ^(FLAG)3 produced robust surface expression in unpermeabilized cells (Fig. 1), as demonstrated previously in Madin-Darby canine kidney (MDCK) cells (Connolly et al., 1996b). Similar differences in surface expression of 2 and 3 were observed in both COS and baby hamster kidney cells, suggesting that this phenomena is not likely to be host cell specific (data not shown).

View larger version (64K): [in this window] [in a new window]   Figure 1.   Surface expression of homomeric (FLAG) subunits in A293 cells. Expression was determined by immunofluorescence using anti-FLAG M2 mouse monoclonal antibody and fluorescein-conjugated secondary antibodies with (+) or without () permeabilization 15-18 hr after transfection. Images were collected by confocal microscopy. The structure of each construct is indicated above the image, with the 2 sequence in white and 3 in gray. The four transmembrane domains in the C-terminal half of the subunits are represented by boxes. A, (FLAG)2 (+); B, (FLAG)3 (); C, (FLAG)23 (+); D, (FLAG)32 (). Scale bar, 10 µm.

Specific residues within the N-terminal domain of GABA_A receptor  subunits control cell surface expression

To determine the molecular basis of the differential ability of homomeric  subunits to access the cell surface, chimeras between ^(FLAG)2 and ^(FLAG)3 were produced. These constructs were produced at amino acid glutamine 224 within transmembrane domain 1 (TM1), which is identical in all  subunits (Yemer et al., 1989; Macdonald and Olsen, 1994; Rabow et al., 1995). Two chimeras were constructed in which the N-terminal and C-terminal portions of the ^(FLAG)3 and ^(FLAG)2 subunits were exchanged. These chimeras, ^(FLAG)2/3 and ^(FLAG)3/2, were expressed in A293 cells, and subunit localization was analyzed by immunofluorescence. The ^(FLAG)3/2 chimera, containing the N terminus of 3, was capable of robust cell surface expression as defined by staining in unpermeabilized cells, comparable to that seen with ^(FLAG)3 (Fig. 1D). In contrast, the ^(FLAG)2/3 chimera containing the N terminus of 2 was not able to access the cell surface (Fig. 1C). However, this protein could be seen in permeabilized cells where it appeared to be retained in the ER, like ^(FLAG)2 (Connolly et al., 1996a). From this approach, it is clear that the N-terminal domain of ^(FLAG)3 is important for determining cell surface expression.

To identify the regions of ^(FLAG)3 responsible for mediating homomeric cell surface expression more precisely, further chimeras were produced. An alignment of the 3 and 2 subunit N-terminal domains is shown in Figure 2. There are 20 amino acid residues within the N terminus that differ between the 2 and 3 subunits. These differences are clustered in two distinct portions of the N-terminal domain (Fig. 2). Exchange of amino acids between isoleucine 154 and glutamine 224 from the ^(FLAG)3 to the ^(FLAG)2 subunit resulted in cell surface expression (Fig. 3B). In contrast, substitution of residues 1-153 from ^(FLAG)3 into ^(FLAG)2 resulted in intracellular retention (Fig. 3A). These studies clearly identify a role for amino acids between residues 154 and 224 within the 3 subunit in mediating cell surface homomeric expression. Using systematic site-directed mutagenesis, four amino acids were identifiedG¹⁷¹, K¹⁷³, E¹⁷⁹, and R¹⁸⁰ (single letter amino acid code)within the ^(FLAG)3 subunit that were critical in conferring cell surface expression on ^(FLAG)2 (Fig. 3D). The individual mutation of D(171)G, N(173)K, T(179)K, or K(180)R in 2 did not promote cell surface homomeric expression (data not shown). As a control, the corresponding residues from ^(FLAG)2, D¹⁷¹ N¹⁷³T¹⁷⁹K¹⁸⁰, were used to replace GKER in ^(FLAG)3. Mutant ^(FLAG)3^(DNTK) was unable to access the cell surface and appeared to be ER-retained like ^(FLAG)2 (Fig. 3C).

View larger version (44K): [in this window] [in a new window]   Figure 2.   Sequence alignment of the N-terminal domains of the 2 and 3 subunits. Amino acids that differ between the 2 and 3 subunits are indicated (*). The joins between the two subunits in the 23 chimeras are shown by arrows. The four residues that affect cell surface expression are in bold. The presumed Cys-Cys loop is indicated. The boxed region indicates the first presumed transmembrane domain.

View larger version (81K): [in this window] [in a new window]   Figure 3.   Surface expression of homomeric (FLAG)23 chimeras in A293 cells. Expression was determined by immunofluorescence using anti-FLAG M2 mouse monoclonal antibody and fluorescein-conjugated secondary antibodies with (+) or without () permeabilization 15-18 hr after transfection, and images were collected by confocal microscopy. A, (FLAG)322 (+); B, (FLAG) 232 (); C, (FLAG)3(DNTK) (+); D, (FLAG)2(GKER) (). Scale bar, 10 µm.

In addition to immunofluorescence studies, flow cytometrical sorting (FACS) was used to determine the levels of cell surface expression of homomeric  subunits. Live A293 cells were labeled by immunofluorescence using FLAG antibody followed by an Alexa 488-conjugated secondary antibody and analyzed by FACS. Figure 4A shows typical results for mock-transfected A293 cells or cells expressing ^(FLAG)2 or ^(FLAG)3. Expression of ^(FLAG)3 on the cell surface results in a clear shift of the histogram peak to higher fluorescence intensity. This shift in fluorescence was expressed as a percentage of cells expressing the FLAG epitope on the cell surface. Typically 30% of ^(FLAG)3-transfected cells expressed the FLAG epitope. This value reflects transfection efficiency; therefore, when different subunits were compared, cell surface expression was calculated as a percentage of the cell surface expression seen for ^(FLAG)3 in each experiment, which was normalized to 100%. Despite the fact that ^(FLAG)2 cannot be detected on the cell surface by immunofluorescence microscopy, very low levels (~2%) of ^(FLAG)2 could sometimes be detected by FACS analysis. This is likely to represent cells that have become permeabilized during the staining procedure. The values obtained for ^(FLAG)2 were not significantly different from mock-transfected cells (p > 0.05) (Fig. 4B). The levels of cell surface expression for the ^(FLAG)2^(GKER) mutant were found to be variable but not significantly different from the ^(FLAG)3 subunit (p > 0.05) (Fig. 4B). Similarly, the number of ^(FLAG)3^(DNTK)-transfected cells in which the FLAG epitope was detected on the cell surface was not significantly different from that for ^(FLAG)2-transfected cells (p > 0.05) (Fig. 4B) and is significantly less than for ^(FLAG)3-transfected cells (p > 0.05).

View larger version (14K): [in this window] [in a new window]   Figure 4.   Quantitation of  subunit cell surface expression in A293 cells by FACS analysis. Cell surface  subunits were labeled by immunofluorescence on nonpermeabilized cells using anti-FLAG M2 mouse monoclonal antibody and an anti-mouse Alexa 488-conjugated secondary antibody. The cells were then subjected to flow cytometry analysis. A, Histograms showing the distribution of cells with different levels of cell surface fluorescence for mock-transfected cells (top panel) and cells transfected with either (FLAG)3 (middle panel) or (FLAG)2 (bottom panel) cDNAs. B, Relative levels of (FLAG) subunit cell surface expression. The number of cells expressing the flag epitope on the cell surface was expressed as a percentage of the number of (FLAG)3-transfected cells expressing the flag epitope on the cell surface (mock, n = 5; (FLAG)3, n = 9; (FLAG)2, n = 4; (FLAG)2(GKER), n = 6; (FLAG)3(DNTK), n = 5). C, Expression levels of (FLAG)2 (lane 2), (FLAG)2(GKER) (lane 3), (FLAG)3 (lane 4), (FLAG)3(DNTK) (lane 5), or control untransfected COS cells (lane 1) were assessed in COS cells labeled for 2 hr with 100 µCi/ml [35S]methionine. Expressing cells were then lysed, and receptor subunits were immunoprecipitated with FLAG antibody, resolved by SDS-PAGE, and visualized by autoradiography. The migration of molecular mass standards is indicated on the left.

To determine whether the differing wild-type and mutant subunits were expressed at similar levels, cells expressing FLAG-tagged versions of these constructs were metabolically labeled with [³⁵S]methionine. Receptor  subunits were then immunoprecipitated and separated by SDS-PAGE (Fig. 4C). ^(FLAG)3 migrated with a molecular mass of between 57 and 59 kDa, and ^(FLAG)2 migrated as bands of 54 and 50 kDa, as determined previously (Connolly et al., 1996a; McDonald et al., 1998). This approach determined that 2, 2^(GKER), 3, and 3^(DNTK) were all expressed to similar levels (Fig. 4C).

Functional properties of  subunit chimeras

The ability of different  subunits to form functional homo-oligomeric receptors was also measured. Whole-cell currents generated in response to the application of various ligands from transfected A293 cells were recorded at a holding potential of 40 mV. A293 cells expressing 2 show no response to the application of GABA, pentobarbital, Zn²⁺, or picrotoxin (Fig. 5A). In contrast, cells expressing 3 subunits are insensitive to the application of up to 1 mM GABA but display large inward currents with associated rebound currents in response to pentobarbital (Fig. 5B) (Wooltorton et al., 1997). The characteristic spontaneous gating of homo-oligomeric 3 receptors can be demonstrated by the generation of outward currents in response to the GABA_A receptor inhibitors Zn²⁺ and picrotoxin (Fig. 5B). This is because the pipette electrolyte and external Krebs' composition caused E_Cl to approximate 0 mV. Thus, the spontaneous gating of 3 homomers was manifest by a persistent inward current at the 40 mV holding potential. In agreement with the immunofluorescence studies, recordings made from cells expressing either the 32 or 232 chimeras resulted in functional cell surface receptors because 1 mM pentobarbital activated inward currents. These chimeras also exhibited spontaneous gating as the addition of 10 µM Zn²⁺ or 10 µM picrotoxin elicited outward membrane currents (Fig. 5C,D). In contrast, 23 or 323 chimeras exhibited no sensitivity to pentobarbital (1 mM), Zn⁺² (10 µM), or picrotoxin (10 µM) (n = 3; data not shown).

View larger version (13K): [in this window] [in a new window]   Figure 5.   Functional analysis of  subunit homomers. Whole-cell currents were recorded from transfected A293 cells after the application of 1 mM GABA, 1 mM pentobarbital (PB), 10 µM Zn2+, or 10 µM picrotoxin (PTX) from A27.1p93 cells expressing A, 2; B, 3; C, 32; D, 232; E, 3(DNTK); and F, 2(GKER) constructs. Calibration bar: A-D, 200 pA; E, F, 100 pA. All of the cells were voltage-clamped at 40 mV, and each trace is representative of observations made from four to five determinations.

Whole-cell recordings were also made from cells expressing  subunit point mutants. Cells transfected with 3^(DNTK) are insensitive to the application of GABA, pentobarbital, Zn²⁺, and picrotoxin (Fig. 5E), confirming that 3^(DNTK) does not assemble into functional homomeric receptors. However, A293 cells expressing 2^(GKER) exhibited a weak response to 1 mM pentobarbital (Fig. 5F), indicating that the four substitutions enable the 2 subunit to form functional homo-oligomeric receptors. In contrast, cells expressing 2^(GKER) do not clearly display outward currents in response to Zn²⁺ or picrotoxin, suggesting that these subunits do not appear to form spontaneously open Cl channels.

Therefore, the data derived from the immunofluoresence, FACS, and electrophysiological studies clearly identify four N-terminal amino acid residues, GKER, within ^(FLAG)3 that are necessary for homomeric cell surface expression and are also sufficient to confer homomeric cell surface expression on the ^(FLAG)2 subunit after mutation. Given that similar surface levels of 2^(GKER) and 3 are seen (Fig. 4), the differences in the physiological properties of these homomeric receptors are of interest. These observations suggest that although the residues G¹⁷¹, K¹⁷³, E¹⁷⁹, and R¹⁸⁰ are sufficient to mediate cell surface expression, other distinct residues are responsible for the unique pharmacological and physiological properties of 3 homomers.

Sucrose density gradient fractionation of receptor  subunits

The ER retention of ^(FLAG)2 and the cell surface expression of ^(FLAG)3 may reflect differences between the abilities of these two proteins to homo-oligomerize, because oligomerization is a prerequisite for ER exit (Hammond and Helenius, 1995). To analyze the oligomerization of receptor  subunits, detergent-solubilized cell extracts were fractionated on 5-20% linear sucrose density gradients. For these studies, expression in COS cells was used because they gave higher expression levels than A293 cells, facilitating biochemical analysis. Gradient fractions were subjected to Western blotting or immunoprecipitation with 9E10 antibody. The behavior of the 3^(DNTK), 2^(GKER), 2, and 3 subunits was identical in both COS and A293 cells (Fig. 1-3) with regard to cell surface expression (data not shown).

The ^(FLAG)3 subunit exhibited a sedimentation coefficient of 9S as determined by reference to standards (Fig. 6A,B). The sedimentation coefficient of ^(FLAG)3 is distinct from ^(FLAG)2, which exhibits a 5S coefficient (Fig. 6A-C) (Gorrie et al., 1997). In contrast, 2 exhibits a coefficient of 9S when coexpressed with the 1 or the 1 and 2 subunits to form functional cell surface receptors (Gorrie et al., 1997; Tretter et al., 1997). The distinct sedimentation coefficients of ^(FLAG)2 and ^(FLAG)3, combined with differential ER retention, suggested that these subunits differ in their abilities to homo-oligomerize. This issue was explored further by determining the sedimentation coefficients of ^(FLAG)2^(GKER) and ^(FLAG)3^(DNTK), which differ in their ability to access the cell surface (Figs. 3, 4). ^(FLAG)3^(DTNK), which is ER-retained, exhibited a sedimentation coefficient of approximately 5S (Fig. 6A,B) like ^(FLAG)2 (Fig. 6A,C) (Gorrie et al., 1997). In contrast, ^(FLAG)2^(GKER), which like ^(FLAG)3 can access the cell surface, had a sedimentation coefficient of 9S (Fig. 6A,C). Given that the ^(FLAG)2, ^(FLAG)2^(GKER), ^(FLAG)3, and ^(FLAG)3^(DNTK) proteins are all expressed to similar overall levels (Fig. 4C), these observations strongly suggest that the amino acids GKER in ^(FLAG)3 mediate cell surface expression by facilitating subunit homo-oligomerization.

View larger version (20K): [in this window] [in a new window]   Figure 6.   Differential sedimentation of (FLAG) subunits on sucrose density gradients. COS cells transfected with (FLAG)3, (FLAG)3(DNTK), or (FLAG)2(GKER) were subjected to sucrose density gradient fractionation 16 hr after transfection. Gradient fractions were separated by SDS-PAGE; the (FLAG) subunits were detected by Western blotting using anti-FLAG M2 monoclonal antibody (A), and the signals were quantified using a Bio-Rad phoshorimager (B, , (FLAG)3, , (FLAG)3(DNTK); C, , (FLAG)2, , (FLAG)2(GKER)). The data for (FLAG)2 are taken from Gorrie et al. (1997) and represent immunoprecipitation of this protein from expressing cells after metabolic labeling with [35S]methionine. The level of 2 in each fraction was quantified using a Bio-Rad phosphorimager. Sedimentation coefficients of receptor subunits were determined by reference to the standards BSA (4.3S), aldolase (7.4S), and catalase (11.2S).

The amino acids responsible for mediating 3 subunit homo-oligomerization mediate cell surface expression with the 2 subunit but not the 1 subunit

To determine whether the amino acids that control 3 subunit homo-oligomerization influence hetero-oligomerization, various ^(FLAG)2 and ^(FLAG)3 constructs were coexpressed with ^(9E10)2L or ^(9E10)1 subunits. Both ^(9E10)1 and ^(9E10)2L are ER-retained on homomeric expression (Connolly et al., 1996a,b), so expression was monitored by detecting the 9E10 reporter epitope at the cell surface. Coexpression of ^(9E10)1 with either the ^(FLAG)2^(GKER) or ^(FLAG)3^(DNTK) constructs resulted in robust expression of both reporter epitopes on the cell surface (Fig. 7). Likewise, both 2^(GKER) and 3^(DNTK) were able to assemble with the 1 and 2 subunits to produce functional 12 receptors (data not shown). Because both the 2 and 3 subunits can produce functional receptors on coexpression with 1 and 2 subunits, this result is not unexpected (Macdonald and Olsen, 1994; Rabow et al., 1995). However, coassembly with the 1 subunit indicates that the four mutations do not disturb the folding of  subunit polypeptides.

View larger version (59K): [in this window] [in a new window]   Figure 7.   Surface expression of heteromeric (FLAG)(9E10)1 receptors in A293 cells. Expression was determined by immunofluorescence on nonpermeabilized cells 15-18 hr after transfection using anti-FLAG M2 mouse monoclonal antibody to detect (FLAG) subunits (left panel) and 9E10 antibody to detect (9E10)1 (right panel) followed by Alexa 488-conjugated secondary antibodies. Images were collected by confocal microscopy. A, (FLAG)3(DNTK)(9E10)1; B, (FLAG)2(GKER) (9E10)1. Scale bar, 10 µm.

Coexpression of ^(FLAG)2 with ^(9E10)2L resulted in ER retention of both subunits, in agreement with earlier observations (Connolly et al., 1996a,b) (Fig. 8A). However, coexpression of ^(FLAG)3 and ^(9E10)2L resulted in robust cell surface expression of ^(9E10)2L (Fig. 8B). These results suggest clear differences in the ability of ^(FLAG)2 and ^(FLAG)3 to assemble with ^(9E10)2L. To determine whether the amino acids that mediate homomeric expression of 3 influence heteromeric expression, selected  subunit mutants were coexpressed with ^(9E10)2L. In contrast to the lack of surface expression of wild-type ^(FLAG)2 with ^(9E10)2L, coexpression of ^(FLAG)2^(GKER) with ^(9E10)2L produced robust cell surface expression of both subunits (Fig. 8C). When ^(9E10)2L was expressed with ^(FLAG)3^(DNTK), cell surface expression of both subunits was also observed, although at reduced levels compared with cells coexpressing ^(FLAG)3 and ^(9E10)2L (Fig. 8D). Identical assembly behavior was seen with both the 2L and 2S splice variants. These observations indicate that the amino acid residues that mediate 3 subunit homo-oligomerization and cell surface expression also mediate hetero-oligomeric interactions between 3 and 2 subunits.

View larger version (43K): [in this window] [in a new window]   Figure 8.   Surface expression of heteromeric (FLAG)(9E10)2L receptors in A293 cells. Expression was determined by immunofluorescence on nonpermeabilized cells 15-18 hr after transfection using anti-FLAG M2 mouse monoclonal antibody to detect (FLAG) subunits (left panel) and 9E10 antibody to detect (9E10)2L (right panel) followed by Alexa 488-conjugated secondary antibodies. Images were collected by confocal microscopy. Transfection and staining were performed simultaneously for each subunit combination, and the pictures were all taken using the same confocal microscope settings. A, (FLAG)2 + (9E10)2L; B, (FLAG)3 + (9E10)2L; C, (FLAG)2(GKER) + (9E10)2L; D, (FLAG)3(DNTK) + (9E10)2L. Scale bar, 10 µm.

Cell surface 2 receptors also form functional ion channels

To investigate the abilities of the  subunits to form hetero-oligomeric receptors when coexpressed with the 2S subunit, whole-cell currents generated in response to the application of various ligands in transfected A293 cells were recorded. Cells coexpressing 2 and 2S subunits were insensitive to GABA, pentobarbital, Zn²⁺, and picrotoxin (Fig. 9A), as described previously (Connolly et al., 1996a). In contrast, cells coexpressing 3 and 2S exhibited both GABA- and pentobarbital-gated membrane currents (Fig. 9B). The pharmacology of these channels was distinct from that of 3 homomers, which are insensitive to GABA (Connolly et al., 1996a; Wooltorton et al., 1997). Application of the GABA_A receptor inhibitors Zn²⁺ (10 µM) and picrotoxin (10 µM) to cells expressing 3 and 2S resulted in the generation of outward currents (Fig. 9B), indicating that 32S channels show a degree of spontaneous activity or that the cells express a mixed population of 3 homomers and 32S receptors.

View larger version (16K): [in this window] [in a new window]   Figure 9.   Functional analysis of 2S hetero-oligomers. Whole-cell currents were recorded in response to 1 mM GABA, 1 mM pentobarbital (PB), 10 µM Zn2+, or 10 µM picrotoxin (PTX) from A293 cells expressing A, 22S; B, 32S; C, 2(GKER)2S; and D, 3(DNTK)2S. Cells were voltage-clamped at 40 mV holding potential, and each trace is representative of four to five determinations.

Cells coexpressing 2S with 2^(GKER) exhibit currents similar to those generated by cells expressing 32S receptors. Application of GABA or pentobarbital generated inward currents; in contrast, both Zn²⁺ and picrotoxin blocked spontaneously open channels resulting in the generation of outward currents (Fig. 9C). Interestingly, cells coexpressing the 3^(DNTK) mutant with 2S also displayed inward currents in response to GABA or pentobarbital, but these currents were much smaller than those observed for 32S or 2^(GKER)2S receptors (Fig. 9D). This was a consistent feature that was independent of the transfection efficiency. Small outward currents were induced in response to the application of 10 µM Zn²⁺ or picrotoxin, indicating that some of the 3^(DNTK)2S receptors gate spontaneously (Fig. 9D). It is unlikely that mixed populations of 3^(DNTK) homomers and 32S receptors are expressed, because the former fail to form functional cell surface receptors. These electrophysiological observations correlate well with the immunofluorescence data, which suggested that 3^(DNTK) formed cell surface receptors when coexpressed with 2, but with a reduced efficiency compared with wild-type 3 subunits. Identical behavior was seen in these experiments with either splice variant of the 2 subunit (data not shown).

Quantitation of 2 cell surface expression

To confirm that the reduction in whole-cell currents produced on expression of 3^(DNTK) and 2 subunits compared with 3 and 2 subunits was caused by a reduction in cell surface expression, coexpressing cells were subjected to flow cytometry to quantify heteromeric 2 receptor cell surface expression. This was achieved by monitoring the level of surface ^(9E10)2L using 9E10 antibody. In cells coexpressing 2 and ^(9E10)2L, the level of cell surface expression was low and similar to that observed for untransfected cells (Fig. 10). For cells coexpressing 3 and ^(9E10)2L, ^(9E10)2L could be detected on the surface of ~15% of cells, and this was used to normalize the cell surface expression of constructs in each experiment (Fig. 10). In ^(9E10)2L3^(DNTK)-transfected cells, ^(9E10)2L surface fluorescence was significantly decreased (p < 0.05) (Fig. 10) compared with ^(9E10)2L3-expressing cells (Fig. 10) but was significantly greater than for both ^(9E10)2L2 and mock-transfected cells (p < 0.05) (Fig. 10).

View larger version (12K): [in this window] [in a new window]   Figure 10.   Relative levels of (9E10)2L subunit cell surface expression when expressed with different  subunits. Cell surface 2L subunits were labeled by immunofluorescence on nonpermeabilized cells using 9E10 antibody and an Alexa-488 conjugated anti-mouse secondary antibody. The number of cells expressing the 9E10 epitope on the cell surface was measured by FACS analysis and expressed as a percentage of the number of (9E10)2L3 transfected cells expressing the 9E10 epitope on the cell surface (n = 3 for each subunit combination).

Interaction of the 2S subunit with  subunits

To determine whether changes in subunit oligomerization are responsible for the reduced cell surface expression of 3^(DNTK)/2S constructs compared with 3/2S or 2^(GKER)/2S, subunit oligomerization was analyzed by immunoprecipitation. For these experiments, a ^(9E10)2S construct was expressed with each of the  subunit constructs used in this study (Fig. 11). The migration of homomeric 2, 3, and 2S subunits is also shown for clarity in Figure 11. The 2 and 3 subunits migrated as bands of 50-54 and 57-59 kDa, respectively, whereas ^(9E10)2S migrated as a diffuse band of between 45 and 49 kDa. Association between the 2 and  subunits was examined by immunoprecipitation using 9E10 antibody. Coimmunoprecipitation of 3 (57 and 59 kDa) and 3^(DNTK) (57 and 59 kDa) with ^(9E10)2S was clearly observed because these proteins have distinct migrations on SDS-PAGE (Fig. 11). Because the close migration of 2 and 2S, coimmunoprecipitation was more difficult to detect; however, the higher molecular mass species of 2 and 2^(GKER) (54 kDa) (Fig. 11) coprecipitated with ^(9E10)2S. These results suggested that the reduced efficiency of surface expression of 3^(DNTK)2S and the failure of 22S to access the cell surface is not attributable to an inability to oligomerize, in agreement with earlier observations (Connolly et al., 1996a). Instead, the efficiency of assembly is likely to be affected at a later stage, possibly with the 22 and 3^(DNTK)2 combinations forming dimeric or trimeric complexes, which are processed inefficiently into functional receptors. Alternatively, these residues may affect the transport or targeting of assembled / oligomers to the cell surface.

View larger version (54K): [in this window] [in a new window]   Figure 11.   Coimmunoprecipitation of  subunits with the (9E10)2S subunit. COS cells or cells expressing 3 (lane 1), 2 (lane 2), (9E10)2S (lane 3), flag-tagged (FLAG)2 + (9E10)2S (lane 4), (FLAG)3 + (9E10)2S (lane 5), (FLAG)2(GKER) + (9E10)2S (lane 6), (FLAG)3(DNTK) + (9E10)2S (lane 7), or control cells were [35S]methionine-labeled and immunoprecipitated using 9E10 antibody coupled to protein A-Sepharose. Immune complexes were separated by SDS-PAGE using 8% gels. The migration of 3, 2, and 2S is indicated as is the migration of molecular mass standards.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

To identify amino acid residues that control GABA_A receptor assembly, we have used a chimeric approach to analyze the selective cell surface expression of the 3 subunit compared with the 2 subunit. This resulted in the identification of four amino acidsG171, K173, E179, and R180within the N-terminal domain of 3 that are capable of conferring homomeric cell surface expression on 2. The sedimentation of  subunit constructs was compared by sucrose density gradient centrifugation. 2 migrated as a 5S complex; in contrast, 3 migrated as a 9S complex. Interconversion of the sedimentation coefficients of 2 and 3 could be achieved by replacing the amino acids GKER in 3 with DNTK from 2 and vice versa. Together, these observations suggest that these amino acids identified in our study mediate 3 subunit oligomerization. However, whether residues G171, K173, E179, and R180 all contribute equally to this process remains to be established.

The functional properties of the different  homomers were also examined. In agreement with earlier observations, 2 was unable to form functional channels. However, 3 produced pentobarbital-activated, Zn⁺²-sensitive responses (Connolly et al., 1996b). In agreement with its failure to homo-oligomerize and its resultant ER retention, expression of 3^(DNTK) did not produce functional receptors. In contrast, pentobarbital-activated responses could be recorded from 2^(GKER)-expressing cells. These pentobarbital-evoked responses were much smaller than those recorded from 3-expressing cells and unlike 3 homomers were not spontaneously gated (Wooltorton et al., 1997). Given that surface levels of 2^(GKER) were similar to those of 3, these observations suggest that the residues GKER are sufficient to mediate 3 subunit homo-oligomerization, but other distinct N-terminal amino acid residues within this subunit are important for channel gating.

The contribution of the amino acids within 3 controlling homo-oligomerization in mediating heteromeric receptor assembly was analyzed. Coexpression of  and  subunits in heterologous systems results in the production of GABA-gated channels (Macdonald and Olsen, 1994; Rabow et al., 1995). That the substitution of residues GKER and DNTK between 2 and 3 does not affect assembly with 1 is not unexpected but is of significance. This result suggests that the amino acids identified in our study are likely to constitute an assembly signal that mediates subunit oligomerization rather than having effects on gross subunit folding.

The production of functional receptors composed of  and  subunits is less consistent. The formation of both